Influence of dietary replacement of fish meal with fish soluble meal on growth and TOR signaling pathway in juvenile black sea bream (Acanthopagrus schlegelii)

Fish and Shellfish Immunology 101 (2020) 269–276

Contents lists available at ScienceDirect

Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Influence of dietary replacement of fish meal with fish soluble meal on growth and TOR signaling pathway in juvenile black sea bream (Acanthopagrus schlegelii)

T

Misbah Irm, Sehrish Taj, Min Jin∗, Hardy Joël Timothée Andriamialinirina, Xin Cheng, Qicun Zhou∗ Laboratory of Fish and Shellfish Nutrition, School of Marine Sciences, Ningbo University, Ningbo, 315211, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Black sea bream Fish soluble meal Growth performance Insulin like growth factor 1 TOR signaling Pathway

An 8-week feeding trial was conducted to evaluate the effect of replacement of fish meal (FM) with fish soluble meal (FSM) on growth performance, feed utilization and expression of genes involved in TOR signaling pathway for juvenile black sea bream (Acanthopagrus schlegelii). Six isonitrogenous (41%) and isolipidic diets were prepared to contain graded levels of FSM which replaced 0% (control diet), 10%, 20%, 30%, 40% and 60% protein from FM. Triplicate groups of 20 fish with initial weight 0.51 ± 0.01 g were fed with experimental diets twice daily to apparent satiation. The results showed significant differences in growth performance and feed utilization among all treatments, final body weight (FBW), percent weight gain (PWG), specific growth rate (SGR) and protein efficiency ratio (PER) significantly increased with dietary replacement levels of FM with FSM increasing from 0% to 40% (P < 0.05), PWG, SGR and PER were significantly reduced when replacement of FM with FSM further increased from 40% to 60%. Based on PWG against replacement levels of FM with FSM, A two-slope broken-line model analysis indicated that the optimal replacement of FM with FSM is to be 42.59%. Moreover, the lowest feed conversion ratio (FCR) was observed in fish fed the 40% FSM replacement diet. Muscle amino acid profile in muscle revealed that total essential amino acids, arginine and threonine were significantly influenced by replacement levels of FSM, while there was no significant difference in NEAA among all treatments. The hematological indices were not affected by the replacement levels of FM with FSM. The relative expression levels of irs-1, pi3k, akt, igf-1, s6k1 and tor were up-regulated when replacement levels of FM with FSM increased from 0% to 40%, and higher values were observed in fish fed with 40% FSM replacement diet compared to those fed the other diets. However, relative expression of 4e-bp2 was down-regulated when replacement levels of FM with FSM increased from 0% to 40% (P < 0.05). In summary, the results of present study indicated that FSM could be a viable alternative protein source for black sea bream, dietary FSM supplementation could improve growth and up-regulate the relative expression of irs-1, pi3k, akt, igf-1, s6k1 genes related to TOR signaling pathway in liver of juvenile black sea bream.

1. Introduction Black sea bream A. schlegelii is a very popular and commercially important marine fish species cultured in China, Japan, Korea and other countries in Southeast Asia, and it has been regarded as an excellent aquaculture species for intensive culture [1]. Black sea bream is a commercially important species due to excellent meat quality, fast growth, high market value, adaptive ability to different cultural conditions and possess high disease resistance [2,3]. Traditionally, trash

fish has been used as a feed in culturing of black sea bream, however, trash fish feed does not meet the nutritional requirements of the fish for optimum growth, because trash fish differs widely in nutritional quality, difficult to preserve and cause water pollution [4,5]. Therefore, there is need to find high quality alternative protein sources for commercial diet. Fish meal (FM) is high-quality protein source in aquafeed, having exceptional amino acids profile and also rich in vitamins, mineral contents, fatty acids and various growth factors [6,7]. High dependency

Abbreviations: irs-1, insulin receptor substrate 1; pi3k, phosphoinositide 3-kinase; akt, protein kinase B; igf-1, insulin-like growth factor 1; s6k1, ribosomal protein S6 kinase 1; tor, target of rapamycin; 4e-bp2, 4 eukaryotic binding protein 2 ∗ Corresponding authors. E-mail addresses: [email protected] (M. Jin), [email protected] (Q. Zhou). https://doi.org/10.1016/j.fsi.2020.03.053 Received 2 February 2020; Received in revised form 14 March 2020; Accepted 25 March 2020 Available online 31 March 2020 1050-4648/ © 2020 Elsevier Ltd. All rights reserved.

Fish and Shellfish Immunology 101 (2020) 269–276

M. Irm, et al.

and increasing prices of FM forced the aquaculture sector to find the alternative protein sources in aquafeed formulations. To overcome FM shortage, marine protein is considered as a potentially alternative source [8]. Fish soluble meal is a product type of fish protein hydrolysate (FPH), it refers to the product obtained by enzymatic hydrolysis of raw fish. Fish soluble meal (FSM) has been demonstrated in a number of fish species, it is also considered as an alternative protein source to FM due to its appropriate amino acid profile [9]. The development of FPH as a functional food is a comparatively new technology gaining attraction due to the array of potential bioactive properties including antioxidant and antihypertensive properties. The fish processing industry produces only 40% fish products for human consumption and 60% by products as fish discards consisting of head, skin, viscera, fins, trimmings and frames [10]. These large quantities of fish discard cause environmental and disposal problems. Fish by-product wastes have good amount of protein rich material that are usually processed into low market-value products, such as fish meal, animal feed, and fertilizer [11]. Exogenous enzymatic hydrolysis is an efficient way to revive high amount of proteins and peptides from fish by‐products [12]. FSM inclusion in fish diet not only improves the digestibility and bioavailability of the protein but also improves fish health [13,14]. FSM has been used as a high nutritional feed ingredient in a variety of marine aqua-cultured species including finfish [15], abalone [16] and shrimp [17]. The replacement of FM with FSM in aquafeed improved the growth performance of fish including red sea bream (Pagrus major) [13], large yellow croaker (Larimichthys crocea) [18], olive flounder (Paralichthys olivaceus) [19] and rainbow trout (Oncorhy nchusmykiss) [20]. Synthesis of protein is one of the vital phenomenon involved in growth response [21]. Target of rapamycin (TOR) signaling pathway plays an important role in regulating protein synthesis in fish and mammals through eukaryotic translation initiation factor 4E (eIF4E) binding protein (4EBP) and ribosomal S6 kinase (S6K) [22–24]. TOR control signals are from nutrients such as growth factors (insulin, IGF etc.), amino acids and energy status [25]. TOR also regulates cell growth and development through growth hormone-insulin-like growth factors axis (GH-IGFs) by optimizing amino acids availability [26,27]. Growth and development of all living organisms depends upon genetic components and interaction with environment [28]. Nutrigenomic approach helps to comprehend diet effect on gene expression [29]. As gut and liver play an essential role in nutrient absorption and metabolism, so it is important to understand whether substitution level of fishmeal is linked with changes in transcription of genes known to participate in protein absorption and metabolism. Therefore, the interaction between nutrition and gene function is required to determine biochemical response, physiological and molecular mechanisms concerned with changes in feed formulation [30]. To date, there is no information regarding the effect of FSM on growth performance, feed utilization and protein metabolism related genes involved in TOR signaling pathway in black sea bream. Therefore, the objective of present study was to evaluate the effect of dietary replacement of FM with FSM on growth performance, feed utilization and expression of genes related to TOR signaling pathway of black sea bream (Acanthopagrus schlegelii).

replacement levels were following as 0, 10%, 20%, 30%, 40% and 60%, respectively. All the ingredients were ground into fine powder, and then mixed in a Hobart type mixer and cold-extruded pellets were shaped using F-26 (Machine factory of South China University of Technology). Pellets strands were cut into uniform sizes of 2 mm and 4 mm diameter pellets by using G- 250 (Machine factory of South China University of Technology). Pellets were steamed for 30 min at 90 °C and then airdried to approximately 10% moisture, sealed in vacuum-packed bags and ere stored at −20 °C until use in the feeding.

