Inhibitory effect and transcriptional impact of berberine and evodiamine on human white preadipocyte differentiation

Fitoterapia 81 (2010) 259–268

Contents lists available at ScienceDirect

Fitoterapia j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / f i t o t e

Inhibitory effect and transcriptional impact of berberine and evodiamine on human white preadipocyte differentiation Yueshan Hu a, Hesham Fahmy a, Jordan K. Zjawiony b, Gareth E. Davies a,c,d,⁎ a b c d

Department of Pharmaceutical Sciences, College of Pharmacy, South Dakota State University, Brookings, SD 57007, USA Department of Pharmacognosy and Research Institute of Pharmaceutical Sciences, School of Pharmacy, University of Mississippi, University, MS 38677, USA Avera Institute for Human Behavioral Genetics, Avera Behavioral Health Center, Sioux Falls, SD 57108, USA Department of Psychiatry, Sanford School of Medicine, University of South Dakota, Vermillion, SD 57069, USA

a r t i c l e

i n f o

Article history: Received 28 April 2009 Accepted in revised form 15 September 2009 Available online 30 September 2009 Keywords: Berberine Evodiamine Combination Human white preadipocyte Differentiation GATA

a b s t r a c t It has been reported that the botanical alkaloids, berberine and evodiamine inhibit mouse preadipocyte 3T3-L1 differentiation. The aim of this study was to investigate the effect and transcriptional impact of berberine and evodiamine individually and in combination on human white preadipocyte (HWP) differentiation. We have shown that treatment with 8 µM berberine or 4 µM evodiamine resulted in a major inhibition of HWP differentiation accompanied by upregulation of both GATA binding protein 2 and 3 (GATA-2 and GATA-3) mRNA and protein expression, suggesting that both compounds may have excellent potential as agents to prevent obesity. © 2009 Elsevier B.V. All rights reserved.

1. Introduction There is irrefutable evidence that obesity is a threat to world health. The worldwide obesity epidemic has been strongly associated with the major risks of developing diseases such as type 2 diabetes, hyperlipidemia, hypercholesterolemia, hypertension and cancer [1–3] and has led to a vastly increased number of preventable deaths [4]. Thus, the prevention and treatment of obesity is critical in maintaining worldwide health. In obese individuals, the differentiation process of preadipocyte into mature adipocyte is the critical check point in the development of obesity [5]. Although adipocyte differentiation is a complex process controlled by multiple regulators, the major players are peroxisome proliferator activated receptor γ (PPARγ) [6] and CCAAT/ enhancer binding protein α (C/EBPα) [7]. More recently the

⁎ Corresponding author. Department of Pharmaceutical Sciences, College of Pharmacy, South Dakota State University, Brookings, SD 57007, USA. Tel.: +1 605 688 4090; fax: +1 605 688 6232. E-mail address: [email protected] (G.E. Davies). 0367-326X/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.fitote.2009.09.012

transcription factors GATA binding protein 2 and 3 (GATA-2 and GATA-3) have been shown to be important gate keepers of the differentiation process [8–10]. Berberine (Fig. 1A) is an alkaloid isolated from many medicinal herbs and is a major component of the Chinese medicine, Huang-Lian. Traditionally used extensively as an anti-bacterial drug [11], berberine has been proven to have many other pharmacological effects including antimicrobial [12], antitumor [13], anti-inflammation [14], as well as LDLlowering effects [15] and also body weight reduction [16]. Several research groups have reported and confirmed that berberine inhibits mouse 3T3-L1 preadipocyte differentiation via mechanisms involving down-regulation of the adipogenic transcription factors C/EBPα and PPARγ [17], inhibiting IkB kinase β(IKKβ) [18], activation of AMP kinase [19,20] and activating glucose transporter 1 (GLUT1) [21]. The previous work of our group has demonstrated that the inhibitory effects of berberine on the differentiation of murine 3T3-L1 cells were accompanied both by increased GATA-2 and GATA3 mRNA and protein expression [22]. Evodiamine (Fig. 1B) is an alkaloid and one of the major bioactive compounds present in the Chinese medicine, Wu-ChuYu. Evodiamine is also known to possess anti-inflammatory

260

Y. Hu et al. / Fitoterapia 81 (2010) 259–268

2.2. Cell culture Cell culture was carried out following the protocol provided by Promocell Company, Heidelberg, Germany. Briefly, human white preadipocytes (HWP 32/female/Caucasian) were cultured at 37 °C in a humidified 5% CO2 atmosphere and grown in a preadipocyte Growth medium (GM) with 100 U/ml penicillin and 100 µg/ml streptomycin until confluence (day 0). Differentiation was induced with preadipocyte Differentiation medium (DM) for 3 days (day 3), where upon the medium was changed to adipocyte Nutrition medium (NM) and cultured for 12 days (day 15) (HWP cell line and media were purchased from Promocell, Heidelberg, Germany). Varying concentrations of berberine, evodiamine, and their combination were added to DM and NM in order to observe their effects. 2.3. MTT assay Fig. 1. Chemical structure of berberine chloride (A) and evodiamine (B).

