- Email: [email protected]
Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration
Vaccine 35 (2017) 3691–3699
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration Myung-Hwa Jung a,⇑, Jehee Lee b, M. Ortega-Villaizan c, Luis Perez c, Sung-Ju Jung a a
Department of Aqualife Medicine, Chonnam National University, Republic of Korea Department of Marine Life Sciences, Jeju National University, Republic of Korea c IBMC, Miguel Hernandez University, Elche, Spain b
a r t i c l e
i n f o
Article history: Received 1 February 2017 Received in revised form 22 May 2017 Accepted 23 May 2017 Available online 1 June 2017 Keywords: Rock bream Rock bream iridovirus CpG ODN 1668 Protection
a b s t r a c t Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5 mg) at 2 days before infection (1.1 107) held at 26 °C died even though mortality was delayed from 8 days (1 mg) and 4 days (5 mg). Similarly, CpG ODN 1668 administered (5 mg) at 2 days before infection (1.2 106) held at 23/20 °C had 100% mortality; the mortality was delayed from 9 days (23 °C) and 11 days (20 °C). Moreover, when CpG ODN 1668 administered (1/5/10 mg) at 2/4/7 days before infection or virus concentration was decreased to 1.1 104 and held at 20 °C had mortality rates of 20/60/30% (2 days), 30/40/60% (4 days) and 60/60/20% (7 days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were reinfected with RBIV (1.1 107) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following rechallenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20 °C and infection dose of 1.1 104). Ó 2017 Elsevier Ltd. All rights reserved.
1. Introduction Iridoviridae is a family of large double stranded DNA viruses (120–300 nm) with icosahedral morphology [1]. The family includes five genera: Iridovirus, Chloriridovirus, Ranavirus, Lymphocystivirus and Megalocytivirus [2]. Members of the genus Megalocytivirus causes disease in more than 30 species of cultured marine fish belonging mainly to the orders Perciformes and Pleuronectiformes [3–10]. Rock bream iridovirus (RBIV), which belongs to the genus Megalocytivirus [11]. RBIV infection in Korea to rock bream (Oplegnathus fasciatus) was first reported in the summer, 1998 from the southern coastal areas [12]. Since first outbreak, high mortality occurred in rock bream annually due to RBIV. Prophylactic measures to control RBIV remain unsolved in
⇑ Corresponding author at: Department of Aqualife Medicine, Chonnam National University, San96-1 Dunduck Dong, Yeosu, Chonnam 550-749, Republic of Korea. E-mail address: [email protected] (M.-H. Jung). http://dx.doi.org/10.1016/j.vaccine.2017.05.073 0264-410X/Ó 2017 Elsevier Ltd. All rights reserved.
rock bream aquaculture industry; thus, fish farmers hesitate to culture them due to the high risk of RBIV. Hence, the development of control and preventive measures against RBIV is required to support rock bream aquaculture industry. Oligodeoxynucleotides (ODNs) containing dinucleotides with unmethylated cytosine-phosphate-guanine (CpG) motifs are a type of pathogen-associated molecular patterns (PAMPs) that are present commonly in the genomes of microbial pathogens [13–15]. CpG is recognized by the toll-like receptor (TLR) 9 on dendritic cells, B cells, and macrophages [15–17]. Interaction between TLR9 and CpG triggers the secretion of Th1-promoting cytokines and enhances Th1-biased cellular and humoral immunity [18–20]. CpG ODNs have shown promise as an immune protective agent and vaccine adjuvant. Several studies have documented the potent adjuvant activity of CpG DNA in vaccines with various antigens, including viral antigens [21,22] and with DNA vaccines [23]. Additionally, CpG DNA has been shown to induce disease resistance against bacterial [24–26], viral [27–30] and protozoa
3692
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
[31,32] diseases. However, the working mechanisms of these CpG remain largely unknown. Water temperature is known to affect the immune system and susceptibility of fish to virus infection [33,34]. In Korea, RBIV outbreaks typically occur in cultured rock bream from August to September, when water temperature between 23 and 27 °C [12]. Recently, our previous studies have demonstrated a clear correlation between mortality and the water temperature against RBIV infection in rock bream [35]; fish injected with RBIV and held at 29, 26, 23 or 20 °C had 100% mortality with delayed mortality at low water temperatures. However, there was no mortality at 17 °C. In addition, fish injected with 7.5 107–6.7 105/100 ll of RBIV and held at 26 °C showed 100% cumulative mortality with delayed mortality at the low virus concentrations. These findings indicate that the virus replication speed with the water temperature is likely the more critical factor for rock bream mortality. Therefore, this study was carried out to find whether CpG ODNs enhance the protection at different virus replication levels at 26, 23 or 20 °C. The experiment involved in searching the efficacy of CpG ODNs on the controlled variation of water temperatures, different concentrations of RBIV, different CpG ODNs, different doses of CpG ODNs and a suitable time of CpG ODNs administration (before or post virus injection). Furthermore, long-term protection from reRBIV infection was estimated.
2. Materials and methods 2.1. Experimental fish Rock bream were obtained from a local farm and reared at the Fisheries Science Institute at Chonnam National University. Approximately 2000 fish (6.4 ± 1.0 cm, 8.1 ± 1.2 g) were maintained in large tanks (10 ton) with a continuous seawater supply with aeration. Fish were fed daily from 2% of their body weight. The required number of fish for the experiments was transferred to the infection experimental facility.
2.2. Isolation of rock bream iridovirus The virus used in the present study was originally isolated from RBIV-infected rock bream in 2010 as explained earlier [36].
2.3. CpG ODNs Six of the CpG ODNs used in this study have been reported previously: 2216 [37,38], 1668 [25,39], 1826 [26], 2133 [40], 2395 [41,42] and 1720 [39]. All CpG ODNs mentioned are detailed in Table 1. All the CpG ODNs were constructed on a phosphorothioate backbone and synthesized by Genotech (Korea). The synthesized CpG ODNs were solubilized in sterile deionized water.
2.4. Pre-challenge studies The virus challenge dose was confirmed with a pre-challenge study using ten naïve fish of each group of which 100% died at a dose of 1.1 107, 1.2 106, 6.7 105 and 1.1 104 MCP gene copies at 26, 23 and 20 °C. 2.5. Effect of CpG ODNs on RBIV infection at 26 °C (Experiment I) Since, optimum RBIV replication water temperature in fish body is 26 °C, this water temperature was selected at first to examine the antiviral property of CpG ODNs on RBIV infection. Rock bream (8.1 ± 1.2 cm, 13.7 ± 2.1 g) were administered intraperioneally (i. p.) with each of the 6 CpG ODNs (2216, 1668, 1826, 2133, 2395 and 1720) at 1 and 5 mg/100 ll/fish or with phosphate-buffered saline (PBS) as a control. At 2 days post administration (dpa) of CpG ODNs, the fish were injected with RBIV (100 ll/fish) containing 1.1 107 MCP gene copies. Each group of 20 fish was maintained at 26 °C for 15 days in an aquarium containing 30 L of UVtreated seawater. Overall daily water exchange rate was 50% of system volume per day (15 L/day). Table 2 summarizes the experimental conditions. 2.6. Effect of CpG ODNs (1668 and 2133) on RBIV infection at 23 and 20 °C (Experiment II) Rock bream are susceptible to high RBIV dose (1.1 107 MCP gene copies) with typical water temperature of RBIV outbreak (at 26 °C). Alterations in experimental conditions were made to determine whether a protective immune response could be induced in the surviving fish. To examine the effect of water temperature and time on the antiviral property of CpG ODNs (1668 and 2133) following three consecutive experiments (trial I, trial II and trial III). In trial I, 20 fish in each group (8.8 ± 1.2 cm, 15.1 ± 2.4 g) were divided randomly into four groups; i) 23 °C with 1668, ii) 23 °C with 2113, iii) 20 °C with 1668 and iv) 20 °C with 2113 were administered i.p. with CpG ODNs (1668 and 2133, respectively) at 5 mg/100 ll/fish. These groups were named the 2 days before infection group. Groups were injected with RBIV (100 ll/fish) containing 1.2 106 MCP gene copies at 2 days post CpG ODN administration, respectively. In trial II, rock bream were divided randomly into four groups (20 fish per group); i) 23 °C with 1668, ii) 23 °C with 2113, iii) 20 °C with 1668 and iv) 20 °C with 2113 were injected with RBIV (100 ll/fish) containing 1.2 106 MCP gene copies. At 2 days post infection (dpi), four groups were administered i.p. with CpG ODNs (1668/2133, respectively) at 5 mg/100 ll/fish; this group was called the 2 days post infection group. In trial III, twenty fish in each group were divided randomly into four groups; i) 23 °C with 1668, ii) 23 °C with 2113, iii) 20 °C with 1668 and iv) 20 °C with 2113, and injected with RBIV (100 ll/fish) containing 1.2 106 MCP gene copies. At 4 days post infection, fish
