- Email: [email protected]
GH cDNA gene in transgenic carp
Aquaculture ELSEVIER
Aquaculture 137 (1995) 179-185
Inheritance of recombinant carp &actin/GH gene in transgenic carp
cDNA
B. Moav a**, Y. Hinits a, Y. Groll a, S. Rothbard b aDepartment ofZoology, Faculty of Life Sciences, Tel Aviv University, Ramat Aviv 69978, Israel b Yafit Laboratory, Fish Breeding Center, Gan Shmuel, Israel
Abstract Individual carp (Cyprinus carpio) raised from zygotes that were microinjected with two different carp l3-actin promoters fused to the chinook salmon GH cDNA gene. Twenty five individual fish, out of 200 males and females, were shown to contain the constructs in a mosaic fashion at sexual maturity, and some of them were crossed with each other as well as with non-transgenic carp. The level of transgene transmittance from the transgenic parents varied between individuals. We observed 32%-87% inheritance when transgenic parents were crossed and 0%-50% inheritance when transgenic parents were mated with non-transgenics. Keywords:
Tausgenic fish; Qprinus carpio; Inheritance; Growth hormone
1. Introduction Several attempts have been made to introduce transgenes into a number of fish species (see recent reviews: Hackett, 1993; Hew and Fletcher, 1992; Maclean and Penman, 1990). In most studies, DNA constructs were introduced into zygotes or early embryos (up to the two cell stage) by microinjection, although several other methods were used successfully. In most of the published data on transgenic fish, integration rate is rather low ( -5%) although this figure varies widely (Hackett, 1993; Fletcher and Davies, 1991). Nuclei are not usually visible and DNA is injected into the cytoplasm; this could have an effect on the extent and timing of integration of the microinjected transgene. Integration of DNA constructs into the fish genome at stages beyond the one cell stage, results in mosaicism. Mosaicism may occur in somatic cells and/or in the germ cells of the developing fish. Transfer of the transgene from the founder generation to their progeny in less than the expected Mendelian ratio may indicate that the transgenic fish have germline mosaicism
* Corresponding author 0044.8486/95/$09.50 0 1995 Elsevier Science B.V. All rights reserved SSD10044-8486(95)01093-9
B. Mom et al. /Aquaculture
180
137(1995)
179-185
(Penman et al., 1990; Culp et al., 1991; Guyomard et al., 1989; Shears et al., 1991). Other unexpected levels of transgene genetic transmittance may be due to transfer of unintegrated transgenes to the offspring (Guyomard et al., 1989; Stuartet al., 1988) or multiple transgene integration sites (Penman et al., 1990; Stuart et al., 1990; Tewari et al., 1992). The choice of promoter/enhancer could determine the success in obtaining expression of transgenes in transgenic fish. Tissue specificity of promoters and enhancers depends on tissue-specific transcription factors, and their availability may affect the expression of the transgene. Some researchers have suggested that constructs made of fish promoters and fish genes are expressed more efficiently than mammalian constructs and/or promoters in fish cells (Winkler et al., 1992; Betancourt et al., 1993). Moreover, the possible use of transgenic fish in the aquaculture industry has raised social and moral considerations which have encouraged the development of ‘all-fish’ gene constructs (Du et al., 1992; Hackett, 1993). Following the isolation and characterization of the carp (Cyprinus carpio) l3-actin gene (Liu et al., 1990~)~ a variety of fish gene constructs containing the carp l3-actin regulatory sequences (Liu et al., 1990a; Liu et al., 1990b) have been prepared. These constructs were tested for their potency in fish tissue culture cells (Moav et al., 1992b), and by transient expression in early fish development (Moav et al., 1992a; Moav et al., 1993). Two ‘allfish’ expression vectors with low and high potencies were developed (Liu et al., 1990a; Liu et al., 1990b) and fused to the chinook salmon growth hormone cDNA which was cloned by Hew et al. ( 1989). This work attempts to produce genetically engineered carp by using these ‘all-fish’ gene constructs. O-actin gene is ubiquitous and highly expressed in carp tissues and it is therefore expected that the chosen carp B-actin promoter will be transcribed in most of the carp tissues. Expression of this genetically engineered fish GH in carp tissues is expected to be high and significant and independent of endogenous hypothalamic and pituitary control. As a result, the enhanced expression of the B-actin/GH transgene should increase growth hormone levels and growth rates in these fish. The present study demonstrates the successful transmittance of carp B-actin/csGH transgene from F, transgenic parents to F, transgenic progeny from which the transgene is expected to be transmitted genetically in a Mendelian fashion.
