- Email: [email protected]
Inhibition of Viral Aphid Transmission by the N-Terminus of the Maize Dwarf Mosaic Virus Coat Protein
VIROLOGY
213, 676–679 (1995)
SHORT COMMUNICATION Inhibition of Viral Aphid Transmission by the N-Terminus of the Maize Dwarf Mosaic Virus Coat Protein RAPHAEL SALOMON*,1 and FRANC¸OISE BERNARDI† *Department of Virology, Agricultural Research Organization, The Volcani Center, P.O.B. 6, Bet Dagan 50 250, Israel; and †Institut Jacques Monod, 2 Place Jussieu—Tour 43, 75251 Paris Cedex 05, France Received April 14, 1995; accepted September 5, 1995 Since removal of the exposed N-terminus of the coat protein of some potyviruses abolishes aphid transmission, the role of this coat protein region of maize dwarf mosaic potyvirus (MDMV) in aphid transmission was investigated. The viral cDNA encoding this region was cloned and expressed as a fusion protein in bacteria. The resulting purified N-terminus of the coat protein was used in controlled aphid transmission experiments in competition with MDMV. The results show that this region inhibits aphid transmission of MDMV, indicating a direct involvement of the N-terminal region of the coat protein in aphid transmission. q1995 Academic Press, Inc.
Maize dwarf mosaic virus (MDMV) is a member of the Potyviridae. These viruses are composed of a monopartite positive-sense, single-stranded RNA molecule of about 10 kb encapsidated by approximately 2000 coat proteins (CP) forming a long flexuous particle. The genome encodes a single polyprotein of about 3000 amino acids which is cleaved into functional proteins by three viral proteinases (reviewed in 1). Potyviruses are transmitted from plant to plant by vectors, aphids in most cases, in a nonpersistent mode; transmission requires two virally encoded factors (2), the CP as constituent of the virion and the helper component–proteinase (HC–Pro). The CP of potyviruses is composed of a core that is well conserved among the viruses of this family and highly variable (in length and sequence) N- and C-terminal regions which are characteristic of a given potyvirus; these terminal regions are exposed on the surface of the virus particle as demonstrated by their susceptibility to proteolytic cleavage (3, 4). Removal of the N-terminal region of the CP results in loss of aphid transmission (5, 6), although such proteinase-treated virions are still infectious when inoculated mechanically. A region of the protein which influences aphid transmissibility has been pinpointed to the DAG (Asp-Ala-Gly) motif present in the N-terminal region of the CP of the aphid-transmissible potyviruses (7, 8). By introducing an A (Ala) to T (Thr) mutation in the DAG motif of an infectious and aphid-
transmissible clone of tobacco vein mottle potyvirus leading to loss of aphid transmissibility, Atreya et al. (8) demonstrated that this motif is essential for aphid transmission. HC – Pro is a multifunctional protein; mutations in two distinct domains have been shown to be involved in aphid transmission (9). The relationships between the CP and HC – Pro and between these proteins and the aphid, as well as the mechanism of transmission, are still a matter of speculation. Since the N-terminal segment of the CP is necessary for aphid transmission, we hypothesized that the segment alone containing the DAG sequence might compete with the virion during aphid acquisition. To test this hypothesis, the N-terminal region of the CP gene of an Israeli MDMV isolate (MDMV-L) was cloned into a bacterial expression vector, expressed as a fusion protein, purified, and utilized in MDMV-controlled aphid transmission experiments. The results presented here clearly demonstrate that competition occurs between the intact virions and the bacterially produced protein carrying the N-terminus of the CP. The 5*-terminal region of the CP gene (191 bp) was amplified by RT – PCR performed on MDMV RNA extracted from purified virus (10). Since the MDMV-L RNA sequence is unknown, the oligonucleotide used for priming the RT reaction (5*-GCGAATATTAGTCGTACCAGCATCTACATC3*) was designed using the sequence established for sugarcane mosaic potyvirus (SCMV-SC; 11) on the basis of the homologies that exist between the core regions of all the MDMV