2.2. Fish and experimental trail Juvenile black sea bream were obtained from a commercial hatchery farm at Xiangshan bay (Ningbo, China). The fish were fed with commercial diet to be acclimated to experimental conditions for two weeks. After the acclimation period, a total of 360 juvenile fish of same size were randomly distributed into 300-L cylindrical fiberglass tanks filled with 250 L of seawater at the stocking rate of 20 fish per tank with three replicates in 18 tanks. Temperature, salinity, pH and dissolved oxygen were measured on daily basis. Temperature ranged from 26.8 to 32.6 °C, salinity 20–26% and dissolved oxygen was 6.4–7.02mgL−1 and pH was 7.9–8.1. During the feeding trail, fish were fed with experimental diets twice a daily (08:00 and 17:00) to apparent satiation. Fish growth performance was measured by weighing their weight after every two weeks and daily ration adjusted accordingly.

2.3. Samples collection At the end of feeding trial, fish in each tank were sampled 24 h after the last feeding. Fish from each tank were anesthetized with tricaine methane sulfonate (MS-222), counted and individually weighed to determine survival, percent weight gain (PWG), specific growth rate (SGR), feed conversion ratio (FCR) and protein efficiency ratio (PER). Five fish from each tank were randomly sampled and frozen at −20 °C to analyze whole body composition, whereas three fish were dissected, viscera and livers were removed and weighed to examine morphological parameters including hepatosomatic index (HSI), viscerosomatic index (VSI) and condition factor (CF). Muscle and liver samples were also collected, poured into 1.5 ml eppendorf tubes and immediately frozen in liquid nitrogen and stored at −80 °C for amino acids and gene expression analysis. Blood samples were collected from the caudal vasculature of fish using 2 ml syringes, and stored at 4 °C. Then the blood samples were centrifuged at 956×g for 10 min at 4 °C to separate the serum for biochemical indices analysis.

2.4. Proximate composition in diets and tissues Proximate composition in whole fish and diets were performed following the standard procedures [32]. Moisture content was determined by drying the samples to a constant weight at 105 °C. Crude protein (N × 6.25) was determined via the Dumas combustion methods with a protein analyzer (FP-528, Leco, USA). Crude lipid was determined by the ether extraction method using Soxtec System HT (Soxtec System HT6, Tecator, Sweden), and ash content was determined using a muffle furnace at 550 °C for 8 h.

2. Materials and methods 2.1. Experimental diet preparation FSM and the other feed ingredients were purchased from Ningbo Tech-Bank Corp., Ningbo, China. Experimental diet formulation and proximate composition of the feed ingredients are presented in Table 1and Table 2. Six experimental diets were formulated to be isonitrogenous and isolipidic. A basal fish meal-based diet was considered as the control diet, and other five diets were formulated to contain partial replacement of fish meal with fish soluble meal (FSM), the

2.5. Serum biochemical analysis The serum biochemical parameters, including total protein (TP), albumin (ALB), globulin (GLB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), cholesterol (CHO) and triglyceride (TG) were measured by an automatic biochemical analyzer (Selectra Pro-M 13–7476, USA). 270

Fish and Shellfish Immunology 101 (2020) 269–276

M. Irm, et al.

Table 1 Formulation and proximate composition of experimental diets (% dry matter). Replacement levels of fish meal with fish soluble meal (%)

Ingredients

Fish meal Fish soluble meala Soybean meal Wheat flour Fish oil Soybean oil Soy lecithin Vitamin premixb Mineral premixb Choline chloride Ca(H2PO4)2 Lysine Methionine Cellulose Proximate composition (%) Dry matter Crude protein Crude lipid Ash a b

0

10

20

30

40

60

40.00 0.00 15.00 26.04 2.24 2.24 2.00 0.50 2.00 0.50 2.00 0.00 0.00 7.48

36.00 5.20 15.00 26.04 2.24 2.24 2.00 0.50 2.00 0.50 2.00 0.02 0.02 6.24

32.00 10.40 15.00 26.04 2.24 2.24 2.00 0.50 2.00 0.50 2.00 0.04 0.05 4.99

28.00 15.60 15.00 26.04 2.24 2.24 2.00 0.50 2.00 0.50 2.00 0.06 0.07 3.75

24.00 20.80 15.00 26.04 2.24 2.24 2.00 0.50 2.00 0.50 2.00 0.08 0.10 2.50

16.00 31.20 15.00 26.04 2.24 2.24 2.00 0.50 2.00 0.50 2.00 0.13 0.15 0.00

88.23 41.07 11.08 13.43

87.97 41.02 11.13 13.72

88.34 40.83 11.05 13.45

88.44 41.11 11.07 12.53

88.79 40.94 11.19 12.33

87.93 40.79 11.48 12.26

Fish soluble meal was derived from Ningbo Tech-Bank Corp., Ningbo, China. Crude protein: 54.86%; lipid: 6.0%. Vitamin premix and mineral premix were based on previous study (Jin et al., 2017) [31].

any residue.20 μL of the solution was used for amino acid determination. The packed column was Hitachi ion-exchange resin 2622 (4.6 mm × 60 mm, particle size 5 μm) and ninhydrin coloring solution was the reactive reagent for the detection of amino acids. Fish muscle samples and diet were analyzed in triplicates. Results were shown as g/ 100 g dry matter.