2. Materials and methods 2.1. Fish maintenance
and breeding
Carp zygotes were microinjected with DNA constructs (Moav et al., 1992b) and were maintained at Yafit Laboratory, Fish Breeding Center, Gan Shmuel, Israel, under specially designed closed nets in an isolated fish pond. Selected mature fish were brought indoors to closed plastic tanks, injected with pituitary extract or GnRH preparation, and artificial insemination was performed according to Rothbard ( 198 1). After hatching, the fry were taken to Tel Aviv University and each progeny was kept in an individual aquarium. 2.2. Preparation
of the transgenes
An ‘all-fish’ expression vector (FV) , FV- 1/csGH, was constructed by inserting a fragment containing the proximal promoter of carp B-actin gene (Liu et al., 1990a) into the PstI
B. Moav et al. /Aquaculture
I37 (1995) 179-185
181
FV-l/csGH
21134
)
4
21133
331 bp
FV-2/csGH
*
4
211.52~ carp
q q
pactin gene:
)
506
5’ flanldog sequence
csGH cDNA
Firstexon
poly A csGH
21133
bp
Fiistimon
Fig.
I. Design of PCR primers for detection of transgenes pFV-1 /c&H and pFV-2/c&H
site of the chinook salmon (Unchoryuchus tsuwytscha) growth hormone cDNA (Hew et al., 1989; Fig.1). A second fish expression vector, pFV-2/csGH, contains the proximal promoter and enhancer regulatory elements of the common carp (Cyprinus carpio) B-actin gene ( 1100 bp of 5’ flanking sequence plus exon 1 and intron 1 and 2 bp of exon 2; Fig. 1)
2.3. Polymerase
Chain Reaction (PCR) analysis
Blood, fins and sperm samples were taken from adult Fe and F, carp. DNA was extracted from these samples or from whole fry with proteinase K, subsequently extracted with phenol, phenol/chloroform/isoamylalcohol and chloroform/isoamylalcohol, precipitated in ethanol, dried, dissolved, treated with RNase and Proteinase K, re-extracted again with phenol, precipitated with ethanol and dissolved in TE buffer. Quality of the DNA was tested by 1% agarose gel electrophoresis. PCR Reaction mixture (final volume of 50 ~1) contained approximately 250 ng of heat denatured fish DNA, two units of Vent DNA polymerase (Bio-labs) , 50 pmol of each primer, 0.1 mM of each dNTP, 3 mM of MgSO+ PCR amplification was started with 1 min at 94°C followed by 1.5 min at 56°C and 1 min at 72”C, followed by 34 cycles of 1 min at 92°C 1.5 min at 56°C and 1 min at 72”C, and then 10 min of 72°C elongation. Three primers were used for the reaction: #21133: S’CACTCGGTCAGCTG’ITCGTGC3’ and #21134: S’GCGTCTCAGCCTCACTTTGAG3’. These primers were designed to give 33 1 bp DNA fragment to detect the FV- 1 /csGH construct and #21133 and #21152: S’GTCTCTGCTGAGTGCCACACC3’ were designed to give 506 bp DNA fragment for the detection of the FV-2/csGH construct (Fig. 1)
182
B. Moav et al. /Aquaculture 137 (1995) I79-185
Table I Tissue distribution and genetic transmission of transgenes from F, to the F, generation. FCR screening was made on individual fish, except for batches of 20 small fry. For further details see text Fish
#4326F
Sex
Male
Construct
FV-I/ CSGH
#D6460
Male
FV-I/ C&H
#B5AO9
Male
#B5C26
Male
FV-I/ CSGH FV-I/ csiGH
#DIl55A
Male
FV-I/ csGH
#7X57
Male
#9OB5F
Male
#73521
Female
#90406
Female
#D5019
Female
#D3B17
Female
#30B2B
Female
#2754E
Female
#72C2C
Female
FV-I/ csGH FV-I/ csGH FV- 1 / csGH FV- 1 I csGH FV-I / csGH FV- I/ csGH FV- 1 / CSGH FV-21 csGH FV-2/ csGH
Transgene presence
Fin DNA
Blood DNA
Sperm DNA
+
_
+
+
+ _
_
+
Crosses with non-tramgenic mate No. of
% of transmitance
progeny tested
Crosses with transgenic mate No. of progeny tested’
% of ua”s”litance
14
21.5%
28:
13
31%
2 batches * * l/2 of batches
14
50%
pass, 2 2/2 of batches batches * * * pass. 87.5% 40*
11 1
63% 0%
19*
18
28%
2 batches * * l/2 of batches
17
18%
2 212 of batches batches * * * pass. 2 batches * * 2/2 of batches pass. l/2 of batches 2 batches * * * pass.
32%
47%
pOSS.
_
+
17
41%
_
+
16
12.5%
_
+
20
0%
+ + -
+
_
+
_
+
+
-
+
-
no eggs available
no eggs available 13
*, Transgenic female # D5019. * * , Transgenic female # 73521.
0%
* * *, Transgenic
female # 90406.