[23], antitumor [24,25] and anti-obesity [26] properties and was recently reported to not only inhibit 3T3-L1 cell differentiation but also decrease weight-gain in diet-induced obesity of Ucptm1 knockout mice [27]. In addition, it was reported that evodiamine functioned as an agonist for rat transient receptor potential vanilloid type-1 (TRPV1) [28] and the activation of TRPV1 prevented adipogenesis in 3T3-L1 preadipocyte and visceral adipose tissue from mice and humans [29], which suggests that evodiamine could inhibit adipogenesis with high possibility during human white preadipocyte differentiation. Huang-Lian and Wu-Chu-Yu have been used in Chinese medicine both individually and in combination to treat a variety of syndromes for thousands of years. Although berberine and evodiamine have been demonstrated to inhibit the differentiation of murine preadipocyte [30], and the mechanisms in murine models of adipogenesis have been fairly well investigated, human models of adipogenesis are relatively poorly characterized. Investigations have, in the past, been hampered by a lack of suitable human preadipocyte cell lines [31]. However, in recent years a number of advances in the development of human preadipocyte cell lines have facilitated more in-depth differentiation studies resulting in several groups using primary human preadipocyte to investigate the differentiation process [32–34]. Nevertheless, the effects of berberine and evodiamine either individually or in combination on the differentiation process of human preadipocyte have not been reported. In this report, we present evidence that both berberine and evodiamine individually and in combination inhibit the differentiation of human white preadipocyte (HWP) and increase the GATA-2 and GATA-3 gene and protein expression.

To detect the effect of berberine, evodiamine and their combination on the viabilities of HWP during differentiation induction, HWP were plated in 96-well culture plates at a density of 4 × 103 cells/well and cultured in GM until confluent, then cultured in DM and NM supplemented with varying concentrations of berberine and evodiamine, alone and in combination. Medium was removed at different time points and MTT (0.5 mg/ml in NM, 50 µl/well) was added. The plates were incubated at 37 °C for 4 h, followed by the addition of DMSO (150 µl/well), and incubated at 37 °C for 1 h. Optical density (OD) was measured at 570 nm with 650 nm as background. 2.4. Oil-Red-O staining and quantification Oil-Red-O staining and quantitative Oil-Red-O staining were performed as previously reported [35,36]. Briefly, medium was removed and cells were washed with PBS twice, fixed with 3.7% formalin at room temperature for 30 min, then rinsed with water, added 60% 2-propanol and incubated for 5 min, then moved out 2-propanol and stained cells with Oil-Red-O solution (Oil-Red-O store solution (3 mg/ml in pure 2-propanol): water = 3:2) at room temperature for 10 min. Then the Oil-Red-O solution was removed and cells were washed 3 times with water. Images were obtained using an Olympus IX70 inverted microscope equipped for phase-contrast microscopy (Olympus, Tokyo, Japan). After staining, the cells were washed twice with 70% ethanol to remove excess stain. Stained oil droplets in the cells were dissolved in 2-propanol containing 4% Nonidet-P40 (Fisher Scientific, Pittsburgh, PA, USA) and OD values were measured at an absorbance of 490 nm. 2.5. Quantitative Real-Time RT-PCR

2. Materials and methods 2.1. General Berberine and evodiamine were purchased from SigmaAldrich Co, St. Luis, MO, USA. Optical rotation of evodiamine was measured in chloroform on AUTOPOL IV automatic polarimeter.

Real-Time reverse transcriptase polymerase chain reaction (RT-PCR) analysis was used to measure mRNA expression of human genes PPARγ, C/EBPα, GATA-2 and GATA-3 under the control of β-actin. Briefly, total RNA was isolated from HWP following treatment at day 15 with Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instruction. RNA was quantified using absorption of

Y. Hu et al. / Fitoterapia 81 (2010) 259–268

light at 260 and 280 nm, and sample integrity was checked by 1.5% agarose gel electrophoresis. 0.8 µg of total RNA from each sample was used for reverse transcription reaction using the TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. PCR was done using the SYBR green Master Mix (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. The primer (Integrated DNA Technologies, Coralville, IA, USA) sequences are shown in Table 1. The temperature cycling conditions of amplification were as follows: an initial step of denaturation at 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 30 s. Real-Time RT-PCR was performed using Mx3000P Real-Time Thermocyclers (Statagene, La Jolla, CA, USA). The relative mRNA levels of these genes were calculated by Pfaffl's mathematical method [37] and normalized with control-treated groups.

