- Email: [email protected]
Inhibition of MDM2 expression by rosmarinic acid in TSLP-stimulated mast cell
European Journal of Pharmacology 771 (2016) 191–198
Contents lists available at ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Immunopharmacology and inflammation
Inhibition of MDM2 expression by rosmarinic acid in TSLP-stimulated mast cell Myoung-schook Yoou a, Chan Lee Park a, Min-Ho Kim b,n, Hyung-Min Kim a,n, Hyun-Ja Jeong c,n a
Department of Pharmacology, College of Korean Medicine, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul 130-701, Republic of Korea Department of Computer Aided Mechanical Engineering, Sohae College, Jeonbuk, Gunsan 573-717, Republic of Korea c Department of Food Technology and Inflammatory Disease Research Center, Hoseo University, 20, Hoseo-ro 79beon-gil, Baebang-eup, Asan, Chungcheongnam-do 336-795, Republic of Korea b
art ic l e i nf o
a b s t r a c t
Article history: Received 12 May 2015 Received in revised form 30 November 2015 Accepted 11 December 2015 Available online 13 December 2015
Rosmarinic acid (RA) has an anti-inflammatory property while thymic stromal lymphopoietin (TSLP) has an important role in mast cell-mediated inflammatory responses. Thus, the aim of this study was to determine the regulatory effect of RA in TSLP-stimulated human mast cell line, HMC-1 cells, and short ragweed pollen-induced allergic conjunctivitis mouse model. As a result, we found that RA significantly decreased the TSLP-induced mast cell proliferation and murine double minute (MDM) 2 expression. RA significantly decreased the levels of interleukin (IL)-13 and phosphorylated the signal transducer and activation of transcription 6 in the TSLP-stimulated HMC-1 cells. RA induced the increment of p53 levels, caspase-3 activation, and poly-ADP-ribose polymerase cleavage and the reduction of the procaspase-3 and Bcl2. RA significantly reduced the production of tumor necrosis factor-α, IL-1β, and IL-6 on the TSLPstimulated HMC-1 cells. In addition, RA significantly reduced the levels of IgE, IL-4, and TSLP in the short ragweed pollen-induced allergic conjunctivitis mouse model. In conclusion, the results of the study suggest that RA has a significant anti-inflammatory effect on TSLP-induced inflammatory reactions. These effects of RA are likely to be mediated through inhibiting the MDM2 increased by TSLP. & 2015 Elsevier B.V. All rights reserved.
Keywords: Rosmarinic acid Thymic stromal lymphopoietin Murine double minute 2 Signal transducer and activator of transcription 6 Interleukin-13
1. Introduction Allergic responses happen in rodents, avian species, humans, non-human primates, and all of the domestic animals. These responses are arbitrated by IgE antibody that bind to FcεRI (mast cells surface marker) of mast cells and induce release or synthesis of potent inflammatory mediators (Gershwin, 2015). Mast cells are originated from hematopoietic progenitor cells and mature in local tissues, such as skin, mucosal surfaces, connective tissues, and vascularized tissues (Metz et al., 2007). Mast cells act important roles in allergic responses because they release histamine, prostaglandins, leukotrienes, and inflammatory cytokines (Jeong et al., 2002). Mast cells degranulation was required for the enhanced expression and production of thymic stromal lymphopoietin (TSLP), which are required for the optimal orchestration and priming of type 2 immunity (Hepworth et al., 2012). TSLP is known to have broad-ranging effects on immune cells including basophils, dendritic cells, mast cells, B cells, epithelial cells, and T cells n
Corresponding authors. E-mail addresses: [email protected] (M.-H. Kim), [email protected] (H.-M. Kim), [email protected] (H.-J. Jeong). http://dx.doi.org/10.1016/j.ejphar.2015.12.025 0014-2999/& 2015 Elsevier B.V. All rights reserved.
(Lo Kuan and Ziegler, 2014). TSLP promotes mast cell proliferation via the regulation of apoptotic and anti-apoptotic factors by murine double minute 2 (MDM2) (Han et al., 2014). MDM2 works as a specific inhibitor of p53 during embryonic development (Toledo and Wahl, 2007). Inhibition of MDM2 blocked cellular proliferation and migration. In addition, inflammatory responses were attenuated by inhibition of MDM2 levels (Hashimoto et al., 2011; Han et al., 2014). Rosmarinic acid (RA, an ester of caffeic acid and 3,4-dihydroxyphenyl lactic acid) is broadly distributed in diverse plants. RA has various pharmacological and biological activities including antiinflammatory effect, slowing the development of Alzheimer's disease, cognitive-enhancing effects, and cancer chemoprotection (Khojasteh et al., 2014). However, the effect of RA on inflammatory reactions by TSLP has not yet been clarified. Therefore, we investigated the effect and regulatory mechanism of RA on TSLPstimulated human mast cell line, HMC-1 cells and short ragweed (SRW) pollen-induced experimental allergic conjunctivitis (EAC) mouse model.
192
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
2. Material and methods 2.1. Reagents We purchased Isocove's modified Dulbecco's medium (IMDM) from Gibco BRL (Grand Island, NY, USA); 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT), anti-phospho- signal transducer and activator of transcription 6 (pSTAT6), lipopolysaccharide (LPS), dexamethasone (DEX), and RA (purity:97%) from Sigma Chemical Co (St. Louis, MO, USA); VGX-1027 from Abcam (Cambridge, UK); bromodeoxyuridine (BrdU) from Roche Diagnostics (Mannheim, Germany); Recombinant TSLP, caspase-3 assay kit, interleukin (IL)-13, tumor necrosis factor (TNF)-α, IL-6, and IL1β antibodies from R&D Systems, Inc. (Minneapolis, MN, USA); Bcl2, procaspase-3, Poly-ADP-ribose polymerase (PARP), MDM2, and actin from Santa Cruz Biotechnology (Dallas, TX, USA). RA was dissolved in distilled water and diluted with IMDM.
transcribed to cDNA for 60 min at 42 °C using a cDNA synthesis kit (iNtRON Biotech, Sungnam, Korea). Quantitative real-Time PCR was performed using a SYBR Green master mix and the detection of mRNA was analyzed using an ABI StepOne real-time PCR System (Applied Biosystems, Foster City, CA, USA). We performed realtime with the following primers: IL-13 (5′ GCCCTGGAATCCCTGATCA 3′; 5′ GCTCAGCAT CCTCTGGGTCTT 3′; GAPDH (5′ TCGACAGTCAGCCGCATCTTCTTT 3′; 5′ ACCAAA TCCGTTGACTCCGACCTT 3′). The level of the target mRNA was normalized to the level of the GAPDH and compared with the control. All data were analyzed using the ΔΔCT method. 2.8. Caspase-3 assay The enzymatic activity of caspase-3 was assayed using a colorimetric assay kit (R&D Systems) according to the manufacturer's protocol.
2.2. HMC-1 cells culture
2.9. Murine model of EAC induced by SRW pollen
HMC-1 cells were incubated in IMDM supplemented with 100 units/ml of penicillin, 100 μg/ml of streptomycin, and 10% fetal bovine serum at 37 °C in 5% CO2 with 95% humidity.
Eight-week-old female BALB/c mice from the Dae-Han Experimental Animal Center (Eumsung, Republic of Korea) were maintained under pathogen-free conditions. The mouse care and experimental procedures were performed with the approval of the Animal Care Committee of Kyung Hee University (KHUASP [SE]12–019). The EAC model was induced according to previous report (Li et al., 2011). In brief, the mice were immunized with 50 μg of SRW pollen (Cosmo Bio, Japan) in 5 mg of Imject Alum (Pierce Biotechnology, Rockford, USA) by means of footpad injection on day 0. Allergic conjunctivitis was induced by means of topically applying 0.15 mg of SRW pollen suspended in 10 μl of PBS into each eye once a day from days 10 to 12. PBS eye drop-treated SRWsensitized mice were used as control animals. RA was prepared at a dose of 4 mg/kg, which is similar to a previous report (Oh et al., 2011). DEX and VGX-1024 were used as positive control drugs. RA (4 mg/kg), DEX (5 mg/kg), or VGX-1027 (20 mg/kg) was administrated by intraperitoneal (i.p.) injection 1 h before the SRW pollen challenge. On day 13, 24 h after the last SRW challenge, the serum and whole eyes were harvested for gene expression assays.
2.3. BrdU assay Cell (1 104) proliferation was determined using a colorimetric immunoassay based on the measurement of BrdU incorporated by DNA synthesis (Roche Diagnostics GmbH, Mannheim, Germany). 2.4. Western blot analysis The stimulated cells were lysed and separated through 10% SDS-PAGE. After electrophoresis, the protein was transferred to nitrocellulose membranes and then the membranes were blocked and incubated with primary (1:500 dilution in PBST) and secondary (1:3000 dilution in PBST) antibodies. Finally, the protein bands were visualized by an enhanced chemiluminesence assay (Amersham Co. Newark, NJ, USA) according to manufacturer's instructions.
2.10. Statistics 2.5. MTT assay Cell viability was measured by a MTT assay. Briefly, 500 ml of HMC-1 cell (3 105) were pretreated with diverse concentrations of RA for 1 h and stimulated with TSLP for 48 h. The cell suspension containing MTT solution (5 mg/ml) was incubated at 37 °C for an additional 4 h. After washing the supernatant out, the insoluble formazan product was dissolved in dimethyl sulfoxide. Then, the optical density of 96-well culture plate was determined using an ELISA method reader at 540 nm. 2.6. Cytokines assay The levels of IL-13, TNF-α, IL-6, and IL-1β were determined using a sandwich ELISA method according to the manufacturer's instructions (R&D Systems). 2.7. RNA isolation and Quantitative Real-Time PCR Using an easy-BLUE™ RNA extraction kit (iNtRON Biotech, Sungnam, Korea), we isolated the total RNA from HMC-1 cells in accordance with the manufacturer's specifications. The concentration of total RNA in the final elutes was determined by spectrophotometry. Total RNA (2.5 μg) was heated at 75 °C for 5 min and then chilled on ice. Each sample was reverse-
All results are representative of three independent experiments with duplicate and expressed as the mean 7SEM. The statistical evaluation of the results was performed by an independent t-test and an ANOVA with a Tukey posthoc test using SPSS statistical software (IBM Corporation, Armonk, NY, USA). Results with a Pvalue of o0.05 were considered significant.