Table 1 CpG ODNs used in this study. Name
Sequence
Action
CpG ODN 2216 CpG ODN 1668
GGGGGACGATCGTCGGGGGG TCCATGACGTTCCTGATGCT
CpG ODN 1826 CpG ODN 2133 CpG ODN 2395
TCCATGACGTTCCTGACGTT TCGTCGTTGGTTGTCGTTTTGGT TCGTCGTTTTCGGCGCGCGCCG
Non-CpG ODN 1720
TCCATGAGCTTCCTGATGCT
Mx expression was highly expressed in atlantic salmon head kindey and spleen (50 mg/fish) [38] Increased disease resistance (0.25 and 0.5 mg/fish) in olive flounder [25] Induced IL1b expression (2, 5, 10 and 20 mM) and antiviral activity (5 mM) in rainbow trout head kidney macrophages [39] Induced protection to Renibacterium salmoninarum in chinook salmon (15 mg/fish) [26] Induced proliferation of rainbow trout peripheral blood leucocytes (1 mg mL1) [40] Myeloid differentiation factor 88 (MyD88) gene was induced in turbot gills, kidney, spleen and muscle (0.15 mg/ml, 95 ll/fish) [42] Non-CpG ODN used as controls: atlantic salmon (1, 2 and 5 mM) [39]
3693
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699 Table 2 The details of effect of 6 CpG ODNs on RBIV infection at 26 °C (Experiment I). Group
No. of fish
CpG ODN concentration
RBIV infection at
RBIV infection dose/fish
Mortality
Day of final mortality
Delay final mortality compared with control
p-value
2216
20 20 20 20 20 20 20 20 20 20 20 20 20 20
1 lg 5 lg 1 lg 5 lg 1 lg 5 lg 1 lg 5 lg 1 lg 5 lg 1 lg 5 lg Virus Naive
26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C
1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 PBS
100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 0%
15 day 14 day 19 day 15 day 14 day 13 day 16 day 19 day 11 day 15 day 15 day 15 day 11 day
+4 days +3 days +8 days +4 days +3 days +2 days +5 days +8 days 0 day +4 days +4 days +4 days
0.0002 <0.0001 <0.0001 <0.0001 0.0208 <0.0001 <0.0001 <0.0001 0.3952 <0.0001 0.0010 <0.0001
1668 1826 2133 2395 1720 Control
Table 3 The details of effect of CpG ODNs (1668 and 2133) on RBIV infection at 23 and 20 °C (Experiment II). Group
CpG ODN
CpG ODN concentration
No. of fish
RBIV infection at
RBIV infection dose/fish
Mortality
Day of final mortality
Delay final mortality compared with control
p-value
2 days before infection
1668 1668 2133 2133
5 lg 5 lg 5 lg 5 lg
20 20 20 20
23 °C 20 °C 23 °C 20 °C
1.2 106 1.2 106 1.2 106 1.2 106
100% 100% 100% 100%
31 day 38 day 27 day 37 day
+9 days +11 days +5 days +10 days
0.0214 <0.0001 0.0775 0.0003
2 days post infection
1668 1668 2133 2133
5 lg 5 lg 5 lg 5 lg
20 20 20 20
23 °C 20 °C 23 °C 20 °C
1.2 106 1.2 106 1.2 106 1.2 106
100% 100% 100% 100%
29 day 26 day 22 day 27 day
+7 days 1 day 0 day 0 day
0.0214 0.0362 0.7945 0.5872
4 days post infection
1668 1668 2133 2133
5 lg 5 lg 5 lg 5 lg
20 20 20 20
23 °C 20 °C 23 °C 20 °C
1.2 106 1.2 106 1.2 106 1.2 106
100% 100% 100% 100%
25 day 25 day 23 day 27 day
+3 days 2 days +1 day 0 day
0.0027 0.5713 0.5012 0.7319
Control
Virus Naive Virus Naive
20 20 20 20
23 °C 23 °C 20 °C 20 °C
1.2 106 PBS 1.2 106 PBS
100% 0% 100% 0%
22 day 27 day
Table 4 Summary of CpG ODN 1668 efficacy test (Experiment III and IV). RBIV infection dose/fish
Mortality at 100 dpi
RPS
p-value
RBIV 2nd infection for survivors
RBIV infection dose/fish
Mortality
p-value
RBIV 3rd infection for survivors
RBIV infection dose/fish
Mortality
p-value
2 days before infection 1 lg 20 20 °C 5 lg 20 20 °C 10 lg 20 20 °C
1.1 104 1.1 104 1.1 104
20% 60% 30%
80% 40% 70%
<0.0001 0.0008 <0.0001
100 dpi 100 dpi 100 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
400 dpi 400 dpi 400 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
4 days before infection 1 lg 20 20 °C 5 lg 20 20 °C 10 lg 20 20 °C
1.1 104 1.1 104 1.1 104
70% 60% 40%
30% 40% 60%
<0.0001 <0.0001 <0.0001
100 dpi 100 dpi 100 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
400 dpi 400 dpi 400 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
7 days before infection 20 20 °C 1 lg 5 lg 20 20 °C 10 lg 20 20 °C
1.1 104 1.1 104 1.1 104
40% 40% 80%
60% 60% 20%
<0.0001 <0.0001 <0.0001
100 dpi 100 dpi 100 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
400 dpi 400 dpi 400 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
Control Naive 1st virus 2nd virus 3rd virus
PBS 1.1 104 N/A N/A
0% 100% N/A N/A
N/A N/A
N/A 1.1 107 N/A
N/A 100% N/A
N/A
N/A N/A
N/A N/A 400 dpi
N/A N/A 1.1 107
N/A N/A 100%
N/A N/A
Group
No. of fish
20 20 20 20
RBIV infection at
20 °C 20 °C 20 °C 20 °C
groups were administered i.p. with CpG ODNs (1668/2133, respectively) at 5 mg/100 ll/fish; these groups were regarded as the 4 days post infection group. The same number of fish in the virus injected control and naive group were injected i.p. with virus or PBS alone at each
N/A
water temperatures (23 or 20 °C, respectively), and the fish were maintained for 38 days in an aquarium containing 30 L of UVtreated seawater. Overall daily water exchange rate was 50% of system volume per day (15 L/day). Table 3 summarizes the experimental conditions.
3694
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
CpG ODN 2216
A 1µg 5µg
80
Virus injected control 60
PBS injected (Naïve)
40 20
1µg
100
Cumulative mortality%
Cumulative mortality%
100
CpG ODN 1668
B 5µg 80
Virus injected control PBS injected (Naïve)
60 40 20
0
0 0
2
4
6
8
10
12
14
16
18
20
0
2
4
6
Days post infection
C 1µg
Cumulative mortality%
Cumulative mortality%
D
CpG ODN 1826
100
5µg
80
Virus injected control 60
PBS injected (Naïve)
40 20 0
10
12
14
16
18
20
16
18
20
CpG ODN 2133 1µg
100
5µg 80
Virus injected control PBS injected (Naïve)
60 40 20 0
0
2
4
6
8
10
12
14
16
18
20
0
2
4
6
Days post infection
8
10
12
14
Days post infection
CpG ODN 2395
E
Non-CpG ODN 1720
F 100
80 60
1µg 5µg
40
Virus injected control 20
PBS injected (Naïve)
0
Cumulative mortality%
100
Cumulative mortality%
8
Days post infection
80 1µg
60
5µg
40
Virus injected control
20
PBS injected (Naïve)
0 0
2
4
6
8
10
12
14
16
18
20
Days post infection
0
2
4
6
8
10
12
14
16
18
20
Days post infection
Fig. 1. The mortality patterns of fish administered with 6 CpG ODNs (2216, 1668, 1826, 2133, 2395 and 1720) at 1 and 5 mg/fish following an i.p. injected with RBIV (1.1 107) at 2 days post CpG ODNs administration at 26 °C (typical water temperature of RBIV). A- CpG ODN 2216; B- CpG ODN 1668; C- CpG ODN 1826; D- CpG ODN 2133; E- CpG ODN 2395; F- Non-CpG ODN 1720.
2.7. Analysis of the antiviral effect of CpG ODN 1668 in relation to dose, time and water temperature (Experiment III)
2.8. Virus re-challenge of survivors from Experiment III (Experiment IV)
Although, all the fish died at water temperatures at 20–26 °C with virus doses of 1.2 106–1.1 107 MCP gene copies, CpG ODN 1668 administered fish group delayed final mortality at low water temperatures or low virus concentrations. To obtain survivors to reduce virus replication speed, fish were injected with RBIV containing 1.1 104 MCP gene copies (100 1000-fold lower than the other experiments). Twenty fish (9.3 ± 1.5 cm, 17.1 ± 2.1 g) in each group were administered i.p. with PBS (virus injected control and naive) or CpG ODN 1668 at the concentration of 1, 5 and 10 mg/100 ll/fish, respectively. Fish were injected with RBIV (100 ll/fish) containing 1.1 104 MCP gene copies at 2, 4 and 7 days post CpG ODN administration, respectively. These groups were named as the 2, 4 and 7 days before infection group, respectively. Fish were maintained at 20 °C for 100 days in an aquarium containing 30 L of UV-treated seawater. Overall daily water exchange rate was 50% of system volume per day (15 L/day). Table 4 summarizes the experimental conditions.