2.6. Immunoblot analysis Protein expression of GATA-2, GATA-3, PPARγ and C/EBPα were assessed by Western Blot. Total proteins were isolated from HWP treated with compounds or vehicles on day 15. The cells were washed twice with PBS, lysed in a lysis buffer containing HEPES-Tx-PI buffer: 910 mM HEPES, 5 mM EDTA, 350 mM Sucrose, 1 µg/ml leupeptin, 1 µg/ml pepstatin, 1% Triton-X, 1 mM PMSF), processed with a 25G needle and centrifuged at 10,000 rpm for 5 min. Protein concentration was determined using the Micro BCA Protein Assay Kit (Fisher Scientific, Pittsburgh, PA, USA) according to the manufacturer's instructions. 20 µg proteins were loaded and separated by electrophoresis using the BioRad Electrophoretic System (60 V for 1 h followed by 90 V for 5 h). The proteins were then transferred to nitrocellulose membranes at 35 V overnight. The membrane was blocked for 1 h at room temperature in 5% nonfat milk in Tris-buffered saline (TBS), then washed with Tween-20-TBS (TTBS, 0.1% Tween-20) three times (15 min, 5 min, 5 min), followed by incubation with primary antibodies human GATA-2, GATA-3, PPARγ, C/EBPα and β-actin (dilution 1:200) (all antibodies were purchased from Santa Cruz Biotechnology, Santa Cruz, CA, USA) at room temperature for 2 h. The membrane was rinsed three times (15 min, 5 min, 5 min), then incubated at room temperature for 1 h with Horseradish peroxidase-conjugated second antibody (1:10,000). The membrane was then incu-

Table 1 Real-Time RT-PCR primers. Oligonucleotide

Sequences (5′ to 3′)

Human PPARγ-F Human PPARγ-R Human CEBPα-F Human CEBPα-R Human GATA-2-F Human GATA-2-R Human GATA-3-F Human GATA-3-R Human β Actin-F Human β Actin-R

GAGCCCAAGTTTGAGTTTGC GGCGGTCTCCACTGAGAATA ATTGCCTAGGAACACGAAGCACGA TTTAGCAGAGACGCGCACATTCAC CGTGTGTCTGTGTGCATGTTGTGT AGGGAGCCATCGAAATCCCAAGAT CAGCGTCCCTCAATTCGCACATTT ATTCCATTCCTGAAGCCAGGAGGT GATGACCCAGATCATGTTTGAGACC AGTCCATCACGATGCCAGTGGT

261

bated in ECL reagent (GE Healthcare, Piscataway, NJ, USA) for 1 min. Protein was visualized using the UVP image analysis system (UVP, Upland, CA, USA).

2.7. Statistical analysis The data was analyzed by the ANOVA procedure of Statistical Analysis System (SAS Institute, 1999–2001). Significant differences between groups were determined using Student's t-test or Duncan's multiple range tests at the p <0.05 (*).

3. Results 3.1. Optical rotation measurement of evodiamine indicates that the purchased material was a racemic mixture Optical rotation of evodiamine (Sigma-Aldrich Co.) was 20 = 0° (c 0.1, CHCl3), which indicate that the zero, [α]D compound was a racemate (the mixture of equal amounts of R, and S enantiomers).

3.2. Berberine does not affect human white preadipocyte (HWP) cell viability. In contrast evodiamine substantially decreases HWP cell viability. However, berberine reverses the viability inhibition effect of evodiamine when used in combination MTT analysis was carried out at days 3, 6, 9, 12, 15, and 18 during differentiation to detect the effect of berberine on the viability of HWP (Fig. 2A). HWP were treated with various concentrations of berberine (0, 1, 2, 4, 8, 16, 32, 64 µM) during each stage. Berberine showed no significant effects on the HWP viability. For example, after inducing differentiation for 15 days, 1, 2, 4, and 8 µM berberine decreased cell viability by −3.1%, 1.1%, −0.0% and 1.3% respectively compared to controls. To detect the effect of evodiamine on the viability of HWP, MTT analysis was carried out at days 12, 15, and 18 during differentiation (Fig. 2B). HWP were treated with various concentrations of evodiamine (0, 0.25, 0.5, 1, 2, 4, 8 µM) during each stage. Evodiamine decreased the HWP viability significantly. For example, after inducing differentiation for 15 days, 0.25, 0.5, 1, 2, 4, and 8 µM evodiamine decreased cell viability by 14.1%, 15%, 17.7%, 30.5%, 34.2% and 53.6% respectively when compared to the control group. The effect of the combination of berberine and evodiamine on the viability of HWP was evaluated by MTT analysis, carried out at day 15 during differentiation (Fig. 2C and D). HWP were treated with various concentrations of berberine (4, 8 µM), evodiamine (0.5, 1, 2, 4 µM) and their combination (4 µM berberine + 0.5, 1, 2, 4 µM evodiamine, or 8 µM berberine + 0.5, 1, 2, 4 µM evodiamine). The combinations of 4 µM berberine with 1, 2, and 4 µM evodiamine compensated the viability inhibition of 1, 2, and 4 µM evodiamine on HWP while 4 µM berberine alone had the lowest inhibition of cell viability. The combinations of 8 µM berberine with 2 and 4 µM evodiamine compensated for the viability inhibition of 2, 4 µM evodiamine on HWP while 8 µM berberine alone had the lowest inhibition of cell viability.