3. Results 3.1. Inhibitory effect of RA on the mast cell proliferation and the MDM2 levels in the TSLP-stimulated HMC-1 The mast cell proliferation amplifies the inflammatory allergic response and was increased by TSLP (Han et al., 2014). Thus, we investigated the effect of RA in the TSLP-induced mast cell proliferation. To determine the regulatory effect of RA on the proliferation of HMC-1 cells, a BrdU assay was performed. As shown in Fig. 1A, RA significantly attenuated the TSLP-induced proliferation of HMC-1 cells. We also evaluated the inhibitory effect of RA on the level of MDM2 in the TSLP-stimulated HMC-1 cells. As a result, the levels of MDM2 increased by TSLP were significantly decreased by RA (Fig. 1B and C, P o0.05). Cytotoxicity did not observe at doses of 0.1, 1, and 10 μM of RA (Fig. 1D).
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
Fig. 1. Inhibitory effect of RA on the mast cell proliferation and the MDM2 levels in the TSLP-stimulated HMC-1. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 48 h. BrdU incorporation assay was performed. (B) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 8 h. The levels of MDM2 were analyzed by Western blotting. (C) The relative intensities of protein levels were quantified by densitometry. (D) Cytotoxicity was measured by MTT assay. #P o 0.05; significantly different from the unstimulated cells,*Po 0.05, significantly different from the TSLP-stimulated cells. RA, rosmarinic acid.
193
Fig. 2. Inhibitory effect of RA on the levels of IL-13 in the TSLP-stimulated HMC-1 cells. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 8 h. The IL-13 production in the supernatant was analyzed by ELISA method. (B) IL-13 mRNA was analyzed by real-time PCR. (C) HMC-1 cells were pretreated with RA (10 μM), VGX-1027 (10 μg/ml), or RA (10 μM) and VGX1027 (10 μg/ml) and then stimulated with TSLP (20 ng/ml) for 8 h or LPS (100 ng/ ml) for 24 h. The IL-13 production in the supernatant was analyzed by ELISA method. #Po 0.05; significantly different from the unstimulated cells,*P o0.05, significantly different from the TSLP/LPS-stimulated cells. RA, rosmarinic acid; Blank, unstimulated cells; Control, TSLP/LPS-stimulated cells.
3.2. Inhibitory effect of RA on the levels of IL-13 in the TSLP-stimulated HMC-1 cells IL-13 is known as a growth factor of the mast cell (Hu et al., 2007). Thus, we evaluated the regulatory effect of RA on the production of IL-13. TSLP significantly increased the production of IL-
194
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
13 in HMC-1 cells (Fig. 2A, P o0.05). However, RA significantly decreased the TSLP-induced IL-13 production (Fig. 2A, Po 0.05). The mRNA expression of IL-13 was analyzed using a real-time PCR. The mRNA expression of IL-13 was also significantly inhibited by RA in the TSLP-stimulated HMC-1 cells (Fig. 2B, P o0.05). The TSLP acted via toll-like receptor (TLR)4-dependent pathways (Li et al., 2011). To investigate the effects of RA on the TLR4-dependent pathways induced by LPS, HMC-1 cells were stimulated with LPS. We used VGX-1027 (TLR4 antagonist) as a positive control drug. TSLP or LPS significantly increased the IL-13 production, while RA or VGX-1027 significantly decreased the TSLP/LPS-induced IL-13 production (Fig. 2C, P o0.05). The synergic effect of RA and VGX1027 did not appear in the TSLP/LPS-induced IL-13 production (Fig. 2C). 3.3. Inhibitory effect of RA on the levels of pSTAT6 in the TSLP-stimulated HMC-1 cells In a previous study, we showed that mast cell proliferation was increased by phosphorylation of STAT6 in HMC-1 cells (Yoou et al., 2015). Thus, we evaluated the inhibitory effect of RA on the level of pSTAT6 in the TSLP-stimulated HMC-1 cells. As a result, the levels of pSTAT6 increased by TSLP were significantly decreased by RA (Fig. 3, P o0.05). 3.4. Regulatory effect of RA on the levels of p53 in the TSLP-stimulated HMC-1 cells As shown in Fig. 1A, RA reduced the TSLP-induced mast cell proliferation. MDM2 is a negative regulator of p53 protein (Gansmo et al., 2015). Thus, we hypothesized that RA might activate the apoptotic factor, p53 protein. As depicted in Fig. 4, RA significantly increased the levels of p53 in the TSLP-stimulated HMC-1 cells (P o0.05).
Fig. 4. Regulatory effect of RA on the levels of p53 in the TSLP-stimulated HMC-1 cells. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 48 h. The level of p53 was analyzed by Western blotting. (B) The relative intensities of protein levels were quantified by densitometry. # Po 0.05; significantly different from the unstimulated cells,*P o 0.05, significantly different from the TSLP-stimulated cells. RA, rosmarinic acid.
3.5. Regulatory effect of RA on the levels of caspase-3 and Bcl2 in the TSLP-stimulated HMC-1 cells TSLP increased the anti-apoptotic factors and decreased the apoptotic factors (Han et al., 2014; Yoou et al., 2015). Thus, we studied whether RA would regulate the level of apoptotic and antiapoptotic factors in the TSLP-stimulated HMC-1 cells. As shown in Fig. 5A–C, RA significantly increased the activity of caspase-3 and significantly decreased the level of procaspase-3 (P o0.05) in the TSLP-stimulated HMC-1 cells (Po 0.05). RA also significantly increased the level of PARP cleavage in the TSLP-stimulated HMC-1 cells (Fig. 5B and C, P o0.05). Finally, we investigated the regulatory effect of RA on the level of Bcl2, anti-apoptotic factor. RA significantly decreased the level of Bcl2 in the TSLP-stimulated HMC-1 cells (Fig. 5D and E, P o0.05). 3.6. Inhibitory effect of RA on the levels of inflammatory cytokines in the TSLP-stimulated HMC-1 cells Mast cells accelerate inflammatory response through secretory action of cytokines (Amin, 2012). In this study, we evaluated the inhibitory effects of RA on the production of proinflammatory cytokines (TNF-α, IL-1β, and IL-6). The production of TNF-α, IL-1β, and IL-6 was increased in TSLP-stimulated HMC-1 cells (Fig. 6, Po 0.05). The up-regulation of TNF-α, IL-1β, and IL-6 by TSLP were reduced by RA (Fig. 6, P o0.05). 3.7. Inhibitory effect of RA on an EAC murine model induced by SRW pollen
Fig. 3. Inhibitory effect of RA on the levels of pSTAT6 in the TSLP-stimulated HMC-1 cells. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 8 h. The levels of pSTAT6 were analyzed by Western blotting. (B) The relative intensities of protein levels were quantified by densitometry. #P o 0.05; significantly different from the unstimulated cells, *P o0.05, significantly different from the TSLP-stimulated cells. RA, rosmarinic acid.
We investigated the regulatory effects of RA on an EAC murine model induced by SRW pollen. The levels of serum IgE, TSLP, and IL-4 significantly increased in the EAC mice (Fig. 7A–C, P o0.05). However, the increased serum IgE and TSLP levels were
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
195
Fig. 5. Regulatory effect of RA on the levels of caspase-3 and Bcl2 in the TSLP-stimulated HMC-1 cells. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 48 h. The caspase-3 activity was assayed using a caspase-3 colorimetric assay kit. (B)The levels of procaspase-3 and PARP cleavage were analyzed by Western blotting. (C) The relative intensities of protein levels were quantified by densitometry. (D) The levels of Bcl2 were analyzed by Western blotting. (E) The relative intensities of protein levels were quantified by densitometry. #P o 0.05; significantly different from the unstimulated cells,*P o0.05, significantly different from the TSLP-stimulated cells. RA, rosmarinic acid.
significantly decreased by RA, DEX, or VGX-1027 (Fig. 7A–C, P o0.05). The levels of TSLP and IL-4 in eye tissues were also reduced by RA, DEX, or VGX-1024 in the EAC mice (Fig. 7D and E, P o0.05).
