Tryptanthrin reduces mast cell proliferation promoted by TSLP through modulation of MDM2 and p53

Biomedicine & Pharmacotherapy 79 (2016) 71–77

Available online at

ScienceDirect www.sciencedirect.com

Original article

Tryptanthrin reduces mast cell proliferation promoted by TSLP through modulation of MDM2 and p53 Na-Ra Hana , Hyung-Min Kima,* , Hyun-Ja Jeongb,* a

Department of Pharmacology, College of Korean Medicine, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul 130-701, Republic of Korea Department of Food Technology and Inflammatory Disease Research Center, Hoseo University, 20, Hoseo-ro 79 beon-gil, Baebang-eup, Asan, Chungcheongnam-do 336-795, Republic of Korea b

A R T I C L E I N F O

A B S T R A C T

Article history: Received 25 September 2015 Received in revised form 14 January 2016 Accepted 15 January 2016

Background: Atopic dermatitis (AD) results from complex interactions between mast cells and inflammatory mediators. An inflammatory mediator, thymic stromal lymphopoietin (TSLP) is known to promote mast cell proliferation through up-regulation of mouse double minute 2 (MDM2, a negative regulator of p53) and aggravate AD. In this study, we investigated whether tryptanthrin (TR, an antiinflammatory agent) would regulate TSLP-induced mast cell proliferation and TSLP-induced a proinflammatory cytokine, tumor necrosis factor (TNF)-a production from mast cells. Methods: Human mast cell line (HMC-1) cells were treated with TR and stimulated with TSLP. Proliferation was measured with a bromodeoxyuridine incorporation assay. And pro- and anti-apoptotic factors were analyzed with quantitative real-time PCR, Western blot analysis, and ELISA. The mRNA expression and production of TNF-a were analyzed with quantitative real-time PCR and ELISA. Results: TR significantly inhibited the proliferation of HMC-1 cells promoted by TSLP. TR inhibited MDM2 expression, whereas TR increased the expression of p53, poly ADP-ribose polymerase, and caspase-3 in the TSLP-stimulated HMC-1 cells. TR significantly inhibited Ki67 mRNA expression as well as mRNA expression and production of interleukin (IL)-13 in the TSLP-stimulated HMC-1 cells. Moreover, TR significantly suppressed mRNA expression and production of TNF-a in the TSLP-stimulated HMC-1 cells. Finally, the mRNA expression of IL-7 receptor a chain and TSLP receptor was inhibited by TR in the TSLPstimulated HMC-1 cells. Conclusion: Our results suggest that TR determined with new concept has intensive potential for the treatment of mast cell-mediated allergic diseases, such as AD. ã 2016 Elsevier Masson SAS. All rights reserved.

Keywords: Tryptanthrin Thymic stromal lymphopoietin Mouse double minute 2 Mast cells Proliferation

1. Introduction Atopic dermatitis (AD) is a multifactorial inflammatory skin disorder. The pathogenesis of AD has been ascribed to complex interactions between various immune cells and inflammatory factors [1]. In the inflammatory process, the cytokines recruit the activated immune cells to lesion site, thereby amplifying and maintaining this condition [2]. Especially, mast cell is a potent effector conducting a critical role in allergic inflammatory reactions, such AD [3]. Exogenous cytokines released from the

Abbreviations: AD, atopic dermatitis; BrdU, bromodeoxyuridine; FBS, fetal bovine serum; HMC-1, human mast cell line cells; IL, interleukin; IMDM, Isocove’s Modified Dulbecco’s Medium; MDM2, mouse double minute2; TR, tryptanthrin; TSLP, thymic stromal lymphopoietin. * Corresponding authors. E-mail addresses: [email protected] (H.-M. Kim), [email protected] (H.-J. Jeong). http://dx.doi.org/10.1016/j.biopha.2016.01.046 0753-3322/ ã 2016 Elsevier Masson SAS. All rights reserved.

activated immune cells influence the number of mast cells [4]. The increases in the mast cell number and mast cell activation in AD lesions contribute to development of AD [5]. The number of mast cells can be regulated by proliferation, migration, survival, and apoptosis from the inflammatory factors in inflamed tissue [6]. The inflammatory factors are critical for mast cell development although they are not mast cell growth factors, such as stem cell factor (SCF) and interleukin (IL)-3 [7]. The activated mast cells release various cytokines that are relevant in chronic skin inflammation [8]. Tumor necrosis factor (TNF)-a which is up-regulated in mast cells, acts as an inducer of cytokines, chemokines and adhesion molecules in the skin of AD lesions [9]. Thymic stromal lymphopoietin (TSLP) is a general biomarker for epidermal-barrier defects [10] and involved in the pathogenesis of AD [11]. TSLP signals through a receptor containing IL-7 receptor a chain (IL-7Ra) and a TSLP specific subunit, TSLP receptor (TSLPR) [12]. TSLP acts on various lineages, including dendritic cells, T cells, and mast cells via IL-7Ra/TSLPR [13]. Epithelial cell-derived TSLP