262

Y. Hu et al. / Fitoterapia 81 (2010) 259–268

Fig. 2. Effects of berberine (A), evodiamine (B) and their combination (C, D) on cell viabilities of HWP during differentiation. Values given are the means ± S.D. (n = 4). ⁎ denotes significant difference comparing with only evodiamine treated cultures (p < 0.05).

3.3. Berberine and evodiamine inhibit differentiation of human white preadipocyte (HWP) both individually and in combination In order to study the potential inhibitory effects of berberine on HWP differentiation, various concentrations of berberine (0, 1, 2, 4, 8 µM) were added to the Differentiation medium (DM) and Nutrition medium (NM) during the culture of HWP. Differentiation was monitored as previously described by Oil-Red-O staining. Fig. 3 shows the staining of HWP 15 days post differentiation (data from other days are not shown) and the quantitative results of HWP at days 9, 12, 15 and 18 post differentiations. As expected, in HWP cells cultured in GM alone there are very few red-stained cells (Fig. 3A), and also as expected the staining of HWP cultured in DM and NM revealed almost total differentiation (Fig. 3B). However, cells grown in DM and NM with the addition of 1 µM (Fig. 3C) and 2 µM (Fig. 3D) berberine respectively showed significant inhibition of cellular differentiation. What is more, cells grown in the presence of 4 µM (Fig. 3E) and 8 µM (Fig. 3F) berberine showed the maximum suppression of differentiation. Quantitative Oil-Red-O staining measurements (Fig. 3G) showed that HWP grown in the presence of 1, 2, 4, or 8 µM berberine and 15 days post differentiation had a reduction in lipid content of 31.9%, 42.9%, 60.6% and 66.4% respectively when compared with vehicle-treated group.

In order to study the potential inhibitory effects of evodiamine on HWP differentiation, various concentrations of evodiamine were added to DM and NM during HWP culture. The differentiation process was monitored as above. Fig. 4 illustrates the staining and quantitative results of HWP treated with evodiamine or control 15 days post differentiation. As expected, the differentiation of HWP cultured in GM alone was negligible (Fig. 4A) and, again as expected, HWP cultured in DM and NM demonstrated almost total differentiation (Fig. 4B). However, cells grown in DM and NM with the addition of evodiamine at 0.5 µM (Fig. 4C), 1 µM (Fig. 4D) 2 µM (Fig. 4E), and 4 µM (Fig. 4F) showed significant inhibition of cellular differentiation. Quantitative Oil-Red-O staining measurements (Fig. 4G) revealed that HWP treated with 0.125, 0.25, 0.5, 1, 2, 4, or 8 µM evodiamine 15 days post differentiation induction, had a reduction in lipid content of 7.5%, 13.8%, 19 %, 27.8%, 46.7%, 84.6%, and 112.6% respectively when compared with the vehicle-treated group. As we observed inhibitory effects of individual treatment with berberine and evodiamine, we then examined the potential effect of a combination of both compounds on HWP differentiation. Thus, varying concentrations of berberine (4, 8 µM) and evodiamine (0.5, 1, 2, 4 µM) were added to DM and NM during HWP culture. Fig. 5 illustrates the quantitative results of Oil-Red-O staining on HWP 15 days post

Fig. 3. Berberine inhibits HWP differentiation after differentiation induction for 15 days. Oil-Red-O stains were done with cells cultured in Growth medium (GM, A), Differentiation medium and Nutrition medium (DM and NM, B), DM and NM with 1 µM (C), 2 µM (D), 4 µM (E), and 8 µM (F) berberine. Quantification was shown in figure G, values given are the means ± S.D. (n = 3).

