Innate immune responses against rock bream iridovirus (RBIV) infection in rock bream (Oplegnathus fasciatus) following poly (I:C) administration

Fish & Shellfish Immunology 71 (2017) 171e176

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Short communication

Innate immune responses against rock bream iridovirus (RBIV) infection in rock bream (Oplegnathus fasciatus) following poly (I:C) administration Myung-Hwa Jung*, Sung-Ju Jung Department of Aqualife Medicine, Chonnam National University, Republic of Korea

a r t i c l e i n f o

a b s t r a c t

Article history: Received 17 August 2017 Received in revised form 25 September 2017 Accepted 3 October 2017 Available online 4 October 2017

Poly (I:C) showed promise as an immunoprotective agents in rock bream against rock bream iridovirus (RBIV) infection. In this study, we evaluated the time-dependent virus replication pattern and antiviral immune responses in RBIV-infected rock bream with and without poly (I:C) administration. In the poly (I:C)þvirus-injected group, virus copy numbers were more than 18.9-, 24.0- and 479.2-fold lower than in the virus only injected group at 4 (4.73  104 and 8.95  105/ml, respectively), 7 (3.67  105 and 8.81  106/ml, respectively) and 10 days post infection (dpi) (1.26  105 and 6.02  107/ml, respectively). Moreover, significantly high expression levels of TLR3 (8.6- and 7.7-fold, at 4 and 7 dpi, respectively) and IL1b (3.6-fold at 2 dpi) were observed in the poly (I:C)þvirus-injected group, but the expression levels were not significantly in the virus-injected group. However, IL8 and TNFa expression levels showed no statistical significance in both groups. Mx, ISG15 and PKR were significantly highly expressed from 4 to 10 dpi in the virus-injected group. Nevertheless, in the poly (I:C)þvirus-injected group, Mx and ISG15 expression were significantly expressed from 2 dpi. In summary, poly (I:C) administration in rock bream induces TLR3, IL1b, Mx and ISG15-mediated immune responses, which could be a critical factor for inhibition of virus replication. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Rock bream Rock bream iridovirus Poly (I:C) Interferon Inhibition of virus replication

1. Introduction Rock bream iridovirus (RBIV) is a member of the Megalocytivirus genus [1]. In Korea, RBIV has caused major economic loss for the rock bream (Oplegnathus fasciatus) aquaculture industry [2]. RBIVinfected fish were characterised by enlarged spleens and the presence of enlarged basophilic cells in the gills, spleen, liver, heart and kidney [2]. Since the first outbreak, high mortality due to RBIV infection has occurred annually in rock bream and remains an important health problem in the rock bream aquaculture industry. Toll-like receptors (TLRs) play crucial roles in the innate immune system by recognizing pathogen-associated molecular patterns (PAMP) derived from microbial pathogens [3,4]. Polyinosinic:polycytidylic acid (poly (I:C)) is a synthetic doublestranded RNA and is a ligand for the TLR3. Upon recognition of TLR3, poly (I:C) leads to the induction of inflammatory cytokine productions and type I interferon (IFN) [5e7]. Poly (I:C) has shown * Corresponding author. Department of Aqualife Medicine, Chonnam National University, San96-1 Dunduck Dong, Yeosu, Chonnam 59626, Republic of Korea. E-mail address: [email protected] (M.-H. Jung). https://doi.org/10.1016/j.fsi.2017.10.002 1050-4648/© 2017 Elsevier Ltd. All rights reserved.

promise as an immunoprotective agents in fish models, and it can be enhances interferon-related immune responses [8e14]. Recently, we found that fish administered with poly (I:C) at 200 mg/ fish and exposed to RBIV at 2 days post poly (I:C) administration showed the highest protective effect [15]. Furthermore, we observed an induction of immune responses (TLR3, IRF3, Mx, ISG15 and PKR), which indicated the possibility of developing long term preventive measures for 200 days against RBIV using poly (I:C). Thus, poly (I:C) plays a crucial role to the development of protective immunity of rock bream against RBIV infection. However, gene expression patterns of factors that inhibit viral replication in the fish recovering from RBIV infection, to determine the pathways responsible for fish survival, have not yet been investigated against RBIV infection in rock bream following poly (I:C) administration. In the present study, poly (I:C) was investigated for its antiviral potentials in rock bream under RBIV infection. We investigated that the virus inhibition and reaction of interferon-related immunity factor(s) from poly (I:C) administered rock bream against RBIV infection. This work emphasizes genes related to pattern recognition (TLR3), inflammatory cytokines (ILs and TNFa) and interferon responses (Mx, ISG15 and PKR) in rock bream.