72

N.-R. Han et al. / Biomedicine & Pharmacotherapy 79 (2016) 71–77

strongly activates dendritic cells and that exerts a profound influence on pro-inflammatory cytokines, such as TNF-a production from T cells or mast cells in many tissues [14]. In addition, TSLP functions as a factor in mast cell proliferation [15]. An E3 ubiquitin ligase, murine double minute 2 (MDM2) which induces cancer cell survival and growth by degrading cell cycle regulator p53, mediated mast cell proliferation promoted by TSLP [15,16]. MDM2 inhibitor inhibited cell proliferation which in turn leads to the activation of caspase-3 [17]. Increased activity of p53 resulted in the activation of caspase-3 and cleavage of poly-ADP-ribose polymerase (PARP) [18]. Recently, Hashimoto et al. [19] reported that MDM2 inhibition decreased NF-kBdependent inflammation in vascular smooth muscle cells. IL-13 is a vital stimulator of inflammation and AD [20]. TSLP resulted in a marked increase in IL-13 and enhanced lung inflammation [21]. In addition, TSLP promoted the mast cell proliferation, increasing IL-13 production [15]. IL-13 was reported to promote the mast cell proliferation as a growth factor of mast cell [22]. Therefore, pharmacologic regulation of the proliferation promoted by TSLP could be a hopeful strategy for mast cellmediated allergic diseases, such as AD. Tryptanthrin (indolo[2,1-b]quinazoline-6,12-dione; TR) is an alkaloid included in many plant species [23]. Studies reported that TR has multiple biological and pharmacological activities including anti-inflammatory [24], anti-allergic [25], and anti-tumor activity [26]. However, the precise regulatory mechanism of TR has not been elucidated in TSLP-induced mast cell proliferation and TSLPinduced inflammatory cytokine production from mast cells. Thus, we investigated anti-proliferative and anti-inflammatory effects of TR on TSLP-stimulated human mast cell line (HMC-1) cells. 2. Materials and methods 2.1. Materials We purchased Isocove’s Modified Dulbecco’s Medium (IMDM) and fetal bovine serum (FBS) from Gibco BRL (Grand Island, NY, USA); TR (#SML0310, purity 98%) from Sigma Chemical Co. (St. Louis, MO, USA); recombinant TSLP and anti-IL-13 antibodies from R&D Systems (Minneapolis, MN, USA); anti-TNF-a antibodies from BD Pharmingen (San Diego, CA, USA); anti-MDM2, p53, PARP, caspase-3, actin, and GAPDH antibodies from Santa Cruz Biotechnology (Dallas, TX, USA). TR was dissolved with carboxylmethyl cellulose solution (0.5% w/v) containing 10% dimethylsulfoxide (DMSO). 2.2. Cell culture HMC-1 cells were incubated in IMDM supplemented with penicillin (100 units/ml), streptomycin (100 mg/ml), and 10% FBS at 37  C in 5% CO2 with 95% humidity.

2.5. Quantitative real-time PCR Total RNA was isolated from HMC-1 cells according to the manufacturer’s specification using an easy-BLUETM RNA extraction kit (iNtRON Biotech, Seongnam, Republic of Korea). The concentration of total RNA in the final elutes was determined by NanoDrop spectrophotometer (Thermo Scientific Inc., Wilmington, DE, USA). The cDNA synthesis reaction was performed for 60 min at 42  C and 5 min at 94  C using a cDNA synthesis kit (Bioneer Corporation, Daejeon, Republic of Korea). Quantitative Real-Time PCR was performed using a SYBR Green master mix (Applied Biosystems, Foster City, CA, USA). The mRNA detections of Ki67, IL-13, TNF-a, IL-7Ra and TSLPR were analyzed using an ABI StepOne real-time PCR System (Applied Biosystems). The primers are in Table 1. All mRNA levels were normalized to GAPDH levels compared with the control sample. All data were analyzed using the DDCT method. 2.6. Cytokines assay The production of IL-13 and TNF-a from HMC-1 cells was measured using a sandwich ELISA method according to the manufacturer’s specifications (R & D system Inc. and BD Pharmingen). 2.7. Western blot analysis Western blot analysis was performed with protein extracts from HMC-1 cells as described previously [27]. Briefly, TR-treated or TSLP-stimulated HMC-1 cells were lysed and separated through 12% SDS-PAGE. After electrophoresis, the proteins were transferred to nitrocellulose membranes. The membranes were blocked with phosphate-buffered saline with Tween 20 containing 5% skim milk and incubated with primary and secondary antibodies. Finally, Blots were visualized by an enhanced chemiluminesence assay according to the manufacturer’s instructions (Amersham Co., Newark, NJ, USA). The relative intensity was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA). 2.8. Statistics Experimental values are a summary from at least-three experiments and represented as the mean  standard error of mean (SEM). Statistical significance was determined using an independent t-test and an ANOVA with a Tukey post hoc test. All statistical analyses were performed using IBM SPSS v21 statistics software (IBM, Armonk, NY, USA). Values of p < 0.05 were considered as significant results. 3. Results 3.1. Regulatory effect of TR on proliferation of HMC-1 cells