4. Discussion RA has played a vital role in anti-proliferation, anti-inflammation, anti-atopic dermatitis, and anti-tumor in various in vivo and in vitro experiments (Hajhosseini et al., 2013; Jang et al., 2011). In this study, we hypothesized that RA could reduce the TSLP-induced mast cell proliferation. This study shows the first evidence that RA has an anti-allergic inflammatory effect through downregulating MDM2 in the TSLP-stimulated HMC-1 cells and inhibiting TSLP levels in the EAC in vivo model. Mast cells have also played a vital role in immediate and inflammatory allergic reactions. They can produce potent inflammatory mediators, such as proteases, histamine, chemotactic
factors, metabolites of arachidonic acid, and cytokines that work on the connective tissue, mucous glands, vasculature, smooth muscles, and inflammatory cells (Amin, 2012). In addition to these direct effector functions, activated mast cells can rapidly recruit other innate and adaptive immune cells and participate in the “tuning” of the immune response (DeBruin et al., 2015). During allergic inflammatory responses, TSLP is released from stromal cells, epithelial cells, dendritic cells, keratinocytes, and mast cells (Ziegler et al., 2013). TSLP also accelerates the mast cell-mediated allergic inflammatory reactions (Han et al., 2014). In a previous study, we indicated that TSLP increases the mast cell proliferation and MDM2 is necessary to proliferate mast cells by TSLP (Han et al., 2014). MDM2 encourages cancer cell growth and survival by degrading the cell cycle regulator p53 (Mulay et al., 2012). TSLPinduced mast cell proliferation was eliminated by MDM2 deficiency (Han et al., 2014). In this study, we showed that RA inhibited the TSLP-induced mast cell proliferation and MDM2 expression. IL-13 functions as a major inducer of bronchial inflammation,
196
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
Fig. 6. Inhibitory effect of RA on the levels of inflammatory cytokines in the TSLPstimulated HMC-1 cells. HMC-1 Cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 8 h. (A–C) The levels of cytokines in culture supernatants were measured by ELISA method. #Po 0.05; significantly different from unstimulated cells, *Po 0.05; significantly different from the TSLPstimulated cells. RA, rosmarinic acid.
which has prompted efforts to develop therapeutics that specifically block this pathway (Healey et al., 2014). IL-13 can bind to two distinct receptors: the heterodimers of IL-13Rα1/IL-4Rα and IL13Rα2. IL-13Rα1/IL-4Rα engagement by IL-13 can lead to the activation of STAT6 (Chandriani et al., 2014). IL-13 can induce hypersensitivity in the airways and increase the production of mucus, level of IgE, and numbers of eosinophils (Takeuchi et al., 2015). Stimulated mast cells can synthesize IL-13 mRNA and protein (Burd et al., 1995). The effect of IL-13 is mainly mediated by the STAT6 signaling pathway (Bang et al., 2013). STAT6 functions as a signaling molecule and transcription factor. Also, STAT6 is an
upstream activator of MDM2. STAT6 plays a key role in the TH2 polarization of the immune system and increases allergic inflammatory reactions (Hebenstreit et al., 2006). Interestingly, the phosphorylation of STAT6 increases MDM2 mRNA expression whereas STAT6-deficient cells decreased MDM2 mRNA expression (Li et al., 2008). In our previous study, we reported that the STAT6 inhibitor inhibited the TSLP-induced MDM2 expression in HMC-1 cells. The mRNA expression of MDM2 was less in the TSLP-/- and STAT6-/- mice (Han et al., 2014). In the present study, we found that RA significantly decreased the IL-13 and pSTAT6 levels in the TSLP-stimulated HMC-1 cells. Therefore, these results indicate that RA reduced the mast cell proliferation through down-regulating the MDM2 and IL-13 by inhibiting pSTAT6. VGX-1027 is an isoxazoline compound currently under development for the treatment of immune-inflammatory and autoimmune diseases (Mangano et al., 2008a, b; Stojanovic et al., 2007; Stosic-Grujicic et al., 2007). It has been shown to be effective in fighting against inflammatory illnesses originating from the TLR4dependent problem by specifically inhibiting the TLR4 (Fagone et al., 2014; Cha et al., 2013). In this study, we observed that RA or VGX-1027 reduced the LPS-induced IL-13 production. However, there was no synergic effect between RA and VGX-1027 in the LPSinduced IL-13 production. Therefore, our results assumed that the effect of RA is similar to the mechanism of VGX-1027. However, further study is needed to elucidate the effect and mechanism of RA on the TLR4 signaling pathways. In regular cell development, the p53 protein is not necessary and it presents lower cellular levels. Because of its short half-life, the p53 protein maintains the integrity of the genome, controls the cell cycle, and promotes apoptosis (Kim and Baek, 2006). It also has negative effects on cell proliferation by cell cycle block between the G1 and S phases (Girod et al., 1998). An increased MDM2 can disturb the induction of p53 genes that are required to initiate apoptosis and directly activate the cell cycle (Allam et al., 2011; Sikdar and Khuda-Bukhsh, 2013). Interestingly, TSLP increases anti-apoptotic factors (MDM2 and IL-13) and decreases apoptotic factors (p53 and caspase-3) (Han et al., 2014). The regulation of apoptosis and cell survival is also regulated by the Bcl-2 family that consists of pro/anti-apoptotic proteins (Westerberg et al., 2015). Among the caspases, caspase-3 is involved in the proteolytic cleavage of PARP protein. An increased PARP is indicative of a greater extent of DNA degradation. Therefore, caspase-3 and PARP are regarded as significant markers of apoptosis (Chakraborty et al., 2012). In a previous study, Zhang et al. (2011) reported that RA reduced the proliferation and increased apoptosis in hepatic stellate cells. In the present study, we found that RA increased the caspase-3 activation and PARP cleavage, and decreased procaspase-3 and Bcl2 levels in the TSLP-stimulated HMC1 cells. Therefore, we suggest that RA inhibits the TSLP-induced mast cell proliferation by increasing apoptosis and decreasing anti-apoptosis. Since TNF-α, IL-1β, IL-6, and other mediators are important inflammatory molecules that induce abnormal cell proliferation. By “paracrine or autocrine” mechanism (Malcolm and Worthen, 2003), these mediators also can synthesize other cytokines and activate the signal transduction pathway in inflammatory cells (Chen et al., 2015). In a previous study, RA conferred protection to mice against acute lung injury induced by lipopolysaccharide through inhibiting the production of TNF-α, IL-1β, and IL-6 (Chu et al., 2012). In this study, we also showed that RA inhibits the overproduction of TNF-α, IL-1β, and IL-6 in TSLP- stimulated HMC1 cells. Therefore, we suggest that the anti-inflammatory effects of RA might originate from the inhibitory action of the TSLP-induced inflammatory cytokines. The SRW pollen, which acts as a functional TLR4 agonist, initiates TLR4-dependent TSLP/OX40L/OX40 signaling pathways that
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
197
Fig. 7. Inhibitory effect of RA on an EAC murine model induced by SRW pollen. RA (4 mg/kg), DEX (5 mg/kg), and VGX-1027 (20 mg/kg) was administrated by i.p. injection on 1 h before SRW pollen challenge. The levels (ng/ml) of serum IgE (A), TSLP (B), and IL-4 (C) and the levels (ng/mg protein) of eye tissue TSLP (D) and IL-4 (E) were analyzed by ELISA method. #Po 0.05; significantly different from unstimulated cells, *P o0.05; significantly different from the EAC murine model induced by SRW pollen. RA, rosmarinic acid; DEX, dexamethasone.
trigger TH2-dominant allergic inflammation (Li et al., 2011). The SRW pollen stimulated TSLP production by ocular epithelia in wild-type mice, but not on Tlr4 deficient or MyD88 / mice. In the present study, we showed that the levels of IgE, TSLP, and IL-4 increased in the SRW pollen-induced EAC mice. RA, DEX, and VGX1027 significantly decreased the SRW pollen-induced the levels of IgE, TSLP, and IL-4. Therefore, we suggest that RA has an anti-allergic inflammatory effect through inhibiting TSLP signaling pathways. The typical signs of allergic conjunctivitis are lid edema, tearing, chemosis, redness, and itching of the eye lids (Li et al., 2011). In this study, we did not analyze clinical symptoms such as redness, itching behavior, lid edema, tearing, and chemosis. Therefore, further investigations are required in order to elucidate the effect of RA on the clinical symptoms of the EAC model.
5. Conclusion In this study, we observed for the first time that RA suppresses the TSLP-induced mast cell proliferation through down-regulating MDM2 and up-regulating p53. RA induced the activation of caspase-3 and decreased the levels of Bcl2. It also inhibited the production of proinflammatory cytokines and reduced the levels of IgE, TSLP, and IL-4 in the EAC in vivo model. Therefore, our studies indicate that RA can be applied to the treatment of allergic inflammatory diseases caused by an increase in the number of mast cells. Conflict of interest The authors state no conflict of interest.
198
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
Acknowledgment This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2015R1A1A3A04000922).