Table 2 Essential and non-essential amino acid composition of experimental diets (g/ 100 g, based on dry matter). Parameters

EAAa Arginine Histidine Isolucine Leucine Lysine Methionine Threonine Valine Phenylalanine NEAAb Cystine Aspartate acid Serine Glycine Alanine Tyrosine Glutamic acid Proline a b

Replacement of fish meal with fish soluble meal (%) 0

10

20

30

40

60

2.67 0.76 1.61 2.61 2.63 0.69 1.22 1.53 1.43

2.69 0.83 1.59 2.60 2.56 0.70 1.20 1.50 1.45

2.71 0.85 1.64 2.63 2.61 0.72 1.24 1.55 1.48

2.73 0.87 1.67 2.66 2.58 0.71 1.27 1.56 1.50

2.76 0.70 1.70 2.71 2.65 0.72 1.3 1.54 1.53

2.74 0.71 1.63 2.78 2.64 0.72 1.25 1.52 1.51

2.47 2.89 1.61 2.07 2.23 0.83 4.55 2.52

2.31 3.03 1.56 2.11 2.13 0.85 4.61 2.36

2.11 3.11 1.60 2.13 2.21 0.88 4.72 2.26

2.25 3.14 1.62 2.30 2.03 0.90 4.75 2.32

2.18 3.17 1.63 2.41 2.10 0.89 4.78 2.16

2.15 3.06 1.62 2.23 2.18 0.90 4.71 2.14

2.7. Total RNA extraction, reverse transcription and real-time PCR RNA was extracted from the liver of black sea bream using Trizol Reagent (Takara, Japan). Nano DropND-1000 spectrophotometer (Nano-Drop Technologies, Wilmington, DE, USA) was used to assess the quantity and quality of total RNA. The 260/280 nm absorbance ratios of all selected samples were ranged from 1.86 to 2.00. Purified RNA was used to synthesize cDNA using PrimeScript™ RT Reagent Kit (Takara, Japan). Primer pairs were designed by using primer-5 based on nucleotide sequences of the genes irs-1, pi3k, akt, igf-1, tor, s6k1, 4e-bp2, while β-actin gene was used as a housekeeping gene (Table 3). Quantitative Real Time PCR (qRT-PCR) analysis was performed in a quantitative thermal cycler (Roche, Light cycler 96, Basel, Switzerland) by using SYBR Green Premix Ex Taq TMП (Takara, Japan). The cycling conditions qRT-PCR were used as follows: 95 °C for 2 min, followed by 40 cycles of 95 °C for 10s, 60 °C for 10s, and 72 °C for 20s. Temperature was increased was from 55 °C to 95 °C (0.5 °C per 10s) to conduct melting curve analysis. Agarose gel electrophoresis of the final product was conducted which confirmed the presence of single amplicons. Each qRT-PCR was performed at least in triplicate for each group. The data of expression analysis was analyzed by using 2−ΔΔCT method described by Livak and Schmittgen [34].

EAA: essential amino acids. NEAA: non-essential amino acids.

2.6. Amino acid analysis Amino acid profile of feed and muscles samples were analyzed by using automatic amino acid analyzer (L-8900, Hitachi HighTechnologies Co., Tokyo, Japan) according to a modified procedure described previously [33]. For amino acid analysis 30 mg dried samples of fish muscles and diet were weighed into a 15 ml glass tubes, 5 ml of 6 N HCl was added sealed with nitrogen atmosphere and hydrolyzed at 110 °C for 24h. Then samples were cooled and washed into a 50 ml volumetric flask using ultrapure water. 1 ml of this solution was transferred into a 4 ml ampoule bottle (CNW, Germany), solution was filtered and evaporated to remove any acid in a rotary evaporator (IKA RV10, Germany). Acid free samples further made up with 1 ml HCl and filtered through a 0.22 μm membrane using a hydrophilic polyether sulfone (PES) syringe filter (CNW, Germany) to remove impurities and

2.8. Calculations and statistical analysis The parameters were calculated as follows: Percent weight gain (PWG, %) = 100 × (Wt-Wi)/Wi Survival (%) = 100 × (final amount of fish)/ (initial amount of fish) Specific growth rate (SGR, % day−1) = 100 × (Ln Wt-Ln Wi)/ t Protein efficiency ratio (PER) = weight gain (g)/ protein intake (g) 271

Fish and Shellfish Immunology 101 (2020) 269–276

M. Irm, et al.

Table 3 The primer pairs sequences used for real time quantitative PCR. Gene names

Primers

a

F:GGGTTGTCCAAGCAGGGTAA F: GAACCTCCGGGTCCTTCACA F: TGCATCGCTTTGTTGGCATC F:GTGGCAGAAAGAGCCAAGAG F: GAACCTCCGGGTCCTTCACA F: AATCCCAGGAAGGCTTGATT F: AGCCAACAACCACATCAACA F:CAGGACTCCATACCGAGGAA

irs-1 pi3kb aktc igf-1d tore s6k1f 4e-bp2g β-actin a b c d e f g

R:GCTTGAGCCATGAGGCAATG R: GTGACCTCCGACTCTTCCAA R: GAGAAGTAGAGGACGGGTG R:CCAAGCAACGACTGACTGAA R: GAACCTCCGGGTCCTTCACA R:GAAGAGAAACGCCTCGTCAC R: GAGGGCTCACAACATTGGTT R:TGCGTGACATCAAGGAGAAG

irs-1: Insulin receptor substrate-1. pi3k: Phosphatidylinositol 3-kinase. akt: Protein kinase B. igf-1: Insulin growth factor-1. tor: Target of rapamycin. s6k1: Ribosomal protein 6 kinase. 4e-bp2: Eukaryotic initiation factor 4 binding protein 2.

Condition factor (CF, g cm cm)3

−3

supplemented with different dosage forms of FSM presented in Table 4. Survival ranged from 93.33 to 96.67%, and there was no significant difference among all dietary treatments (P > 0.05). Percent weight gain (PWG), specific growth rate (SGR) and protein efficiency ratio (PER) were significantly influenced by replacement levels of FM with FSM (P < 0.05). PWG, SGR and PER significantly increased with replacement level of FM with FSM increasing up to 40%. The lower FCR was recorded in fish fed with dietary 40% FSM replacement level. A two slope broken-line regression analysis of PWG against dietary FSM replacement levels indicated that the optimal replacement level of FM with FSM was to be 42.59% for juvenile black sea bream (Fig. 1). Morphological indices (HSI, VSI and CF) did not show any statistical difference among dietary groups.

) = 100 × (bodyweight, g)/(body length,

Hepatosomatic index (HSI, %) = 100 × (liver weight /whole body weight) Viscerosomatic index (VSI, %) = 100 × (viscera weight, g)/ (body weight g) Feed conversion ratio (FCR) = feed intake (g, dry weight)/weight gain (g, wet weight) Where Wt is the final body weight (g), Wi is the initial body weight (g), t is the experimental duration in days. The results are presented as the means ± S.E.M (n = 3). One-way analysis of variance (ANOVA) was used to test the main effects of dietary manipulation. When there were significant differences (P < 0.05), the group means were further compared using Tukey's multiple range tests. A two-slope broken-line regression analysis was conducted to analyze PWG in response to dietary fish meal replacement with FSM of juvenile black sea bream (Fig. 1). All statistical analyses were performed using SPSS 23.0 (SPSS, IBM, USA).

3.2. Proximate composition in whole body and amino acid composition in muscle Moisture, crude protein, crude lipid and ash contents in whole body were not significantly influenced by dietary replacement levels of FM with FSM (P > 0.05) (Table 5). The effects of dietary replacement of FM with FSM on amino acids profile of muscle are presented in Table 6. The highest total EAA, arginine, and threonine contents in muscle were observed in fish fed the 40% replacement level of FM with FSM diet (P < 0.05). However, the other EAAs and non-essential amino acids did not show variations among all treatments.