2.3. Bromodeoxyuridine assay The proliferation of HMC-1 cells (1 104) was determined using a colorimetric immunoassay based on the mensuration of bromodeoxyuridine (BrdU) incorporated by DNA synthesis (Roche Diagnostics GmbH, Mannheim, Germany). 2.4. MTT assay Cell viability was measured by a MTT assay. HMC-1 cell (4  105) were treated with TR and incubated with MTT solution (5 mg/ml) at 37  C. After washing the supernatant out, insoluble formazan product was dissolved in DMSO. The optical density was determined using an ELISA reader at 540 nm.

First of all, we clarified whether TR could regulate mast cell proliferation promoted by TSLP. The stimulation with TSLP significantly induced BrdU incorporation into HMC-1 cells as Table 1 Primer sequences. Gene

Forward primer

Reverse primer

Ki67 IL-13 TNF-a IL-7Ra TSLPR GAPDH

ATAAACACCCCAACACACACAA GCCCTGGAATCCCTGATCA AGGACGAACATCCAACCTTCCCAA GCT CAG GGG AGA TGG ATC CT CAG AGC AGC GAG ACG ACA TT ACCAAATCCGTTGACTCCGACCTT

GCCACTTCTTCATCCAGTTAC GCTCAGCATCCTCTGGGTCTT TTTGAGCCAGAAGAGGTTGAGGGT GTC TTC TTA TGA TCG GGG AG GGT ACT GAA CCT CAT AGA GG TCGACAGTCAGCCGCATCTTCTTT

N.-R. Han et al. / Biomedicine & Pharmacotherapy 79 (2016) 71–77

73

Fig. 1. Regulatory effect of TR on proliferation of HMC-1 cells. (A) HMC-1 cells (1 104) were treated with TR for 2 h and stimulated with TSLP (20 ng/ml) for 48 h. Proliferation was measured with a BrdU incorporation assay. Error bars indicate SEM of three biological repeats. #p < 0.05; significantly different from unstimulated cells. *p < 0.05; significantly different from TSLP-stimulated cells. (B) These images show an amount of BrdU incorporated into HMC-1 cells (original magnification, 400). (C) The viability of HMC-1 cells (1 104) was measured with a MTT assay. Error bars indicate SEM of three biological repeats.

shown in Fig. 1A and B (p < 0.05). However, TR significantly inhibited the BrdU incorporation into the TSLP-stimulated HMC-1 cells at a concentration of 1 and 10 mM (p < 0.05; Fig. 1A and B). TR does not have an effect on the BrdU incorporation into unstimulated HMC-1 cells (Fig. 1A). The concentration of TR was decided on the basis of previous reports [25,28]. In this study, cytotoxicity also was not showed at all concentrations of TR (Fig. 1C). 3.2. Regulatory effect of TR on Ki67 mRNA expression of HMC-1 cells Ki67 is widely used to verify the proliferative activity and the Ki67 mRNA expression is analyzed for a precise quantitative examination of the proliferation activity [29]. And Ki-67 can serve as a useful alternative to BrdU in determining the proliferation [30]. The stimulation with TSLP significantly increased the Ki67 mRNA expression in HMC-1 cells (p < 0.05, Fig. 2). However, TR significantly inhibited the Ki67 mRNA expression at doses of 1 and 10 mM similar to the result of the BrdU incorporation of TR (p < 0.05, Fig. 2). 3.3. Modulatory effect of TR on levels of MDM2 and p53 and activation of caspase-3 in HMC-1 cells We sought to determine how TR would regulate the proliferation in the TSLP-stimulated HMC-1 cells. In our previous study, we