Y. Hu et al. / Fitoterapia 81 (2010) 259–268

263

264

Y. Hu et al. / Fitoterapia 81 (2010) 259–268

Fig. 4. Evodiamine inhibits HWP differentiation after differentiation induction for 15 days. Oil-Red-O stains were done with cells cultured in Growth medium (GM, A), Differentiation medium and Nutrition medium (DM and NM, B), DM and NM with 0.5 µM (C), 1 µM (D), 2 µM (E), and 4 µM (F) evodiamine. Quantification was shown in figure G, values given are the means ± S.D. (n = 3).

Y. Hu et al. / Fitoterapia 81 (2010) 259–268

Fig. 5. Quantification of lipid amount in differentiated HWP cultured in GM, DM and NM without or with various concentrations of combination (A: 4 µM berberine + 0, 0.5, 1, 2, 4 µM evodiamine, B: 8 µM berberine + 0, 0.5, 1, 2, 4 µM evodiamine) for 15 days. Values given are the means ± S.D. (n = 3). ⁎ denotes significant difference comparing with only evodiamine treated cultures (p < 0.05).

differentiation. HWP cultured in 0.5, 1, 2, or 4 µM evodiamine in combination with either 4 µM (Fig. 5A) or 8 µM berberine (Fig. 5B) exhibited less adipogenesis when compared to cells treated with evodiamine alone, however demonstrated similar adipogenesis when compared to cells treated with berberine alone.

3.4. Berberine and evodiamine increase the mRNA expression of GATA-2 and GATA-3 genes during the inhibition of human white preadipocyte (HWP) differentiation As anticipated from our studies in mouse cells, GATA-2 and GATA-3 mRNA expression were increased in cells cultured in DM and NM when treated with varying concentrations of berberine compared to cells cultured in media treated with vehicle (Fig. 6A). GATA-2 mRNA expression was increased to 3.87 fold (1 µM), 4.1 fold (2 µM), 3.8 fold (4 µM), and 5.33 fold (8 µM) comparing to vehicle (control) group. GATA-3 mRNA expression was increased to 2.77 fold (1 µM), 2.79 fold (2 µM), 4.43 fold (4 µM), and 6.77 fold (8 µM) when compared to the vehicle (control) group. In addition, GATA-2 and GATA-3 mRNA expression were also increased in HWP cells cultured in DM and NM treated with varying concentrations of evodiamine (0, 1, 2, 4 µM) (Fig. 6B). GATA-2 mRNA expression was increased 1.36 fold (1 µM), 1.5 fold (2 µM), and 2.08 fold (4 µM), whilst GATA-3 mRNA expression was increased 2.61 fold (1 µM), 2.7 fold (2 µM), and 2.79 fold (4 µM).

265

Fig. 6. Effects of berberine (A) and evodiamine (B) on mRNA expression of GATA-2, GATA-3, PPARγ and C/EBPα during HWP differentiation. Values given are the means ± S.D. (n = 3). ⁎ denotes significant difference comparing with vehicle-treated cultures (p < 0.05).

Interestingly, our data illustrated that there were no significant changes in PPARγ and C/EBPα mRNA expression following treatment with berberine or evodiamine. 3.5. Berberine and evodiamine increase GATA-2 and GATA-3 protein expression GATA-2 protein expression was increased in cells cultured in DM and NM containing various concentrations of berberine (Fig. 7A). Protein expression results were consistent with our GATA-2 mRNA expression. GATA-2 protein expression relative to the protein expression of β-actin and normalized with controls was increased to 4.8 fold (1 µM), 4.38 fold (2 µM), 5.53 fold (4 µM) and 4.72 fold (8 µM) (Fig. 7E). GATA-3 protein expression was also increased in cells cultured in DM and NM containing berberine (Fig. 7B). Protein expression results were also consistent with our mRNA expression findings. GATA-3 protein expression was increased to 5.63 fold (1 µM), 5.65 fold (2 µM), 6.43 fold (4 µM) and 5.37 fold (8 µM) (Fig. 7E). Evodiamine also increased the protein expression of GATA-2 and GATA-3. When treated with various concentrations of evodiamine (0, 1, 2, 4 µM), the GATA-2 and GATA-3 protein expression increased which was consistent with our mRNA expression findings (Fig. 8A, B). GATA-2 protein expression was increased to 2.44 fold (1 µM), 4.81 fold (2 µM), and 4.92 fold (4 µM). Whilst GATA-3 protein increased 4.21 fold (1 µM), 4.95 fold (2 µM), and 6.57 fold (4 µM) when compared to controls (Fig. 8E). Consistent with the finding of mRNA expression, the PPARγ and C/EBPα protein expression had no significant difference between drug-treated cells and control cells for