3. Results 3. I. F, generation
During the summer of 1990, the two transgenes were injected into Koi carp eggs fertilized by DOR 70 carp sperm in both linear and supercoiled forms. Two hundred and fifty adult
B. Moav et al. /Aquaculture 137 (1995) 179-185
183
fish that had reached the correct size were tagged with individual pit tags (Destron/ID Inc. Biosonics), and 200 were screened for the transgene. Screening was performed by the PCR method using DNA extracted from blood, fin and sperm. Twenty five fish ( 12.5% of the screened fish) were found to contain the transgene in one of their tissues; 14 of them contained the FV- 1/csGH transgene and 11 contained the FV2/csGH transgene. The transgenes were distributed in the fish tissues in a mosaic pattern, i.e. DNA extracted from different tissues of the same individual gave different results (Table 1) . Mosaic distribution indicates that DNA integration may have occurred at late stages of embryonic development rather than in the pre-cleavage stage. 3.2. F, generation Fourteen fish which were found positive by PCR in one of their tissues were chosen for crosses to obtain the F, generation (see Table 1) . Of these, seven males and five females contained the FV-1 /csGH transgene and two females contained the FV-2/csGH transgene. In a series of crosses held during the summer of 1993 in Yafit laboratory, Gan Shmuel, these fish were crossed between themselves and with non-transgenic mates. Males provided sperm continuously throughout the breeding season, but each female produced only one batch of eggs annually. PCR screening was at first performed on DNA extract from batches of 20 small fry (a few days after hatching). In subsequent crosses, fry (XL-200 mg) were individually tested and their length and weight measured. Under these conditions, we were unable to observe any significant differences in length and weight between transgenic fry and their nontransgenic siblings. When the fish had reached a suitable size for individual tagging, samples from blood, sperm and fins were taken and tested by PCR. The number of progeny tested from each crossing, and the percentage of the F, fish containing the transgene (transgene transmittance) is presented in Table 1. The percentage of transgene transmittance varies between different crosses. However no significant difference in transgene transmittance was found in repeated crosses of the same TgFo individuals. A higher percentage of transgene transmittance was detected when TgFo males were crossed with TgF, female (#D5019) in comparison to crosses of the same males with non-transgenic female.It seems that a high proportion of the TgF, fish that were tested, transferred the transgene to the F, generation indicating that there is a high level of germline transformation in the TgFo generation.
4. Discussion The results of the screening for F, carp which contain the injected transgenes FV-11 csGH and FV-2/csGH indicate mosaicism for most, if not all, of the fish. Transgenic fish were found to have the transgene in some of their tissues but not in others. This conclusion adds to and supports previous findings in F, fish by others (Stuart et al., 1988; Stuart et al., 1990; Guyomard et al., 1989; Zhang et al., 1990; Penman et al., 1990; Culp et al., 1991; Shears et al., 1991; Tewari et al., 1992). These mosaic individuals are able to transmit the transgenes to the next generation (Fi ), indicating that foreign DNA is present in their germlines. In some cases, the percent of
184
B. Mouv et al. /Aquacul!ure
137 (1995) 179-185
transmittance of the transgene is less than the 50% expected, if there is only one single integration site of the transgene on one chromosome (hemizygocity). These cases probably occur because of germline mosaicism (Zhang et al., 1990; Stuart et al., 1990; Penman et al., 1990; Culp et al., 199 1; Shears et al., 199 1) . Male #D6460 showed 50% of transgene transmittance or higher in repeated crosses. Higher than 50% transmittance could be explained by the occurrence of two or more different integration sites on different chromosomes (Penman et al., 1990; Zhang et al., 1990; Stuart et al., 1990; Guyomard et al., 1989). Another male, #90B5F, was found not to transmit the transgene to its progeny even though its sperm contained the FV-1 /csGH transgene. As only a few fish of this progeny (20 were examined) survived, the explanation could be a very low percent (under 5%) of transgenic germline cells in this TgF,, male. Another possibility is that the transgene acted as a dominant lethal gene once it was inherited by the offspring with only non-transgene offspring surviving. Mosaicism in this F, parent could have prevented the lethal effect of the transgene. Repeated massive death of the progeny from this male supports this possibility. Similar results were obtained by Penman et al. ( 1990). No F, transgenic progeny was obtained from a cross of transgenic female (#72C2C). It is possible that either the transgene is transmitted in a low percentage or that, due to mosaicism, this female does not contain the transgene in its germ cells (#72C2C was found to contain the transgene in fin DNA, but not in blood DNA). Although no progeny exist from a cross between female #D5019 and non-transgenic male, the contribution of transgene transmittance of this TgF, female could be detected in crosses of #D5019 with three TgF, males: #4326F, #D6460 and #B5A09 compared to crosses of these males with a non-transgenic female carp. The establishment of F? generation by crossing TgF, carps will enable us to perform a large scale growth and growth rate experiments.
Acknowledgements
This work is supported by the ISRAEL-U.S.A. Binational Agricultural Research and Development Fund (BARD #US- 15 17-88 and #US-2305-93RC) and the Basic Research Fund of the Tel Aviv University. The technical assistance in PCR screening by H. Sternberg is greatly appreciated.
References Betancourt, O.H., Attal, J., Theron, M.C., Puissant, C. and Houdebine, L.M., 1993. Efficiency of introns from various origins in fish cells. Mol. Mar. Biol. Biotechnol., 2: 181-188. Gulp, P., Ntisslein-Volhard, C. and Hopkins, N. 199 1. High-frequency germ-line transmission of plasmid DNA sequences injected into fertilized zebrafish eggs, Proc. Nat]. Acad. Sci. USA, 88: 7953-7957. Du, S.J., Gong, Z.,Fletcher,G.L., Shears, M.A., King, M.J., Idler, D.R. andHew, C.L., 1992. Growthenhancement in transgenic Atlantic salmon by the use of an “all-fish” chimeric growth hormone gene construct. Bio/ Technology. IO: 176-181. Fletcher. G.L. and Davies, P.L., I99 1. Transgenic fish for aquaculture. Gen. Eng., 13: 33 ll370.