1 To whom correspondence and reprint requests should be addressed. Fax: 972 3 9604180.
0042-6822/95 $12.00
676
Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4088$7539
10-17-95 06:06:01
viras
AP-Virology
SHORT COMMUNICATION
FIG. 1. Expression and purification of prMV534. (a) Structure of the fusion protein prMV534. Open box is MBP, hatched box corresponds to the N-terminus of the CP (N-ter CP), and arrow indicates the Xa cleavage site. (b) Fractions from the different purification steps are shown on an SDS–10% polyacrylamide gel. Panel A, Coomassiestained gel; panel B, corresponding Western blot using anti-MDMV antibodies. Lanes 1 and 2 are the total protein extracts, respectively, before and after 2 hr of induction of strain MV534 with 0.3 mM isopropylb-thiogalactopyranoside; lane 3, prMV534 (52 kDa) collected after chromatography on an amylose column; lane 4, cleavage products of prMV534 by Xa, the MBP 42 kDa not detected in panel B and the Nterminal peptide of the MDMV CP with an apparent mass of 14 kDa; lane 5, purified MBP-bgala (52 kDa) not detected in panel B; lane 6, MDMV CP extracted from the virion. The arrows to the right indicate the size markers in kDa.
and SCMV strains. The sequence of the second primer 5*CGGGATCCTCTGGAACAGTCGATGCAGG3* was based on the identity that is known to exist at the amino acid level between the N-terminus of SCMV-SC and MDMV-B (4, 12, 13), except for the change of the alanine to a serine codon for the first amino acid. These oligonucleotides included two restriction sites (BamHI and SspI) for oriented cloning into pGEX-2T (14) in the adequate frame so as to achieve the fusion between the glutathione S-transferase and the N-terminus of the CP. Avian myeloblastosis virus RT (Promega) and Taq polymerase (Boehringer) were used for RT – PCR according to the suppliers’ recommendations. Cloning into pGEX-2T, for which the primers were designed, resulted in low yield of the fusion protein; therefore, a BamHI – RsaI fragment (181 bp) carrying the N-terminal region of the MDMV CP gene was subcloned into the BamHI and blunted PstI sites of pMal-c2 (New England Biolabs). Plasmids of the correct size were isolated from Escherichia coli strain SCS1 and tested for expression of the fusion protein between the maltose binding protein (MBP) and the N-terminus of the MDMV CP. Figure 1 shows an SDS – polyacrylamide gel of the fraction from purification steps of the protein encoded by pMV534 (fusion between the MBP and N-terminus of the MDMV CP: prMV534) and of MBP- bgala (which is the protein expressed from pMal-c2 devoid of insert) used as a con-
/ m4088$7539
10-17-95 06:06:01
viras
677
trol. Western blot analyses performed using antiMDMV polyclonal antibodies (15) confirmed the origin and correct expression of the fused protein. After cleavage of the fusion protein by the Xa proteinase, a polypeptide of 77 amino acids with a calculated mass of 8 kDa was released; it is composed of 59 amino acids of MDMV CP flanked by 6 and 12 nonviral amino acids at the N- and C-termini, respectively (not shown), as deduced from the sequence (16) determined on the corresponding region (Fig. 2). The migration of this protein on an SDS – polyacrylamide gel corresponds to a 14-kDa protein; the reason for this aberrant migration is not known. To test the biological effect of the bacterially expressed proteins, seven independent experiments (I to VII) were performed. Cultures of Myzus persicae were maintained on mustard plants (Genus Brassica). One hundred fifty apterous aphids were collected by suction, starved for 2 hr (17), and then prefed for 5 min through membranes on a 10% sucrose solution containing one of the bacterially expressed proteins (1 mg/ml in Tris – HCl 20 mM, NaCl 150 mM, 10 mM maltose, pH 7.5). Following this prefeeding period, only the aphids present on the membrane were transferred for 5 min to MDMV-infected sweet corn leaves for virus and HC – Pro acquisition. Since not all aphids fed on the plants, only two to three aphids were placed on each test plant (10 to 14-day-old ‘‘Jubilee’’ seedlings) for 18 – 20 hr to colonize the seedlings and transmit the virus. The aphids were then eliminated by spraying the seedlings twice with 0.2% nicotine sulfate at 30min intervals and the treated seedlings were transferred to an insect-proof greenhouse for 2 – 3 weeks. Within 8 – 10 days symptoms of the viral disease developed. Duplicate ELISA tests using antigen-coated plates (ACP-ELISA) were performed on each plant (15). To avoid overlooking plants with slowly developing disease symptoms, the ELISA test was repeated a week later, and sometimes again after an additional week. The results expressed as number of plants infected over the total number of plants used are summarized in Table 1. Each experiment involved the following products: prMV534, prMV534-Xa (the mixture of the MBP and the N-terminal CP polypeptide obtained by treatment of prMV534 with Xa proteinase), and as controls, MBP-b gala, the sucrose solution alone, and a group designated ‘‘control’’ that acquired the virus from infected leaves without prefeeding on sucrose solution. MBP- bgala had no inhibitory effect on MDMV aphid transmission as compared to the control, 51.4 vs 48%. Prefeeding aphids on sucrose alone before virus – HC – Pro acquisition reduced the level of transmission slightly (42.7%), but not significantly. On the contrary,
AP-Virology
678
SHORT COMMUNICATION
FIG. 2. Nucleotide sequence of the 5* region of the CP gene of MDMV and the deduced amino acid sequence. The underlined nucleotides correspond to the primer sequences homologous to SCMV-SC. The underlined amino acids correspond to conserved amino acids among MDMV and SCMV strains.