Surviving fish (11.0 ± 1.4 cm, 18.7 ± 1.3 g) from Experiment III at 100 dpi were challenged a second time with an RBIV injection of 100 ml/fish (1.1 107 MCP gene copies). Twenty naive fish (11.2 ± 1.3 cm, 19.1 ± 1.5 g) (not previously exposed to virus) were injected with RBIV in the same manner as the survivors. Each group of fish were kept at 20 °C for 300 days in an aquarium containing 40 L of UV-treated seawater. Overall daily water exchange rate was 50% of system volume per day (20 L/day). After reaching 400 dpi (300 days from the second challenge), the fish (16.2 ± 1.4 cm, 26.4 ± 1.2 g) were challenged a third time with an RBIV injection of 100 ml/fish (1.1 107 MCP gene copies). Twenty naive fish (16.1 ± 1.2 cm, 26.2 ± 1.1 g) (not previously exposed to virus) were injected with RBIV in the same manner as the survivors. The fish were maintained for an additional 50 days in an aquarium containing 40 L of UV-treated seawater and observed for the reoccurrence of mortality due to RBIV. Overall daily water exchange rate was 50% of system volume per day
3695
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
CpG ODN 1668 (23 C)
A
CpG ODN 1668 (20 C)
B
100
100
2 days before infection
Cumulative mortality%
Cumulative mortality%
2 days before infection 2 days post infection
80
4 days post infection 60
Virus injected control PBS injected (Naïve)
40 20 0
2 days post infection
80
4 days post infection 60
Virus injected control PBS injected (Naïve)
40 20 0
0
5
10
15
20
25
30
0
5
10
15
Days post infection
CpG ODN 2113 (23 C)
C
100
2 days before infection 2 days post infection
80
4 days post infection 60
Virus injected control PBS injected (Naïve)
40
25
30
35
40
35
40
CpG ODN 2113 (20 C)
D Cumulative mortality%
Cumulative mortality%
100
20
Days post infection
20 0
2 days before infection 2 days post infection
80
4 days post infection 60
Virus injected control PBS injected (Naïve)
40 20 0
0
5
10
15
20
25
30
0
5
10
Days post infection
15
20
25
30
Days post infection
Fig. 2. The effect of CpG ODNs (1668 and 2113) on RBIV (1.2 106) at 23 and 20 °C. To obtain survivors, experimental conditions were adjusted as follows; water temperature (23 and 20 °C) and RBIV injection dose (1.2 106) were lower than the experiment I. Twenty fish in each group (8.8 ± 1.2 cm, 15.1 ± 2.4 g) were i.p injected with CpG ODNs (1668 and 2113) at 1, 5 and 10 lg/fish before or post virus injection. A- CpG ODN 1668 administration at 23 °C; B- CpG ODN 1668 administration at 20 °C; C- CpG ODN 2113 administration at 23 °C; D- CpG ODN 2113 administration at 20 °C.
(20 L/day). To determine the MCP gene copy number, spleen were collected from all the surviving fish at the end of 450 dpi. Table 4 summarizes the experimental conditions.
2.11. Statistical analysis For all the challenge trials, Log rank test was carried out using GraphPad Prism5 Software for survival analysis.
2.9. Determination of viral copy number in the spleen 2.12. Ethics statement Genomic DNA was isolated from whole spleen (45–150 mg) of Ò each fish using an AccuPrep Genomic DNA extraction kit (Bioneer, Korea) according to the manufacturer’s instructions. RBIV major capsid protein gene (MCP) specific primer set (F 50 tgcacaatctagttgaggaggtg 30 and R 50 aggcgttccaaaagtcaagg 30 ) was used to perform quantitative real time polymerase chain reaction (qRTPCR) using Exicycler 96 Real-Time Quantitative Thermal Block (Bioneer, Korea) to yield 90 bp product and reaction conditions were similar as previously described [36]. Standard curve was generated to determine the RBIV MCP gene copy number by qRT-PCR as described previously [36]. The virus copy number was determined from 1 ll of DNA of 100 ll of total DNA that was extracted from a whole spleen. The detection limit level of RBIV MCP copy number was 1.0 101/ml. 2.10. Relative percent survival (RPS) RPS was calculated according to the method described by Amend et al. [43].
RPS ¼ ½1 ð% mortality of CpG ODN administered group= % mortality in control 100
All rock bream experiments were carried out in strict accordance with the recommendations of the Institutional Animal Care and Use Committee of Chonnam National University (permit number: CNU IACUC-YS-2015-4). 3. Results 3.1. Selection of CpG ODNs that inhibit virus replication in rock bream at 26 °C (Experiment I) Rock bream were administered 5 CpG ODNs (2216, 1668, 1826, 2133 and 2395) and 1 non-CpG ODN 1720 (used as control) i.p. at the concentration of 1 and 5 mg/fish and injected with RBIV at 2 days post administration and held 26 °C showed 100% cumulative mortality by 19 dpi. However, mortality was delayed from 2 days to 8 days in comparison to virus-injected control fish (Fig. 1) (Table 2). The log-rank test showed a significant difference between the CpG ODNs administered and non-administered virus injected control group, and the p-values for each groups are given in Table 2. Two types of CpG ODNs (1668 and 2113) delayed final mortality more than that observed in other CpG ODNs administered fish. For
3696
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
CpG ODN 1668 administration (2 days before RBIV infection)
A 100
1 µg
Survival%
80
5 µg 10 µg
60
1st virus injected control 2nd virus injected control
40 20
3rd virus injected control
Third infection
Second infection
PBS injected (Naïve)
0 0
10
20
30
40
50
60
70
100
110
120
130
140
400
410
420
430
440
450
Days post infection CpG ODN 1668 administration (4 days before RBIV infection)
B 100
1 µg
Survival%
80
5 µg 10 µg
60
1st virus injected control 2nd virus injected control
40
3rd virus injected control
Third infection
Second infection
20
PBS injected (Naïve)
0 0
10
20
30
40
50
60
70
100
110
120
130
140
400
410
420
430
440
450
Days post infection CpG ODN 1668 administration (7 days before RBIV infection)
C 100
1 µg
Survival%
80
5 µg 10 µg
60
1st virus injected control 2nd virus injected control
40
3rd virus injected control 20
0
10
20
30
40
50
60
70
100
110
PBS injected (Naïve)
Third infection
Second infection
0
120
130
140
400
410
420
430
440
450
Days post infection Fig. 3. The protection efficacy of CpG ODN 1668 at 20 °C. Twenty fish (9.3 ± 1.5 cm, 17.1 ± 2.1 g) in each group were administered i.p. with CpG ODN 1668 (1, 5 and 10 lg/fish) at 2, 4 and 7 days before RBIV infection. To establish mild infection to reduce virus replication speed, fish were injected with RBIV (1.1 104) and maintained at 20 °C in the aquarium. At 100 dpi, surviving fish from Experiment III were infected a second time (1.1 107 MCP copies/fish). The surviving fish from the second infection were subjected to a third infection (period of 400 to 450 dpi) using 1.1 107 MCP copies/fish. A- CpG ODN 1668 administration at 2 days before RBIV infection; B- CpG ODN 1668 administration at 4 days before RBIV infection; C- CpG ODN 1668 administration at 7 days before RBIV infection.
further experimental administrations, two types CpG ODNs (1668 and 2113) were selected from the results.
3.2. Effect of CpG ODNs (1668 and 2133) on RBIV infection at 23 and 20 °C (Experiment II) Fish were administered CpG ODNs (1668 and 2113) at the concentration of 5 mg/fish and injected with RBIV at 2 days post CpG ODN administration showed 100% cumulative mortality at 23 and 20 °C. However, there was a considerable delay in the final mortality compared to virus-injected control fish at 31 dpi (1668 at 23 °C), 38 dpi (1668 at 20 °C), 27 dpi (2133 at 23 °C) and 37 dpi (2133 at 20 °C), respectively (Fig. 2) (Table 3), while the virus-injected control fish exhibited 100% mortality at 23 °C and 20 °C at 23 dpi and 28 dpi, respectively. Furthermore, the significant difference was observed only in the CpG ODN 1668 administration group at 20 °C (p < 0.0001).
The fish groups maintained for 2 and 4 days at 23 °C and 20 °C with RBIV injection and then administered CpG ODNs (1668 and 2133) at the concentration of 5 mg/fish showed 100% cumulative mortality. The mortality was delayed only in the group CpG ODN 1668 administered group at 23 °C. However, CpG ODN 2113 administered group did not show considerable delay in the mortality compared to virus-injected control fish (Fig. 2) (Table 3). For further experimental administrations, CpG ODN 1668 was selected from the results.
3.3. Protection efficacy of CpG ODN 1668 at 20 °C (Experiment III) The experiment was designed to evaluate the efficacy and duration of protection provided by the administration of the CpG ODN 1668 to rock bream at 1, 5 and 10 mg/fish. At 2, 4 and 7 days post CpG ODN administration, the fish were exposed to RBIV at 20 °C. The RPS obtained due to administration was 20%, 60% and 30% (2 days), 30%, 40% and 60% (4 days) and 60%, 60% and 20% (7 days),
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
Dead fish
3697
MCP copy number in dead or survived fish
1010 109
lethal virus copy number
Absolute virus copy number
108 107 106 105 104
Survived fish 103 102 101 detection limit
2
nd
vi ru si nj ec 3 rd te d vi co ru nt si ro nj l ec te d co nt ro 1 l g (2 da ys ) 5 g (2 da ys 10 ) g (2 da ys ) 1 g (4 da ys ) 5 g (4 da ys 10 ) g (4 da ys ) 1 g (7 da ys ) 5 g (7 da ys 10 ) g (7 da ys )
100
Groups Fig. 4. RBIV MCP (major capsid protein) copy number of the fish used for re-infection from survivors (Experiment IV). The MCP gene copies of all dead fish from the 2nd or 3rd virus injected control groups and the MCP gene copies in all rock bream survivors from CpG ODN 1668 administration groups are shown. RBIV MCP copy number was 1.0 101/ml can be regarded as negative.