demonstrated that MDM2 is involved in the proliferation of HMC-1cells promoted by TSLP [15]. Thus, we investigated whether TR could regulate the MDM2 expression in the TSLP-stimulated HMC-1 cells. As indicated in Fig. 3A, TR significantly inhibited the MDM2 expression increased by the simulation with TSLP (p < 0.05). On the contrary, TR significantly increased the p53 expression decreased by the simulation with TSLP (p < 0.05, Fig. 3A). We also examined whether TR would regulate the activation of an apoptotic factor, caspase-3. The results showed that TR significantly increased the caspase-3 activation decreased by the simulation with TSLP (p < 0.05; Fig. 3B). And TR significantly increased the expression of cleaved PARP in the TSLP-stimulated HMC-1 cells (p < 0.05; Fig. 3B). 3.4. Regulatory effect of TR on levels of IL-13 in HMC-1 cells Next, we noted that IL-13, a kind of cytokine derived from mast cells, promoted the mast cell proliferation as well as IL-13 is involved in AD pathogenesis and functions an important IgE inducer [15,31,32]. Thus, we estimated an effect of TR on the production and mRNA expression of IL-13 in the TSLP-stimulated HMC-1 cells. TR (1 and 10 mM) significantly decreased the mRNA expression and the production of IL-13 increased by the stimulation with TSLP (p < 0.05, Fig. 4). TR (10 mM) did not affect the mRNA expression and production of IL-13 in unstimulated HMC-1 cells (Fig. 4). 3.5. Regulatory effect of TR on levels of TNF-a in HMC-1 cells We assessed whether TR would regulate the levels of TNF-a in the TSLP-stimulated HMC-1 cells, since TSLP triggers the allergic inflammation, increasing production of TNF-a [15]. As shown in Fig. 5, TSLP significantly increased the mRNA expression and production of TNF-a (p < 0.05)
However, TR significantly decreased increased the mRNA expression and production of TNF-a in the TSLP-stimulated HMC-1 cells (p < 0.05, Fig. 5). TR (10 mM) did not induce the mRNA expression and production of TNF-a in unstimulated HMC-1 cells (Fig. 5). 3.6. Regulatory effect of TR on expression of IL-7Ra and TSLPR in HMC-1 cells

Fig. 2. Regulatory effect of TR on Ki67 mRNA expression of HMC-1 cells. HMC1 cells (1 106) were treated with TR for 2 h and stimulated with TSLP (20 ng/ml) for 24 h. The Ki67 mRNA expression was analyzed with the real-time quantitative PCR analysis. Error bars indicate SEM of three biological repeats. #p < 0.05; significantly different from unstimulated cells. *p < 0.05; significantly different from TSLPstimulated cells.

Finally, TSLP signaling is initiated by a heterodimer composed of IL-7Ra and TSLPR [33]. Thus, we determined whether the regulatory effect of TR on TSLP-promoted proliferation and TSLPinduced inflammatory cytokine production, would be caused via IL-7Ra and TSLPR in HMC-1 cells. As shown as Fig. 6, TSLP significantly increased the mRNA expression of IL-7Ra and TSLPR (p < 0.05). However, TR significantly decreased the mRNA

74

N.-R. Han et al. / Biomedicine & Pharmacotherapy 79 (2016) 71–77

Fig. 3. Regulatory effect of TR on levels of pro- and anti-apoptotic factors in HMC-1 cells. (A) HMC-1 cells (3  106) were treated with TR for 2 h and stimulated with TSLP (20 ng/ml) for 8 h. The levels were assessed by western blotting. (B) HMC-1 cells (3  106) were treated with TR for 2 h and stimulated with TSLP (20 ng/ml) for 48 h. The levels were assessed by western blotting. Error bars of densitometry values indicate SEM of three biological repeats, expressed relative to unstimulated cells, #p < 0.05 or TSLPstimulated cells, *p < 0.05.

expression of IL-7Ra and TSLPR in the TSLP-stimulated HMC1 cells (p < 0.05, Fig. 6). 4. Discussion Mast cells are closely involved in AD [34]. The increased mast cells in skin lesions contribute to skin inflammation [35,36]. TSLP is highly expressed in the lesional skin of AD patients [37]. Recently, TSLP was unraveled to regulate the number of mast cells by promoting the mast cell proliferation and to aggravate mast cellmediated diseases, such as AD [15]. Thus, the inhibitory effect of TR on the mast cell proliferation is determined with this new concept for the treatment of mast cell-mediated diseases, such as AD in this study. TR significantly inhibited the incorporation of BrdU into the

TSLP-stimulated HMC-1 cells. TR modulated the expression of MDM2, p53, PARP, and caspase-3 in the TSLP-stimulated HMC-1 cells. And the levels of Ki67 and IL-13 were significantly inhibited by TR in the TSLP-stimulated HMC-1 cells. TR also decreased the TSLP-induced TNF-a production and IL-7Ra/TSLPR mRNA expression. The mast cell development involves a particularly complex process entailing the interaction of apoptosis-inducing factors [7]. MDM2 is involved in p53 degradation and critical for regulating p53 homeostasis [38]. The MDM2-p53 pathway regulates cell proliferation and apoptosis [39]. Also, the apoptosis is mediated by the activation of caspases which amplify the apoptotic signal [40]. During the apoptosis, the 113 kDa PARP is cleaved to a distinct 89 and 24 kDa fragments by caspase [41]. The apoptotic markers,

Fig. 4. Regulatory effect of TR on levels of IL-13 in HMC-1 cells. (A) HMC-1 cells (1 106) were treated with TR for 2 h and stimulated with TSLP (20 ng/ml) for 4 h. The IL13 mRNA expression was analyzed with the real-time quantitative PCR analysis. Error bars indicate SEM of three biological repeats. (B) HMC-1 cells (4  105) were treated with TR for 2 h and stimulated with TSLP (20 ng/ml) for 8 h. The IL-13 production was measured with ELISA. Error bars indicate SEM of three biological repeats. #p < 0.05; significantly different from unstimulated cells. *p < 0.05; significantly different from TSLP-stimulated cells.