References Allam, R., Sayyed, S.G., Kulkarni, O.P., Lichtnekert, J., Anders, H.J., 2011. Mdm2 promotes systemic lupus erythematosus and lupus nephritis. J. Am. Soc. Nephrol. 22, 2016–2027. Amin, K., 2012. The role of mast cells in allergic inflammation. Respir. Med. 106, 9–14. Bang, B.R., Lee, H.S., Lee, S.Y., Chun, E., Kim, Y.K., Cho, S.H., Min, K.U., Kim, Y.Y., Park, H.W., 2013. IL-13 and STAT6 signaling involve in low dose lipopolysaccharide induced murine model of asthma. Asia Pac. Allergy 3, 194–199. Burd, P.R., Thompson, W.C., Max, E.E., Mills, F.C., 1995. Activated mast cells produce interleukin 13. J. Exp. Med. 181, 1373–1380. Cha, J.J., Hyun, Y.Y., Lee, M.H., Kim, J.E., Nam, D.H., Song, H.K., Kang, Y.S., Lee, J.E., Kim, H.W., Han, J.Y., Cha, D.R., 2013. Renal protective effects of toll-like receptor 4 signaling blockade in type 2 diabetic mice. Endocrinology 154, 2144–2155. Chakraborty, D., Bishayee, K., Ghosh, S., Biswas, R., Mandal, S.K., Khuda-Bukhsh, A. R., 2012. [6]-Gingerol induces caspase 3 dependent apoptosis and autophagy in cancer cells: drug-DNA interaction and expression of certain signal genes in HeLa cells. Eur. J. Pharmacol. 694, 20–29. Chandriani, S., DePianto, D.J., N’Diaye, E.N., Abbas, A.R., Jackman, J., Bevers 3rd, J., Ramirez-Carrozzi, V., Pappu, R., Kauder, S.E., Toy, K., Ha, C., Modrusan, Z., Wu, L. C., Collard, H.R., Wolters, P.J., Egen, J.G., Arron, J.R., 2014. Endogenously expressed IL-13Rα2 attenuates IL-13-mediated responses but does not activate signaling in human lung fibroblasts. J. Immunol. 193, 111–119. Chen, J.Y., Wu, H., Li, H., Hu, S.L., Dai, M.M., Chen, J., 2015. Anti-inflammatory effects and pharmacokinetics study of geniposide on rats with adjuvant arthritis. Int. Immunopharmacol. 24, 102–109. Chu, X., Ci, X., He, J., Jiang, L., Wei, M., Cao, Q., Guan, M., Xie, X., Deng, X., He, J., 2012. Effects of a natural prolyl oligopeptidase inhibitor, rosmarinic acid, on lipopolysaccharide-induced acute lung injury in mice. Molecules 17, 3586–3598. DeBruin, E.J., Gold, M., Lo, B.C., Snyder, K., Cait, A., Lasic, N., Lopez, M., McNagny, K. M., Hughes, M.R., 2015. Mast cells in human health and disease. Methods Mol. Biol. 1220, 93–119. Fagone, P., Muthumani, K., Mangano, K., Magro, G., Meroni, P.L., Kim, J.J., Sardesai, N. Y., Weiner, D.B., Nicoletti, F., 2014. VGX-1027 modulates genes involved in lipopolysaccharide-induced Toll-like receptor 4 activation and in a murine model of systemic lupus erythematosus. Immunology 142, 594–602. Gansmo, L.B., Knappskog, S., Romundstad, P., Hveem, K., Vatten, L., Lønning, P.E., 2015. Influence of MDM2 SNP309 and SNP285 Status on the risk of cancer in the breast, prostate, lung and colon. Int. J. Cancer 137, 96–103. Gershwin, L.J., 2015. Comparative immunobiology of allergic responses. Annu. Rev. Anim. Biosci. 3, 327–346. Girod, S.C., Pfeiffer, P., Ries, J., Pape, H.D., 1998. Proliferative activity and loss of function of tumour suppressor genes as’‘biomarkers’ in diagnosis and prognosis of benign and preneoplastic oral lesions and oral squamous cell carcinoma. Br. J. Oral. Maxillofac. Surg. 36, 252–260. Hajhosseini, L., Khaki, A., Merat, E., Ainehchi, N., 2013. Effect of rosmarinic acid on sertoli cells apoptosis and serum antioxidant levels in rats after exposure to electromagnetic fields. Afr. J. Tradit. Complement. Altern. Med. 10, 477–480. Han, N.R., Oh, H.A., Nam, S.Y., Moon, P.D., Kim, D.W., Kim, H.M., Jeong, H.J., 2014. TSLP induces mast cell development and aggravates allergic reactions through the activation of MDM2 and STAT6. J. Investig. Dermatol. 134, 2521–2530. Hashimoto, T., Ichiki, T., Ikeda, J., Narabayashi, E., Matsuura, H., Miyazaki, R., Inanaga, K., Takeda, K., Sunagawa, K., 2011. Inhibition of MDM2 attenuates neointimal hyperplasia via suppression of vascular proliferation and inflammation. Cardiovasc. Res. 91, 711–719. Healey, G.D., Lockridge, J.A., Zinnen, S., Hopkin, J.M., Richards, I., Walker, W., 2014. Development of pre-clinical models for evaluating the therapeutic potential of candidate siRNA targeting STAT6. PLoS One 9, e90338. Hebenstreit, D., Wirnsberger, G., Horejs-Hoeck, J., Duschl, A., 2006. Signaling mechanisms, interaction partners, and target genes of STAT6. Cytokine Growth Factor Rev. 17, 173–188. Hepworth, M.R., Maurer, M., Hartmann, S., 2012. Regulation of type 2 immunity to
helminths by mast cells. Gut Microbes 3, 476–481. Hu, Z.Q., Zhao, W.H., Shimamura, T., 2007. Regulation of mast cell development by inflammatory factors. Curr. Med. Chem. 14, 3044–3050. Jang, A.H., Kim, T.H., Kim, G.D., Kim, J.E., Kim, H.J., Kim, S.S., Jin, Y.H., Park, Y.S., Park, C.S., 2011. Rosmarinic acid attenuates 2,4-dinitrofluorobenzene-induced atopic dermatitis in NC/Nga mice. Int. Immunopharmacol. 11, 1271–1277. Jeong, H.J., Koo, H.N., Na, H.J., Kim, M.S., Hong, S.H., Eom, J.W., Kim, K.S., Shin, T.Y., Kim, H.M., 2002. Inhibition of TNF-alpha and IL-6 production by Aucubin through blockade of NF-kappaB activation RBL-2H3 mast cells. Cytokine 18, 252–259. Khojasteh, A., Mirjalili, M.H., Hidalgo, D., Corchete, P., Palazon, J., 2014. New trends in biotechnological production of rosmarinic acid. Biotechnol. Lett. 36, 2393–2406. Kim, K.I., Baek, S.H., 2006. SUMOylation code in cancer development and metastasis. Mol. Cells 22, 247–253. Li, B.H., Yang, X.Z., Li, P.D., Yuan, Q., Liu, X.H., Yuan, J., Zhang, W.J., 2008. IL-4/Stat6 activities correlate with apoptosis and metastasis in colon cancer cells. Biochem. Biophys. Res. Commun. 369, 554–560. Li, D.Q., Zhang, L., Pflugfelder, S.C., De Paiva, C.S., Zhang, X., Zhao, G., Zheng, X., Su, Z., Qu, Y., 2011. Short ragweed pollen triggers allergic inflammation through toll-like receptor 4-dependent thymic stromal lymphopoietin/OX40 ligand/ OX40 signaling pathways. J. Allergy Clin. Immunol. 128, 1318–1325. Lo Kuan, E., Ziegler, S., 2014. Thymic stromal lymphopoietin and cancer. J. Immunol. 193, 4283–4288. Malcolm, K.C., Worthen, G.S., 2003. Lipopolysaccharide stimulates p38-dependent induction of antiviral genes in neutrophils independently of paracrine factors. J. Biol. Chem. 278, 15693–15701. Mangano, K., Sardesai, N., D’Alcamo, M., Libra, M., Malaguarnera, L., Donia, M., Bendtzen, K., Meroni, P., Nicoletti, F., 2008a. In vitro inhibition of enterobacteria-reactive CD4 þCD25-T cells and suppression of immunoinflammatory colitis in mice by the novel immunomodulatory agent VGX-1027. Eur. J. Pharmacol. 586, 313–321. Mangano, K., Sardesai, N.Y., Quattrocchi, C., Mazzon, E., Cuzzocrea, S., Bendtzen, K., Meroni, P.L., Kim, J.J., Nicoletti, F., 2008b. Effects of the immunomodulator, VGX1027, in endotoxin-induced uveitis in Lewis rats. Br. J. Pharmacol. 155, 722–730. Metz, M., Grimbaldeston, M.A., Nakae, S., Piliponsky, A.M., Tsai, M., Galli, S.J., 2007. Mast cells in the promotion and limitation of chronic inflammation. Immunol. Rev. 217, 304–328. Mulay, S.R., Thomasova, D., Ryu, M., Anders, H.J., 2012. MDM2 (murine double minute-2) links inflammation and tubular cell healing during acute kidney injury in mice. Kidney. Int. 81, 1199–1211. Oh, H.A., Park, C.S., Ahn, H.J., Park, Y.S., Kim, H.M., 2011. Effect of Perilla frutescens var. acuta Kudo and rosmarinic acid on allergic inflammatory reactions. Exp. Biol. Med. 236, 99–106. Sikdar, S., Khuda-Bukhsh, A.R., 2013. Alternative drug therapies are superior to epidermal growth factor receptor-targeted chemotherapeutic drug responses in non-small cell lung cancer. TANG 3, e10. Stojanovic, I., Cuzzocrea, S., Mangano, K., Mazzon, E., Miljkovic, D., Wang, M., Donia, M., Al Abed, Y., Kim, J., Nicoletti, F., Stosic-Grujicic, S., Claesson, M., 2007. In vitro, ex vivo and in vivo immunopharmacological activities of the isoxazoline compound VGX-1027: modulation of cytokine synthesis and prevention of both organ-specific and systemic autoimmune diseases in murine models. Clin. Immunol. 123, 311–323. Stosic-Grujicic, S., Cvetkovic, I., Mangano, K., Fresta, M., Maksimovic-Ivanic, D., Harhaji, L., Popadic, D., Momcilovic, M., Miljkovic, D., Kim, J., Al-Abed, Y., Nicoletti, F., 2007. A potent immunomodulatory compound, (S,R)-3-Phenyl-4,5dihydro-5-isoxazole acetic acid, prevents spontaneous and accelerated forms of autoimmune diabetes in NOD mice and inhibits the immunoinflammatory diabetes induced by multiple low doses of streptozotocin in CBA/H mice. J. Pharmacol. Exp. Ther. 320, 1038–1049. Takeuchi, M., Ohno, K., Takata, K., Gion, Y., Tachibana, T., Orita, Y., Yoshino, T., Sato, Y., 2015. Interleukin 13-positive mast cells are increased in immunoglobulin G4-related sialadenitis. Sci. Rep. 5, 7696. Toledo, F., Wahl, G.M., 2007. MDM2 and MDM4: p53 regulators as targets in anticancer therapy. Int. J. Biochem. Cell. Biol. 39, 1476–1482. Westerberg, C.M., Ekoff, M., Nilsson, G., 2015. Regulation of mast cell survival and apoptosis. Methods Mol. Biol. 1220, 257–267. Yoou, M.S., Kim, H.M., Jeong, H.J., 2015. Acteoside attenuates TSLP-induced mast cell proliferation via down-regulating MDM2. Int. Immunopharmacol. 26, 23–29. Zhang, J.J., Wang, Y.L., Feng, X.B., Song, X.D., Liu, W.B., 2011. Rosmarinic acid inhibits proliferation and induces apoptosis of hepatic stellate cells. Biol. Pharm. Bull. 34, 343–348. Ziegler, S.F., Roan, F., Bell, B.D., Stoklasek, T.A., Kitajima, M., Han, H., 2013. The biology of thymic stromal lymphopoietin (TSLP). Adv. Pharmacol. 66, 129–155.