respectively, for the respective administration dose and time points at the end of 100 dpi (Fig. 3). RPS obtained at each groups is shown in Table 4. 3.4. RBIV re-challenge of survivors (Experiment IV) To all surviving fish group from experiment III at 100 dpi were re-challenge with RBIV, and the survivors obtained administration of CpG ODN 1668 concentrations at 1, 5 and 10 mg/fish at 2 days before infection group (16, 8 and 14 of fish), 4 days before infection group (14, 12 and 8 of fish) and 7 days before infection group (8, 8 and 16 of fish), for the respective administration dose (Fig. 3). All of survivors, following the first re-infection at 100 dpi, did not show any mortality or clinical signs of disease. Initial mortality was observed after 17 days in the virus-infected control fish (naive fish, not previously exposed to virus), with characteristic clinical signs of the RBIV disease, and the mortality reached 100% at 22 dpi (Fig. 3). The dead fish demonstrated high MCP gene copy numbers in the spleen (greater than 7.1 107/ml/whole spleen weight 91– 150 mg) (Fig. 4). At 400 dpi (from the initial virus infection), the surviving fish from the second challenge were subjected to a third infection trial. During 400 to 450 dpi, all the re-challenged fish survived (Fig. 3), with low MCP gene copy numbers (below 102/ml/whole spleen weight 45–58 mg) (Fig. 4). The virus-infected control fish exhibited 100% mortality at 25 dpi (virus copy number greater than 1.2 107/ml/whole spleen weight 95–135 mg) (Fig. 4). 4. Discussion Once rock bream exposed to RBIV at high water temperature conditions (over 20 °C), it is difficult to avoid the mortality [35,44] because the immune system is not established such as the inflammatory cytokines and apoptosis-related responses when RBIV infection occurs [36,45]. CpG ODN is believed to activate an antiviral state of sufficient duration for virus replication inhibition
to protect fish from virus infection [27–30]. However, there is no reported on the efficacy of CpG ODN in providing protection against RBIV infection in rock bream. Hence, in the present study, 5 CpG ODNs and 1 non-CpG ODN were designed and examined for antiviral potentials in rock bream. Among the 5 CpG ODNs and 1 non-CpG ODN examined in experiment I, 1 or 5 mg of CpG ODNs administered at 2 days before infection (1.1 107 MCP gene copies/100 ll) at 26 °C did not show any protection in rock bream. However, 5 CpG ODNs and 1 nonCpG ODN delayed the final mortality of fish compared to virus infected control. This indicates that although CpG ODNs mediated antiviral responses are not the immediate antiviral host defence response, it could still induce an antiviral response against optimum RBIV replication condition (26 °C). Non-CpG ODN 1720, which was included to be a control, there was delay in the final mortality compared to the virus injected control fish at 4 days (1 or 5 lg/fish, respectively). Interestingly, two types of CpG ODNs (1668 and 2113) were more help to delay the final mortality by 8 and 4 days (1 and 5 mg of CpG ODN 1668, respectively), and 5 and 8 days (1 and 5 mg of CpG ODN 2113, respectively). A similar observation was showed in the experiment II, and the final mortality was delayed more when 5 mg of CpG ODN 1668 and 2113 were administered at 2 days before virus infection (1.2 106 MCP gene copies/100 ll) at 23 or 20 °C by 9 and 11 days (CpG ODN 1668, at 23 and 20 °C, respectively), and 5 and 11 days (CpG ODN 2113, at 23 and 20 °C, respectively). However, when CpG ODN 1668 and 2113 administration at post infection at 23 or 20 °C; the considerable delayed mortality was only observed in CpG ODN 1668 administration group at 23 °C (7/3 days, at 2/4 days post infection, respectively). Therefore, these observation suggest that CpG ODN 1668 made greater delay in final mortality and CpG ODN 1668 can induce better antiviral immune responses in administered fish at before infection than in administered fish at post infection. CpG ODN 1668 administered to olive flounder increased the protection level significantly from 83.3% and 70% upon infection with Edwardsiella tarda and Philasterides dicentrarchi, respectively
3698
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
[25,32]. Bridle et al. [31] also demonstrated that CpG ODN 1668 can provide better protection to treated fish than to untreated control fish against Neoparamoeba perurans, the agent of amoebic gill disease in Atlantic salmon. They observed a 90% survival rate in fish treated with CpG ODN 1668 compared to 60% in untreated control fish. To obtain survivors, in the experiment III had a virus concentration, which was lower than the concentration in the other experiments. Fish administered CpG ODN 1668 (1, 5 and 10 mg/fish) at 2, 4 and 7 days before virus infection (1.1 104) at 20 °C had provide the highest protection, mortality rates of 20%, 60% and 30% (2 days), 30%, 40% and 60% (4 days), and 60%, 60% and 20% (7 days), respectively, for the respective administration doses. This indicates that the CpG ODN 1668 can induce better antiviral immune responses with lower virus replication speed and show the possibility of developing preventive measures against RBIV using CpG ODN 1668. Recently, we found that rock bream surviving from RBIV infection acquired protection against RBIV re-infection [35]. However, once activated RBIV was not easily inactivated in fish body, the fish need at least 40 days to 50 days from final mortality to not to activate the virus again, and completely eliminating them from their body. Thus, in this study, survivors from experiment III were maintained for an additional 40 days from final mortality (around 60 dpi) and protective immunity was evaluated by re-infection of RBIV at 100 dpi. Survivors re-infected by RBIV (1.1 107 gene MCP gene copy/fish) at 100 dpi used 1000 times higher virus concentration than 1st infection, and fish showed 100% survival rates at 2nd virus infection. In 3rd virus infection at 400 dpi showed 100% survival rates with low virus copy (below 102) at 450 dpi. This suggests that virus completely eliminated from fish body under the threshold of causing mortality. This was evident from the previous report demonstrated that the once virus decrease under limit threshold (below 102) to cause mortality, possibility is less to cause fish mortality again [35]. Moreover, protective immunity from CpG ODN 1668 administration can provide significantly higher protection from re-exposure to the virus infection for about 15 months (450 days). This observation indicates that the immune defense systems of surviving fish can protect them from RBIV re-infection. In conclusion, the present study demonstrated, for the first time, the possibility of development of control measures against RBIV using CpG ODN 1668. Therefore, CpG ODN 1668 is efficient and safe for rock bream and can offer an appropriate strategy to prevent RBIV. Acknowledgements This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT & Future Planning (2015R1C1A1A01053685). References [1] Williams T. The iridoviruses. Adv Virus Res 1996;46:345–412. [2] Eaton HE, Metcalf J, Penny E, Tcherepanov V, Upton C, Brunetti CR. Comparative genomic analysis of the family Iridoviridae: re-annotating and defining the core set of iridovirus genes. Virol J 2007;4:11. [3] Inouye K, Yamano K, Maeno Y, Nakajima K, Matsuoka M, Wada Y, et al. Iridovirus infection of cultured red sea bream, Pagrus major. Fish Pathol 1992;27:19–27. [4] Nakajima K, Sorimachi M. Biological and physico-chemical properties of the iridovirus isolated from cultured red sea bream, Pagrus major. Fish Pathol 1994;29:29–33. [5] Chua FHC, Ng ML, Ng KL, Loo JJ, Wee JY. Investigation of outbreaks of a novel disease, ‘Sleepy Grouper Disease’, affecting the brown-spotted grouper, Epinephelus tauvina Forskal. J Fish Dis 1994;17:417–27. [6] Matsuoke S, Inouye K, Nakajima K. Cultured fish species affected by red sea bream iridoviral disease from 1991 to 1995. Fish Pathol 1996;31:233–4.
[7] Miyata M, Matsuno K, Jung SJ, Danayadol Y, Miyazaki T. Genetic similarity of iridoviruses from Japan and Thailand. J Fish Dis 1997;20:127–34. [8] Chou HY, Hsu CC, Peng TY. Isolation and characterization of a pathogenic iridovirus from cultured grouper (Epinephelus sp.) in Taiwan. Fish Pathol 1998;33:201–6. [9] Do JW, Cha SJ, Kim JS, An EJ, Lee NS, Choi HJ, et al. Phylogenetic analysis of the major capsid protein gene of iridovirus isolates from cultured flounders Paralichthys olivaceus in Korea. Dis Aquat Organisms 2005;64:193–200. [10] Kim WS, Oh MJ, Jung SJ, Kim YJ, Kitamura SI. Characterization of an iridovirus detected from cultured turbot Scophthalmus maximus in Korea. Dis Aquat Organisms 2005;64:175–80. [11] Kurita J, Nakajima K. Megalocytiviruses. Viruses 2012;4:521–38. [12] Jung SJ, Oh MJ. Iridovirus-like infection associated with high mortalities of striped beakperch, Oplegnathus fasciatus (Temminck et Schlegel), in southern coastal areas of the Korean peninsula. J Fish Dis 2000;23:223–6. [13] Bird AP. CpG islands as gene markers in the vertebrate nucleus. Trends Genet 1987;3:342–7. [14] Cardon LR, Burge C, Clayton DA, Karlin S. Pervasive CpG suppression in animal mitochondrial genomes. Proc Natl Acad Sci 1994;91:3799–803. [15] Krieg AM. CPG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 2002;20:709–60. [16] Bauer S, Kirschning CJ, Häcker H, Redecke V, Hausmann S, Akira S, et al. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc Natl Acad Sci 2001;98:9237–42. [17] Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, et al. A Toll-like receptor recognizes bacterial DNA. Nature 2000;408:740–5. [18] Martin-Orozco E, Kobayashi H, Van Uden J, Nguyen MD, Kornbluth RS, Raz E. Enhancement of antigen-presenting cell surface molecules involved in cognate interactions by immunostimulatory DNA sequences. Int Immunol 1999;11:1111–8. [19] Krieg AM. Therapeutic potential of Toll-like receptor 9 activation. Nat Rev Drug Discovery 2006;5:471–84. [20] Shima F, Uto T, Akagi T, Akashi M. Synergistic stimulation of antigen presenting cells via TLR by combining CpG ODN and poly (c-glutamic acid)based nanoparticles as vaccine adjuvants. Bioconjug Chem 2013;24:926–33. [21] Ioannou XP, Griebel P, Hecker R, Babiuk LA. The immunogenicity and protective efficacy of bovine herpesvirus 1 glycoprotein D plus Emulsigen are increased by formulation with CpG oligodeoxy nucleotides. J Virol 2002;76:9002–10. [22] Oxenius A, Martinic MM, Hengartner H, Klenerman P. CpG-containing oligonucleotides are efficient adjuvants for induction of protective antiviral immune responses with T-cell peptide vaccines. J Virol 1999;73:4120–6. [23] Martinez-Alonso S, Martinez-Lopez A, Estepa A, Cuesta A, Tafalla C. The introduction of multi-copy CpG motifs into an antiviral DNA vaccine strongly up-regulates its immunogenicity in fish. Vaccine 2011;29:1289–96. [24] Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 1995;374:546–9. [25] Lee CH, Jeong HD, Chung JK, Lee HH, Kim KH. CpG motif in synthetic ODN primes respiratory burst of olive flounder Paralichthys olivaceus phagocytes and enhances protection against Edwardsiella tarda. Dis Aquat Organisms 2003;56:43–8. [26] Rhodes LD, Rathbone CK, Corbett SC, Harrell LW, Strom MS. Efficacy of cellular vaccines and genetic adjuvants against bacterial kidney disease in chinook salmon (Oncorhynchus tshawytscha). Fish Shellfish Immunol 2004;16:461–74. [27] Jørgensen JB, Johansen LH, Steiro K, Johansen A. CpG DNA induces protective antiviral immune responses in Atlantic salmon (Salmo salar L.). J Virol 2003;77:11471–9. [28] Kang YJ, Kim KH. Effect of CpG-ODNs belonging to different classes on resistance of olive flounder (Paralichthys olivaceus) against viral hemorrhagic septicemia virus (VHSV) and Miamiensis avidus (Ciliata; Scuticociliatia) infections. Aquaculture 2012;324:39–43. [29] Thim HL, Iliev DB, Christie KE, Villoing S, McLoughlin MF, Strandskog G, et al. Immunoprotective activity of a Salmonid Alphavirus Vaccine: comparison of the immune responses induced by inactivated whole virus antigen formulations based on CpG class B oligonucleotides and poly I: C alone or combined with an oil adjuvant. Vaccine 2012;30:4828–34. [30] Zhou ZX, Zhang J, Sun L. C7: A CpG oligodeoxynucleotide that induces protective immune response against megalocytivirus in Japanese flounder (Paralichthys olivaceus) via toll-like receptor 9-mediated signaling pathway. Dev Comp Immunol 2014;44:124–32. [31] Bridle AR, Butler B, Nowak BF. Immunostimulatory CpG oligodeoxynucleotides increase resistance against amoebic gill disease in Atlantic salmon, Salmo salar L. J Fish Dis 2003;26:367–71. [32] Lee EH, Kim KH. Immobilization antigen-independent protection of olive flounder (Paralichthys olivaceus) against Philasterides dicentrarchi (Ciliophora: Scuticociliatia) infection. Aquaculture 2008;279:211–3. [33] Alcorn SW, Murray AL, Pascho RJ. Effects of rearing temperature on immune functions in sockeye salmon (Oncorhynchus nerka). Fish Shellfish Immunol 2002;12:303–34. [34] Bly JE, Clem LW. Temperature and teleost immune functions. Fish Shellfish Immunol 1992;2:159–71. [35] Jung MH, Jung SJ, Vinay TN, Nikapitiya C, Kim JO, Lee JH, et al. Effects of water temperature on mortality in Megalocytivirus-infected rock bream Oplegnathus fasciatus (Temminck et Schlegel) and development of protective immunity. J Fish Dis 2015;38:729–37.
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699 [36] Jung MH, Nikapitiya C, Song JY, Lee JH, Lee JH, Oh MJ, et al. Gene expression of proand anti-apoptotic proteins in rock bream (Oplegnathus fasciatus) infected with Megalocytivirus (family Iridoviridae). Fish Shellfish Immunol 2014;37:122–30. [37] Krug A, Rothenfusser S, Hornung V, Jahrsdörfer B, Blackwell S, Ballas ZK, et al. Identification of CpG oligonucleotide sequences with high induction of IFN-a/b in plasmacytoid dendritic cells. Eur J Immunol 2001;31:2154–63. [38] Strandskog G, Skjæveland I, Ellingsen T, Jørgensen JB. Double-stranded RNAand CpG DNA-induced immune responses in Atlantic salmon: comparison and synergies. Vaccine 2008;26:4704–15. [39] Jørgensen JB, Zou J, Johansen A, Secombes CJ. Immunostimulatory CpG oligodeoxynucleotides stimulate expression of IL-1b and interferon-like cytokines in rainbow trout macrophages via a chloroquine-sensitive mechanism. Fish Shellfish Immunol 2001;11:673–82. [40] Carrington AC, Collet B, Holland JW, Secombes CJ. CpG oligodeoxynucleotides stimulate immune cell proliferation but not specific antibody production in rainbow trout (Oncorhynchus mykiss). Vet Immunol Immunopathol 2004;101:211–22.
3699
[41] Vollmer J, Weeratna R, Payette P, Jurk M, Schetter C, Laucht M, et al. Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur J Immunol 2004;34:251–62. [42] Lin JY, Hu GB, Yu CH, Li S, Liu QM, Zhang SC. Molecular cloning and expression studies of the adapter molecule myeloid differentiation factor 88 (MyD88) in turbot (Scophthalmus maximus). Dev Comp Immunol 2015;52:166–71. [43] Amend DF. Potency testing of fish vaccines. In: Anderson DP, Hennessen W, editors. Developments in biological standardization, vol. 49. Basel: Fish biologics. Serodiagnostics and Vaccines; 1981. p. 447–54. [44] Jung MH, Lee J, Jung SJ. Low pathogenicity of FLIV (flounder iridovirus) and the absence of cross-protection between FLIV and RBIV (rock bream iridovirus). J Fish Dis 2016;39:1325–33. [45] Hong S, Jin JW, Park JH, Kim JK, Jeong HD. Analysis of proinflammatory gene expression by RBIV infection in rock bream Oplegnathus faciatus. Fish Shellfish Immunol 2016;50:317–26.
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration Myung-Hwa Jung a,⇑, Jehee Lee b, M. Ortega-Villaizan c, Luis Perez c, Sung-Ju Jung a a
Department of Aqualife Medicine, Chonnam National University, Republic of Korea Department of Marine Life Sciences, Jeju National University, Republic of Korea c IBMC, Miguel Hernandez University, Elche, Spain b
a r t i c l e
i n f o
Article history: Received 1 February 2017 Received in revised form 22 May 2017 Accepted 23 May 2017 Available online 1 June 2017 Keywords: Rock bream Rock bream iridovirus CpG ODN 1668 Protection
a b s t r a c t Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5 mg) at 2 days before infection (1.1 107) held at 26 °C died even though mortality was delayed from 8 days (1 mg) and 4 days (5 mg). Similarly, CpG ODN 1668 administered (5 mg) at 2 days before infection (1.2 106) held at 23/20 °C had 100% mortality; the mortality was delayed from 9 days (23 °C) and 11 days (20 °C). Moreover, when CpG ODN 1668 administered (1/5/10 mg) at 2/4/7 days before infection or virus concentration was decreased to 1.1 104 and held at 20 °C had mortality rates of 20/60/30% (2 days), 30/40/60% (4 days) and 60/60/20% (7 days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were reinfected with RBIV (1.1 107) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following rechallenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20 °C and infection dose of 1.1 104). Ó 2017 Elsevier Ltd. All rights reserved.
1. Introduction Iridoviridae is a family of large double stranded DNA viruses (120–300 nm) with icosahedral morphology [1]. The family includes five genera: Iridovirus, Chloriridovirus, Ranavirus, Lymphocystivirus and Megalocytivirus [2]. Members of the genus Megalocytivirus causes disease in more than 30 species of cultured marine fish belonging mainly to the orders Perciformes and Pleuronectiformes [3–10]. Rock bream iridovirus (RBIV), which belongs to the genus Megalocytivirus [11]. RBIV infection in Korea to rock bream (Oplegnathus fasciatus) was first reported in the summer, 1998 from the southern coastal areas [12]. Since first outbreak, high mortality occurred in rock bream annually due to RBIV. Prophylactic measures to control RBIV remain unsolved in
⇑ Corresponding author at: Department of Aqualife Medicine, Chonnam National University, San96-1 Dunduck Dong, Yeosu, Chonnam 550-749, Republic of Korea. E-mail address: [email protected] (M.-H. Jung). http://dx.doi.org/10.1016/j.vaccine.2017.05.073 0264-410X/Ó 2017 Elsevier Ltd. All rights reserved.
rock bream aquaculture industry; thus, fish farmers hesitate to culture them due to the high risk of RBIV. Hence, the development of control and preventive measures against RBIV is required to support rock bream aquaculture industry. Oligodeoxynucleotides (ODNs) containing dinucleotides with unmethylated cytosine-phosphate-guanine (CpG) motifs are a type of pathogen-associated molecular patterns (PAMPs) that are present commonly in the genomes of microbial pathogens [13–15]. CpG is recognized by the toll-like receptor (TLR) 9 on dendritic cells, B cells, and macrophages [15–17]. Interaction between TLR9 and CpG triggers the secretion of Th1-promoting cytokines and enhances Th1-biased cellular and humoral immunity [18–20]. CpG ODNs have shown promise as an immune protective agent and vaccine adjuvant. Several studies have documented the potent adjuvant activity of CpG DNA in vaccines with various antigens, including viral antigens [21,22] and with DNA vaccines [23]. Additionally, CpG DNA has been shown to induce disease resistance against bacterial [24–26], viral [27–30] and protozoa
3692
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
[31,32] diseases. However, the working mechanisms of these CpG remain largely unknown. Water temperature is known to affect the immune system and susceptibility of fish to virus infection [33,34]. In Korea, RBIV outbreaks typically occur in cultured rock bream from August to September, when water temperature between 23 and 27 °C [12]. Recently, our previous studies have demonstrated a clear correlation between mortality and the water temperature against RBIV infection in rock bream [35]; fish injected with RBIV and held at 29, 26, 23 or 20 °C had 100% mortality with delayed mortality at low water temperatures. However, there was no mortality at 17 °C. In addition, fish injected with 7.5 107–6.7 105/100 ll of RBIV and held at 26 °C showed 100% cumulative mortality with delayed mortality at the low virus concentrations. These findings indicate that the virus replication speed with the water temperature is likely the more critical factor for rock bream mortality. Therefore, this study was carried out to find whether CpG ODNs enhance the protection at different virus replication levels at 26, 23 or 20 °C. The experiment involved in searching the efficacy of CpG ODNs on the controlled variation of water temperatures, different concentrations of RBIV, different CpG ODNs, different doses of CpG ODNs and a suitable time of CpG ODNs administration (before or post virus injection). Furthermore, long-term protection from reRBIV infection was estimated.