3. Results 3.1. Growth performance and feed utilization

3.3. Serum biochemical parameters

The results of the growth performance, feed utilization and morphological indices of the juvenile black sea bream fed diets

There were no significant differences in serum biochemical parameters (ALT, AST, GLU, ALP, TP, ALB, TG and CHO) among dietary groups (Table 7). 3.4. Expression of genes involved in TOR pathway genes in liver The sequence of the primers used for q-PCR in the study was presented in Table 3. It gave the forward and reverse primers for TOR genes. The relative mRNA expression levels of TOR pathway genes in liver of juvenile black sea bream fed the experimental diets are presented in Fig. 2, Fig. 3 and Fig. 4. The relative gene expressions of irs-1, pi3k, akt, igf-1, tor, s6k1, and 4e-bp2 were significantly affected by the replacement levels of FM with FSM (P < 0.05). Fish fed the 40% replacement level of FM with FSM diet had higher relative expressions of irs-1, pi3k and akt than those fed the other diets, and the lowest relative expressions of irs-1, pi3k and akt were observed in fish fed the control diet (Fig. 2). Relative expression of igf-1 significantly increased with dietary

Fig. 1. The relationship between percent weight gain (PWG) and dietary FSM replacement levels in juvenile black seabream for 8 weeks. 272

Fish and Shellfish Immunology 101 (2020) 269–276

M. Irm, et al.

Table 4 Growth performance and feed utilization of Acanthopagrus schlegelii fed with experimental diets for 8 weeks. Parameters

1

IBW (g) FBW2 (g) WG3 (g) PWG4 (%) SGR5 (% day−1) PER6 FCR7 Survival (%) HSI8(%) VSI9(%) CF10 (g cm−3)

Replacement of fish meal with fish soluble meal (%)

P-values

0

10

20

30

40

60

0.50 ± 0.02 4.28 ± 0.34a 3.77 ± 0.33a 748.9 ± 46.8a 3.82 ± 0.10a 1.83 ± 0.16a 1.47 ± 0.17c 96.67 ± 2.89 1.14 ± 0.09 7.61 ± 0.71 3.19 ± 0.16

0.51 ± 0.02 4.37 ± 0.44a 3.87 ± 0.44a 766.9 ± 92.9a 3.85 ± 0.20a 1.51 ± 0.19ab 1.37 ± 0.07bc 96.67 ± 2.89 1.55 ± 0.043 7.61 ± 0.91 3.55 ± 0.09

0.51 ± 0.01 4.80 ± 0.51ab 4.29 ± 0.51ab 837.6 ± 91.5ab 3.99 ± 0.17ab 1.67 ± 0.10bc 1.25 ± 0.14ab 95.33 ± 5.00 1.69 ± 0.041 7.97 ± 1.11 3.49 ± 0.45

0.52 ± 0.01 5.33 ± 0.31b 4.81 ± 0.31b 934.1 ± 55.5b 4.17 ± 0.10b 1.72 ± 0.18bc 1.24 ± 0.11ab 95.67 ± 8.66 1.62. ± 0.30 8.33 ± 0.89 3.35 ± 0.14

0.50 ± 0.01 6.14 ± 0.60c 5.64 ± 0.60c 1120.6 ± .127.84c 4.46 ± 0.19c 1.93 ± 0.19c 1.09 ± 0.09a 96.67 ± 2.89 1.46. ± 0.43 7.24 ± 0.31 3.32 ± 0.16

0.51 ± 0.02 4.88 ± 0.28ab 4.37 ± 0.28ab 863.6 ± 70.5ab 4.04 ± 0.13ab 1.60 ± 0.04ab 1.31 ± 0.02b 93.33 ± 5.77 1.17 ± 0.45 7.74 ± 0.94 3.03 ± 0.31

Values in each row with different superscript letters are significantly different (P ˂ 0.05). 1 IBW: initial body weight; 2 FBW: final body weight; 3 WG: weight gain; 4 PWG: percent weight gain; 5 SGR: specific growth rate; ratio; 7 FCR: feed conversion ratio; 8 HSI: hepatosomatic index; 9 VSI: viscerosomatic index; 10 CF: condition factor.

replacement levels of FM with FSM increasing from 0% to 40%, and then decreased when dietary replacement levels of FM with FSM increased from 40% to 60% (Fig. 3). The highest expression of tor and s6k1 were occurred at fish fed the 40% replacement level of FM with FSM, fish fed the control diet had lower expression of tor and s6k1than those fed the other diets (Fig. 4). In contrast, the relative expression of 4e-bp2 significantly decreased with dietary replacement levels of FM with FSM increasing from 0% to 40%, and the highest expression of 4ebp2 was observed in fish fed the 60% replacement level of FM with FSM (Fig. 4).

6

0.002 0.002 0.002 0.002 0.014 0.021 0.952 0.080 0.570 0.205

PER: protein efficiency

Table 6 Amino acid composition in muscle of Acanth pagrus schlegelii fed the experimental diets. Parameters

Replacement of fish meal with fish soluble meal (%) 0

10

20

30

40

60

P-Value

3.92a 1.51 3.07 5.52 6.01 1.83 2.82a 2.30 2.90 29.88b

4.02ab 1.52 3.08 5.45 6.11 1.69 3.05ab 2.41 2.91 30.24b

4.10b 1.50 3.03 5.56 6.03 1.83 3.19ab 2.44 2.92 30.89b

4.30bc 1.51 3.07 5.58 6.13 1.87 3.33bc 2.52 2.93 31.71bc

4.71c 1.53 3.09 5.45 6.16 1.84 3.74c 2.48 2.92 32.47b

4.12b 1.50 3.10 5.53 6.05 1.741 3.39bc 2.43 2.91 26.67a

0.000 0.998 0.781 1.00 0.978 0.983 0.002 0.180 0.740 0.019

0.39 6.55 2.51 3.34 3.81 2.10 9.02 2.24 29.96

0.44 6.56 2.65 3.35 4.11 2.18 9.16 2.23 30.68

0.52 6.58 2.53 3.34 4.09 2.16 9.17 2.25 30.64

0.64 6.61 2.66 3.35 4.20 2.15 9.16 2.22 30.99

0.43 6.63 2.67 3.27 4.18 2.11 9.26 2.27 30.82

0.51 6.60 2.63 3.32 4.09 2.12 9.13 2.28 30.68

0.428 0.993 0.888 0.990 0.352 0.295 0.781 0.260 0.344

a

EAA Arginine Histidine Isoleucine Leucine Lysine Methionine Threonine Valine Phenylalanine ΣEAA NEAAb Cystine Aspartic acid Serine Glycine Alanine Tyrosine Glutamic acid Proline ΣNEAA

4. Discussion In the present study, the results indicated that FSM is a good marine animal protein source, and it is an effective substitute for fish meal. In recent years, some studies have focused on the substitute of FM with FSM or fish protein hydrolysate (FPH) in some aquatic animals. Dietary fish protein hydrolysate supplementation could improve growth performance for juvenile turbot (Scophthalmus maximus L.) [35]. In large yellow croaker (Larimichthys crocea) larvae, 40% replacement of FM with FPH exhibited better growth performance than fish meal [18]. Whereas, 20% inclusion of FPH improved growth performance as compared to control dietary group in silver catfish (Clarias gariepinus) [36]. In the present study, FBW and PWG significantly increased with replacement levels of FM with FSM increasing from 0% to 40%, and then decreased with further increase in replacement level. Two slope broken-line regression analysis of PWG against dietary FSM replacement levels have demonstrated that the optimal replacement level was 42.59% for juvenile black sea bream. These results are in agreement with the study performed on Persian sturgeon larvae (Acipenser persicus L.) in which inclusion of 10% and 25% FPH resulted higher FBW and PWG than control group [37]. Moreover, similar results were observed in red sea bream (Pagrus major) and olive flounder (Paralichthy solivaceus) when diet supplemented with krill hydrolysate and tuna hydrolysate, respectively [38]. However, excessive substitution of FM with

Values in each row with different superscript letters are significantly different (P ˂0.05). a EAA: essential amino acids. b NEAA: non-essential amino acids.