N.-R. Han et al. / Biomedicine & Pharmacotherapy 79 (2016) 71–77

75

Fig. 5. Regulatory effect of TR on levels of TNF-a in HMC-1 cells. (A) HMC-1 cells (1 106) were treated with TR for 2 h and stimulated with TSLP (20 ng/ml) for 6 h. The TNF-a mRNA expression was analyzed with the real-time quantitative PCR analysis. Error bars indicate SEM of three biological repeats. (B) HMC-1 cells (4  105) were treated with TR for 2 h and stimulated with TSLP (20 ng/ml) for 8 h. The TNF-a production was measured with ELISA. Error bars indicate SEM of three biological repeats. #p < 0.05; significantly different from unstimulated cells. *p < 0.05; significantly different from TSLP-stimulated cells.

such as caspase-3 and cleaved PARP are mediated by p53 [42]. We reported that the MDM2 levels were increased in mast cellmediated diseases, such as AD [15]. And the levels of inflammatory cytokines and chemokines were less in MDM2-deficient lesions compared with those in control lesions [15]. Ki67 is used to be an important parameter in the pathogenesis of AD [43]. MDM2 knockdown was reported to reduce Ki67 expression [44]. In addition, cleaved caspase-3 and cleaved PARP were also involved in allergic reactions [45,46]. TR was reported to attenuate proliferation and induce apoptosis of leukemia cells through activating apoptotic factors [47]. In this study, TR inhibited the mast cell proliferation and Ki67 mRNA expression in the TSLPstimulated mast cells. And TR inhibited the expression of MDM2, whereas TR increased the expressions of p53, PARP, and caspase3 in the TSLP-stimulated HMC-1 cells. These results suggest that TR might have an anti-proliferative effect by modulating the levels of proteins related to anti-apoptosis/apoptosis in mast cells. Also, it implies that TR could regulate mast cell-mediated allergic reactions through inhibiting the mast cell proliferation. The cytokine IL-13 is called mast cell growth factor due to promoting the mast cell proliferation [31]. The blockade of

IL-13 signaling decreased the cell proliferation [48]. Also, IL-13 is associated predominantly with chronic inflammatory reactions [20]. In allergic asthma, IL-13 was found to be a key factor and therapeutic administration of an IL-13 inhibitor in mice successfully prevented allergic diseases [49]. TSLP deficiency attenuated IL-13 levels in mast cell-mediated allergic reactions [15]. TSLP-TSLPR signaling is involved in the AD pathogenesis induced by IL-13 [20]. In this study, TR inhibited the mRNA expression and production of IL-13 in the TSLP-stimulated HMC-1 cells. TR decreased mRNA expression of IL-7Ra and TSLPR. In addition, because HMC-1 cells express IL-13 receptors [50,51], we presume that the stimulation with TSLP and an autocrine manner of endogenous IL-13 would promote synergistically the mast cell proliferation. Thus, these data imply that TR would have anti-allergic effects by regulating the levels of IL-13. TNF-a plays a central role in the pathogenesis of inflammatory diseases [52]. TNF-a in combination with IL-13 amplifies inflammatory reactions [53]. Dexamethasone has an anti-allergic and inflammatory effect, inhibiting the levels of TNF-a [54]
In this study, TR inhibited the mRNA expression and production of TNF-a in the TSLP-stimulated HMC-1 cells. Thus, we propose that TR

Fig. 6. Regulatory effect of TR on expression of IL-7Ra and TSLPR in HMC-1 cells. HMC-1 cells (1 106) were treated with TR for 2 h and then stimulated with TSLP (20 ng/ml) for 8 h. The mRNA expression of (A) IL-7Ra and (B) TSLPR was assessed by real-time quantitative PCR analysis. Error bars indicate SEM of three biological repeats. #p < 0.05; significantly different from unstimulated cells. *p < 0.05; significantly different from TSLP-stimulated cells.

76

N.-R. Han et al. / Biomedicine & Pharmacotherapy 79 (2016) 71–77

would regulate mast cell-mediated allergic reactions through regulating the levels of TNF-a in its pathogenesis aggravated by TSLP.