prefeeding on prMV534 or prMV534-Xa reduced transmission to 12.5 and 7.6%, respectively; prMV534-Xa completely inhibited viral transmission in three of seven experiments conducted. We have performed preliminary transmission experiments (not shown) using a mutant of prMV534 in which the DAG motif as well as the 12 extra amino acids of nonviral origin at the C-terminus of prMV534 had been deleteted: no inhibition was observed. Since MBP-bgala and this mutant had no inhibitory effect, these results demonstrate that the N-terminus of the MDMV CP is the competing factor. The large number of plants and aphids used in seven independent experiments minimizes the possibility of an artifactual result. Our results clearly show that feeding a polypeptide corresponding to the N-terminus of the CP interferes with the transmission process, bringing the level of aphid transmission from about 50% in the controls to 12.5 and 7.6% for the uncleaved and cleaved fusion proteins, respectively. Potyvirus transmission is a complex process involving interactions between several partners: virion, HC – Pro, host plant, and aphid. It has been shown using different techniques (18, 19) that the virus alone is not able to bind to the aphid stylets and that HC – Pro is absolutely required for a correct localization of the virus particles and for efficient transmission. The re-
sults presented here were obtained by prefeeding the aphids with the N-terminus of the CP (as a fusion protein or cleaved by Xa proteinase) and allowing acquisition of virions and HC – Pro to occur in the acquisition step. Under these conditions inhibition by the N-terminus of the CP is observed. The simplest hypothesis to explain the difference in behavior of the N-terminus of the CP, when it is part of the virus particle or as free protein, is that in the intact particle the N-terminus is not free to interact with the aphid stylets and that the presence of HC – Pro is required to induce a conformational change so as to unfold the N-terminus of the CP. Even though the N-terminal region is on the outer surface of the virus particle it may interact with the core region of the CP and necessitate the interaction of HC – Pro to be released. Interactions of this type have been reported recently in the case of the transcription factor TFIIB (20), whose N- and Ctermini interact: binding of an activator molecule to the N-terminus is required for binding of TFIIB to other transcription factors. Interaction between HC and CP has been shown to occur in the case of cauliflower mosaic virus and its requirement for aphid transmission demonstrated (21). However, no interaction between HC – Pro and CP of potyviruses has been described to date. If such an interaction exists, its demonstration would be of great importance, since it
TABLE 1 Effect of the N-Terminus of the MDMV CP on Transmission Infected plants/inoculated plantsa Competing protein prMV534 prMV534-Xa MBP-bgala Sucrose Control
I
II
III
IV
V
VI
VII
Total
% of transmission
1/12 0/12 5/12 4/12 5/12
3/12 3/12 7/12 5/12 6/12
3/16 2/16 9/16 8/16 11/15
3/18 2/18 13/18 8/17 10/18
0/14 0/14 8/14 8/14 6/13
3/15 0/15 4/16 3/15 4/15
0/17 1/17 9/17 8/17 7/17
13/104 8/104 54/105 44/103 49/102
12.5 7.6 51.4 42.7 48
Note. A statistical analysis was performed on the set of seven experiments. For each experiment, the rate of infection was calculated as the ratio of infected plants over total plants. Angular transformation was used to normalize the ratios. The effect of the competing proteins on the rate of infection was tested using ANOVA and post-hoc test (Fisher least significant difference) using Statview 4.01. Data can be grouped as two sets, controls (MBP-bgala, Sucrose, and Control) and competing proteins (prMV534 and prMV534-Xa), exhibiting significant differences in infection rate (P õ 1004) but no difference within each group (P ú 0.3). a Infection was determined by the appearance of symptoms and ACP-ELISA tests.