Contents lists available at ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Immunopharmacology and inflammation
Inhibition of MDM2 expression by rosmarinic acid in TSLP-stimulated mast cell Myoung-schook Yoou a, Chan Lee Park a, Min-Ho Kim b,n, Hyung-Min Kim a,n, Hyun-Ja Jeong c,n a
Department of Pharmacology, College of Korean Medicine, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul 130-701, Republic of Korea Department of Computer Aided Mechanical Engineering, Sohae College, Jeonbuk, Gunsan 573-717, Republic of Korea c Department of Food Technology and Inflammatory Disease Research Center, Hoseo University, 20, Hoseo-ro 79beon-gil, Baebang-eup, Asan, Chungcheongnam-do 336-795, Republic of Korea b
art ic l e i nf o
a b s t r a c t
Article history: Received 12 May 2015 Received in revised form 30 November 2015 Accepted 11 December 2015 Available online 13 December 2015
Rosmarinic acid (RA) has an anti-inflammatory property while thymic stromal lymphopoietin (TSLP) has an important role in mast cell-mediated inflammatory responses. Thus, the aim of this study was to determine the regulatory effect of RA in TSLP-stimulated human mast cell line, HMC-1 cells, and short ragweed pollen-induced allergic conjunctivitis mouse model. As a result, we found that RA significantly decreased the TSLP-induced mast cell proliferation and murine double minute (MDM) 2 expression. RA significantly decreased the levels of interleukin (IL)-13 and phosphorylated the signal transducer and activation of transcription 6 in the TSLP-stimulated HMC-1 cells. RA induced the increment of p53 levels, caspase-3 activation, and poly-ADP-ribose polymerase cleavage and the reduction of the procaspase-3 and Bcl2. RA significantly reduced the production of tumor necrosis factor-α, IL-1β, and IL-6 on the TSLPstimulated HMC-1 cells. In addition, RA significantly reduced the levels of IgE, IL-4, and TSLP in the short ragweed pollen-induced allergic conjunctivitis mouse model. In conclusion, the results of the study suggest that RA has a significant anti-inflammatory effect on TSLP-induced inflammatory reactions. These effects of RA are likely to be mediated through inhibiting the MDM2 increased by TSLP. & 2015 Elsevier B.V. All rights reserved.
Keywords: Rosmarinic acid Thymic stromal lymphopoietin Murine double minute 2 Signal transducer and activator of transcription 6 Interleukin-13
1. Introduction Allergic responses happen in rodents, avian species, humans, non-human primates, and all of the domestic animals. These responses are arbitrated by IgE antibody that bind to FcεRI (mast cells surface marker) of mast cells and induce release or synthesis of potent inflammatory mediators (Gershwin, 2015). Mast cells are originated from hematopoietic progenitor cells and mature in local tissues, such as skin, mucosal surfaces, connective tissues, and vascularized tissues (Metz et al., 2007). Mast cells act important roles in allergic responses because they release histamine, prostaglandins, leukotrienes, and inflammatory cytokines (Jeong et al., 2002). Mast cells degranulation was required for the enhanced expression and production of thymic stromal lymphopoietin (TSLP), which are required for the optimal orchestration and priming of type 2 immunity (Hepworth et al., 2012). TSLP is known to have broad-ranging effects on immune cells including basophils, dendritic cells, mast cells, B cells, epithelial cells, and T cells n
Corresponding authors. E-mail addresses: [email protected] (M.-H. Kim), [email protected] (H.-M. Kim), [email protected] (H.-J. Jeong). http://dx.doi.org/10.1016/j.ejphar.2015.12.025 0014-2999/& 2015 Elsevier B.V. All rights reserved.
(Lo Kuan and Ziegler, 2014). TSLP promotes mast cell proliferation via the regulation of apoptotic and anti-apoptotic factors by murine double minute 2 (MDM2) (Han et al., 2014). MDM2 works as a specific inhibitor of p53 during embryonic development (Toledo and Wahl, 2007). Inhibition of MDM2 blocked cellular proliferation and migration. In addition, inflammatory responses were attenuated by inhibition of MDM2 levels (Hashimoto et al., 2011; Han et al., 2014). Rosmarinic acid (RA, an ester of caffeic acid and 3,4-dihydroxyphenyl lactic acid) is broadly distributed in diverse plants. RA has various pharmacological and biological activities including antiinflammatory effect, slowing the development of Alzheimer's disease, cognitive-enhancing effects, and cancer chemoprotection (Khojasteh et al., 2014). However, the effect of RA on inflammatory reactions by TSLP has not yet been clarified. Therefore, we investigated the effect and regulatory mechanism of RA on TSLPstimulated human mast cell line, HMC-1 cells and short ragweed (SRW) pollen-induced experimental allergic conjunctivitis (EAC) mouse model.
192
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
2. Material and methods 2.1. Reagents We purchased Isocove's modified Dulbecco's medium (IMDM) from Gibco BRL (Grand Island, NY, USA); 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT), anti-phospho- signal transducer and activator of transcription 6 (pSTAT6), lipopolysaccharide (LPS), dexamethasone (DEX), and RA (purity:97%) from Sigma Chemical Co (St. Louis, MO, USA); VGX-1027 from Abcam (Cambridge, UK); bromodeoxyuridine (BrdU) from Roche Diagnostics (Mannheim, Germany); Recombinant TSLP, caspase-3 assay kit, interleukin (IL)-13, tumor necrosis factor (TNF)-α, IL-6, and IL1β antibodies from R&D Systems, Inc. (Minneapolis, MN, USA); Bcl2, procaspase-3, Poly-ADP-ribose polymerase (PARP), MDM2, and actin from Santa Cruz Biotechnology (Dallas, TX, USA). RA was dissolved in distilled water and diluted with IMDM.
transcribed to cDNA for 60 min at 42 °C using a cDNA synthesis kit (iNtRON Biotech, Sungnam, Korea). Quantitative real-Time PCR was performed using a SYBR Green master mix and the detection of mRNA was analyzed using an ABI StepOne real-time PCR System (Applied Biosystems, Foster City, CA, USA). We performed realtime with the following primers: IL-13 (5′ GCCCTGGAATCCCTGATCA 3′; 5′ GCTCAGCAT CCTCTGGGTCTT 3′; GAPDH (5′ TCGACAGTCAGCCGCATCTTCTTT 3′; 5′ ACCAAA TCCGTTGACTCCGACCTT 3′). The level of the target mRNA was normalized to the level of the GAPDH and compared with the control. All data were analyzed using the ΔΔCT method. 2.8. Caspase-3 assay The enzymatic activity of caspase-3 was assayed using a colorimetric assay kit (R&D Systems) according to the manufacturer's protocol.
2.2. HMC-1 cells culture
2.9. Murine model of EAC induced by SRW pollen
HMC-1 cells were incubated in IMDM supplemented with 100 units/ml of penicillin, 100 μg/ml of streptomycin, and 10% fetal bovine serum at 37 °C in 5% CO2 with 95% humidity.
Eight-week-old female BALB/c mice from the Dae-Han Experimental Animal Center (Eumsung, Republic of Korea) were maintained under pathogen-free conditions. The mouse care and experimental procedures were performed with the approval of the Animal Care Committee of Kyung Hee University (KHUASP [SE]12–019). The EAC model was induced according to previous report (Li et al., 2011). In brief, the mice were immunized with 50 μg of SRW pollen (Cosmo Bio, Japan) in 5 mg of Imject Alum (Pierce Biotechnology, Rockford, USA) by means of footpad injection on day 0. Allergic conjunctivitis was induced by means of topically applying 0.15 mg of SRW pollen suspended in 10 μl of PBS into each eye once a day from days 10 to 12. PBS eye drop-treated SRWsensitized mice were used as control animals. RA was prepared at a dose of 4 mg/kg, which is similar to a previous report (Oh et al., 2011). DEX and VGX-1024 were used as positive control drugs. RA (4 mg/kg), DEX (5 mg/kg), or VGX-1027 (20 mg/kg) was administrated by intraperitoneal (i.p.) injection 1 h before the SRW pollen challenge. On day 13, 24 h after the last SRW challenge, the serum and whole eyes were harvested for gene expression assays.
2.3. BrdU assay Cell (1 104) proliferation was determined using a colorimetric immunoassay based on the measurement of BrdU incorporated by DNA synthesis (Roche Diagnostics GmbH, Mannheim, Germany). 2.4. Western blot analysis The stimulated cells were lysed and separated through 10% SDS-PAGE. After electrophoresis, the protein was transferred to nitrocellulose membranes and then the membranes were blocked and incubated with primary (1:500 dilution in PBST) and secondary (1:3000 dilution in PBST) antibodies. Finally, the protein bands were visualized by an enhanced chemiluminesence assay (Amersham Co. Newark, NJ, USA) according to manufacturer's instructions.
2.10. Statistics 2.5. MTT assay Cell viability was measured by a MTT assay. Briefly, 500 ml of HMC-1 cell (3 105) were pretreated with diverse concentrations of RA for 1 h and stimulated with TSLP for 48 h. The cell suspension containing MTT solution (5 mg/ml) was incubated at 37 °C for an additional 4 h. After washing the supernatant out, the insoluble formazan product was dissolved in dimethyl sulfoxide. Then, the optical density of 96-well culture plate was determined using an ELISA method reader at 540 nm. 2.6. Cytokines assay The levels of IL-13, TNF-α, IL-6, and IL-1β were determined using a sandwich ELISA method according to the manufacturer's instructions (R&D Systems). 2.7. RNA isolation and Quantitative Real-Time PCR Using an easy-BLUE™ RNA extraction kit (iNtRON Biotech, Sungnam, Korea), we isolated the total RNA from HMC-1 cells in accordance with the manufacturer's specifications. The concentration of total RNA in the final elutes was determined by spectrophotometry. Total RNA (2.5 μg) was heated at 75 °C for 5 min and then chilled on ice. Each sample was reverse-
All results are representative of three independent experiments with duplicate and expressed as the mean 7SEM. The statistical evaluation of the results was performed by an independent t-test and an ANOVA with a Tukey posthoc test using SPSS statistical software (IBM Corporation, Armonk, NY, USA). Results with a Pvalue of o0.05 were considered significant.