172

M.-H. Jung, S.-J. Jung / Fish & Shellfish Immunology 71 (2017) 171e176

2. Materials and methods 2.1. Virus preparation The virus used in the present study was originally isolated from RBIV-infected rock bream in 2010 as described earlier [16].

Table 1 Primers used in this study. Name

Sequence

Accession number

b-actin

F CAGGGAGAAGATGACCCAGA R CATAGATGGGCACTGTGTGG F TGCACAATCTAGTTGAGGAGGTG R AGGCGTTCCAAAAGTCAAGG F TAAAGCCCATCAGGCACTTCAC R AGGAAGAGTGAGCGAGACAACC F ATCTGGAGACGGTGGACAAC R GCTGATGTACCAGTCGCTGA F CCCTCCTGACCATCAGTGAA R TGATCTCAGTCTCCTCGCAGT F GCAATCAGGCCAAACAGAAGCACT R TTGGCTTTGCTGCTGATACGCTTC F GATCGCCTCTCCTGATGTTC R ACCACCAAGCTGATGGTTTC F CTTTAAGACCAAGGTCCAATGC R GCCTCCACATTGTAGTCTGAAAG F GCTCAACAAATAGTCAGTGGAGT R CTCTGGTGACCAGACCAAAGTCC

FJ975145

MCP

2.2. Effect of poly (I:C) administration on the gene expression and virus replication

TLR3

RBIV-free rock bream were obtained from a local farm to determined the antiviral immune defense mechanisms against RBIV in rock bream following poly (I:C) administration. The experimental parameters such as virus dose, poly (I:C) dose and time of poly (I:C) administration were previously described [15]; we found that 200 mg of poly (I:C) administered 2 days before RBIV (1.1  104 major capsid protein (MCP) gene copies/100 ml) infection showed the highest protective effect, while poly (I:C) administration at 2 days post infection showed no protection. Fish (8.9 ± 1.3 cm, 16.3 ± 1.5 g) were separated into four groups; i) poly (I:C)-injected group (n ¼ 30), ii) poly (I:C)þvirus-injected group (n ¼ 30), iii) virus-injected group (n ¼ 30) and iv) PBSinjected group (n ¼ 30). Experimental fish groups (i and ii) were administered intraperioneally (i.p.) with poly (I:C) (Sigma) at 200 mg/100 ml/fish. At 2 days post poly (I:C) administration, the appropriate fish groups (ii and iii) were i.p. injected with RBIV (1.1  107 MCP gene copies/100 ml) and the control group (iv) was i.p. injected with PBS (100 ml/fish). Fish were maintained in an aquaria containing 250 L of UV-treated seawater at 20  C. The overall daily seawater exchange rate was 10% of the system volume per day (25 L/day). The virus copy number and gene expression (ILs, TNFa, Mx, ISG15 and PKR) of virus-injected group has been previously published [25]. In the virus-infected groups (ii and iii), the spleen, liver, kidney and blood were collected from four fish from each group at 0 h and 12 h post infection (hpi) and 1, 2, 4, 7 and 10 days post infection (dpi). In the non-infected groups (i and iv), the kidney was collected from four fish, randomly chosen from each group at 0 h and 12 h post poly (I:C) or PBS administration (hpa) and, 1, 2, 4, 7 and 10 days post poly (I:C) or PBS administration (dpa). The samples were stored at 80  C after being flash frozen in liquid nitrogen.

IL8

2.3. Quantitative expression of immune genes and viral copy numbers Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out in an Exicycler 96 Real-Time Quantitative Thermal Block (Bioneer, Korea) using an AccuPre®2 Greenstar qPCR Master mix (Bioneer, Korea). The qRT-PCR was performed with initial denaturation of 10 min at 95  C followed by 40 cycles of 15 s denaturation at 95  C and 45 s annealing at 58e60  C followed by a melting curve analysis as previously described [16]. For the analysis of the immune gene expression, the kidney of poly (I:C)-injected, poly (I:C)þvirus-injected, virus-injected and PBS-injected fish were used for total RNA extraction using the RNAiso Plus reagent (TaKaRa, Japan) followed by Recombinant DNase I (RNase free) (TaKaRa, Japan) and Rever Tra Ace qPCR RT Kit (Toyobo, Japan) treatment according standard protocol. Each assay or Real-time PCR was performed in duplicate with b-actin RNA as control. Details of primers are given in Table 1. The quantitation of the mRNA was determined by the 2DDCt method [17]. All the data were represented as the means ± the standard error. Statistical differences were determined by unpaired t-tests using the GraphPad Prism software version 5.0 for Windows (GraphPad Software,