/ m4088$7539
10-17-95 06:06:01
viras
AP-Virology
SHORT COMMUNICATION
would pave the way to determining if the DAG motif is involved in interaction with HC – Pro or with the aphid stylets. Further information on the role of the DAG motif will be obtained with mutants of the N-terminus of the CP deleted or mutated at this motif and used in competition experiments which are already under way. ACKNOWLEDGMENTS We are most grateful to Anne-Lise Haenni for her support throughout this work. We thank Marc Girondot, who kindly performed the statistical analysis, and Anita Buffing and Shmuel Levy for excellent technical help. This work was a contribution to the Agricultural Research Organization Volcani Center, Bet-Dagan, Israel 1610E 1995 series. The Institut Jacques Monod is an ‘‘Institut Mixte CNRS-Universite´ Paris VII.’’
REFERENCES 1. Riechmann, J. L., Lain, S., and Garcia, J. A., J. Gen. Virol. 73, 1–16 (1992). 2. Pirone, T. P., Semin. Virol. 2, 81–87 (1991). 3. Shukla, D. D., Strike, P. M., Tracy, S. L., Gough, K. H., and Ward, C. W., J. Gen. Virol. 69, 493–502 (1988). 4. Shukla, D. D., and Ward, C. W., Adv. Virus Res. 36, 273–313 (1989). 5. Salomon, R., J. Gen. Virol. 70, 1943–1949 (1989).
/ m4088$7539
10-17-95 06:06:01
viras
679
6. Salomon, R., Arch. Virol. Suppl. 5, 75–76 (1992). 7. Harrison, B. D., and Robinson, D. J., Phil. Trans. R. Soc. London Ser. B 321, 447–462 (1988). 8. Atreya, C. D., Raccah, B., and Pirone, T. P., Virology 178, 161–165 (1990). 9. Granier, F., Durand-Tardif, M., Casse-Delbart, F., Lecoq, H., and Robaglia, C., J. Gen. Virol. 74, 2737–2742 (1993). 10. Cohen, J., Salomon, R., and Loebenstein, G., Phytopathology 78, 809–811 (1988). 11. Frenkel, M. J., Jilka, J. M., McKern, N. M., Strike, P. M., Clark, J. M. J., Shukla, D. D., and Ward, C. W., J. Gen. Virol. 72, 237– 242 (1991). 12. Lenardon, S., Gordon, D. T., and Gingery, R. E., Phytopathology 83, 86–91 (1993). 13. Lesemann, D. E., Shukla, D. D., Tosic, M., and Huth, W., Arch. Virol. Suppl. 5, 353–361 (1992). 14. Smith, D. B., and Johnson, K. S., Gene 67, 31 (1988). 15. Koch, M., and Salomon, R., Plant Dis. 78, 785–788 (1994). 16. Sanger, F., Nicklen, S., and Coulson, A. R., Proc. Natl. Acad. Sci. USA 74, 5463–5467 (1977). 17. Murant, A. F., Raccah, B., and Pirone, T. P., ‘‘The Plant Viruses’’ (R. G. Milne, Ed.), Vol. 4, pp. 237–273. Plenum, New York, 1990. 18. Raccah, B., and Pirone, T. P., Phytopathology 74, 305–308 (1984). 19. Berger, P. H., and Pirone, T. P., Virology 153, 256–261 (1986). 20. Roberts, S. G. E., and Green, M. R., Nature 371, 717–720 (1994). 21. Schmidt, I., Blanc, S., Esperandieu, P., Kuhl, G., Devauchelle, G., Louis, C., and Cerutti, M., Proc. Natl. Acad. Sci. USA 91, 8885– 8889 (1994).