B. Mouv et al. /Ayuaculture
137 (1995) 179-185
185
Guyomard. R.. Chourrout, D., Leroux, C., Houdebine, L.M. and Pourrain, F., 1989. Integration and germline transmission of foreign genes microinjected into fertilized trout eggs. Biochimie 7 I: 857-863. Hackett, P.B., 1993. The molecular biology oftransgenic fish. In: P.W. Hochachkaand T.P. Mommsen (Editors), Biochemistry and Molecular Biology of Fishes, Vol. 2. Elsevier, Amsterdam, pp. 207-239. Hew. CL.. Trink, K.Y.. Du, S.J. and Song, S., 1989. Molecular cloning and expression of salmon pituitary hormones. Fish. Physiol. Biochem., 7: 375-380. Hew. CL. and Fletcher, G.L. (Editors), 1992. Transgenic Fish. World Sci. Publ., Singapore, 274 pp. Liu, Z.. Moav, B., Faras, A.J., Guise, K.S., Kapuscinski, A.R. and Hackett, P.B., 1990a. Development ofexpression vectors for transgenic fish. Bio/TechnoIogy, 8: 1268-1272. Liu, Z.. Moav, B.. Faras, A.J., Guise, K.S., Kapuscinski, A.R. and Hackett, P.B., 1990b. Functional analysis of elements affecting expression of the l?-actin gene of carp. Mol. Cell. Biol., IO; 3432-3440. Liu, Z.. Zhu, Z.. Roberg, K., Faras, A.J.. Guise, KS., Kapuscinski, A.R. and Hackett, P.B., 1990~. Isolation and characterization of the l3-actin gene of carp (C.vprinus carpio) DNA Sequence, I : 125-136. Maclean, N. and Penman. D., 1990. The application of gene manipulation to aquaculture. Aquaculture, 85: I-20. Moav. B., Liu. Z.. Caldovic, L.D., Gross, M.L., Kapuscinski, A.R., Faras, A.J., Guise, K.S. and Hackett, P.B., 1992a. Expression of heterologous genes in transgenic fish. In: C. Hew and G.L. Fletcher (Editors), Transgenic Fish. World Sci. Pub., Singapore, pp. 121-140. Moav. B., Liu, Z.. Groll. Y. and Hackett, P.B., 1992b. Selection of promoters for transgenic fish. Mol. Mar. Biol. Biotech.. I: 338834.5. Moav. B.. Liu. Z., Caldovic, L.D.. Gross, M.L. and Hackett, P.B., 1993. Regulation of early expression of transgenes in developing fish. Transgen. Res., 2: 153-161. Penman, D.J., Beeching. A.J., Penn, S. and Maclean, N., 1990. Factors affecting survival and integration following microinjection of novel DNA into rainbow trout eggs. Aquaculture, 85: 35-50. Rothbard, S.. 198 1. Induced reproduction in cultivated cyprinids - the common carp and the group of Chinese carps. I. The technique of induction, spawning and hatching. Isr. J. Aquaculture-Bamidgeh, 33: 103-121, Shears, M.A., Fletcher, G.L., Hew. C.L., Gautheier. S. and Davies, P.L., 1991. Transfer, expression and stable inheritance of antifreeze protein genes in Atlantic salmon (S&no s&r). Mol. Mar. Biol. Biotechnol., 1: 5863. Stuart, G.W., McMurray, J.V. and Westerfield, M., 1988. Replication, integration, and stable germ-line transmission of foreign sequences injected into early zebrafish embryos. Development, 103: 403412. Stuart, G.W.. McMurray. J.V. and Westerfield, M., 1990. Stable lines of transgenic zebrafish exhibit reproduction patterns of transgene expression. Development, 109: 577-584. Tewari. R., Michard-Vanhee, C., Perrot, E. and Chourrout, D., 1992. Mendelian transmission, structure and expression of transgenes following their injection into the cytoplasm of trout eggs. Transgen. Res., 1: 250260. Winkler, C.. Hong, Y., Wittbrodt, J. and Schartl, M., 1992. Analysis of heterologous and homologous promoters and enhancers in vitro and in vivo by gene transfer into Japanese medaka (0~~ricr.y [utipes) and Xiphophorus. Mol. Mar. Biol. Biotechnol., 1: 326-337. Zhang, P., Hayat, M., Joyce, C., Gonzalez-Villasenor, L.I., Lin, CM., Dunham, R.A., Chen, T.T. and Powers, D.A., 1990. Gene transfer, expression and inheritance of pRSV-rainbow trout&H cDNA in the common carp, C\~J&LI.S ctrr@ (Linnaeus), Mol. Rep. Dev., 25: 3-l 3.