IL1b

TNFa Mx ISG15 PKR

AY849394 KY613955 KC522967 KC522965 FJ623187 FJ155359.1 BAJ16365.1 FJ179396.1

USA). Differences were considered statistically significant at p < 0.05 and p < 0.01. We targeted the RBIV major capsid protein (MCP) gene to determine the virus copy number, genomic DNA was isolated from the whole spleen (40e120 mg/fish), liver (50 mg/fish), kidney (50 mg/fish) and blood (100 ml/fish) of each RBIV-infected fish using an AccuPrep®Genomic DNA extraction kit (Bioneer, Korea) according to the manufacturer's instructions. Standard curves were generated to determine the MCP gene copy number by qRT-PCR, as previously described [16]. MCP primers that were used for virus copy number are shown in Table 1. The MCP copy number was determined from 1 ml of DNA from 100 ml of total genomic DNA. 3. Results and discussion In RBIV-infected rock bream, the spleen is the major site of pathogen growth and disease pathology, and nearly all RBIV deaths are accompanied by enlargement of spleen [2]; hence spleen is well known as one of the indicators for RBIV replication [15,16,18e21]. In this study, we found a possible crucial role of poly (I:C) in effectively controlling RBIV replication in the spleen of RBIV-infected rock bream. In the poly (I:C)þvirus-injected group, virus copy numbers were more than 18.9-, 24.0- and 479.2-fold lower than in the virus only injected group at 4 (4.73  104 and 8.95  105/ml, respectively), 7 (3.67  105 and 8.81  106/ml, respectively) and 10 dpi (1.26  105 and 6.02  107/ml, respectively) (Fig. 1A). Interestingly, similarities in the virus replication patterns of spleen to other organs (liver, kidney and blood) were observed in the experimental groups (Fig. 1B, 1C and 1D). This observation suggested that the RBIV replication was inhibited in the fish body following poly (I:C) administration. This was evident from the previous report, in which the mortality due to RBIV in rock bream can be controlled by poly (I:C) administration [15]. Moreover, from 7 to 10 dpi in the virusinjected group, there was gradually increased virus copy number and reached its peaked, while the poly (I:C)þvirus-injected group showed gradual decrease in virus copy numbers, eventually virus may be eliminated from the fish body (below the threshold to cause mortality). Therefore, it might important to evaluate important factor(s) for inhibition of virus replication in immune defense mechanisms between 7 and 10 dpi and to determine if RBIV could be inhibited in fish body following poly (I:C) administration. Similar to these results, CpG ODN 1668 is known to be an excellent immune adjuvant in rock bream against RBIV infection [20]. In the CpG ODN 1668þvirus-injected group, virus copies were more than 7.4-,

M.-H. Jung, S.-J. Jung / Fish & Shellfish Immunology 71 (2017) 171e176

B

10 8

10 8

Abs o lute virus c o py numbe r

10 9

10 7 10 6 10 5 10 4 10 3 10 2 10 1 10 0

C

Abs o lute virus c o py numbe r

Virus copy number in spleen

12h 1d 2d 4d 7d 10d

12h 1d 2d 4d 7d 10d

Poly (I:C) + virus

Virus

Virus copy number in kidney

10 6 10 5 10 4 10 3 10 2 10 1

D

10 9

10 9

10 8

10 8

10 7 10 6 10 5 10 4 10 3 10 2 10 1 10 0

12h 1d 2d 4d 7d 10d

12h 1d 2d 4d 7d 10d

Poly (I:C) + virus

Virus

Virus copy number in liver

10 7

10 0

Abs o lute virus c o py numbe r

Abs o lute virus c o py numbe r

A 10 9

173

12h 1d 2d 4d 7d 10d

12h 1d 2d 4d 7d 10d

Poly (I:C) + virus

Virus

Virus copy number in blood

10 7 10 6 10 5 10 4 10 3 10 2 10 1 10 0

12h 1d 2d 4d 7d 10d

12h 1d 2d 4d 7d 10d

Poly (I:C) + virus

Virus

Fig. 1. Absolute major capsid protein (MCP) gene copies of rock bream, fish administered with poly (I:C) at 200 mg/100 ml/fish following an i.p. injection with RBIV (1.1  104) at 2 days post poly (I:C) administration at 20  C. Virus copy number in spleen (A), liver (B), kidney (C) and blood (D) at 12 h, 1 d, 2 d, 4 d, 7 d and 10 days post infection. The virus copy number of virus-injected group as published previously [25] is shown for reference.