AP-Virology
213, 676–679 (1995)
SHORT COMMUNICATION Inhibition of Viral Aphid Transmission by the N-Terminus of the Maize Dwarf Mosaic Virus Coat Protein RAPHAEL SALOMON*,1 and FRANC¸OISE BERNARDI† *Department of Virology, Agricultural Research Organization, The Volcani Center, P.O.B. 6, Bet Dagan 50 250, Israel; and †Institut Jacques Monod, 2 Place Jussieu—Tour 43, 75251 Paris Cedex 05, France Received April 14, 1995; accepted September 5, 1995 Since removal of the exposed N-terminus of the coat protein of some potyviruses abolishes aphid transmission, the role of this coat protein region of maize dwarf mosaic potyvirus (MDMV) in aphid transmission was investigated. The viral cDNA encoding this region was cloned and expressed as a fusion protein in bacteria. The resulting purified N-terminus of the coat protein was used in controlled aphid transmission experiments in competition with MDMV. The results show that this region inhibits aphid transmission of MDMV, indicating a direct involvement of the N-terminal region of the coat protein in aphid transmission. q1995 Academic Press, Inc.
Maize dwarf mosaic virus (MDMV) is a member of the Potyviridae. These viruses are composed of a monopartite positive-sense, single-stranded RNA molecule of about 10 kb encapsidated by approximately 2000 coat proteins (CP) forming a long flexuous particle. The genome encodes a single polyprotein of about 3000 amino acids which is cleaved into functional proteins by three viral proteinases (reviewed in 1). Potyviruses are transmitted from plant to plant by vectors, aphids in most cases, in a nonpersistent mode; transmission requires two virally encoded factors (2), the CP as constituent of the virion and the helper component–proteinase (HC–Pro). The CP of potyviruses is composed of a core that is well conserved among the viruses of this family and highly variable (in length and sequence) N- and C-terminal regions which are characteristic of a given potyvirus; these terminal regions are exposed on the surface of the virus particle as demonstrated by their susceptibility to proteolytic cleavage (3, 4). Removal of the N-terminal region of the CP results in loss of aphid transmission (5, 6), although such proteinase-treated virions are still infectious when inoculated mechanically. A region of the protein which influences aphid transmissibility has been pinpointed to the DAG (Asp-Ala-Gly) motif present in the N-terminal region of the CP of the aphid-transmissible potyviruses (7, 8). By introducing an A (Ala) to T (Thr) mutation in the DAG motif of an infectious and aphid-
transmissible clone of tobacco vein mottle potyvirus leading to loss of aphid transmissibility, Atreya et al. (8) demonstrated that this motif is essential for aphid transmission. HC – Pro is a multifunctional protein; mutations in two distinct domains have been shown to be involved in aphid transmission (9). The relationships between the CP and HC – Pro and between these proteins and the aphid, as well as the mechanism of transmission, are still a matter of speculation. Since the N-terminal segment of the CP is necessary for aphid transmission, we hypothesized that the segment alone containing the DAG sequence might compete with the virion during aphid acquisition. To test this hypothesis, the N-terminal region of the CP gene of an Israeli MDMV isolate (MDMV-L) was cloned into a bacterial expression vector, expressed as a fusion protein, purified, and utilized in MDMV-controlled aphid transmission experiments. The results presented here clearly demonstrate that competition occurs between the intact virions and the bacterially produced protein carrying the N-terminus of the CP. The 5*-terminal region of the CP gene (191 bp) was amplified by RT – PCR performed on MDMV RNA extracted from purified virus (10). Since the MDMV-L RNA sequence is unknown, the oligonucleotide used for priming the RT reaction (5*-GCGAATATTAGTCGTACCAGCATCTACATC3*) was designed using the sequence established for sugarcane mosaic potyvirus (SCMV-SC; 11) on the basis of the homologies that exist between the core regions of all the MDMV