2. Materials and methods 2.1. Experimental fish Rock bream were obtained from a local farm and reared at the Fisheries Science Institute at Chonnam National University. Approximately 2000 fish (6.4 ± 1.0 cm, 8.1 ± 1.2 g) were maintained in large tanks (10 ton) with a continuous seawater supply with aeration. Fish were fed daily from 2% of their body weight. The required number of fish for the experiments was transferred to the infection experimental facility.
2.2. Isolation of rock bream iridovirus The virus used in the present study was originally isolated from RBIV-infected rock bream in 2010 as explained earlier [36].
2.3. CpG ODNs Six of the CpG ODNs used in this study have been reported previously: 2216 [37,38], 1668 [25,39], 1826 [26], 2133 [40], 2395 [41,42] and 1720 [39]. All CpG ODNs mentioned are detailed in Table 1. All the CpG ODNs were constructed on a phosphorothioate backbone and synthesized by Genotech (Korea). The synthesized CpG ODNs were solubilized in sterile deionized water.
2.4. Pre-challenge studies The virus challenge dose was confirmed with a pre-challenge study using ten naïve fish of each group of which 100% died at a dose of 1.1 107, 1.2 106, 6.7 105 and 1.1 104 MCP gene copies at 26, 23 and 20 °C. 2.5. Effect of CpG ODNs on RBIV infection at 26 °C (Experiment I) Since, optimum RBIV replication water temperature in fish body is 26 °C, this water temperature was selected at first to examine the antiviral property of CpG ODNs on RBIV infection. Rock bream (8.1 ± 1.2 cm, 13.7 ± 2.1 g) were administered intraperioneally (i. p.) with each of the 6 CpG ODNs (2216, 1668, 1826, 2133, 2395 and 1720) at 1 and 5 mg/100 ll/fish or with phosphate-buffered saline (PBS) as a control. At 2 days post administration (dpa) of CpG ODNs, the fish were injected with RBIV (100 ll/fish) containing 1.1 107 MCP gene copies. Each group of 20 fish was maintained at 26 °C for 15 days in an aquarium containing 30 L of UVtreated seawater. Overall daily water exchange rate was 50% of system volume per day (15 L/day). Table 2 summarizes the experimental conditions. 2.6. Effect of CpG ODNs (1668 and 2133) on RBIV infection at 23 and 20 °C (Experiment II) Rock bream are susceptible to high RBIV dose (1.1 107 MCP gene copies) with typical water temperature of RBIV outbreak (at 26 °C). Alterations in experimental conditions were made to determine whether a protective immune response could be induced in the surviving fish. To examine the effect of water temperature and time on the antiviral property of CpG ODNs (1668 and 2133) following three consecutive experiments (trial I, trial II and trial III). In trial I, 20 fish in each group (8.8 ± 1.2 cm, 15.1 ± 2.4 g) were divided randomly into four groups; i) 23 °C with 1668, ii) 23 °C with 2113, iii) 20 °C with 1668 and iv) 20 °C with 2113 were administered i.p. with CpG ODNs (1668 and 2133, respectively) at 5 mg/100 ll/fish. These groups were named the 2 days before infection group. Groups were injected with RBIV (100 ll/fish) containing 1.2 106 MCP gene copies at 2 days post CpG ODN administration, respectively. In trial II, rock bream were divided randomly into four groups (20 fish per group); i) 23 °C with 1668, ii) 23 °C with 2113, iii) 20 °C with 1668 and iv) 20 °C with 2113 were injected with RBIV (100 ll/fish) containing 1.2 106 MCP gene copies. At 2 days post infection (dpi), four groups were administered i.p. with CpG ODNs (1668/2133, respectively) at 5 mg/100 ll/fish; this group was called the 2 days post infection group. In trial III, twenty fish in each group were divided randomly into four groups; i) 23 °C with 1668, ii) 23 °C with 2113, iii) 20 °C with 1668 and iv) 20 °C with 2113, and injected with RBIV (100 ll/fish) containing 1.2 106 MCP gene copies. At 4 days post infection, fish
Table 1 CpG ODNs used in this study. Name
Sequence
Action
CpG ODN 2216 CpG ODN 1668
GGGGGACGATCGTCGGGGGG TCCATGACGTTCCTGATGCT
CpG ODN 1826 CpG ODN 2133 CpG ODN 2395
TCCATGACGTTCCTGACGTT TCGTCGTTGGTTGTCGTTTTGGT TCGTCGTTTTCGGCGCGCGCCG
Non-CpG ODN 1720
TCCATGAGCTTCCTGATGCT
Mx expression was highly expressed in atlantic salmon head kindey and spleen (50 mg/fish) [38] Increased disease resistance (0.25 and 0.5 mg/fish) in olive flounder [25] Induced IL1b expression (2, 5, 10 and 20 mM) and antiviral activity (5 mM) in rainbow trout head kidney macrophages [39] Induced protection to Renibacterium salmoninarum in chinook salmon (15 mg/fish) [26] Induced proliferation of rainbow trout peripheral blood leucocytes (1 mg mL1) [40] Myeloid differentiation factor 88 (MyD88) gene was induced in turbot gills, kidney, spleen and muscle (0.15 mg/ml, 95 ll/fish) [42] Non-CpG ODN used as controls: atlantic salmon (1, 2 and 5 mM) [39]
3693
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699 Table 2 The details of effect of 6 CpG ODNs on RBIV infection at 26 °C (Experiment I). Group
No. of fish
CpG ODN concentration
RBIV infection at
RBIV infection dose/fish
Mortality
Day of final mortality
Delay final mortality compared with control
p-value
2216
20 20 20 20 20 20 20 20 20 20 20 20 20 20
1 lg 5 lg 1 lg 5 lg 1 lg 5 lg 1 lg 5 lg 1 lg 5 lg 1 lg 5 lg Virus Naive
26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C 26 °C
1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 1.1 107 PBS
100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 0%
15 day 14 day 19 day 15 day 14 day 13 day 16 day 19 day 11 day 15 day 15 day 15 day 11 day
+4 days +3 days +8 days +4 days +3 days +2 days +5 days +8 days 0 day +4 days +4 days +4 days
0.0002 <0.0001 <0.0001 <0.0001 0.0208 <0.0001 <0.0001 <0.0001 0.3952 <0.0001 0.0010 <0.0001
1668 1826 2133 2395 1720 Control
Table 3 The details of effect of CpG ODNs (1668 and 2133) on RBIV infection at 23 and 20 °C (Experiment II). Group
CpG ODN
CpG ODN concentration
No. of fish
RBIV infection at
RBIV infection dose/fish
Mortality
Day of final mortality
Delay final mortality compared with control
p-value
2 days before infection
1668 1668 2133 2133
5 lg 5 lg 5 lg 5 lg
20 20 20 20
23 °C 20 °C 23 °C 20 °C
1.2 106 1.2 106 1.2 106 1.2 106
100% 100% 100% 100%
31 day 38 day 27 day 37 day
+9 days +11 days +5 days +10 days
0.0214 <0.0001 0.0775 0.0003
2 days post infection
1668 1668 2133 2133
5 lg 5 lg 5 lg 5 lg
20 20 20 20
23 °C 20 °C 23 °C 20 °C
1.2 106 1.2 106 1.2 106 1.2 106
100% 100% 100% 100%
29 day 26 day 22 day 27 day
+7 days 1 day 0 day 0 day
0.0214 0.0362 0.7945 0.5872
4 days post infection
1668 1668 2133 2133
5 lg 5 lg 5 lg 5 lg
20 20 20 20
23 °C 20 °C 23 °C 20 °C
1.2 106 1.2 106 1.2 106 1.2 106
100% 100% 100% 100%
25 day 25 day 23 day 27 day
+3 days 2 days +1 day 0 day
0.0027 0.5713 0.5012 0.7319
Control
Virus Naive Virus Naive
20 20 20 20
23 °C 23 °C 20 °C 20 °C
1.2 106 PBS 1.2 106 PBS
100% 0% 100% 0%
22 day 27 day
Table 4 Summary of CpG ODN 1668 efficacy test (Experiment III and IV). RBIV infection dose/fish
Mortality at 100 dpi
RPS
p-value
RBIV 2nd infection for survivors
RBIV infection dose/fish
Mortality
p-value
RBIV 3rd infection for survivors
RBIV infection dose/fish
Mortality
p-value
2 days before infection 1 lg 20 20 °C 5 lg 20 20 °C 10 lg 20 20 °C
1.1 104 1.1 104 1.1 104
20% 60% 30%
80% 40% 70%
<0.0001 0.0008 <0.0001
100 dpi 100 dpi 100 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
400 dpi 400 dpi 400 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
4 days before infection 1 lg 20 20 °C 5 lg 20 20 °C 10 lg 20 20 °C
1.1 104 1.1 104 1.1 104
70% 60% 40%
30% 40% 60%
<0.0001 <0.0001 <0.0001
100 dpi 100 dpi 100 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
400 dpi 400 dpi 400 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
7 days before infection 20 20 °C 1 lg 5 lg 20 20 °C 10 lg 20 20 °C
1.1 104 1.1 104 1.1 104
40% 40% 80%
60% 60% 20%
<0.0001 <0.0001 <0.0001
100 dpi 100 dpi 100 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
400 dpi 400 dpi 400 dpi
1.1 107 1.1 107 1.1 107
0% 0% 0%
<0.0001 <0.0001 <0.0001
Control Naive 1st virus 2nd virus 3rd virus
PBS 1.1 104 N/A N/A
0% 100% N/A N/A
N/A N/A
N/A 1.1 107 N/A
N/A 100% N/A
N/A
N/A N/A
N/A N/A 400 dpi
N/A N/A 1.1 107
N/A N/A 100%
N/A N/A
Group
No. of fish
20 20 20 20
RBIV infection at
20 °C 20 °C 20 °C 20 °C
groups were administered i.p. with CpG ODNs (1668/2133, respectively) at 5 mg/100 ll/fish; these groups were regarded as the 4 days post infection group. The same number of fish in the virus injected control and naive group were injected i.p. with virus or PBS alone at each
N/A
water temperatures (23 or 20 °C, respectively), and the fish were maintained for 38 days in an aquarium containing 30 L of UVtreated seawater. Overall daily water exchange rate was 50% of system volume per day (15 L/day). Table 3 summarizes the experimental conditions.