[12]

5. Conclusion

[13]

It needed to develop an effective and individualized treatment, because there is the interindividual deviation between patients with AD. To achieve this, a deeper understanding of the complicated pathogenesis of AD is necessary to determine effective and therapeutic strategies about anti-AD drugs. Recently, it was reported that TSLP promotes the mast cell proliferation via MDM2 activation and aggravates the mast cell-mediated allergic reactions, such as AD. Thus, we noted to determine an effect of drug with a new novel insight into the complex pathophysiology of AD. Our data shows that TR has anti-proliferative activity against the mast cell proliferation promoted by TSLP. This is the first evidence of the ability of TR to inhibit the levels of Ki67, MDM2, and IL-13, resulting in the suppression of the mast cell proliferation. In addition, TR increased the expression of cleaved PARP and caspase3 in the TSLP-stimulated HMC-1 cells. TR inhibited the TNF-a mRNA expression and production induced by TSLP in mast cells. TR also decreased the TSLP-induced IL-7Ra/TSLPR mRNA expression. These compelling evidences provide an intensive basis for further exploration of TR as a therapeutic drug against mast cell-mediated diseases, such as AD from at least these results. However, there are no data about the potential role of TR on the regulation of MDM2 in mouse models of allergic diseases in this present study. Therefore, in vivo studies about the regulation of MDM2 are needed to further elucidate the regulatory effect of TR on mast cell-mediated allergic diseases.

[14]

Conflict of interest The authors have no conflict of interest.

[15]

[16] [17]

[18] [19]

[20]

[21]

[22] [23] [24]

[25]

[26]

[27]

Acknowledgments

[28]

This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2015R1A1A3A04000922).

[29]

References [1] J.Y. Kim, M.S. Jeong, M.K. Park, M.K. Lee, S.J. Seo, Time-dependent progression from the acute to chronic phases in atopic dermatitis induced by epicutaneous allergen stimulation in NC/Nga mice, Exp. Dermatol. 23 (2014) 53–57. [2] M.K. Church, F.J. Levi-Schaffer, The human mast cell, Allergy Clin. Immunol. 99 (1997) 155–160. [3] D. Voehringer, Protective and pathological roles of mast cells and basophils, Nat. Rev. Immunol. 13 (2013) 362–375. [4] Z.Q. Hu, K. Kobayashi, N. Zenda, Tumor necrosis factor-alpha- and interleukin6-triggered mast cell development from mouse spleen cells, Blood 89 (1997) 526–533. [5] F.T. Liu, H. Goodarzi, H.Y. Chen, IgE mast cells, and eosinophils in atopic dermatitis, Clin. Rev. Allergy Immunol. 41 (2011) 298–310. [6] Y. Okayama, T. Kawakami, Development migration, and survival of mast cells, Immunol. Res. 34 (2006) 97–115. [7] Z.Q. Hu, W.H. Zhao, T. Shimamura, Regulation of mast cell development by inflammatory factors, Curr. Med. Chem. 14 (2007) 3044–3050. [8] I.T. Harvima, G. Nilsson, Mast cells as regulators of skin inflammation and immunity, Acta Derm. Venereol. 91 (2011) 644–650. [9] T. Uchida, H. Suto, C. Ra, H. Ogawa, T. Kobata, K. Okumura, Preferential expression of T(h) 2-type chemokine and its receptor in atopic dermatitis, Int. Immunol. 14 (2002) 1431–1438. [10] S. Demehri, M. Morimoto, M.J. Holtzman, R. Kopan, Skin-derived TSLP triggers progression from epidermal-barrier defects to asthma, PLoS Biol. 7 (2009) e1000067. [11] J. Yoo, M. Omori, D. Gyarmati, B. Zhou, T. Aye, A. Brewer, et al., Spontaneous atopic dermatitis in mice expressing an inducible thymic stromal

[30]

[31]

[32]

[33]

[34]

[35] [36] [37]

[38] [39] [40] [41]