FSM led to growth depression in some fish species, such as large yellow croaker [39] and cobia (Rachycentron canadum) [40]. The major reason may be due to faster absorption of AAs and small peptides through the gut wall, which finally caused the imbalance of AA absorption with high level of FPH inclusion [41].

Table 5 The whole body composition of Acanthopagrus schlegelii fed with experimental diets for 8 weeks. Parameters

Moisture (%) Lipid (%) Protein (%) Ash (%)

Replacement of fish meal with fish soluble meal (%)

P-values

0

10

20

30

40

60

72.49 ± 1.48 6.33 ± 0.56 16.12 ± 0.48 5.15 ± 0.34

72.65 ± 0.47 6.42 ± 0.12 16.31 ± 0.32 5.05 ± 0.11

72.55 ± 0.58 6.06 ± 0.46 16.20 ± 0.50 5.00 ± 0.13

72.35 ± 0.38 6.26 ± 0.41 16.04 ± 0.34 5.18 ± 0.31

72.65 ± 1.21 5.96 ± 0.10 16.07 ± 0.44 5.25 ± 0.01

72.57 ± 0.71 6.12 ± 0.45 16.10 ± 0.33 4.96 ± 0.21

Values in each row with different superscript letters are significantly different (P ˂ 0.05). 273

0.999 0.877 0.616 0.842

Fish and Shellfish Immunology 101 (2020) 269–276

M. Irm, et al.

Table 7 Serum biochemical parameters of Acanthopagrus schlegelii fed with experimental diets for 8 weeks. Parameters

1

ALT (U/L) GLU2(mmol/L) AST3(U/L) ALP4(U/L) TP5(g/L) ALB6(mmol/L) TG7(mmol/L) CHO8(mmol/L)

Replacement of fish meal with fish soluble meal (%)

P-values

0

10

20

30

40

60

40.81 ± 0.54 4.13 ± 0.05 302.37 ± 2.73 36.43 ± 1.09 37.57 ± 0.88 9.41 ± 0.11 3.14 ± 0.10 6.83 ± 0.14

40.42 ± 0.63 4.30 ± 0.15 303.37 ± 2.06 37.03 ± 1.89 37.72 ± 0.37.56 9.33 ± 0.11 3.02 ± 0.08 6.68 ± 0.20

40.57 ± 0.58 4.19 ± 0.04 304.23 ± 1.84 37.11 ± 1.05 37.81 ± 0.21 9.61 ± 0.92 3.16 ± 0.25 6.58 ± 0.42

40.80. ± 0.86 4.22 ± 0.19 305.23 ± 1.84 36.79 ± 1.53 37.81 ± 0.218 9.74 ± 0.54 3.24 ± 0.05 6.81 ± 0.19

40.93 ± 0.24 4.20 ± 0.06 305.32 ± 1.24 36.66 ± 1.78 37.71 ± 0.94 9.49 ± 0.22 3.13 ± 0.43 6.74 ± 0.53

41.03 ± 0.33 4.22 ± 0.22 303.40 ± 1.96 36.72 ± 1.01 37.82 ± 0.42 9.36 ± 0.28 3.02 ± 0.56 6.93 ± 0.08

0.798 0.813 0.777 0.942 0.988 0.890 0.942 0.770

Values in each row with different superscript letters are significantly different (P˂0.05). 1 ALT: alanine aminotransferase; 2 GLU: glucose; 3 AST: aspartate transaminase; 4 ALP: alkaline phosphate; 5 TP: total protein; 6 ALB: albumin; 7 TG: triglycerides; 8 CHOL: cholesterol.

Fig. 4. Relative expression of tor, s6k1and 4e-bp2 genes of juvenile black seabream (Acanthopagrus schlegelii) fed diets with replacement levels of fish meal with fish soluble meal. Mean values for the same gene with different letters were significantly different (p ˂ 0.05).

Fig. 2. Relative expression of irs-1, akt and pi3k genes of juvenile black seabream (Acanthopagrus schlegelii) fed diets with replacement levels of fish meal with fish soluble meal. Mean values for the same gene with different letters were significantly different (p ˂ 0.05).

bream and large yellow croaker [18,39]. In fish, the optimum dietary EAA pattern represents the proper balance of amino acid required for optimal protein retention [43]. Amino acids mediated transcription and translation of protein synthesis by activating TOR nutrient signaling pathway in common with GH/IGF system [26,44]. Arginine (Arg) is an essential and the most versatile amino acid for fish [30]. In addition to protein synthesis, arginine also involves in numerous metabolic pathways such as urea production, metabolism of proline and glutamic acid and synthesis of polyamines and creatine [45], and stimulating growth and protein deposition in fish [46,47]. Threonine (Thr) is the third essential amino acid, it is involved in many biochemical and physiological processes, including growth, feed efficiency, maintenance of sufficient feed intake and immune function [48,49]. In the present study, fish fed the diet with 40% replacement level of FM with FSM had higher EAA, arginine and threonine concentration in muscle than those fed the other diets. The results demonstrated that black sea bream could effectively utilize protein from FSM to synthesize the essential amino acids in muscle. Previous studies reported dietary arginine and threonine affected growth and gene expressions of TOR signaling pathway for blunt snout bream (Megalobrama amblycephala) [50,51]. Growth in fish and other vertebrates is controlled by endocrine system, especially through the growth hormone (GH)-Insulin-like growth factor (IGF) axis [52]. IGFs are important upstream regulators of the TOR signaling pathway which regulate the activity of TOR protein through IRS-PI3K-Akt pathway. IRS-1 is a major insulin receptor substrate which acts as a docking protein for homology 2-domain which contains signaling molecules that reconcile many pleiotropic insulin actions [53]. PI3K is an important component of the insulin signaling

Fig. 3. Relative expression of igf-1gene of juvenile black seabream (Acanthopagrus schlegelii) fed diets with replacement levels of fish meal with fish soluble meal. Mean values for the same gene with different letters were significantly different (p ˂ 0.05).