3694
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
CpG ODN 2216
A 1µg 5µg
80
Virus injected control 60
PBS injected (Naïve)
40 20
1µg
100
Cumulative mortality%
Cumulative mortality%
100
CpG ODN 1668
B 5µg 80
Virus injected control PBS injected (Naïve)
60 40 20
0
0 0
2
4
6
8
10
12
14
16
18
20
0
2
4
6
Days post infection
C 1µg
Cumulative mortality%
Cumulative mortality%
D
CpG ODN 1826
100
5µg
80
Virus injected control 60
PBS injected (Naïve)
40 20 0
10
12
14
16
18
20
16
18
20
CpG ODN 2133 1µg
100
5µg 80
Virus injected control PBS injected (Naïve)
60 40 20 0
0
2
4
6
8
10
12
14
16
18
20
0
2
4
6
Days post infection
8
10
12
14
Days post infection
CpG ODN 2395
E
Non-CpG ODN 1720
F 100
80 60
1µg 5µg
40
Virus injected control 20
PBS injected (Naïve)
0
Cumulative mortality%
100
Cumulative mortality%
8
Days post infection
80 1µg
60
5µg
40
Virus injected control
20
PBS injected (Naïve)
0 0
2
4
6
8
10
12
14
16
18
20
Days post infection
0
2
4
6
8
10
12
14
16
18
20
Days post infection
Fig. 1. The mortality patterns of fish administered with 6 CpG ODNs (2216, 1668, 1826, 2133, 2395 and 1720) at 1 and 5 mg/fish following an i.p. injected with RBIV (1.1 107) at 2 days post CpG ODNs administration at 26 °C (typical water temperature of RBIV). A- CpG ODN 2216; B- CpG ODN 1668; C- CpG ODN 1826; D- CpG ODN 2133; E- CpG ODN 2395; F- Non-CpG ODN 1720.
2.7. Analysis of the antiviral effect of CpG ODN 1668 in relation to dose, time and water temperature (Experiment III)
2.8. Virus re-challenge of survivors from Experiment III (Experiment IV)
Although, all the fish died at water temperatures at 20–26 °C with virus doses of 1.2 106–1.1 107 MCP gene copies, CpG ODN 1668 administered fish group delayed final mortality at low water temperatures or low virus concentrations. To obtain survivors to reduce virus replication speed, fish were injected with RBIV containing 1.1 104 MCP gene copies (100 1000-fold lower than the other experiments). Twenty fish (9.3 ± 1.5 cm, 17.1 ± 2.1 g) in each group were administered i.p. with PBS (virus injected control and naive) or CpG ODN 1668 at the concentration of 1, 5 and 10 mg/100 ll/fish, respectively. Fish were injected with RBIV (100 ll/fish) containing 1.1 104 MCP gene copies at 2, 4 and 7 days post CpG ODN administration, respectively. These groups were named as the 2, 4 and 7 days before infection group, respectively. Fish were maintained at 20 °C for 100 days in an aquarium containing 30 L of UV-treated seawater. Overall daily water exchange rate was 50% of system volume per day (15 L/day). Table 4 summarizes the experimental conditions.
Surviving fish (11.0 ± 1.4 cm, 18.7 ± 1.3 g) from Experiment III at 100 dpi were challenged a second time with an RBIV injection of 100 ml/fish (1.1 107 MCP gene copies). Twenty naive fish (11.2 ± 1.3 cm, 19.1 ± 1.5 g) (not previously exposed to virus) were injected with RBIV in the same manner as the survivors. Each group of fish were kept at 20 °C for 300 days in an aquarium containing 40 L of UV-treated seawater. Overall daily water exchange rate was 50% of system volume per day (20 L/day). After reaching 400 dpi (300 days from the second challenge), the fish (16.2 ± 1.4 cm, 26.4 ± 1.2 g) were challenged a third time with an RBIV injection of 100 ml/fish (1.1 107 MCP gene copies). Twenty naive fish (16.1 ± 1.2 cm, 26.2 ± 1.1 g) (not previously exposed to virus) were injected with RBIV in the same manner as the survivors. The fish were maintained for an additional 50 days in an aquarium containing 40 L of UV-treated seawater and observed for the reoccurrence of mortality due to RBIV. Overall daily water exchange rate was 50% of system volume per day
3695
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
CpG ODN 1668 (23 C)
A
CpG ODN 1668 (20 C)
B
100
100
2 days before infection
Cumulative mortality%
Cumulative mortality%
2 days before infection 2 days post infection
80
4 days post infection 60
Virus injected control PBS injected (Naïve)
40 20 0
2 days post infection
80
4 days post infection 60
Virus injected control PBS injected (Naïve)
40 20 0
0
5
10
15
20
25
30
0
5
10
15
Days post infection
CpG ODN 2113 (23 C)
C
100
2 days before infection 2 days post infection
80
4 days post infection 60
Virus injected control PBS injected (Naïve)
40
25
30
35
40
35
40
CpG ODN 2113 (20 C)
D Cumulative mortality%
Cumulative mortality%
100
20
Days post infection
20 0
2 days before infection 2 days post infection
80
4 days post infection 60
Virus injected control PBS injected (Naïve)
40 20 0
0
5
10
15
20
25
30
0
5
10
Days post infection
15
20
25
30
Days post infection
Fig. 2. The effect of CpG ODNs (1668 and 2113) on RBIV (1.2 106) at 23 and 20 °C. To obtain survivors, experimental conditions were adjusted as follows; water temperature (23 and 20 °C) and RBIV injection dose (1.2 106) were lower than the experiment I. Twenty fish in each group (8.8 ± 1.2 cm, 15.1 ± 2.4 g) were i.p injected with CpG ODNs (1668 and 2113) at 1, 5 and 10 lg/fish before or post virus injection. A- CpG ODN 1668 administration at 23 °C; B- CpG ODN 1668 administration at 20 °C; C- CpG ODN 2113 administration at 23 °C; D- CpG ODN 2113 administration at 20 °C.
(20 L/day). To determine the MCP gene copy number, spleen were collected from all the surviving fish at the end of 450 dpi. Table 4 summarizes the experimental conditions.
2.11. Statistical analysis For all the challenge trials, Log rank test was carried out using GraphPad Prism5 Software for survival analysis.
2.9. Determination of viral copy number in the spleen 2.12. Ethics statement Genomic DNA was isolated from whole spleen (45–150 mg) of Ò each fish using an AccuPrep Genomic DNA extraction kit (Bioneer, Korea) according to the manufacturer’s instructions. RBIV major capsid protein gene (MCP) specific primer set (F 50 tgcacaatctagttgaggaggtg 30 and R 50 aggcgttccaaaagtcaagg 30 ) was used to perform quantitative real time polymerase chain reaction (qRTPCR) using Exicycler 96 Real-Time Quantitative Thermal Block (Bioneer, Korea) to yield 90 bp product and reaction conditions were similar as previously described [36]. Standard curve was generated to determine the RBIV MCP gene copy number by qRT-PCR as described previously [36]. The virus copy number was determined from 1 ll of DNA of 100 ll of total DNA that was extracted from a whole spleen. The detection limit level of RBIV MCP copy number was 1.0 101/ml. 2.10. Relative percent survival (RPS) RPS was calculated according to the method described by Amend et al. [43].