Aquaculture 137 (1995) 179-185
Inheritance of recombinant carp &actin/GH gene in transgenic carp
cDNA
B. Moav a**, Y. Hinits a, Y. Groll a, S. Rothbard b aDepartment ofZoology, Faculty of Life Sciences, Tel Aviv University, Ramat Aviv 69978, Israel b Yafit Laboratory, Fish Breeding Center, Gan Shmuel, Israel
Abstract Individual carp (Cyprinus carpio) raised from zygotes that were microinjected with two different carp l3-actin promoters fused to the chinook salmon GH cDNA gene. Twenty five individual fish, out of 200 males and females, were shown to contain the constructs in a mosaic fashion at sexual maturity, and some of them were crossed with each other as well as with non-transgenic carp. The level of transgene transmittance from the transgenic parents varied between individuals. We observed 32%-87% inheritance when transgenic parents were crossed and 0%-50% inheritance when transgenic parents were mated with non-transgenics. Keywords:
Tausgenic fish; Qprinus carpio; Inheritance; Growth hormone
1. Introduction Several attempts have been made to introduce transgenes into a number of fish species (see recent reviews: Hackett, 1993; Hew and Fletcher, 1992; Maclean and Penman, 1990). In most studies, DNA constructs were introduced into zygotes or early embryos (up to the two cell stage) by microinjection, although several other methods were used successfully. In most of the published data on transgenic fish, integration rate is rather low ( -5%) although this figure varies widely (Hackett, 1993; Fletcher and Davies, 1991). Nuclei are not usually visible and DNA is injected into the cytoplasm; this could have an effect on the extent and timing of integration of the microinjected transgene. Integration of DNA constructs into the fish genome at stages beyond the one cell stage, results in mosaicism. Mosaicism may occur in somatic cells and/or in the germ cells of the developing fish. Transfer of the transgene from the founder generation to their progeny in less than the expected Mendelian ratio may indicate that the transgenic fish have germline mosaicism
* Corresponding author 0044.8486/95/$09.50 0 1995 Elsevier Science B.V. All rights reserved SSD10044-8486(95)01093-9
B. Mom et al. /Aquaculture
180
137(1995)
179-185
(Penman et al., 1990; Culp et al., 1991; Guyomard et al., 1989; Shears et al., 1991). Other unexpected levels of transgene genetic transmittance may be due to transfer of unintegrated transgenes to the offspring (Guyomard et al., 1989; Stuartet al., 1988) or multiple transgene integration sites (Penman et al., 1990; Stuart et al., 1990; Tewari et al., 1992). The choice of promoter/enhancer could determine the success in obtaining expression of transgenes in transgenic fish. Tissue specificity of promoters and enhancers depends on tissue-specific transcription factors, and their availability may affect the expression of the transgene. Some researchers have suggested that constructs made of fish promoters and fish genes are expressed more efficiently than mammalian constructs and/or promoters in fish cells (Winkler et al., 1992; Betancourt et al., 1993). Moreover, the possible use of transgenic fish in the aquaculture industry has raised social and moral considerations which have encouraged the development of ‘all-fish’ gene constructs (Du et al., 1992; Hackett, 1993). Following the isolation and characterization of the carp (Cyprinus carpio) l3-actin gene (Liu et al., 1990~)~ a variety of fish gene constructs containing the carp l3-actin regulatory sequences (Liu et al., 1990a; Liu et al., 1990b) have been prepared. These constructs were tested for their potency in fish tissue culture cells (Moav et al., 1992b), and by transient expression in early fish development (Moav et al., 1992a; Moav et al., 1993). Two ‘allfish’ expression vectors with low and high potencies were developed (Liu et al., 1990a; Liu et al., 1990b) and fused to the chinook salmon growth hormone cDNA which was cloned by Hew et al. ( 1989). This work attempts to produce genetically engineered carp by using these ‘all-fish’ gene constructs. O-actin gene is ubiquitous and highly expressed in carp tissues and it is therefore expected that the chosen carp B-actin promoter will be transcribed in most of the carp tissues. Expression of this genetically engineered fish GH in carp tissues is expected to be high and significant and independent of endogenous hypothalamic and pituitary control. As a result, the enhanced expression of the B-actin/GH transgene should increase growth hormone levels and growth rates in these fish. The present study demonstrates the successful transmittance of carp B-actin/csGH transgene from F, transgenic parents to F, transgenic progeny from which the transgene is expected to be transmitted genetically in a Mendelian fashion.
2. Materials and methods 2.1. Fish maintenance
and breeding
Carp zygotes were microinjected with DNA constructs (Moav et al., 1992b) and were maintained at Yafit Laboratory, Fish Breeding Center, Gan Shmuel, Israel, under specially designed closed nets in an isolated fish pond. Selected mature fish were brought indoors to closed plastic tanks, injected with pituitary extract or GnRH preparation, and artificial insemination was performed according to Rothbard ( 198 1). After hatching, the fry were taken to Tel Aviv University and each progeny was kept in an individual aquarium. 2.2. Preparation
of the transgenes
An ‘all-fish’ expression vector (FV) , FV- 1/csGH, was constructed by inserting a fragment containing the proximal promoter of carp B-actin gene (Liu et al., 1990a) into the PstI
B. Moav et al. /Aquaculture
I37 (1995) 179-185
181
FV-l/csGH
21134
)
4
21133
331 bp
FV-2/csGH
*
4
211.52~ carp
q q
pactin gene:
)
506
5’ flanldog sequence
csGH cDNA
Firstexon
poly A csGH
21133
bp
Fiistimon
Fig.