3. Results 3.1. Inhibitory effect of RA on the mast cell proliferation and the MDM2 levels in the TSLP-stimulated HMC-1 The mast cell proliferation amplifies the inflammatory allergic response and was increased by TSLP (Han et al., 2014). Thus, we investigated the effect of RA in the TSLP-induced mast cell proliferation. To determine the regulatory effect of RA on the proliferation of HMC-1 cells, a BrdU assay was performed. As shown in Fig. 1A, RA significantly attenuated the TSLP-induced proliferation of HMC-1 cells. We also evaluated the inhibitory effect of RA on the level of MDM2 in the TSLP-stimulated HMC-1 cells. As a result, the levels of MDM2 increased by TSLP were significantly decreased by RA (Fig. 1B and C, P o0.05). Cytotoxicity did not observe at doses of 0.1, 1, and 10 μM of RA (Fig. 1D).
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
Fig. 1. Inhibitory effect of RA on the mast cell proliferation and the MDM2 levels in the TSLP-stimulated HMC-1. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 48 h. BrdU incorporation assay was performed. (B) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 8 h. The levels of MDM2 were analyzed by Western blotting. (C) The relative intensities of protein levels were quantified by densitometry. (D) Cytotoxicity was measured by MTT assay. #P o 0.05; significantly different from the unstimulated cells,*Po 0.05, significantly different from the TSLP-stimulated cells. RA, rosmarinic acid.
193
Fig. 2. Inhibitory effect of RA on the levels of IL-13 in the TSLP-stimulated HMC-1 cells. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 8 h. The IL-13 production in the supernatant was analyzed by ELISA method. (B) IL-13 mRNA was analyzed by real-time PCR. (C) HMC-1 cells were pretreated with RA (10 μM), VGX-1027 (10 μg/ml), or RA (10 μM) and VGX1027 (10 μg/ml) and then stimulated with TSLP (20 ng/ml) for 8 h or LPS (100 ng/ ml) for 24 h. The IL-13 production in the supernatant was analyzed by ELISA method. #Po 0.05; significantly different from the unstimulated cells,*P o0.05, significantly different from the TSLP/LPS-stimulated cells. RA, rosmarinic acid; Blank, unstimulated cells; Control, TSLP/LPS-stimulated cells.
3.2. Inhibitory effect of RA on the levels of IL-13 in the TSLP-stimulated HMC-1 cells IL-13 is known as a growth factor of the mast cell (Hu et al., 2007). Thus, we evaluated the regulatory effect of RA on the production of IL-13. TSLP significantly increased the production of IL-
194
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
13 in HMC-1 cells (Fig. 2A, P o0.05). However, RA significantly decreased the TSLP-induced IL-13 production (Fig. 2A, Po 0.05). The mRNA expression of IL-13 was analyzed using a real-time PCR. The mRNA expression of IL-13 was also significantly inhibited by RA in the TSLP-stimulated HMC-1 cells (Fig. 2B, P o0.05). The TSLP acted via toll-like receptor (TLR)4-dependent pathways (Li et al., 2011). To investigate the effects of RA on the TLR4-dependent pathways induced by LPS, HMC-1 cells were stimulated with LPS. We used VGX-1027 (TLR4 antagonist) as a positive control drug. TSLP or LPS significantly increased the IL-13 production, while RA or VGX-1027 significantly decreased the TSLP/LPS-induced IL-13 production (Fig. 2C, P o0.05). The synergic effect of RA and VGX1027 did not appear in the TSLP/LPS-induced IL-13 production (Fig. 2C). 3.3. Inhibitory effect of RA on the levels of pSTAT6 in the TSLP-stimulated HMC-1 cells In a previous study, we showed that mast cell proliferation was increased by phosphorylation of STAT6 in HMC-1 cells (Yoou et al., 2015). Thus, we evaluated the inhibitory effect of RA on the level of pSTAT6 in the TSLP-stimulated HMC-1 cells. As a result, the levels of pSTAT6 increased by TSLP were significantly decreased by RA (Fig. 3, P o0.05). 3.4. Regulatory effect of RA on the levels of p53 in the TSLP-stimulated HMC-1 cells As shown in Fig. 1A, RA reduced the TSLP-induced mast cell proliferation. MDM2 is a negative regulator of p53 protein (Gansmo et al., 2015). Thus, we hypothesized that RA might activate the apoptotic factor, p53 protein. As depicted in Fig. 4, RA significantly increased the levels of p53 in the TSLP-stimulated HMC-1 cells (P o0.05).
Fig. 4. Regulatory effect of RA on the levels of p53 in the TSLP-stimulated HMC-1 cells. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 48 h. The level of p53 was analyzed by Western blotting. (B) The relative intensities of protein levels were quantified by densitometry. # Po 0.05; significantly different from the unstimulated cells,*P o 0.05, significantly different from the TSLP-stimulated cells. RA, rosmarinic acid.
3.5. Regulatory effect of RA on the levels of caspase-3 and Bcl2 in the TSLP-stimulated HMC-1 cells TSLP increased the anti-apoptotic factors and decreased the apoptotic factors (Han et al., 2014; Yoou et al., 2015). Thus, we studied whether RA would regulate the level of apoptotic and antiapoptotic factors in the TSLP-stimulated HMC-1 cells. As shown in Fig. 5A–C, RA significantly increased the activity of caspase-3 and significantly decreased the level of procaspase-3 (P o0.05) in the TSLP-stimulated HMC-1 cells (Po 0.05). RA also significantly increased the level of PARP cleavage in the TSLP-stimulated HMC-1 cells (Fig. 5B and C, P o0.05). Finally, we investigated the regulatory effect of RA on the level of Bcl2, anti-apoptotic factor. RA significantly decreased the level of Bcl2 in the TSLP-stimulated HMC-1 cells (Fig. 5D and E, P o0.05). 3.6. Inhibitory effect of RA on the levels of inflammatory cytokines in the TSLP-stimulated HMC-1 cells Mast cells accelerate inflammatory response through secretory action of cytokines (Amin, 2012). In this study, we evaluated the inhibitory effects of RA on the production of proinflammatory cytokines (TNF-α, IL-1β, and IL-6). The production of TNF-α, IL-1β, and IL-6 was increased in TSLP-stimulated HMC-1 cells (Fig. 6, Po 0.05). The up-regulation of TNF-α, IL-1β, and IL-6 by TSLP were reduced by RA (Fig. 6, P o0.05). 3.7. Inhibitory effect of RA on an EAC murine model induced by SRW pollen
Fig. 3. Inhibitory effect of RA on the levels of pSTAT6 in the TSLP-stimulated HMC-1 cells. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 8 h. The levels of pSTAT6 were analyzed by Western blotting. (B) The relative intensities of protein levels were quantified by densitometry. #P o 0.05; significantly different from the unstimulated cells, *P o0.05, significantly different from the TSLP-stimulated cells. RA, rosmarinic acid.
We investigated the regulatory effects of RA on an EAC murine model induced by SRW pollen. The levels of serum IgE, TSLP, and IL-4 significantly increased in the EAC mice (Fig. 7A–C, P o0.05). However, the increased serum IgE and TSLP levels were
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
195
Fig. 5. Regulatory effect of RA on the levels of caspase-3 and Bcl2 in the TSLP-stimulated HMC-1 cells. (A) HMC-1 cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 48 h. The caspase-3 activity was assayed using a caspase-3 colorimetric assay kit. (B)The levels of procaspase-3 and PARP cleavage were analyzed by Western blotting. (C) The relative intensities of protein levels were quantified by densitometry. (D) The levels of Bcl2 were analyzed by Western blotting. (E) The relative intensities of protein levels were quantified by densitometry. #P o 0.05; significantly different from the unstimulated cells,*P o0.05, significantly different from the TSLP-stimulated cells. RA, rosmarinic acid.
significantly decreased by RA, DEX, or VGX-1027 (Fig. 7A–C, P o0.05). The levels of TSLP and IL-4 in eye tissues were also reduced by RA, DEX, or VGX-1024 in the EAC mice (Fig. 7D and E, P o0.05).
4. Discussion RA has played a vital role in anti-proliferation, anti-inflammation, anti-atopic dermatitis, and anti-tumor in various in vivo and in vitro experiments (Hajhosseini et al., 2013; Jang et al., 2011). In this study, we hypothesized that RA could reduce the TSLP-induced mast cell proliferation. This study shows the first evidence that RA has an anti-allergic inflammatory effect through downregulating MDM2 in the TSLP-stimulated HMC-1 cells and inhibiting TSLP levels in the EAC in vivo model. Mast cells have also played a vital role in immediate and inflammatory allergic reactions. They can produce potent inflammatory mediators, such as proteases, histamine, chemotactic
factors, metabolites of arachidonic acid, and cytokines that work on the connective tissue, mucous glands, vasculature, smooth muscles, and inflammatory cells (Amin, 2012). In addition to these direct effector functions, activated mast cells can rapidly recruit other innate and adaptive immune cells and participate in the “tuning” of the immune response (DeBruin et al., 2015). During allergic inflammatory responses, TSLP is released from stromal cells, epithelial cells, dendritic cells, keratinocytes, and mast cells (Ziegler et al., 2013). TSLP also accelerates the mast cell-mediated allergic inflammatory reactions (Han et al., 2014). In a previous study, we indicated that TSLP increases the mast cell proliferation and MDM2 is necessary to proliferate mast cells by TSLP (Han et al., 2014). MDM2 encourages cancer cell growth and survival by degrading the cell cycle regulator p53 (Mulay et al., 2012). TSLPinduced mast cell proliferation was eliminated by MDM2 deficiency (Han et al., 2014). In this study, we showed that RA inhibited the TSLP-induced mast cell proliferation and MDM2 expression. IL-13 functions as a major inducer of bronchial inflammation,
196
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
Fig. 6. Inhibitory effect of RA on the levels of inflammatory cytokines in the TSLPstimulated HMC-1 cells. HMC-1 Cells were pretreated with RA (0.1, 1, 10 μM) and then stimulated with TSLP (20 ng/ml) for 8 h. (A–C) The levels of cytokines in culture supernatants were measured by ELISA method. #Po 0.05; significantly different from unstimulated cells, *Po 0.05; significantly different from the TSLPstimulated cells. RA, rosmarinic acid.