266

Y. Hu et al. / Fitoterapia 81 (2010) 259–268

Fig. 7. Effects of berberine on protein expression of GATA-2 (A), GATA-3 (B), PPARγ (C) and C/EBPα (D) during HWP differentiation and the quantification (E), values given are the means ± S.D. (n = 3). ⁎ denotes significant difference comparing with vehicle-treated cultures (p < 0.05).

either berberine (Fig. 7C, D and E) or evodiamine (Fig. 8C, D and E). 4. Discussion Adipocyte differentiation plays a crucial role in obesity [38] and the process of adipogenesis has recently become a major target of obesity research [39]. It is estimated that the structural and functional morphogenesis associated with adipocyte differentiation involves changes in the expression levels of approximately 300 proteins [40], among those are the critical adipogenic regulators–transcription factors C/EBPα, PPARγ [41], GATA-2 and 3 verified by recent researches in murine-derived cell lines. GATA-2 and GATA-3 are specifically expressed in murine preadipocyte but not mature adipocytes and continuous expression of GATA-2 and 3 in preadipocyte cell lines inhibits terminal differentiation into mature adipocyte [42] via impairing in part basal promoter activity of PPARγ [9] and forming protein complexes with C/EBPα [10]. Berberine and evodiamine are alkaloids isolated from many Chinese herbs and have been demonstrated to have many pharmacological effects including up-regulation of GATA-2 and GATA-3 expression and down-regulation of PPARγ and C/EBPα expression during mouse preadipocyte 3T3-L1 differentiation [20]. However, there are no reports of the effects of

Fig. 8. Effects of evodiamine on protein expression of GATA-2 (A), GATA-3 (B), PPARγ (C) and C/EBPα (D) during HWP differentiation and the quantification (E), values were expressed as means± S.D. (n = 3). ⁎ denotes significant difference comparing with vehicle-treated cultures (p < 0.05).

berberine and evodiamine individually or in combination on human white preadipocyte differentiation. In the present study, we demonstrated comprehensively that berberine has no inhibitory effect on the viability of HWP during differentiation. Evodiamine, however, decreases the cell viability substantially in HWP (8 µM decreased cell viability by 53.6%). But, this study shows that the combination of berberine and evodiamine inhibits viability significantly less than evodiamine alone which could be advantageous with regards to the future potential of berberine and evodiamine in obesity prevention. Importantly, this report demonstrates for the first time that both berberine and evodiamine inhibit adipogenic differentiation in HWP. However, we did not observe greater inhibition of adipogenesis when cells were treated with a combination of berberine and evodiamine than with berberine alone, (which had the highest inhibition quantitatively). There were no significant additive or synergetic effects of inhibition of adipogenesis for combination of berberine and evodiamine. Furthermore, the present study did demonstrate an important inhibitory effect on gene and protein expression in HWP. Berberine and evodiamine substantially increased expression of GATA-2 and 3 during HWP differentiation both

Y. Hu et al. / Fitoterapia 81 (2010) 259–268

at the gene and protein level and is consistent with the increased expression in mouse preadipocyte 3T3-L1 differentiation observed in our previous studies [22]. Interestingly, we did not observe significant differences in either gene or protein expression of PPARγ and C/EBPα during inhibition of HWP differentiation between compound-treated groups and control-treated groups. This could be due to a number of molecular mechanisms, for example, it has been reported that PPARγ promoter activity can be down regulated by GATA-2 and GATA-3 in murine-derived cell lines [9] however this has not been observed in human primary preadipocyte. Furthermore, several research groups have also reported similar PPARγ-independent mechanisms during the inhibition of human primary preadipocyte differentiation [43,44]. These results strongly suggest that different mechanisms of differentiation inhibition exist between murine 3T3-L1 and human preadipocyte. In addition, we did not observe the obvious dosedependent increasing in gene and protein expression of GATA-2 and 3 comparing dose-dependent enhancement of inhibition of adipogenesis detecting by Oil-Red-O staining, such an incompatibility suggested there are possibly other mechanisms for the inhibition of berberine and evodiamine on HWP differentiation. The enhanced GATA-2 and GATA-3 expression provides probably the basal inhibition of HWP differentiation but other mechanisms such as IKKβ and AMPK could result in a dose-dependent differentiation inhibition, which will be the basis of further studies. In conclusion, understanding the molecular mechanisms and signaling pathways by which berberine and evodiamine interact in the complex gene expression patterns involved in adipocyte differentiation will be critically important if berberine and evodiamine are to be used as a future antiobesity agent. Nevertheless from these encouraging findings we believe that berberine and evodiamine have potential to prevent/treat obesity agents and our present work in animal models seems to confirm this suggestion.

[11] [12] [13] [14] [15]

[16] [17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

Acknowledgement The authors would like to thank Paige Kostboth for help in the preparation of this manuscript.