I. Design of PCR primers for detection of transgenes pFV-1 /c&H and pFV-2/c&H
site of the chinook salmon (Unchoryuchus tsuwytscha) growth hormone cDNA (Hew et al., 1989; Fig.1). A second fish expression vector, pFV-2/csGH, contains the proximal promoter and enhancer regulatory elements of the common carp (Cyprinus carpio) B-actin gene ( 1100 bp of 5’ flanking sequence plus exon 1 and intron 1 and 2 bp of exon 2; Fig. 1)
2.3. Polymerase
Chain Reaction (PCR) analysis
Blood, fins and sperm samples were taken from adult Fe and F, carp. DNA was extracted from these samples or from whole fry with proteinase K, subsequently extracted with phenol, phenol/chloroform/isoamylalcohol and chloroform/isoamylalcohol, precipitated in ethanol, dried, dissolved, treated with RNase and Proteinase K, re-extracted again with phenol, precipitated with ethanol and dissolved in TE buffer. Quality of the DNA was tested by 1% agarose gel electrophoresis. PCR Reaction mixture (final volume of 50 ~1) contained approximately 250 ng of heat denatured fish DNA, two units of Vent DNA polymerase (Bio-labs) , 50 pmol of each primer, 0.1 mM of each dNTP, 3 mM of MgSO+ PCR amplification was started with 1 min at 94°C followed by 1.5 min at 56°C and 1 min at 72”C, followed by 34 cycles of 1 min at 92°C 1.5 min at 56°C and 1 min at 72”C, and then 10 min of 72°C elongation. Three primers were used for the reaction: #21133: S’CACTCGGTCAGCTG’ITCGTGC3’ and #21134: S’GCGTCTCAGCCTCACTTTGAG3’. These primers were designed to give 33 1 bp DNA fragment to detect the FV- 1 /csGH construct and #21133 and #21152: S’GTCTCTGCTGAGTGCCACACC3’ were designed to give 506 bp DNA fragment for the detection of the FV-2/csGH construct (Fig. 1)
182
B. Moav et al. /Aquaculture 137 (1995) I79-185
Table I Tissue distribution and genetic transmission of transgenes from F, to the F, generation. FCR screening was made on individual fish, except for batches of 20 small fry. For further details see text Fish
#4326F
Sex
Male
Construct
FV-I/ CSGH
#D6460
Male
FV-I/ C&H
#B5AO9
Male
#B5C26
Male
FV-I/ CSGH FV-I/ csiGH
#DIl55A
Male
FV-I/ csGH
#7X57
Male
#9OB5F
Male
#73521
Female
#90406
Female
#D5019
Female
#D3B17
Female
#30B2B
Female
#2754E
Female
#72C2C
Female
FV-I/ csGH FV-I/ csGH FV- 1 / csGH FV- 1 I csGH FV-I / csGH FV- I/ csGH FV- 1 / CSGH FV-21 csGH FV-2/ csGH
Transgene presence
Fin DNA
Blood DNA
Sperm DNA
+
_
+
+
+ _
_
+
Crosses with non-tramgenic mate No. of
% of transmitance
progeny tested
Crosses with transgenic mate No. of progeny tested’
% of ua”s”litance
14
21.5%
28:
13
31%
2 batches * * l/2 of batches
14
50%
pass, 2 2/2 of batches batches * * * pass. 87.5% 40*
11 1
63% 0%
19*
18
28%
2 batches * * l/2 of batches
17
18%
2 212 of batches batches * * * pass. 2 batches * * 2/2 of batches pass. l/2 of batches 2 batches * * * pass.
32%
47%
pOSS.
_
+
17
41%
_
+
16
12.5%
_
+
20
0%
+ + -
+
_
+
_
+
+
-
+
-
no eggs available
no eggs available 13
*, Transgenic female # D5019. * * , Transgenic female # 73521.
0%
* * *, Transgenic
female # 90406.