1 To whom correspondence and reprint requests should be addressed. Fax: 972 3 9604180.
0042-6822/95 $12.00
676
Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4088$7539
10-17-95 06:06:01
viras
AP-Virology
SHORT COMMUNICATION
FIG. 1. Expression and purification of prMV534. (a) Structure of the fusion protein prMV534. Open box is MBP, hatched box corresponds to the N-terminus of the CP (N-ter CP), and arrow indicates the Xa cleavage site. (b) Fractions from the different purification steps are shown on an SDS–10% polyacrylamide gel. Panel A, Coomassiestained gel; panel B, corresponding Western blot using anti-MDMV antibodies. Lanes 1 and 2 are the total protein extracts, respectively, before and after 2 hr of induction of strain MV534 with 0.3 mM isopropylb-thiogalactopyranoside; lane 3, prMV534 (52 kDa) collected after chromatography on an amylose column; lane 4, cleavage products of prMV534 by Xa, the MBP 42 kDa not detected in panel B and the Nterminal peptide of the MDMV CP with an apparent mass of 14 kDa; lane 5, purified MBP-bgala (52 kDa) not detected in panel B; lane 6, MDMV CP extracted from the virion. The arrows to the right indicate the size markers in kDa.
and SCMV strains. The sequence of the second primer 5*CGGGATCCTCTGGAACAGTCGATGCAGG3* was based on the identity that is known to exist at the amino acid level between the N-terminus of SCMV-SC and MDMV-B (4, 12, 13), except for the change of the alanine to a serine codon for the first amino acid. These oligonucleotides included two restriction sites (BamHI and SspI) for oriented cloning into pGEX-2T (14) in the adequate frame so as to achieve the fusion between the glutathione S-transferase and the N-terminus of the CP. Avian myeloblastosis virus RT (Promega) and Taq polymerase (Boehringer) were used for RT – PCR according to the suppliers’ recommendations. Cloning into pGEX-2T, for which the primers were designed, resulted in low yield of the fusion protein; therefore, a BamHI – RsaI fragment (181 bp) carrying the N-terminal region of the MDMV CP gene was subcloned into the BamHI and blunted PstI sites of pMal-c2 (New England Biolabs). Plasmids of the correct size were isolated from Escherichia coli strain SCS1 and tested for expression of the fusion protein between the maltose binding protein (MBP) and the N-terminus of the MDMV CP. Figure 1 shows an SDS – polyacrylamide gel of the fraction from purification steps of the protein encoded by pMV534 (fusion between the MBP and N-terminus of the MDMV CP: prMV534) and of MBP- bgala (which is the protein expressed from pMal-c2 devoid of insert) used as a con-
/ m4088$7539
10-17-95 06:06:01
viras
677
trol. Western blot analyses performed using antiMDMV polyclonal antibodies (15) confirmed the origin and correct expression of the fused protein. After cleavage of the fusion protein by the Xa proteinase, a polypeptide of 77 amino acids with a calculated mass of 8 kDa was released; it is composed of 59 amino acids of MDMV CP flanked by 6 and 12 nonviral amino acids at the N- and C-termini, respectively (not shown), as deduced from the sequence (16) determined on the corresponding region (Fig. 2). The migration of this protein on an SDS – polyacrylamide gel corresponds to a 14-kDa protein; the reason for this aberrant migration is not known. To test the biological effect of the bacterially expressed proteins, seven independent experiments (I to VII) were performed. Cultures of Myzus persicae were maintained on mustard plants (Genus Brassica). One hundred fifty apterous aphids were collected by suction, starved for 2 hr (17), and then prefed for 5 min through membranes on a 10% sucrose solution containing one of the bacterially expressed proteins (1 mg/ml in Tris – HCl 20 mM, NaCl 150 mM, 10 mM maltose, pH 7.5). Following this prefeeding period, only the aphids present on the membrane were transferred for 5 min to MDMV-infected sweet corn leaves for virus and HC – Pro acquisition. Since not all aphids fed on the plants, only two to three aphids were placed on each test plant (10 to 14-day-old ‘‘Jubilee’’ seedlings) for 18 – 20 hr to colonize the seedlings and transmit the virus. The aphids were then eliminated by spraying the seedlings twice with 0.2% nicotine sulfate at 30min intervals and the treated seedlings were transferred to an insect-proof greenhouse for 2 – 3 weeks. Within 8 – 10 days symptoms of the viral disease developed. Duplicate ELISA tests using antigen-coated plates (ACP-ELISA) were performed on each plant (15). To avoid overlooking plants with slowly developing disease symptoms, the ELISA test was repeated a week later, and sometimes again after an additional week. The results expressed as number of plants infected over the total number of plants used are summarized in Table 1. Each experiment involved the following products: prMV534, prMV534-Xa (the mixture of the MBP and the N-terminal CP polypeptide obtained by treatment of prMV534 with Xa proteinase), and as controls, MBP-b gala, the sucrose solution alone, and a group designated ‘‘control’’ that acquired the virus from infected leaves without prefeeding on sucrose solution. MBP- bgala had no inhibitory effect on MDMV aphid transmission as compared to the control, 51.4 vs 48%. Prefeeding aphids on sucrose alone before virus – HC – Pro acquisition reduced the level of transmission slightly (42.7%), but not significantly. On the contrary,
AP-Virology
678
SHORT COMMUNICATION
FIG. 2. Nucleotide sequence of the 5* region of the CP gene of MDMV and the deduced amino acid sequence. The underlined nucleotides correspond to the primer sequences homologous to SCMV-SC. The underlined amino acids correspond to conserved amino acids among MDMV and SCMV strains.