Morphological indices, (HSI, VSI &CF) are well representative of the heath. In the present study, HSI, VSI and CF were not significantly affected by replacement levels of FM with FSM. Similar findings were also observed in red sea bream when fed with FPH [42]. Moreover, there were no significant differences on proximate compositions (moisture, crude protein, crude lipid and ash) in whole-body among all treatments. These results suggested that black sea bream efficiently utilized protein and other nutrients from FSM protein-based diets. The results were in agreement with previous studies for other fish species, such as red sea 274

Fish and Shellfish Immunology 101 (2020) 269–276

M. Irm, et al.

(2018A610343) and Scientific Research Foundation of Ningbo University (XYL20007). This research was also sponsored by the K. C. Wong Magna Fund in Ningbo University. The authors expressed our thanks to the technical staff of FSN Laboratory involved in this experiment. We would also like to thank T.T. Zhu, J.X. Luo, T.T. Pan, P. Sun, Y. Yuan, X.X. Wang for their valuable assistance during the feeding trial, sampling and chemical analysis.

pathway and downstream gene of IRS-1 which plays an essential role insulin metabolic actions [54]. AKT is also known as protein kinase B (PKB), it is a downstream regulator of PI3K and an important mediator of mTOR activity as well as a positive regulator of mTOR [55]. In the present study, the results indicated that dietary optimal FSM supplementation up-regulated the relative expression of irs-1, pi3k and akt in liver. However, excessive FSM supplementation could down-regulate the relative expression of irs-1, pi3k and akt in liver. The findings were agreement with previous study who reported that dietary optimal arginine could up-regulate expression of irs-1, pi3k and akt in blunt snout bream [56]. In fish, nutritional status had a reflective effect on expression of igf-1 [57,58]. IGF-1 level was found to be effective in the evaluation of fish growth rate and the response about alterative feed nutrition composition [52,59]. In the present study, there was a positive correlation between relative expression of igf-1 in liver and growth performance. Fish fed the diet with 40% replacement of FM with FSM had higher relative expression of igf-1 in liver than those fed the other diets. Previous study indicated that igf-1 gene expression increased with dietary inclusion of 11% FPH, which also showed consistent results with growth performance for juvenile Japanese flounder (Paralichthys olivaceus) [60]. Similar trend was also observed for igf-1 expression in giant grouper (Epinephelus lanceolatus) juveniles for different dietary protein levels and juvenile turbot for high krill protein hydrolysate [61,62]. Protein synthesis is an important component of the processes involved in growth response [21]. The TOR signaling pathway plays an important role in balancing protein synthesis and degradation [63]. In aquatic animals a number of studies have been conducted to understand the effect of the dietary protein source on TOR signaling pathway [64]. In the current study, relative expression of tor had a similar trend as igf1. Fish fed the 40% replacement level of FM with FSM diet had significantly higher expression level of tor in liver than those fed the other diets. The results indicated that FSM supplementation could influence TOR signaling pathway. Similar results was found in hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus ♂) [65]. TOR promotes cap dependent translation initiation through the phosphorylation of s6k1 and inactivation of its downstream effector 4e-bp [63]. In the present study, the relative expression of s6k1 was up-regulated in 40% replacement of FM with FSM diet, while a reverse pattern was found for 4e-bp2 gene expression. The relative expression of 4e-bp2 was down regulated in fish fed 40% replacement of FM with FSM diet. The similar results were observed in juvenile blunt snout bream [51]. These findings implied that FSM positively influenced the expression of igf-1 and genes related to tor signaling pathway.

References [1] E.B. Gonzalez, T. Umino, K. Nagasawa, Stock enhancement programme for black seabream, Acanthopagrus schlegelii (Bleeker), in Hiroshima Bay, Japan: a review, Aquacult. Res. 39 (2008) 1307–1315. [2] Q. Shao, J. Ma, Z. Xu, W. Hu, J. Xu, S. Xie, Dietary phosphorus requirement of juvenile black seabream, Sparus macrocephalus, Aquaculture 277 (2008) 92–100. [3] T.H.M. Nip, W.Y. Ho, C.K. Wong, Feeding ecology of larval and juvenile black seabream (Acanthopagrus schlegeli) and Japanese seaperch (Lateolabrax japonicus) in Tolo Harbour, Hong Kong, Environ. Biol. Fish. 66 (2003) 197–209. [4] B.O. Ngandzali, F. Zhou, W. Xiong, Q.J. Shao, J.Z. Xu, Effect of dietary replacement of fish meal by soybean protein concentrate on growth performance and phosphorus discharging of juvenile black seabream, Acanthopagrus schlegelii, Aquacult. Nutr. 17 (2011) 526–535. [5] J.J. Ma, Z.R. Xu, Q.J. Shao, J.Z. Xu, S.S.O. Hung, W.L. Hu, et al., Effect of dietary supplemental l-carnitine on growth performance, body composition and antioxidant status in juvenile black seabream, Sparus macrocephalus, Aquacult. Nutr. 14 (2008) 464–471. [6] Q.C. Zhou, B.P. Tan, K.S. Mai, Y.J. Liu, Apparent digestibility of selected feed ingredients for juvenile cobia Rachycentron canadum, Aquaculture 241 (2004) 441–451. [7] A.D. Anderson, M.S. Alam, W.O. Watanabe, P.M. Carroll, T.C. Wedegaertner, M.K. Dowd, Full replacement of menhaden fish meal protein by low-gossypol cottonseed flour protein in the diet of juvenile black sea bass Centropristis striata, Aquaculture 464 (2016) 618–628. [8] H.G. Xu, Y.C. Mu, Y. Zhang, J.Q. Li, M.Q. Liang, K.K. Zheng, Y.L. Wei, Graded levels of fish protein hydrolysate in high plant diets for turbot (Scophthalmus maximus): effects on growth performance and lipid accumulation, Aquaculture 454 (2016) 140–147. [9] M. Chalamaiah, B. Dinesh Kumar, R. Hemalatha, T. Jyothirmayi, Fish protein hydrolysates: proximate composition, amino acid composition, antioxidant activities and applications: a review, Food Chem. 135 (2012) 3020–3038. [10] E. Dekkers, S. Raghavan, H.G. Kristinsson, M.R. Marshall, Oxidative stability of mahi mahi red muscle dipped in tilapia protein hydrolysates, Food Chem. 124 (2011) 640–645. [11] K.C. Hsu, Purification of antioxidative peptides prepared from enzymatic hydrolysates of tuna dark muscle by-product, Food Chem. 122 (2010) 42–48. [12] J. Zamora-Sillero, A. Gharsallaoui, C. Prentice, Peptides from fish by-product protein hydrolysates and its functional properties: an overview, Mar. Biotechnol. 20 (2018) 118–130. [13] H.T.D. Bui, S. Khosravi, V. Fournier, M. Herault, K.J. Lee, Growth performance, feed utilization, innate immunity, digestibility and disease resistance of juvenile red seabream (Pagrus major) fed diets supplemented with protein hydrolysates, Aquaculture 418–419 (2014) 11–16. [14] F. Shahidi, Y.V.A. Janak Kamil, Enzymes from fish and aquatic invertebrates and their application in the food industry, Trends Food Sci. Technol. 12 (2001) 435–464. [15] A. Skalli, J. Zambonino-Infante, Y. Kotzamanis, R. Fabregat, E. Gisbert, Peptide molecular weight distribution of soluble protein fraction affects growth performance and quality in European sea bass(Dicentrarchus labrax) larvae, Aquacult. Nutr. 20 (2013) 118–131. [16] N.J. Goosen, L.F. De Wet, J.F. Görgens, The effects of protein hydrolysates on the immunity and growth of the abalone Haliotis midae, Aquaculture 428–429 (2014) 243–248. [17] C. Hernández, M.A. Olvera-Novoa, D.M. Smith, R.W. Hardy, B. Gonzalez-Rodriguez, Enhancement of shrimp Litopenaeus vannamei diets based on terrestrial protein sources via the inclusion of tuna by-product protein hydrolysates, Aquaculture 317 (2011) 117–123. [18] Z. Cai, W. Li, K. Mai, W. Xu, Y. Zhang, Q. Ai, Effects of dietary size-fractionated fish hydrolysates on growth, activities of digestive enzymes and aminotransferases and expression of some protein metabolism related genes in large yellow croaker (Larimichthys crocea) larvae, Aquaculture 440 (2015) 40–47. [19] S. Khosravi, H.T.D. Bui, S. Rahimnejad, M. Herault, V. Fournier, J.B. Jeong, Effect of dietary hydrolysate supplementation on growth performance, non‐specific immune response and disease resistance of olive flounder ( Paralichthys olivaceus ) challenged with Edwardsiella tarda, Aquacult. Nutr. 21 (2015) 321–331. [20] J. Bae, A. Azad, S. Won, A. Hamidoghli, M. Seong, S. Bai, Effects of enzymatically hydrolyzed fish by-products in diet of juvenile rainbow trout (Oncorhynchus mykiss), Fisheries Aquat. Sci 22 (2019) 1. [21] T.G. Anthony, A.K. Reiter, J.C. Anthony, S.R. Kimball, L.S. Jefferson, Deficiency of dietary EAA preferentially inhibits mRNA translation of ribosomal proteins in liver of meal-fed rats, Am J. Physi.Endocrin.Metab. 281 (2001) 430–439. [22] L. Feng, Y. Peng, P. Wu, K. Hu, W.-D. Jiang, Y. Liu, et al., Threonine affects intestinal function, protein synthesis and gene expression of TOR in Jian carp (Cyprinus carpio var. Jian), PloS One 8 (2013) e69974.