3. Results 3. I. F, generation
During the summer of 1990, the two transgenes were injected into Koi carp eggs fertilized by DOR 70 carp sperm in both linear and supercoiled forms. Two hundred and fifty adult
B. Moav et al. /Aquaculture 137 (1995) 179-185
183
fish that had reached the correct size were tagged with individual pit tags (Destron/ID Inc. Biosonics), and 200 were screened for the transgene. Screening was performed by the PCR method using DNA extracted from blood, fin and sperm. Twenty five fish ( 12.5% of the screened fish) were found to contain the transgene in one of their tissues; 14 of them contained the FV- 1/csGH transgene and 11 contained the FV2/csGH transgene. The transgenes were distributed in the fish tissues in a mosaic pattern, i.e. DNA extracted from different tissues of the same individual gave different results (Table 1) . Mosaic distribution indicates that DNA integration may have occurred at late stages of embryonic development rather than in the pre-cleavage stage. 3.2. F, generation Fourteen fish which were found positive by PCR in one of their tissues were chosen for crosses to obtain the F, generation (see Table 1) . Of these, seven males and five females contained the FV-1 /csGH transgene and two females contained the FV-2/csGH transgene. In a series of crosses held during the summer of 1993 in Yafit laboratory, Gan Shmuel, these fish were crossed between themselves and with non-transgenic mates. Males provided sperm continuously throughout the breeding season, but each female produced only one batch of eggs annually. PCR screening was at first performed on DNA extract from batches of 20 small fry (a few days after hatching). In subsequent crosses, fry (XL-200 mg) were individually tested and their length and weight measured. Under these conditions, we were unable to observe any significant differences in length and weight between transgenic fry and their nontransgenic siblings. When the fish had reached a suitable size for individual tagging, samples from blood, sperm and fins were taken and tested by PCR. The number of progeny tested from each crossing, and the percentage of the F, fish containing the transgene (transgene transmittance) is presented in Table 1. The percentage of transgene transmittance varies between different crosses. However no significant difference in transgene transmittance was found in repeated crosses of the same TgFo individuals. A higher percentage of transgene transmittance was detected when TgFo males were crossed with TgF, female (#D5019) in comparison to crosses of the same males with non-transgenic female.It seems that a high proportion of the TgF, fish that were tested, transferred the transgene to the F, generation indicating that there is a high level of germline transformation in the TgFo generation.
4. Discussion The results of the screening for F, carp which contain the injected transgenes FV-11 csGH and FV-2/csGH indicate mosaicism for most, if not all, of the fish. Transgenic fish were found to have the transgene in some of their tissues but not in others. This conclusion adds to and supports previous findings in F, fish by others (Stuart et al., 1988; Stuart et al., 1990; Guyomard et al., 1989; Zhang et al., 1990; Penman et al., 1990; Culp et al., 1991; Shears et al., 1991; Tewari et al., 1992). These mosaic individuals are able to transmit the transgenes to the next generation (Fi ), indicating that foreign DNA is present in their germlines. In some cases, the percent of
184
B. Mouv et al. /Aquacul!ure
137 (1995) 179-185
transmittance of the transgene is less than the 50% expected, if there is only one single integration site of the transgene on one chromosome (hemizygocity). These cases probably occur because of germline mosaicism (Zhang et al., 1990; Stuart et al., 1990; Penman et al., 1990; Culp et al., 199 1; Shears et al., 199 1) . Male #D6460 showed 50% of transgene transmittance or higher in repeated crosses. Higher than 50% transmittance could be explained by the occurrence of two or more different integration sites on different chromosomes (Penman et al., 1990; Zhang et al., 1990; Stuart et al., 1990; Guyomard et al., 1989). Another male, #90B5F, was found not to transmit the transgene to its progeny even though its sperm contained the FV-1 /csGH transgene. As only a few fish of this progeny (20 were examined) survived, the explanation could be a very low percent (under 5%) of transgenic germline cells in this TgF,, male. Another possibility is that the transgene acted as a dominant lethal gene once it was inherited by the offspring with only non-transgene offspring surviving. Mosaicism in this F, parent could have prevented the lethal effect of the transgene. Repeated massive death of the progeny from this male supports this possibility. Similar results were obtained by Penman et al. ( 1990). No F, transgenic progeny was obtained from a cross of transgenic female (#72C2C). It is possible that either the transgene is transmitted in a low percentage or that, due to mosaicism, this female does not contain the transgene in its germ cells (#72C2C was found to contain the transgene in fin DNA, but not in blood DNA). Although no progeny exist from a cross between female #D5019 and non-transgenic male, the contribution of transgene transmittance of this TgF, female could be detected in crosses of #D5019 with three TgF, males: #4326F, #D6460 and #B5A09 compared to crosses of these males with a non-transgenic female carp. The establishment of F? generation by crossing TgF, carps will enable us to perform a large scale growth and growth rate experiments.
Acknowledgements
This work is supported by the ISRAEL-U.S.A. Binational Agricultural Research and Development Fund (BARD #US- 15 17-88 and #US-2305-93RC) and the Basic Research Fund of the Tel Aviv University. The technical assistance in PCR screening by H. Sternberg is greatly appreciated.
References Betancourt, O.H., Attal, J., Theron, M.C., Puissant, C. and Houdebine, L.M., 1993. Efficiency of introns from various origins in fish cells. Mol. Mar. Biol. Biotechnol., 2: 181-188. Gulp, P., Ntisslein-Volhard, C. and Hopkins, N. 199 1. High-frequency germ-line transmission of plasmid DNA sequences injected into fertilized zebrafish eggs, Proc. Nat]. Acad. Sci. USA, 88: 7953-7957. Du, S.J., Gong, Z.,Fletcher,G.L., Shears, M.A., King, M.J., Idler, D.R. andHew, C.L., 1992. Growthenhancement in transgenic Atlantic salmon by the use of an “all-fish” chimeric growth hormone gene construct. Bio/ Technology. IO: 176-181. Fletcher. G.L. and Davies, P.L., I99 1. Transgenic fish for aquaculture. Gen. Eng., 13: 33 ll370.