prefeeding on prMV534 or prMV534-Xa reduced transmission to 12.5 and 7.6%, respectively; prMV534-Xa completely inhibited viral transmission in three of seven experiments conducted. We have performed preliminary transmission experiments (not shown) using a mutant of prMV534 in which the DAG motif as well as the 12 extra amino acids of nonviral origin at the C-terminus of prMV534 had been deleteted: no inhibition was observed. Since MBP-bgala and this mutant had no inhibitory effect, these results demonstrate that the N-terminus of the MDMV CP is the competing factor. The large number of plants and aphids used in seven independent experiments minimizes the possibility of an artifactual result. Our results clearly show that feeding a polypeptide corresponding to the N-terminus of the CP interferes with the transmission process, bringing the level of aphid transmission from about 50% in the controls to 12.5 and 7.6% for the uncleaved and cleaved fusion proteins, respectively. Potyvirus transmission is a complex process involving interactions between several partners: virion, HC – Pro, host plant, and aphid. It has been shown using different techniques (18, 19) that the virus alone is not able to bind to the aphid stylets and that HC – Pro is absolutely required for a correct localization of the virus particles and for efficient transmission. The re-
sults presented here were obtained by prefeeding the aphids with the N-terminus of the CP (as a fusion protein or cleaved by Xa proteinase) and allowing acquisition of virions and HC – Pro to occur in the acquisition step. Under these conditions inhibition by the N-terminus of the CP is observed. The simplest hypothesis to explain the difference in behavior of the N-terminus of the CP, when it is part of the virus particle or as free protein, is that in the intact particle the N-terminus is not free to interact with the aphid stylets and that the presence of HC – Pro is required to induce a conformational change so as to unfold the N-terminus of the CP. Even though the N-terminal region is on the outer surface of the virus particle it may interact with the core region of the CP and necessitate the interaction of HC – Pro to be released. Interactions of this type have been reported recently in the case of the transcription factor TFIIB (20), whose N- and Ctermini interact: binding of an activator molecule to the N-terminus is required for binding of TFIIB to other transcription factors. Interaction between HC and CP has been shown to occur in the case of cauliflower mosaic virus and its requirement for aphid transmission demonstrated (21). However, no interaction between HC – Pro and CP of potyviruses has been described to date. If such an interaction exists, its demonstration would be of great importance, since it
TABLE 1 Effect of the N-Terminus of the MDMV CP on Transmission Infected plants/inoculated plantsa Competing protein prMV534 prMV534-Xa MBP-bgala Sucrose Control
I
II
III
IV
V
VI
VII
Total
% of transmission
1/12 0/12 5/12 4/12 5/12
3/12 3/12 7/12 5/12 6/12
3/16 2/16 9/16 8/16 11/15
3/18 2/18 13/18 8/17 10/18
0/14 0/14 8/14 8/14 6/13
3/15 0/15 4/16 3/15 4/15
0/17 1/17 9/17 8/17 7/17
13/104 8/104 54/105 44/103 49/102
12.5 7.6 51.4 42.7 48
Note. A statistical analysis was performed on the set of seven experiments. For each experiment, the rate of infection was calculated as the ratio of infected plants over total plants. Angular transformation was used to normalize the ratios. The effect of the competing proteins on the rate of infection was tested using ANOVA and post-hoc test (Fisher least significant difference) using Statview 4.01. Data can be grouped as two sets, controls (MBP-bgala, Sucrose, and Control) and competing proteins (prMV534 and prMV534-Xa), exhibiting significant differences in infection rate (P õ 1004) but no difference within each group (P ú 0.3). a Infection was determined by the appearance of symptoms and ACP-ELISA tests.