lymphopoietin transgene specifically in the skin, J. Exp. Med. 202 (2005) 541– 579. M.M. Miazgowicz, M.B. Headley, R.P. Larson, S.F. Ziegler, Thymic stromal lymphopoietin and the pathophysiology of atopic disease, Expert Rev. Clin. Immunol. 5 (2009) 547–556. M. Kashyap, Y. Rochman, R. Spolski, L. Samsel, W.J. Leonard, Thymic stromal lymphopoietin is produced by dendritic cells, J. Immunol. 187 (2011) 1207– 1211. Y.J. Liu, Thymic stromal lymphopoietin and OX40 ligand pathway in the initiation of dendritic cell-mediated allergic inflammation, J. Allergy Clin. Immunol. 120 (2007) 238–244. N.R. Han, H.A. Oh, S.Y. Nam, P.D. Moon, D.W. Kim, H.M. Kim, et al., TSLP induces mast cell development and aggravates allergic reactions through the activation of MDM2 and STAT6, J. Invest. Dermatol. 134 (2014) 2521–2530. Y. Haupt, R. Maya, A. Kazaz, M. Oren, Mdm2 promotes the rapid degradation of p53, Nature 387 (1997) 296–299. J. Wang, T. Zheng, X. Chen, X. Song, X. Meng, N. Bhatta, et al., MDM2 antagonist can inhibit tumor growth in hepatocellular carcinoma with different types of p53 in vitro, J. Gastroenterol. Hepatol. 26 (2011) 371–377. P. Zhang, S. Elabd, S. Hammer, V. Solozobova, H. Yan, F. Bartel, et al., TRIM25 has a dual function in the p53/Mdm2 circuit, Oncogene 34 (2015) 5729–5738. T. Hashimoto, T. Ichiki, J. Ikeda, E. Narabayashi, H. Matsuura, R. Miyazaki, et al., Inhibition of MDM2 attenuates neointimal hyperplasia via suppression of vascular proliferation and inflammation, Cardiovasc. Res. 91 (2011) 711–719. M.H. Oh, S.Y. Oh, J. Yu, A.C. Myers, W.J. Leonard, Y.J. Liu, et al., IL-13 induces skin fibrosis in atopic dermatitis by thymic stromal lymphopoietin, J. Immunol. 186 (2011) 7232–7242. Y. Nagata, H. Kamijuku, M. Taniguchi, S. Ziegler, K. Seino, Differential role of thymic stromal lymphopoietin in the induction of airway hyperreactivity and Th2 immune response in antigen-induced asthma with respect to natural killer T cell function, Int. Arch. Allergy Immunol. 144 (2007) 305–314. C. Liu, Z. Liu, Z. Li, Y. Wu, Molecular regulation of mast cell development and maturation, Mol. Biol. Rep. 37 (2010) 1993–2001. J. Scovill, E. Blank, M. Konnick, E. Nenortas, T. Shapiro, Antitrypanosomal activities of tryptanthrins, Antimicrob. Agents Chemother. 46 (2002) 882–883. M.C. Recio, M. Cerdá-Nicolás, O. Potterat, M. Hamburger, J.L. Ríos, Antiinflammatory and antiallergic activity in vivo of lipophilic Isatis tinctoria extracts and tryptanthrin, Planta Med. 72 (2006) 539–546. K. Iwaki, E. Ohashi, N. Arai, K. Kohno, S. Ushio, M. Taniguchi, et al., Tryptanthrin inhibits Th2 development, and IgE-mediated degranulation and IL4 production by rat basophilic leukemia RBL-2H3 cells, J. Ethnopharmacol. 134 (2011) 450–459. X. Liao, X. Zhou, N.K. Mak, K.N. Leung, Tryptanthrin inhibits angiogenesis by targeting the VEGFR2-mediated ERK1/2 signalling pathway, PLoS One 8 (2013) e82294. M.H. Gulam, R. Richa, R. Geeta, B.S. Harikesh, K.T. Ajit, K. Vikas, Potential mechanism of anti-diabetic activity of Picrorhiza kurroa, TANG 4 (2014) e27. N.R. Han, P.D. Moon, H.M. Kim, H.J. Jeong, Tryptanthrin ameliorates atopic dermatitis through down-regulation of TSLP, Arch. Biochem. Biophys. 542 (2014) 14–20. H. Brizova, M. Kalinova, L. Krskova, M. Mrhalova, R. Kodet, A novel quantitative PCR of proliferation markers (Ki-67, topoisomerase IIalpha, and TPX2): an immunohistochemical correlation testing, and optimizing for mantle cell lymphoma, Virchows Arch. 456 (2010) 671–679. N. Kee, S. Sivalingam, R. Boonstra, J.M. Wojtowicz, The utility of Ki-67 and BrdU as proliferative markers of adult neurogenesis, J. Neurosci. Methods 115 (2002) 97–105. D. Kaur, F. Hollins, L. Woodman, W. Yang, P. Monk, R. May, et al., Mast cells express IL-13R alpha 1: IL-13 promotes human lung mast cell proliferation and Fc epsilon RI expression, Allergy 61 (2006) 1047–1053. S.S. Metwally, Y.M. Mosaad, E.R. Abdel-Samee, M.A. El-Gayyar, A.M. AbdelAziz, F.A. El-Chennawi, IL-13 gene expression in patients with atopic dermatitis: relation to IgE level and to disease severity, Egypt. J. Immunol. 11 (2004) 171–177. Y.J. Liu, Thymic stromal lymphopoietin and OX40 ligand pathway in the initiation of dendritic cell-mediated allergic inflammation, J. Allergy Clin. Immunol. 120 (2007) 238–244. L. Horsmanheimo, I.T. Harvima, A. Järvikallio, R.J. Harvima, A. Naukkarinen, M. Horsmanheimo, Mast cells are one major source of interleukin-4 in atopic dermatitis, Br. J. Dermatol. 131 (1994) 348–353. H. Sugiura, M. Uehara, Mitosis of mast cells in skin lesions of atopic dermatitis, Acta Derm. Venereol. 73 (1993) 296–299. T. Kawakami, T. Ando, M. Kimura, B.S. Wilson, Y. Kawakami, Mast cells in atopic dermatitis, Curr. Opin. Immunol. 21 (2009) 666–678. V. Soumelis, P.A. Reche, H. Kanzler, W. Yuan, G. Edward, B. Homey, et al., Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP, Nat. Immunol. 3 (2002) 673–680. C.C. Chao, Mechanisms of p53 degradation, Clin. Chim. Acta 438C (2014) 139– 147. Z. Wang, B. Li, Mdm2 links genotoxic stress and metabolism to p53, Protein Cell 1 (2010) 1063–1072. G.M. Cohen, Caspase: the executioners of apoptosis, Biochem. J. 326 (1997) 1– 16. Y.A. Lazebnik, S.H. Kaufmann, S. Desnoyers, G.G. Poirier, W.C. Earnshaw, Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE, Nature 371 (1994) 346–347.