5. Conclusion The present study demonstrated that dietary FSM could partially replace the FM without negative effect on growth performance, survival and feed utilization. Based on two slope broken-line regression analysis, the optimal replacement of fish meal with FSM is recommended to be 42.59% for juvenile black sea bream. Moreover, replacement of the dietary fish meal with FSM could regulate the expression levels of gene involved in protein synthesis and TOR signaling pathway of black sea bream juvenile. Furthermore, this study could provide important insight for molecular studies on fish nutrition and sustainable aquaculture development of black sea bream. Acknowledgments This study was supported by National Key R & D Program of China (2018YFD0900400), China Agricultural Research System (CARS-48), National Natural Science Foundation of China (31802303), Key Research Program of Zhejiang Province of China (2018C02037), Zhejiang Aquaculture Nutrition & Feed Technology Service Team (ZJANFTST2017-2), Natural Science Foundation of Ningbo 275

Fish and Shellfish Immunology 101 (2020) 269–276

M. Irm, et al.

[46] Z. Cheng, D.M. Gatlin, A. Buentello, Dietary supplementation of arginine and/or glutamine influences growth performance, immune responses and intestinal morphology of hybrid striped bass (Morone chrysops×Morone saxatilis), Aquaculture 362–363 (2012) 39–43. [47] M. Ren, Y. Liao, J. Xie, B. Liu, Q. Zhou, X. Ge, Dietary arginine requirement of juvenile blunt snout bream, Megalobrama amblycephala, Aquaculture 414–415 (2013) 229–234. [48] Y.J. Gao, H.J. Yang, Y.J. Liu, S.J. Chen, D.Q. Guo, Y.Y. Yu, Effects of graded levels of threonine on growth performance, biochemical parameters and intestine morphology of juvenile grass carp Ctenopharyngodon idella, Aquaculture 424–425 (2014) 113–119. [49] H.M. Habte-Tsion, X. Ge, B. Liu, J. Xie, M. Ren, Q. Zhou, A deficiency or an excess of dietary threonine level affects weight gain, enzyme activity, immune response and immune-related gene expression in juvenile blunt snout bream (Megalobrama amblycephala), Fish Shellfish Immunol. 42 (2015) 439–446. [50] H. Liang, M. Ren, H.-M. Habte-Tsion, X. Ge, J. Xie, H. Mi, Dietary arginine affects growth performance, plasma amino acid contents and gene expressions of the TOR signaling pathway in juvenile blunt snout bream, Megalobrama amblycephala, Aquaculture 461 (2016) 1–8. [51] H.M. Habte-Tsion, M. Ren, B. Liu, J. Xie, X. Ge, R. Chen, Threonine affects digestion capacity and hepatopancreatic gene expression of juvenile blunt snout bream (Megalobrama amblycephala), Br. J. Nutr. 114 (2015) 533–543. [52] M. Picha, M. Turano, B. Beckman, R. Borski, Endocrine biomarkers of growth and applications to aquaculture: a minireview of growth hormone, insulin-like growth factor (IGF)-I, and IGF-binding proteins as potential growth indicators in fish, N. Am. J. Aquacult. 70 (2008) 196–211. [53] T. Haruta, T. Uno, J. Kawahara, A. Takano, K. Egawa, P.M. Sharma, A rapamycinsensitive pathway down-regulates insulin signaling via phosphorylation and proteasomal degradation of insulin receptor substrate-1, Mol. Endocrinol. 14 (2000) 783–794. [54] Y.B. Kim, S.E. Nikoulina, T.P. Ciaraldi, R.R. Henry, B.B. Kahn, Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle in type 2 diabetes, J. Clin.Investig. 104 (1999) 733–741. [55] J.M. Lizcano, S. Alrubaie, A. Kieloch, M. Deak, S.J. Leevers, D.R. Alessi, Insulininduced Drosophila S6 kinase activation requires phosphoinositide 3-kinase and protein kinase B, Biochem. J. 374 (2003) 297–306. [56] H. Liang, H.M. Habte-Tsion, X. Ge, M. Ren, J. Xie, L. Miao, Dietary arginine affects the insulin signaling pathway, glucose metabolism and lipogenesis in juvenile blunt snout bream Megalobrama amblycephala, Sci. Rep. 7 (2017) 7864. [57] C. Duan, H. Ren, S. Gao, Insulin-like growth factors (IGFs), IGF receptors, and IGFbinding proteins: roles in skeletal muscle growth and differentiation, Gen. Comp. Endocrinol. 167 (2010) 344–351. [58] A.L. Pierce, M. Shimizu, B.R. Beckman, D.M. Baker, W.W. Dickhoff, Time course of the GH/IGF axis response to fasting and increased ration in chinook salmon (Oncorhynchus tshawytscha), Gen. Comp. Endocrinol. 140 (2005) 192–202. [59] M. Li, B. Peterson, C. Janes, E. Robinson, Comparison of diets containing various fish meal levels on growth performance, body composition, and insulin-like growth factor-I of juvenile channel catfish Ictalurus punctatus of different strains, Aquaculture 253 (2006) 628–635. [60] K. Zheng, M. Liang, H. Yao, J. Wang, Q. Chang, Effect of dietary fish protein hydrolysate on growth, feed utilization and IGF-I levels of Japanese flounder (Paralichthys olivaceus), Aquacult. Nutr. 18 (2012) 297–303. [61] Y. Gao, S. Lu, M. Wu, W. Yao, Z. Jin, X. Wu, Effects of dietary protein levels on growth, feed utilization and expression of growth related genes of juvenile giant grouper (Epinephelus lanceolatus), Aquaculture 504 (2019) 369–374. [62] L. Zhang, B. Guo, M. Liang, H. Xu, Y. Wei, Dietary krill hydrolysates affect the expression of growth-related genes in juvenile turbot (Scophthalmus maximus L.), Aquacult. Nutr. 25 (2019) 406–413. [63] S. Wullschleger, R. Loewith, M.N. Hall, TOR signaling in growth and metabolism, Cell 124 (2006) 471–484. [64] Q. Wang, G. He, K. Mai, W. Xu, H. Zhou, Fishmeal replacement by mixed plant proteins and maggot meal on growth performance, target of rapamycin signalling and metabolism in juvenile turbot (Scophthalmus maximus L.), Aquacult. Nutr. 22 (2016) 752–758. [65] M. Wu, S. Lu, X. Wu, S. Jiang, Y. Luo, W. Yao, et al., Effects of dietary amino acid patterns on growth, feed utilization and hepatic IGF-I, TOR gene expression levels of hybrid grouper (Epinephelus fuscoguttatus ♀×Epinephelus lanceolatus ♂) juveniles, Aquaculture 468 (2017) 508–514.