[28]

[29]

References [30] [1] Kopelman PG. Obesity as a medical problem. Nature 2000;404:635–43. [2] Spiegelman BM, Flier JS. Obesity and the regulation of energy balance. Cell 2001;104:531–43. [3] Overweight, obesity, and health risk. National Task Force on the Prevention and Treatment of Obesity. Arch Intern Med 2000;160:898–904. [4] Fontaine KR, Redden DT, Wang C, Westfall AO, Allison DB. Years of life lost due to obesity. JAMA 2003;289:187–93. [5] Auwerx J, Martin G, Guerre-Millo M, Staels B. Transcription, adipocyte differentiation, and obesity. J Mol Med 1996;74:347–52. [6] Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. Transcriptional regulation of adipogenesis. Genes Dev 2000;14:1293–307. [7] Farmer SR. Transcriptional control of adipocyte formation. Cell Metab 2006;4:263–73. [8] Tong Q, Hotamisligi GS. Molecular mechanisms of adipocyte differentiation. Rev Endocr Metab Disord 2001;2:349–55. [9] Tong Q, Dalgin G, Xu H, Ting CN, Leiden JM, Hotamisligil GS. Function of GATA transcription factors in preadipocyte-adipocyte transition. Science 2000;5489:134–8. [10] Tong Q, Tsai J, Tan G, Dalgin G, Hotamisligil GS. Interaction between GATA and the C/EBP family of transcription factors is critical in GATA-

[31]

[32]

[33]

[34]

[35]

267

mediated suppression of adipocyte differentiation. Mol Cell Biol 2005;25: 706–15. Huang KC, Williams WM. Antibacterial, antiviral, and antifungal herbs. Pharmacol Chin Herbs 1999:381–3. Amin AH. Berberine sulfate: antimicrobial activity, bioassay, and mode of action. Can J Microbiol 1969;15:1067–76. Anis KV, Rajeshkumar NV, Kuttan R. Inhibition of chemical carcinogenesis by berberine in rats and mice. J Pharm Pharmacol 2001;53:763–8. Kuo CL, Chi CW, Liu TY. The anti-inflammatory potential of berberine in vitro and in vivo. Cancer Lett 2004;203:127–37. Kong W, Wei J, Abidi P, Lin M, Inaba S, Li C, et al. Berberine is a novel cholesterol-lowering drug working through a unique mechanism distinct from statins. Nat Med 2004;10:1344–51. Zhou LB. Effect of berberine on the differentiation of adipocyte. Zhonghua Yi Xue Za Zhi 2003;83:338–40. Huang C, Zhang YB, Gong ZW, Sheng XY, Li ZM, Zhang W, et al. Berberine inhibits 3T3-L1 adipocyte differentiation through the PPARγ pathway. Biochem Biophys Res Commun 2006;348:571–8. Yi P, Lu FE, Xu LJ, Chen G, Dong H, Wang KF. Berberine reverses freefatty-acid-induced insulin resistance in 3T3-L1 adipocytes through targeting IKKβ. World J Gastroenterol 2008;14(6):876–83. Brusq JM, Ancellin N, Grondin P, Guillard R, Martin S, Saintillan Y, et al. Inhibition of lipid synthesis through activation of AMP kinase: an additional mechanism for the hypolipidemic effects of berberine. J Lipid Res 2006;7:1281–8. Cheng Z, Pang T, Gu M, Gao AH, Xie CM, Li JY, et al. Berberine-stimulated glucose uptake in L6 myotubes involves both AMPK and p38 MAPK. Biochim Biophys Acta 2006;1760:1682–9. Zhou L, Yang Y, Wang X, Liu S, Shang W, Yuan G, et al. Berberine stimulates glucose transport through a mechanism distinct from insulin. Metabolism 2007;56:405–12. Hu Y, Davies GE. Berberine increases expression of GATA-2 and GATA-3 during inhibition of adipocyte differentiation. Phytomedicine 2009;16: 864–73. Chiou WF, Sung YJ, Liao JF, Shum AY, Chen CF. Inhibitory effect of dehydroevodiamine and evodiamine on nitric oxide production in cultured murine macrophages. J Nat Prod 1997;60:708–11. Liao CH, Pan SL, Guh JH, Chang YL, Pai HC, Lin CH, et al. Antitumor mechanism of evodiamine, a constituent from Chinese herb Evodiae fructus, in human multiple-drug resistant breast cancer NCI/ADR-RES cells in vitro and in vivo. Carcinogenesis 2005;26:968–75. Tan YH, Wu YY, Zhong FY, Hu YS, Lin YZ, Li JF. Proliferation-inhibited and apoptosis-inducted effects of evodiamine on liver cancer cells of mice. Pharmacol Clin Chin Mater Med 2006;22:33–5. Kobayashi Y, Nakano Y, Kizaki M, Hoshikuma K, Yokoo Y, Kamiya T. Capsaicin-like anti-obese activities of evodiamine from fruits of Evodia rutaecarpa, a vanilloid receptor agonist. Planta Med 2001;67: 628–33. Wang T, Wang YX, Kontani Y, Kobayashi Y, Sato Y, Mori N, et al. Evodiamine improves diet-induced obesity in a uncoupling protein-1independent manner: involvement of antiadipogenic mechanism and extracellularly regulated kinase/mitogen-activated protein kinase signaling. Endocrinology 2008;149(1):358–66. Zhang LL, Liu DY, Ma LQ, Luo ZD, Cao TB, Zhong J, et al. Activation of transient receptor potential vanilloid type-1 channel prevents adipogenesis and obesity. Circ Res 2007;100:1063–70. Pearce LV, Petukhov PA, Szabo T, Kedei N, Bizik F, Kozikowski AP, et al. Evodiamine functions as an agonist for the vanilloid receptor TRPV1. Org Biomol Chem 2004;2:2281–6. Lee YS, Kim WS, Kim KH, Yoon MJ, Cho HJ, Shen Y, et al. Berberine, a natural plant product, activates AMP activated protein kinase with beneficial metabolic effects in diabetic and insulin-resistant states. Diabetes 2006;55:2256–64. Newell FS, Su H, Tornqvist H, Whitehead JP, Prins JB, Hutley LJ. Characterization of the transcriptional and functional effects of fibroblast growth factor-1 on human preadipocyte differentiation. FASEB J 2006;20:2615–7. Adams M, Montague CT, Prins JB, Holder JC, Smith SA, Sanders L, et al. Activators of peroxisome proliferator-activated receptor have depotspecific effects on human preadipocyte differentiation. J Clin Invest 1997;100:3149–53. Dos Santos E, Dieudonné MN, Leneveu MC, Pecquery R, Serazin V, Giudicelli Y. In vitro effects of chorionic gonadotropin hormone on human adipose development. J Endocrinol 2007;194:313–25. Tomlinson JJ, Boudreau A, Wu D, Atlas E, Haché RJ. Modulation of early human preadipocyte differentiation by glucocorticoids. Endocrinology 2006;147:5284–93. Liu LH, Wang XK, Hu YD, Kang JL, Wang LL, Li S. Effects of a fatty acid synthase inhibitor on adipocyte differentiation of mouse 3T3 cells. Acta Pharm Sin 2004;25:1052–7.