which has prompted efforts to develop therapeutics that specifically block this pathway (Healey et al., 2014). IL-13 can bind to two distinct receptors: the heterodimers of IL-13Rα1/IL-4Rα and IL13Rα2. IL-13Rα1/IL-4Rα engagement by IL-13 can lead to the activation of STAT6 (Chandriani et al., 2014). IL-13 can induce hypersensitivity in the airways and increase the production of mucus, level of IgE, and numbers of eosinophils (Takeuchi et al., 2015). Stimulated mast cells can synthesize IL-13 mRNA and protein (Burd et al., 1995). The effect of IL-13 is mainly mediated by the STAT6 signaling pathway (Bang et al., 2013). STAT6 functions as a signaling molecule and transcription factor. Also, STAT6 is an
upstream activator of MDM2. STAT6 plays a key role in the TH2 polarization of the immune system and increases allergic inflammatory reactions (Hebenstreit et al., 2006). Interestingly, the phosphorylation of STAT6 increases MDM2 mRNA expression whereas STAT6-deficient cells decreased MDM2 mRNA expression (Li et al., 2008). In our previous study, we reported that the STAT6 inhibitor inhibited the TSLP-induced MDM2 expression in HMC-1 cells. The mRNA expression of MDM2 was less in the TSLP-/- and STAT6-/- mice (Han et al., 2014). In the present study, we found that RA significantly decreased the IL-13 and pSTAT6 levels in the TSLP-stimulated HMC-1 cells. Therefore, these results indicate that RA reduced the mast cell proliferation through down-regulating the MDM2 and IL-13 by inhibiting pSTAT6. VGX-1027 is an isoxazoline compound currently under development for the treatment of immune-inflammatory and autoimmune diseases (Mangano et al., 2008a, b; Stojanovic et al., 2007; Stosic-Grujicic et al., 2007). It has been shown to be effective in fighting against inflammatory illnesses originating from the TLR4dependent problem by specifically inhibiting the TLR4 (Fagone et al., 2014; Cha et al., 2013). In this study, we observed that RA or VGX-1027 reduced the LPS-induced IL-13 production. However, there was no synergic effect between RA and VGX-1027 in the LPSinduced IL-13 production. Therefore, our results assumed that the effect of RA is similar to the mechanism of VGX-1027. However, further study is needed to elucidate the effect and mechanism of RA on the TLR4 signaling pathways. In regular cell development, the p53 protein is not necessary and it presents lower cellular levels. Because of its short half-life, the p53 protein maintains the integrity of the genome, controls the cell cycle, and promotes apoptosis (Kim and Baek, 2006). It also has negative effects on cell proliferation by cell cycle block between the G1 and S phases (Girod et al., 1998). An increased MDM2 can disturb the induction of p53 genes that are required to initiate apoptosis and directly activate the cell cycle (Allam et al., 2011; Sikdar and Khuda-Bukhsh, 2013). Interestingly, TSLP increases anti-apoptotic factors (MDM2 and IL-13) and decreases apoptotic factors (p53 and caspase-3) (Han et al., 2014). The regulation of apoptosis and cell survival is also regulated by the Bcl-2 family that consists of pro/anti-apoptotic proteins (Westerberg et al., 2015). Among the caspases, caspase-3 is involved in the proteolytic cleavage of PARP protein. An increased PARP is indicative of a greater extent of DNA degradation. Therefore, caspase-3 and PARP are regarded as significant markers of apoptosis (Chakraborty et al., 2012). In a previous study, Zhang et al. (2011) reported that RA reduced the proliferation and increased apoptosis in hepatic stellate cells. In the present study, we found that RA increased the caspase-3 activation and PARP cleavage, and decreased procaspase-3 and Bcl2 levels in the TSLP-stimulated HMC1 cells. Therefore, we suggest that RA inhibits the TSLP-induced mast cell proliferation by increasing apoptosis and decreasing anti-apoptosis. Since TNF-α, IL-1β, IL-6, and other mediators are important inflammatory molecules that induce abnormal cell proliferation. By “paracrine or autocrine” mechanism (Malcolm and Worthen, 2003), these mediators also can synthesize other cytokines and activate the signal transduction pathway in inflammatory cells (Chen et al., 2015). In a previous study, RA conferred protection to mice against acute lung injury induced by lipopolysaccharide through inhibiting the production of TNF-α, IL-1β, and IL-6 (Chu et al., 2012). In this study, we also showed that RA inhibits the overproduction of TNF-α, IL-1β, and IL-6 in TSLP- stimulated HMC1 cells. Therefore, we suggest that the anti-inflammatory effects of RA might originate from the inhibitory action of the TSLP-induced inflammatory cytokines. The SRW pollen, which acts as a functional TLR4 agonist, initiates TLR4-dependent TSLP/OX40L/OX40 signaling pathways that
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
197
Fig. 7. Inhibitory effect of RA on an EAC murine model induced by SRW pollen. RA (4 mg/kg), DEX (5 mg/kg), and VGX-1027 (20 mg/kg) was administrated by i.p. injection on 1 h before SRW pollen challenge. The levels (ng/ml) of serum IgE (A), TSLP (B), and IL-4 (C) and the levels (ng/mg protein) of eye tissue TSLP (D) and IL-4 (E) were analyzed by ELISA method. #Po 0.05; significantly different from unstimulated cells, *P o0.05; significantly different from the EAC murine model induced by SRW pollen. RA, rosmarinic acid; DEX, dexamethasone.
trigger TH2-dominant allergic inflammation (Li et al., 2011). The SRW pollen stimulated TSLP production by ocular epithelia in wild-type mice, but not on Tlr4 deficient or MyD88 / mice. In the present study, we showed that the levels of IgE, TSLP, and IL-4 increased in the SRW pollen-induced EAC mice. RA, DEX, and VGX1027 significantly decreased the SRW pollen-induced the levels of IgE, TSLP, and IL-4. Therefore, we suggest that RA has an anti-allergic inflammatory effect through inhibiting TSLP signaling pathways. The typical signs of allergic conjunctivitis are lid edema, tearing, chemosis, redness, and itching of the eye lids (Li et al., 2011). In this study, we did not analyze clinical symptoms such as redness, itching behavior, lid edema, tearing, and chemosis. Therefore, further investigations are required in order to elucidate the effect of RA on the clinical symptoms of the EAC model.
5. Conclusion In this study, we observed for the first time that RA suppresses the TSLP-induced mast cell proliferation through down-regulating MDM2 and up-regulating p53. RA induced the activation of caspase-3 and decreased the levels of Bcl2. It also inhibited the production of proinflammatory cytokines and reduced the levels of IgE, TSLP, and IL-4 in the EAC in vivo model. Therefore, our studies indicate that RA can be applied to the treatment of allergic inflammatory diseases caused by an increase in the number of mast cells. Conflict of interest The authors state no conflict of interest.
198
M.-s. Yoou et al. / European Journal of Pharmacology 771 (2016) 191–198
Acknowledgment This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2015R1A1A3A04000922).