[23] I. Seiliez, J.C. Gabillard, S. Skiba-Cassy, D. Garcia-Serrana, J. Gutiérrez, S. Kaushik, An in vivo and in vitro assessment of TOR signaling cascade in rainbow trout (Oncorhynchus mykiss), American Am 295 (2008) 329–335. [24] S. Sengupta, T.R. Peterson, D.M. Sabatini, Regulation of the mTOR complex 1 pathway by nutrients, growth factors, and stress, Mol. Cell 40 (2010) 310–322. [25] D.D. Sarbassov, S.M. Ali, D.M. Sabatini, Growing roles for the mTOR pathway, Curr. Opin. Cell Biol. 17 (2005) 596–603. [26] E.N. Fuentes, J.A. Valdés, A. Molina, B.T. Björnsson, Regulation of skeletal muscle growth in fish by the growth hormone – insulin-like growth factor system, Gen. Comp. Endocrinol. 192 (2013) 136–148. [27] S.R. Kimball, L.S. Jefferson, Signaling pathways and molecular mechanisms through which branched-chain amino acids mediate translational control of protein synthesis, J. Nutr. 136 (2006) 227–231. [28] J. Qiang, H. Yang, H. Wang, M.D. Kpundeh, P. Xu, Growth and IGF-I response of juvenile Nile tilapia (Oreochromis niloticus) to changes in water temperature and dietary protein level, J. Biol. 37 (2012) 686–695. [29] D.M. Mutch, W. Wahli, G. Williamson, Nutrigenomics and nutrigenetics: the emerging faces of nutrition, Faseb. J. 19 (2005) 1602–1616. [30] National Research Council, Nutrient Requirements of Fish and Shrimp, NationalAcademies Press, Washington, DC, USA, 2011, pp. 176–179. [31] M. Jin, Y. Lu, Y. Yuan, Y. Li, H. Qiu, P. Sun, Q.C. Zhou, Regulation of growth, antioxidant capacity, fatty acid profiles, hematological characteristics and expression of lipid related genes by different dietary n-3 highly unsaturated fatty acids in juvenile black seabream (Acanthopagrus schlegelii), Aquaculture 471 (2017) 55–65. [32] F.J. Baur, L.G. Ensminger, The association of official analytical chemists (AOAC), JAOCS (J. Am. Oil Chem. Soc.) 54 (1977) 171–172. [33] Y. Yuan, X. Wang, M. Jin, L. Jiao, P. Sun, M.B. Betancor, et al., Modification of nutritional values and flavor qualities of muscle of swimming crab (Portunus trituberculatus): application of a dietary lipid nutrition strategy, Food Chem. 308 (2020) 125607. [34] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method, Methods 25 (2001) 402–408. [35] K. Zheng, M. Liang, H. Yao, J. Wang, Q. Chang, Effect of size-fractionated fish protein hydrolysate on growth and feed utilization of turbot (Scophthalmus maximus L.), Aquacult. Res. 44 (2013) 895–902. [36] J. Uczay, E.K. Battisti, R. Lazzari, M.L. Pessatti, T.L. Schneider, L.B. Hermes, Tilapia protein hydrolyzate improves growth performance, protein absorption and antioxidant status in Silver catfish (Rhamdia quelen), Aquacult. Res. 50 (2019) 3192–3201. [37] M. Ovissipour, A. Abedian Kenari, R. Nazari, A. Motamedzadegan, B. Rasco, Tuna viscera protein hydrolysate: nutritive and disease resistance properties for Persian sturgeon (Acipenser persicus L.) larvae, Aquacult. Res. 45 (2014) 591–601. [38] S. Khosravi, H.T.D. Bui, S. Rahimnejad, M. Herault, V. Fournier, S.S. Kim, Dietary supplementation of marine protein hydrolysates in fish-meal based diets for red sea bream (Pagrus major) and olive flounder (Paralichthys olivaceus), Aquaculture 435 (2015) 371–376. [39] H.G. Tang, T.X. Wu, Z.Y. Zhao, X.D. Pan, Effects of fish protein hydrolysate on growth performance and humoral immune response in large yellow croaker (Pseudosciaena crocea R.), J. Zhejiang Univ. - Sci. 9 (2008) 684–690. [40] D.T.N. Mach, R. Nortvedt, Free amino acid distribution in plasma and liver of juvenile cobia (Rachycentron canadum) fed increased levels of lizardfish silage, Aquacult. Nutr. 17 (2011) 644–656. [41] Y.P. Kotzamanis, E. Gisbert, F.J. Gatesoupe, J. Zambonino Infante, C. Cahu, Effects of different dietary levels of fish protein hydrolysates on growth, digestive enzymes, gut microbiota, and resistance to Vibrio anguillarum in European sea bass (Dicentrarchus labrax) larvae, Comp. Biochem. Physiol. Mol. Integr. Physiol. 147 (2007) 205–214. [42] S. Khosravi, S. Rahimnejad, M. Herault, V. Fournier, C.R. Lee, H.T. Dio Bui, Effects of protein hydrolysates supplementation in low fish meal diets on growth performance, innate immunity and disease resistance of red sea bream Pagrus major, Fish Shellfish Immunol. 45 (2015) 858–868. [43] L.E.C. Conceição, H. Grasdalen, I. Rønnestad, Amino acid requirements of fish larvae and post-larvae: new tools and recent findings, Aquaculture 227 (2003) 221–232. [44] J. Avruch, X. Long, S. Ortiz-Vega, J. Rapley, A. Papageorgiou, N. Dai, Amino acid regulation of TOR complex 1, Am. J. Physiol. Endocrinol. Metab. 296 (2009) 592–602. [45] G. Wu, F.W. Bazer, T.A. Davis, S.W. Kim, P. Li, J. Marc Rhoads, Arginine metabolism and nutrition in growth, health and disease, Amino Acids 37 (2009) 153–168.

276