B. Mouv et al. /Ayuaculture
137 (1995) 179-185
185
Guyomard. R.. Chourrout, D., Leroux, C., Houdebine, L.M. and Pourrain, F., 1989. Integration and germline transmission of foreign genes microinjected into fertilized trout eggs. Biochimie 7 I: 857-863. Hackett, P.B., 1993. The molecular biology oftransgenic fish. In: P.W. Hochachkaand T.P. Mommsen (Editors), Biochemistry and Molecular Biology of Fishes, Vol. 2. Elsevier, Amsterdam, pp. 207-239. Hew. CL.. Trink, K.Y.. Du, S.J. and Song, S., 1989. Molecular cloning and expression of salmon pituitary hormones. Fish. Physiol. Biochem., 7: 375-380. Hew. CL. and Fletcher, G.L. (Editors), 1992. Transgenic Fish. World Sci. Publ., Singapore, 274 pp. Liu, Z.. Moav, B., Faras, A.J., Guise, K.S., Kapuscinski, A.R. and Hackett, P.B., 1990a. Development ofexpression vectors for transgenic fish. Bio/TechnoIogy, 8: 1268-1272. Liu, Z.. Moav, B.. Faras, A.J., Guise, K.S., Kapuscinski, A.R. and Hackett, P.B., 1990b. Functional analysis of elements affecting expression of the l?-actin gene of carp. Mol. Cell. Biol., IO; 3432-3440. Liu, Z.. Zhu, Z.. Roberg, K., Faras, A.J.. Guise, KS., Kapuscinski, A.R. and Hackett, P.B., 1990~. Isolation and characterization of the l3-actin gene of carp (C.vprinus carpio) DNA Sequence, I : 125-136. Maclean, N. and Penman. D., 1990. The application of gene manipulation to aquaculture. Aquaculture, 85: I-20. Moav. B., Liu. Z.. Caldovic, L.D., Gross, M.L., Kapuscinski, A.R., Faras, A.J., Guise, K.S. and Hackett, P.B., 1992a. Expression of heterologous genes in transgenic fish. In: C. Hew and G.L. Fletcher (Editors), Transgenic Fish. World Sci. Pub., Singapore, pp. 121-140. Moav. B., Liu, Z.. Groll. Y. and Hackett, P.B., 1992b. Selection of promoters for transgenic fish. Mol. Mar. Biol. Biotech.. I: 338834.5. Moav. B.. Liu. Z., Caldovic, L.D.. Gross, M.L. and Hackett, P.B., 1993. Regulation of early expression of transgenes in developing fish. Transgen. Res., 2: 153-161. Penman, D.J., Beeching. A.J., Penn, S. and Maclean, N., 1990. Factors affecting survival and integration following microinjection of novel DNA into rainbow trout eggs. Aquaculture, 85: 35-50. Rothbard, S.. 198 1. Induced reproduction in cultivated cyprinids - the common carp and the group of Chinese carps. I. The technique of induction, spawning and hatching. Isr. J. Aquaculture-Bamidgeh, 33: 103-121, Shears, M.A., Fletcher, G.L., Hew. C.L., Gautheier. S. and Davies, P.L., 1991. Transfer, expression and stable inheritance of antifreeze protein genes in Atlantic salmon (S&no s&r). Mol. Mar. Biol. Biotechnol., 1: 5863. Stuart, G.W., McMurray, J.V. and Westerfield, M., 1988. Replication, integration, and stable germ-line transmission of foreign sequences injected into early zebrafish embryos. Development, 103: 403412. Stuart, G.W.. McMurray. J.V. and Westerfield, M., 1990. Stable lines of transgenic zebrafish exhibit reproduction patterns of transgene expression. Development, 109: 577-584. Tewari. R., Michard-Vanhee, C., Perrot, E. and Chourrout, D., 1992. Mendelian transmission, structure and expression of transgenes following their injection into the cytoplasm of trout eggs. Transgen. Res., 1: 250260. Winkler, C.. Hong, Y., Wittbrodt, J. and Schartl, M., 1992. Analysis of heterologous and homologous promoters and enhancers in vitro and in vivo by gene transfer into Japanese medaka (0~~ricr.y [utipes) and Xiphophorus. Mol. Mar. Biol. Biotechnol., 1: 326-337. Zhang, P., Hayat, M., Joyce, C., Gonzalez-Villasenor, L.I., Lin, CM., Dunham, R.A., Chen, T.T. and Powers, D.A., 1990. Gene transfer, expression and inheritance of pRSV-rainbow trout&H cDNA in the common carp, C\~J&LI.S ctrr@ (Linnaeus), Mol. Rep. Dev., 25: 3-l 3.