43142- and 790591-fold lower than in the virus only injected group at 4, 7 and 10 dpi, respectively [25]. This indicates that although RBIV is known for its very strong pathogenicity in rock bream [15,16,18e21], administration with the immunostimulants [poly (I:C) and CpG ODN 1668] could allow for rock bream survivors when RBIV infection occurs. Currently, RBIV remains an important health problem in the rock bream aquaculture industry. Our results are part of few critical studies in fish diseases control, hence the need for more detailed studies to obtain a better understanding of immune defense mechanism for disease recovery and adjuvant or immunostimulant-based disease control experiments. Members of the TLR family have a crucial role in the detection of microbial infection [3,4]. TLR3 is an intracellular receptor that recognizes synthetic double-stranded RNA. In this study, TLR3 was significantly highly activated at 4 (8.6-fold) and 7 dpi (7.7-fold) in the poly (I:C)þvirus-injected group, whereas the TLR3 expression in virus-injected group was not significant (Fig. 2A). In addition, in the poly (I:C)-injected group, significantly higher levels of TLR3 expression were observed at 1 dpa (4.6-fold) (Fig. 2A), which suggests a vital contribution of the TLR3 immune response to the antiviral activity of poly (I:C) in rock bream. Furthermore, IL1b is known as a proinflammatory cytokine [22], a significantly higher level of IL1b expression was observed at 2 dpi (3.6-fold) in the poly (I:C)þvirus-injected group, whereas the IL1b expression level was

not significantly expressed in the virus-injected group (Fig. 2B). Similar to these results, the inflammatory cytokine (IL1b) expression was not sufficient to induce antiviral response in the dead fish condition [23,24]; otherwise, IL1b was significantly highly expressed in the survivor fish condition after RBIV infection [24,25]. This indicated that the IL1b-mediated immune responses which could be a major contributor to effective rock bream control over RBIV transcription. However, other inflammatory cytokines (IL8 and TNFa) expression was not significantly upregulated in poly (I:C)-, poly (I:C)þvirus- and virus-injected groups (Supplementary Fig. 1). Type I IFN response is one of the crucial defense lines against viral infection in vertebrates. Generally, transcription of the IFN gene occurs when virus infection [26] and IFN is secreted by virusinfected cells. In this study, similarities in the expression patterns of Mx, ISG15 and PKR were observed in virus-injected group, with basal levels from 12 h to 2 d and significantly high levels at 4 (41.6-, 183.8- and 85.2-fold, respectively), 7 (81.0-, 133.4- and 29.1-fold, respectively) and 10 dpi (115.4-, 106.9- and 22.1-fold, respectively) (Fig. 3). Otherwise, in the poly (I:C)þvirus-injected group, Mx and ISG15 were significantly upregulated earlier at 2 dpi compared to the virus-injected group (from 4 dpi) (Fig. 3A and 3B). Furthermore, expression levels of Mx, ISG15 and PKR were reached their highest at 7 dpi and then gradually decreased from 10 dpi when virus

174

M.-H. Jung, S.-J. Jung / Fish & Shellfish Immunology 71 (2017) 171e176

Fig. 2. Relative expression analysis of TLR3 and IL1b in kidney stimulated with poly (I:C) (200 mg/100 ml/fish) alone, poly (I:C) (200 mg/100 ml/fish) with RBIV (1.1  104 MCP gene copy/fish) and RBIV (1.1  104 MCP gene copy/fish) alone at 12 h, 1 d, 2 d, 4 d, 7 d and 10 d at 20  C. The bars represent the standard error (SE) of the mean for 4 individuals, *p < 0.05. A- TLR3; B- IL1b. The virus copy number of spleen at each sampling point is plotted together for the reference. The gene expression (IL1b) of virus-injected group as published previously [25] is shown for reference.