References Allam, R., Sayyed, S.G., Kulkarni, O.P., Lichtnekert, J., Anders, H.J., 2011. Mdm2 promotes systemic lupus erythematosus and lupus nephritis. J. Am. Soc. Nephrol. 22, 2016–2027. Amin, K., 2012. The role of mast cells in allergic inflammation. Respir. Med. 106, 9–14. Bang, B.R., Lee, H.S., Lee, S.Y., Chun, E., Kim, Y.K., Cho, S.H., Min, K.U., Kim, Y.Y., Park, H.W., 2013. IL-13 and STAT6 signaling involve in low dose lipopolysaccharide induced murine model of asthma. Asia Pac. Allergy 3, 194–199. Burd, P.R., Thompson, W.C., Max, E.E., Mills, F.C., 1995. Activated mast cells produce interleukin 13. J. Exp. Med. 181, 1373–1380. Cha, J.J., Hyun, Y.Y., Lee, M.H., Kim, J.E., Nam, D.H., Song, H.K., Kang, Y.S., Lee, J.E., Kim, H.W., Han, J.Y., Cha, D.R., 2013. Renal protective effects of toll-like receptor 4 signaling blockade in type 2 diabetic mice. Endocrinology 154, 2144–2155. Chakraborty, D., Bishayee, K., Ghosh, S., Biswas, R., Mandal, S.K., Khuda-Bukhsh, A. R., 2012. [6]-Gingerol induces caspase 3 dependent apoptosis and autophagy in cancer cells: drug-DNA interaction and expression of certain signal genes in HeLa cells. Eur. J. Pharmacol. 694, 20–29. Chandriani, S., DePianto, D.J., N’Diaye, E.N., Abbas, A.R., Jackman, J., Bevers 3rd, J., Ramirez-Carrozzi, V., Pappu, R., Kauder, S.E., Toy, K., Ha, C., Modrusan, Z., Wu, L. C., Collard, H.R., Wolters, P.J., Egen, J.G., Arron, J.R., 2014. Endogenously expressed IL-13Rα2 attenuates IL-13-mediated responses but does not activate signaling in human lung fibroblasts. J. Immunol. 193, 111–119. Chen, J.Y., Wu, H., Li, H., Hu, S.L., Dai, M.M., Chen, J., 2015. Anti-inflammatory effects and pharmacokinetics study of geniposide on rats with adjuvant arthritis. Int. Immunopharmacol. 24, 102–109. Chu, X., Ci, X., He, J., Jiang, L., Wei, M., Cao, Q., Guan, M., Xie, X., Deng, X., He, J., 2012. Effects of a natural prolyl oligopeptidase inhibitor, rosmarinic acid, on lipopolysaccharide-induced acute lung injury in mice. Molecules 17, 3586–3598. DeBruin, E.J., Gold, M., Lo, B.C., Snyder, K., Cait, A., Lasic, N., Lopez, M., McNagny, K. M., Hughes, M.R., 2015. Mast cells in human health and disease. Methods Mol. Biol. 1220, 93–119. Fagone, P., Muthumani, K., Mangano, K., Magro, G., Meroni, P.L., Kim, J.J., Sardesai, N. Y., Weiner, D.B., Nicoletti, F., 2014. VGX-1027 modulates genes involved in lipopolysaccharide-induced Toll-like receptor 4 activation and in a murine model of systemic lupus erythematosus. Immunology 142, 594–602. Gansmo, L.B., Knappskog, S., Romundstad, P., Hveem, K., Vatten, L., Lønning, P.E., 2015. Influence of MDM2 SNP309 and SNP285 Status on the risk of cancer in the breast, prostate, lung and colon. Int. J. Cancer 137, 96–103. Gershwin, L.J., 2015. Comparative immunobiology of allergic responses. Annu. Rev. Anim. Biosci. 3, 327–346. Girod, S.C., Pfeiffer, P., Ries, J., Pape, H.D., 1998. Proliferative activity and loss of function of tumour suppressor genes as’‘biomarkers’ in diagnosis and prognosis of benign and preneoplastic oral lesions and oral squamous cell carcinoma. Br. J. Oral. Maxillofac. Surg. 36, 252–260. Hajhosseini, L., Khaki, A., Merat, E., Ainehchi, N., 2013. Effect of rosmarinic acid on sertoli cells apoptosis and serum antioxidant levels in rats after exposure to electromagnetic fields. Afr. J. Tradit. Complement. Altern. Med. 10, 477–480. Han, N.R., Oh, H.A., Nam, S.Y., Moon, P.D., Kim, D.W., Kim, H.M., Jeong, H.J., 2014. TSLP induces mast cell development and aggravates allergic reactions through the activation of MDM2 and STAT6. J. Investig. Dermatol. 134, 2521–2530. Hashimoto, T., Ichiki, T., Ikeda, J., Narabayashi, E., Matsuura, H., Miyazaki, R., Inanaga, K., Takeda, K., Sunagawa, K., 2011. Inhibition of MDM2 attenuates neointimal hyperplasia via suppression of vascular proliferation and inflammation. Cardiovasc. Res. 91, 711–719. Healey, G.D., Lockridge, J.A., Zinnen, S., Hopkin, J.M., Richards, I., Walker, W., 2014. Development of pre-clinical models for evaluating the therapeutic potential of candidate siRNA targeting STAT6. PLoS One 9, e90338. Hebenstreit, D., Wirnsberger, G., Horejs-Hoeck, J., Duschl, A., 2006. Signaling mechanisms, interaction partners, and target genes of STAT6. Cytokine Growth Factor Rev. 17, 173–188. Hepworth, M.R., Maurer, M., Hartmann, S., 2012. Regulation of type 2 immunity to
helminths by mast cells. Gut Microbes 3, 476–481. Hu, Z.Q., Zhao, W.H., Shimamura, T., 2007. Regulation of mast cell development by inflammatory factors. Curr. Med. Chem. 14, 3044–3050. Jang, A.H., Kim, T.H., Kim, G.D., Kim, J.E., Kim, H.J., Kim, S.S., Jin, Y.H., Park, Y.S., Park, C.S., 2011. Rosmarinic acid attenuates 2,4-dinitrofluorobenzene-induced atopic dermatitis in NC/Nga mice. Int. Immunopharmacol. 11, 1271–1277. Jeong, H.J., Koo, H.N., Na, H.J., Kim, M.S., Hong, S.H., Eom, J.W., Kim, K.S., Shin, T.Y., Kim, H.M., 2002. Inhibition of TNF-alpha and IL-6 production by Aucubin through blockade of NF-kappaB activation RBL-2H3 mast cells. Cytokine 18, 252–259. Khojasteh, A., Mirjalili, M.H., Hidalgo, D., Corchete, P., Palazon, J., 2014. New trends in biotechnological production of rosmarinic acid. Biotechnol. Lett. 36, 2393–2406. Kim, K.I., Baek, S.H., 2006. SUMOylation code in cancer development and metastasis. Mol. Cells 22, 247–253. Li, B.H., Yang, X.Z., Li, P.D., Yuan, Q., Liu, X.H., Yuan, J., Zhang, W.J., 2008. IL-4/Stat6 activities correlate with apoptosis and metastasis in colon cancer cells. Biochem. Biophys. Res. Commun. 369, 554–560. Li, D.Q., Zhang, L., Pflugfelder, S.C., De Paiva, C.S., Zhang, X., Zhao, G., Zheng, X., Su, Z., Qu, Y., 2011. Short ragweed pollen triggers allergic inflammation through toll-like receptor 4-dependent thymic stromal lymphopoietin/OX40 ligand/ OX40 signaling pathways. J. Allergy Clin. Immunol. 128, 1318–1325. Lo Kuan, E., Ziegler, S., 2014. Thymic stromal lymphopoietin and cancer. J. Immunol. 193, 4283–4288. Malcolm, K.C., Worthen, G.S., 2003. Lipopolysaccharide stimulates p38-dependent induction of antiviral genes in neutrophils independently of paracrine factors. J. Biol. Chem. 278, 15693–15701. Mangano, K., Sardesai, N., D’Alcamo, M., Libra, M., Malaguarnera, L., Donia, M., Bendtzen, K., Meroni, P., Nicoletti, F., 2008a. In vitro inhibition of enterobacteria-reactive CD4 þCD25-T cells and suppression of immunoinflammatory colitis in mice by the novel immunomodulatory agent VGX-1027. Eur. J. Pharmacol. 586, 313–321. Mangano, K., Sardesai, N.Y., Quattrocchi, C., Mazzon, E., Cuzzocrea, S., Bendtzen, K., Meroni, P.L., Kim, J.J., Nicoletti, F., 2008b. Effects of the immunomodulator, VGX1027, in endotoxin-induced uveitis in Lewis rats. Br. J. Pharmacol. 155, 722–730. Metz, M., Grimbaldeston, M.A., Nakae, S., Piliponsky, A.M., Tsai, M., Galli, S.J., 2007. Mast cells in the promotion and limitation of chronic inflammation. Immunol. Rev. 217, 304–328. Mulay, S.R., Thomasova, D., Ryu, M., Anders, H.J., 2012. MDM2 (murine double minute-2) links inflammation and tubular cell healing during acute kidney injury in mice. Kidney. Int. 81, 1199–1211. Oh, H.A., Park, C.S., Ahn, H.J., Park, Y.S., Kim, H.M., 2011. Effect of Perilla frutescens var. acuta Kudo and rosmarinic acid on allergic inflammatory reactions. Exp. Biol. Med. 236, 99–106. Sikdar, S., Khuda-Bukhsh, A.R., 2013. Alternative drug therapies are superior to epidermal growth factor receptor-targeted chemotherapeutic drug responses in non-small cell lung cancer. TANG 3, e10. Stojanovic, I., Cuzzocrea, S., Mangano, K., Mazzon, E., Miljkovic, D., Wang, M., Donia, M., Al Abed, Y., Kim, J., Nicoletti, F., Stosic-Grujicic, S., Claesson, M., 2007. In vitro, ex vivo and in vivo immunopharmacological activities of the isoxazoline compound VGX-1027: modulation of cytokine synthesis and prevention of both organ-specific and systemic autoimmune diseases in murine models. Clin. Immunol. 123, 311–323. Stosic-Grujicic, S., Cvetkovic, I., Mangano, K., Fresta, M., Maksimovic-Ivanic, D., Harhaji, L., Popadic, D., Momcilovic, M., Miljkovic, D., Kim, J., Al-Abed, Y., Nicoletti, F., 2007. A potent immunomodulatory compound, (S,R)-3-Phenyl-4,5dihydro-5-isoxazole acetic acid, prevents spontaneous and accelerated forms of autoimmune diabetes in NOD mice and inhibits the immunoinflammatory diabetes induced by multiple low doses of streptozotocin in CBA/H mice. J. Pharmacol. Exp. Ther. 320, 1038–1049. Takeuchi, M., Ohno, K., Takata, K., Gion, Y., Tachibana, T., Orita, Y., Yoshino, T., Sato, Y., 2015. Interleukin 13-positive mast cells are increased in immunoglobulin G4-related sialadenitis. Sci. Rep. 5, 7696. Toledo, F., Wahl, G.M., 2007. MDM2 and MDM4: p53 regulators as targets in anticancer therapy. Int. J. Biochem. Cell. Biol. 39, 1476–1482. Westerberg, C.M., Ekoff, M., Nilsson, G., 2015. Regulation of mast cell survival and apoptosis. Methods Mol. Biol. 1220, 257–267. Yoou, M.S., Kim, H.M., Jeong, H.J., 2015. Acteoside attenuates TSLP-induced mast cell proliferation via down-regulating MDM2. Int. Immunopharmacol. 26, 23–29. Zhang, J.J., Wang, Y.L., Feng, X.B., Song, X.D., Liu, W.B., 2011. Rosmarinic acid inhibits proliferation and induces apoptosis of hepatic stellate cells. Biol. Pharm. Bull. 34, 343–348. Ziegler, S.F., Roan, F., Bell, B.D., Stoklasek, T.A., Kitajima, M., Han, H., 2013. The biology of thymic stromal lymphopoietin (TSLP). Adv. Pharmacol. 66, 129–155.