/ m4088$7539
10-17-95 06:06:01
viras
AP-Virology
SHORT COMMUNICATION
would pave the way to determining if the DAG motif is involved in interaction with HC – Pro or with the aphid stylets. Further information on the role of the DAG motif will be obtained with mutants of the N-terminus of the CP deleted or mutated at this motif and used in competition experiments which are already under way. ACKNOWLEDGMENTS We are most grateful to Anne-Lise Haenni for her support throughout this work. We thank Marc Girondot, who kindly performed the statistical analysis, and Anita Buffing and Shmuel Levy for excellent technical help. This work was a contribution to the Agricultural Research Organization Volcani Center, Bet-Dagan, Israel 1610E 1995 series. The Institut Jacques Monod is an ‘‘Institut Mixte CNRS-Universite´ Paris VII.’’
REFERENCES 1. Riechmann, J. L., Lain, S., and Garcia, J. A., J. Gen. Virol. 73, 1–16 (1992). 2. Pirone, T. P., Semin. Virol. 2, 81–87 (1991). 3. Shukla, D. D., Strike, P. M., Tracy, S. L., Gough, K. H., and Ward, C. W., J. Gen. Virol. 69, 493–502 (1988). 4. Shukla, D. D., and Ward, C. W., Adv. Virus Res. 36, 273–313 (1989). 5. Salomon, R., J. Gen. Virol. 70, 1943–1949 (1989).
/ m4088$7539
10-17-95 06:06:01
viras
679
6. Salomon, R., Arch. Virol. Suppl. 5, 75–76 (1992). 7. Harrison, B. D., and Robinson, D. J., Phil. Trans. R. Soc. London Ser. B 321, 447–462 (1988). 8. Atreya, C. D., Raccah, B., and Pirone, T. P., Virology 178, 161–165 (1990). 9. Granier, F., Durand-Tardif, M., Casse-Delbart, F., Lecoq, H., and Robaglia, C., J. Gen. Virol. 74, 2737–2742 (1993). 10. Cohen, J., Salomon, R., and Loebenstein, G., Phytopathology 78, 809–811 (1988). 11. Frenkel, M. J., Jilka, J. M., McKern, N. M., Strike, P. M., Clark, J. M. J., Shukla, D. D., and Ward, C. W., J. Gen. Virol. 72, 237– 242 (1991). 12. Lenardon, S., Gordon, D. T., and Gingery, R. E., Phytopathology 83, 86–91 (1993). 13. Lesemann, D. E., Shukla, D. D., Tosic, M., and Huth, W., Arch. Virol. Suppl. 5, 353–361 (1992). 14. Smith, D. B., and Johnson, K. S., Gene 67, 31 (1988). 15. Koch, M., and Salomon, R., Plant Dis. 78, 785–788 (1994). 16. Sanger, F., Nicklen, S., and Coulson, A. R., Proc. Natl. Acad. Sci. USA 74, 5463–5467 (1977). 17. Murant, A. F., Raccah, B., and Pirone, T. P., ‘‘The Plant Viruses’’ (R. G. Milne, Ed.), Vol. 4, pp. 237–273. Plenum, New York, 1990. 18. Raccah, B., and Pirone, T. P., Phytopathology 74, 305–308 (1984). 19. Berger, P. H., and Pirone, T. P., Virology 153, 256–261 (1986). 20. Roberts, S. G. E., and Green, M. R., Nature 371, 717–720 (1994). 21. Schmidt, I., Blanc, S., Esperandieu, P., Kuhl, G., Devauchelle, G., Louis, C., and Cerutti, M., Proc. Natl. Acad. Sci. USA 91, 8885– 8889 (1994).
AP-Virology