268

Y. Hu et al. / Fitoterapia 81 (2010) 259–268

[36] Furuyashiki T, Nagayasu H, Aoki Y, Bessho H, Hashimoto T, Kanazawa K, et al. Tea catichin suppresses adipocyte differentiation accompanied by down-regulation of PPARγ2 and C/EBPα in 3T3-L1 cells. Biosci Biotechnol Biochem 2004;68:2253–359. [37] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:e45. [38] Giri S, Rattan R, Haq E, Khan M, Yasmin R, Won JS, et al. AICAR inhibits adipocyte differentiation in 3T3L1 and restores metabolic alterations in diet-induced obesity mice model. Nutr Metab 2006;3:1–20. [39] Must AJ, Spadano EH, Coakley AE, Field AE, Colditz G, Dietz WH. The disease burden associated with overweight and obesity. J Am Med Assoc 1999;282:1523–9. [40] Morrison RF, Farmer SR. Hormonal signaling and transcriptional control of adipocyte differentiation. J Nutr 2000;130:3116S–21S.

[41] Fox KE, Fankell DM, Erickson PF, Majka SM, Crossno Jr JT, Klemm DJ. Depletion of CREB/ATF1 inhibits adipogenic conversion of 3T3-L1 cells ectopically expressing CCAAT/enhancer-binding protein (C/EBP) alpha, C/EBP beta, or PPAR gamma 2. J Biol Chem 2006;281:40341–53. [42] Tong Q, Tsai J, Hotamisligil GS. GATA transcription factors and fat cell formation. Drug News Perspect 2003;16:585–8. [43] El Hadri K, Glorian M, Monsempes C, Dieudonné MN, Pecquery R, Giudicelli Y, et al. In vitro suppression of the lipogenic pathway by the nonnucleoside reverse transcriptase inhibitor Efavirenz in 3T3 and human preadipocyte or adipocytes. J Biol Chem 2004;279:15130–41. [44] Wentworth JM, Burris TP, Chatterjee VKK. HIV protease inhibitors block human preadipocyte differentiation, but not via the PPARγ/RXR heterodimer. J Endocrinol 2000;164:R7–R10.