M.-H. Jung, S.-J. Jung / Fish & Shellfish Immunology 71 (2017) 171e176

175

Fig. 3. Relative expression analysis of interferon-related genes in kidney stimulated with poly (I:C) (200 mg/100 ml/fish) alone, poly (I:C) (200 mg/100 ml/fish) with RBIV (1.1  104 MCP gene copy/fish) and RBIV (1.1  104 MCP gene copy/fish) alone at 12 h, 1 d, 2 d, 4 d, 7 d and 10 d at 20  C. The bars represent the standard error (SE) of the mean for 4 individuals, *p < 0.05 and **p < 0.01. A- Mx; B- ISG15; C- PKR. The virus copy number of spleen at each sampling point is plotted together for the reference. The gene expression (Mx, ISG15 and PKR) of virus-injected group as published previously [25] is shown for reference.

replication was decreased in fish body (Fig. 3). The present results indicate the poly (I:C)þvirus-injected fish IFN-related responses might be quick enough to suppress viral replication. Similarily, IFNrelated immune response is known to exhibit an inhibitory effect on the infection of fish viruses [27,28]; hirame rhabdovirus (HIRRV)

and viral haemorrhagic septicaemia virus (VHSV)-infected olive flounder (Paralichthys olivaceus) induced an earlier response of IFN, Mx and ISG15-related immune genes could have reduced the viral copy numbers in the fish body.

176

M.-H. Jung, S.-J. Jung / Fish & Shellfish Immunology 71 (2017) 171e176

4. Conclusions In this study, inhibition of virus replication and antiviral immune-related gene expression were analyzed in RBIV-infected rock bream after poly (I:C) administration. In the poly (I:C)þvirus-injected group, we observed an advanced antiviral immune response, including TLR3, IL1b, Mx and ISG15, which may completely eliminate the virus and allow for recovery of the fish from virus infection. Acknowledgements This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT & Future Planning (2015R1C1A1A01053685).

[12]

[13]

[14]

[15]

[16]

[17]

Appendix A. Supplementary data [18]

Supplementary data related to this article can be found at https://doi.org/10.1016/j.fsi.2017.10.002. [19]

References [1] J. Kurita, K. Nakajima, Megalocytiviruses, Viruses 4 (2012) 521e538. [2] S.J. Jung, M.J. Oh, Iridovirus-like infection associated with high mortalities of striped beakperch, Oplegnathus fasciatus (Temminck et Schlegel), in southern coastal areas of the Korean peninsula, J. Fish. Dis. 23 (2000) 223e226. [3] S. Akira, Toll-like receptors and innate immunity, Adv. Immunol. 78 (2001) 1e56. [4] R. Medzhitov, C. Janeway, Innate immune recognition: mechanisms and pathways, Immunol. Rev. 173 (2000) 89e97. [5] H. Oshiumi, M. Matsumoto, K. Funami, T. Akazawa, T. Seya, TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon-beta induction, Nat. Immunol. 4 (2003) 161e167. [6] K.G. Lee, S. Xu, Z.H. Kang, J. Huo, M. Huang, D. Liu, et al., Bruton's tyrosine kinase phosphorylates Toll-like receptor 3 to initiate antiviral response, P. Natl. Acad. Sci. U. S. A. 109 (2012) 5791e5796. [7] M. Yamamoto, S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, et al., Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway, Science 301 (2003) 640e643. [8] H.J. Kim, N. Oseko, T. Nishizawa, M. Yoshimizu, Protection of rainbow trout from infectious hematopoietic necrosis (IHN) by injection of infectious pancreatic necrosis virus (IPNV) or Poly (I: C), Dis. Aquat. Org. 83 (2009) 105e113. [9] T. Nishizawa, I. Takami, Y. Kokawa, M. Yoshimizu, Fish immunization using a synthetic double-stranded RNA Poly (I: C), an interferon inducer, offers protection against RGNNV, a fish nodavirus, Dis. Aquat. Org. 83 (2009) 115e122. [10] T. Nishizawa, I. Takami, M. Yang, M.J. Oh, Live vaccine of viral hemorrhagic septicemia virus (VHSV) for Japanese flounder at fish rearing temperature of 21  C instead of Poly (I: C) administration, Vaccine 29 (2011) 8397e8404. [11] K. Thanasaksiri, N. Sakai, H. Yamashita, I. Hirono, H. Kondo, Influence of temperature on Mx gene expression profiles and the protection of sevenband grouper, Epinephelus septemfasciatus, against red-spotted grouper nervous