N.-R. Han et al. / Biomedicine & Pharmacotherapy 79 (2016) 71–77 [42] Q. Yu, Restoring p53-mediated apoptosis in cancer cells: new opportunities for cancer therapy, Drug Resist. Updat. 9 (2006) 19–25. [43] S.G. Sapuntsova, N.P. Mel’nikova, V.I. Deigin, E.A. Kozulin, S.S. Timoshin, Proliferative processes in the epidermis of patients with atopic dermatitis treated with thymodepressin, Bull. Exp. Biol. Med. 133 (2002) 488–490. [44] A. Künkele, K. De Preter, L. Heukamp, T. Thor, K.W. Pajtler, W. Hartmann, et al., Pharmacological activation of the p53 pathway by nutlin-3 exerts antitumoral effects in medulloblastomas, Neuro Oncol. 14 (2012) 859–869. [45] Z. Gao, Y. Ma, D. Zhao, X. Zhang, H. Zhou, H. Liu, et al., Neochromine S5 improves contact hypersensitivity through a selective effect on activated T lymphocytes, Biochem. Pharmacol. 92 (2014) 358–368. [46] F. Fang, Y. Tang, Z. Gao, Q. Xu, A novel regulatory mechanism of naringenin through inhibition of T lymphocyte function in contact hypersensitivity suppression, Biochem. Biophys. Res. Commun. 397 (2010) 163–169. [47] S. Miao, X. Shi, H. Zhang, S. Wang, J. Sun, W. Hua, et al., Proliferationattenuating and apoptosis-inducing effects of tryptanthrin on human chronic myeloid leukemia K562 cell line in vitro, Int. J. Mol. Sci. 12 (2011) 3831–3845. [48] S.C. Tsai, S.J. Lin, P.W. Chen, W.Y. Luo, T.H. Yeh, H.W. Wang, et al., EBV Zta protein induces the expression of interleukin-13, promoting the proliferation of EBVinfected B cells and lymphoblastoid cell lines, Blood 114 (2009) 109–118.

77

[49] F. Brombacher, The role of interleukin-13 in infectious diseases and allergy, Bioessays 22 (2000) 646–656. [50] G.P. Katsoulotos, M. Qi, J.C. Qi, K. Tanaka, W.E. Hughes, T.J. Molloy, et al., The diacylglycerol-dependent translocation of ras guanine nucleotide-releasing protein 4 inside a human mast cell line results in substantial phenotypic changes, including expression of interleukin 13 receptor alpha2, J. Biol. Chem. 283 (2008) 1610–1621. [51] S. Yu, R. Zhang, C. Zhu, J. Cheng, H. Wang, J. Wu, MicroRNA-143 downregulates interleukin-13 receptor alpha1 in human mast cells, Int. J. Mol. Sci. 14 (2013) 16958–16969. [52] M.C. Wasko, J. Kay, E.C. Hsia, M.U. Rahman, Diabetes mellitus and insulin resistance in patients with rheumatoid arthritis: risk reduction in a chronic inflammatory disease, Arthritis Care Res. (Hoboken) 63 (2011) 512–521. [53] X. Zhou, H. Hu, S. Balzar, J.B. Trudeau, S.E. Wenzel, MAPK regulation of IL-4/IL13 receptors contributes to the synergistic increase in CCL11/eotaxin-1 in response to TGF-b1 and IL-13 in human airway fibroblasts, J. Immunol. 188 (2012) 6046–6054. [54] S.H. Ferreira, F.Q. Cunha, B.B. Lorenzetti, M.A. Michelin, M. Perretti, R.J. Flower, et al., Role of lipocortin-1 in the anti-hyperalgesic actions of dexamethasone, Br. J. Pharmacol. 121 (1997) 883–888.