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

necrosis virus (RGNNV) infection after poly (I: C) injection, Fish. Shellfish. Immunol. 40 (2014) 441e445. Z.X. Zhou, B.C. Zhang, L. Sun L, Poly (I: C) induces antiviral immune responses in Japanese flounder (Paralichthys olivaceus) that require TLR3 and MDA5 and is negatively regulated by Myd88, PLoS One 9 (2014) e112918. I. Jensen, A. Albuerque, A.I. Sommer, B. Robertsen, Effect of poly I: C on the expression of Mx proteins and resistance against infection by infectious salmon anaemia virus in Atlantic salmon, Fish. Shellfish. Immunol. 13 (2002) 311e326. H.J. Kim, J.S. Park, M.C. Choi, S.R. Kwon, Comparison of the efficacy of Poly (I: C) immunization with live vaccine and formalin-killed vaccine against viral hemorrhagic septicemia virus (VHSV) in olive flounder (Paralichthys olivaceus), Fish. Shellfish. Immunol. 48 (2016) 206e211. M.H. Jung, S.J. Jung, Protective immunity against rock bream iridovirus (RBIV) infection and TLR3-mediated type I interferon signaling pathway in rock bream (Oplegnathus fasciatus) following poly (I: C) administration, Fish. Shellfish Immunol. 67 (2017) 293e301. M.H. Jung, C. Nikapitiya, J.Y. Song, J.H. Lee, J. Lee, M.J. Oh, et al., Gene expression of pro- and anti-apoptotic proteins in rock bream (Oplegnathus fasciatus) infected with Megalocytivirus (family Iridoviridae), Fish. Shellfish Immunol. 37 (2014) 122e130. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (2001) 402e408. M.H. Jung, S.J. Jung, T.N. Vinay, C. Nikapitiya, J.O. Kim, J.H. Lee, et al., Effects of water temperature on mortality in Megalocytivirus-infected rock bream Oplegnathus fasciatus (Temminck et Schlegel) and development of protective immunity, J. Fish. Dis. 38 (2015) 729e737. M.H. Jung, J. Lee, S.J. Jung, Low pathogenicity of FLIV (flounder iridovirus) and the absence of cross-protection between FLIV and RBIV (rock bream iridovirus), J. Fish. Dis. 39 (2016) 1325e1333. M.H. Jung, J. Lee, M. Ortega-Villaizan, L. Perez, S.J. Jung, Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration, Vaccine 35 (2017) 3691e3699. M.H. Jung, C. Nikapitiya, T.N. Vinay, J. Lee, S.J. Jung, Rock bream iridovirus (RBIV) replication in rock bream (Oplegnathus fasciatus) exposed for different time periods to susceptible water temperatures, Fish. Shellfish Immunol. 70 (2017) 731e735. E.M. El-Omar, M. Carrington, C. Wong-Ho, K.E. McColl, Interleukin-1 polymorphisms associated with increased risk of gastric cancer, Nature 404 (2000) 398. S. Hong, J.W. Jin, J.H. Park, J.K. Kim, H.D. Jeong, Analysis of proinflammatory gene expression by RBIV infection in rock bream, Oplegnathus faciatus, Fish. Shellfish. Immunol. 50 (2016) 317e326. M.H. Jung, S.J. Jung, Gene expression regulation of the TLR9 and MyD88dependent pathways in rock bream against rock bream iridovirus (RBIV) infection, Fish. Shellfish Immunol. 70 (2017) 507e514. M.H. Jung, S.J. Jung, CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection, Fish. Shellfish Immunol. 69 (2017) 247e257. R.E. Randall, S. Goodbourn, Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures, J. Gen. Virol. 89 (2008) 1e47. J. Zhang, X. Tang, X. Sheng, J. Xing, W. Zhan, The influence of temperature on viral replication and antiviral-related genes response in hirame rhabdovirusinfected flounder (Paralichthys olivaceus), Fish. Shellfish Immunol. 68 (2017) 260e265. S. Avunje, W.S. Kim, C.S. Park, M.J. Oh, S.J. Jung, Toll-like receptors and interferon associated immune factors in viral haemorrhagic septicaemia virus-infected olive flounder (Paralichthys olivaceus), Fish. Shellfish. Immunol. 31 (2011) 407e414.