RPS ¼ ½1 ð% mortality of CpG ODN administered group= % mortality in control 100
All rock bream experiments were carried out in strict accordance with the recommendations of the Institutional Animal Care and Use Committee of Chonnam National University (permit number: CNU IACUC-YS-2015-4). 3. Results 3.1. Selection of CpG ODNs that inhibit virus replication in rock bream at 26 °C (Experiment I) Rock bream were administered 5 CpG ODNs (2216, 1668, 1826, 2133 and 2395) and 1 non-CpG ODN 1720 (used as control) i.p. at the concentration of 1 and 5 mg/fish and injected with RBIV at 2 days post administration and held 26 °C showed 100% cumulative mortality by 19 dpi. However, mortality was delayed from 2 days to 8 days in comparison to virus-injected control fish (Fig. 1) (Table 2). The log-rank test showed a significant difference between the CpG ODNs administered and non-administered virus injected control group, and the p-values for each groups are given in Table 2. Two types of CpG ODNs (1668 and 2113) delayed final mortality more than that observed in other CpG ODNs administered fish. For
3696
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
CpG ODN 1668 administration (2 days before RBIV infection)
A 100
1 µg
Survival%
80
5 µg 10 µg
60
1st virus injected control 2nd virus injected control
40 20
3rd virus injected control
Third infection
Second infection
PBS injected (Naïve)
0 0
10
20
30
40
50
60
70
100
110
120
130
140
400
410
420
430
440
450
Days post infection CpG ODN 1668 administration (4 days before RBIV infection)
B 100
1 µg
Survival%
80
5 µg 10 µg
60
1st virus injected control 2nd virus injected control
40
3rd virus injected control
Third infection
Second infection
20
PBS injected (Naïve)
0 0
10
20
30
40
50
60
70
100
110
120
130
140
400
410
420
430
440
450
Days post infection CpG ODN 1668 administration (7 days before RBIV infection)
C 100
1 µg
Survival%
80
5 µg 10 µg
60
1st virus injected control 2nd virus injected control
40
3rd virus injected control 20
0
10
20
30
40
50
60
70
100
110
PBS injected (Naïve)
Third infection
Second infection
0
120
130
140
400
410
420
430
440
450
Days post infection Fig. 3. The protection efficacy of CpG ODN 1668 at 20 °C. Twenty fish (9.3 ± 1.5 cm, 17.1 ± 2.1 g) in each group were administered i.p. with CpG ODN 1668 (1, 5 and 10 lg/fish) at 2, 4 and 7 days before RBIV infection. To establish mild infection to reduce virus replication speed, fish were injected with RBIV (1.1 104) and maintained at 20 °C in the aquarium. At 100 dpi, surviving fish from Experiment III were infected a second time (1.1 107 MCP copies/fish). The surviving fish from the second infection were subjected to a third infection (period of 400 to 450 dpi) using 1.1 107 MCP copies/fish. A- CpG ODN 1668 administration at 2 days before RBIV infection; B- CpG ODN 1668 administration at 4 days before RBIV infection; C- CpG ODN 1668 administration at 7 days before RBIV infection.
further experimental administrations, two types CpG ODNs (1668 and 2113) were selected from the results.
3.2. Effect of CpG ODNs (1668 and 2133) on RBIV infection at 23 and 20 °C (Experiment II) Fish were administered CpG ODNs (1668 and 2113) at the concentration of 5 mg/fish and injected with RBIV at 2 days post CpG ODN administration showed 100% cumulative mortality at 23 and 20 °C. However, there was a considerable delay in the final mortality compared to virus-injected control fish at 31 dpi (1668 at 23 °C), 38 dpi (1668 at 20 °C), 27 dpi (2133 at 23 °C) and 37 dpi (2133 at 20 °C), respectively (Fig. 2) (Table 3), while the virus-injected control fish exhibited 100% mortality at 23 °C and 20 °C at 23 dpi and 28 dpi, respectively. Furthermore, the significant difference was observed only in the CpG ODN 1668 administration group at 20 °C (p < 0.0001).
The fish groups maintained for 2 and 4 days at 23 °C and 20 °C with RBIV injection and then administered CpG ODNs (1668 and 2133) at the concentration of 5 mg/fish showed 100% cumulative mortality. The mortality was delayed only in the group CpG ODN 1668 administered group at 23 °C. However, CpG ODN 2113 administered group did not show considerable delay in the mortality compared to virus-injected control fish (Fig. 2) (Table 3). For further experimental administrations, CpG ODN 1668 was selected from the results.
3.3. Protection efficacy of CpG ODN 1668 at 20 °C (Experiment III) The experiment was designed to evaluate the efficacy and duration of protection provided by the administration of the CpG ODN 1668 to rock bream at 1, 5 and 10 mg/fish. At 2, 4 and 7 days post CpG ODN administration, the fish were exposed to RBIV at 20 °C. The RPS obtained due to administration was 20%, 60% and 30% (2 days), 30%, 40% and 60% (4 days) and 60%, 60% and 20% (7 days),
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
Dead fish
3697
MCP copy number in dead or survived fish
1010 109
lethal virus copy number
Absolute virus copy number
108 107 106 105 104
Survived fish 103 102 101 detection limit
2
nd
vi ru si nj ec 3 rd te d vi co ru nt si ro nj l ec te d co nt ro 1 l g (2 da ys ) 5 g (2 da ys 10 ) g (2 da ys ) 1 g (4 da ys ) 5 g (4 da ys 10 ) g (4 da ys ) 1 g (7 da ys ) 5 g (7 da ys 10 ) g (7 da ys )
100
Groups Fig. 4. RBIV MCP (major capsid protein) copy number of the fish used for re-infection from survivors (Experiment IV). The MCP gene copies of all dead fish from the 2nd or 3rd virus injected control groups and the MCP gene copies in all rock bream survivors from CpG ODN 1668 administration groups are shown. RBIV MCP copy number was 1.0 101/ml can be regarded as negative.
respectively, for the respective administration dose and time points at the end of 100 dpi (Fig. 3). RPS obtained at each groups is shown in Table 4. 3.4. RBIV re-challenge of survivors (Experiment IV) To all surviving fish group from experiment III at 100 dpi were re-challenge with RBIV, and the survivors obtained administration of CpG ODN 1668 concentrations at 1, 5 and 10 mg/fish at 2 days before infection group (16, 8 and 14 of fish), 4 days before infection group (14, 12 and 8 of fish) and 7 days before infection group (8, 8 and 16 of fish), for the respective administration dose (Fig. 3). All of survivors, following the first re-infection at 100 dpi, did not show any mortality or clinical signs of disease. Initial mortality was observed after 17 days in the virus-infected control fish (naive fish, not previously exposed to virus), with characteristic clinical signs of the RBIV disease, and the mortality reached 100% at 22 dpi (Fig. 3). The dead fish demonstrated high MCP gene copy numbers in the spleen (greater than 7.1 107/ml/whole spleen weight 91– 150 mg) (Fig. 4). At 400 dpi (from the initial virus infection), the surviving fish from the second challenge were subjected to a third infection trial. During 400 to 450 dpi, all the re-challenged fish survived (Fig. 3), with low MCP gene copy numbers (below 102/ml/whole spleen weight 45–58 mg) (Fig. 4). The virus-infected control fish exhibited 100% mortality at 25 dpi (virus copy number greater than 1.2 107/ml/whole spleen weight 95–135 mg) (Fig. 4). 4. Discussion Once rock bream exposed to RBIV at high water temperature conditions (over 20 °C), it is difficult to avoid the mortality [35,44] because the immune system is not established such as the inflammatory cytokines and apoptosis-related responses when RBIV infection occurs [36,45]. CpG ODN is believed to activate an antiviral state of sufficient duration for virus replication inhibition
to protect fish from virus infection [27–30]. However, there is no reported on the efficacy of CpG ODN in providing protection against RBIV infection in rock bream. Hence, in the present study, 5 CpG ODNs and 1 non-CpG ODN were designed and examined for antiviral potentials in rock bream. Among the 5 CpG ODNs and 1 non-CpG ODN examined in experiment I, 1 or 5 mg of CpG ODNs administered at 2 days before infection (1.1 107 MCP gene copies/100 ll) at 26 °C did not show any protection in rock bream. However, 5 CpG ODNs and 1 nonCpG ODN delayed the final mortality of fish compared to virus infected control. This indicates that although CpG ODNs mediated antiviral responses are not the immediate antiviral host defence response, it could still induce an antiviral response against optimum RBIV replication condition (26 °C). Non-CpG ODN 1720, which was included to be a control, there was delay in the final mortality compared to the virus injected control fish at 4 days (1 or 5 lg/fish, respectively). Interestingly, two types of CpG ODNs (1668 and 2113) were more help to delay the final mortality by 8 and 4 days (1 and 5 mg of CpG ODN 1668, respectively), and 5 and 8 days (1 and 5 mg of CpG ODN 2113, respectively). A similar observation was showed in the experiment II, and the final mortality was delayed more when 5 mg of CpG ODN 1668 and 2113 were administered at 2 days before virus infection (1.2 106 MCP gene copies/100 ll) at 23 or 20 °C by 9 and 11 days (CpG ODN 1668, at 23 and 20 °C, respectively), and 5 and 11 days (CpG ODN 2113, at 23 and 20 °C, respectively). However, when CpG ODN 1668 and 2113 administration at post infection at 23 or 20 °C; the considerable delayed mortality was only observed in CpG ODN 1668 administration group at 23 °C (7/3 days, at 2/4 days post infection, respectively). Therefore, these observation suggest that CpG ODN 1668 made greater delay in final mortality and CpG ODN 1668 can induce better antiviral immune responses in administered fish at before infection than in administered fish at post infection. CpG ODN 1668 administered to olive flounder increased the protection level significantly from 83.3% and 70% upon infection with Edwardsiella tarda and Philasterides dicentrarchi, respectively
3698
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699
[25,32]. Bridle et al. [31] also demonstrated that CpG ODN 1668 can provide better protection to treated fish than to untreated control fish against Neoparamoeba perurans, the agent of amoebic gill disease in Atlantic salmon. They observed a 90% survival rate in fish treated with CpG ODN 1668 compared to 60% in untreated control fish. To obtain survivors, in the experiment III had a virus concentration, which was lower than the concentration in the other experiments. Fish administered CpG ODN 1668 (1, 5 and 10 mg/fish) at 2, 4 and 7 days before virus infection (1.1 104) at 20 °C had provide the highest protection, mortality rates of 20%, 60% and 30% (2 days), 30%, 40% and 60% (4 days), and 60%, 60% and 20% (7 days), respectively, for the respective administration doses. This indicates that the CpG ODN 1668 can induce better antiviral immune responses with lower virus replication speed and show the possibility of developing preventive measures against RBIV using CpG ODN 1668. Recently, we found that rock bream surviving from RBIV infection acquired protection against RBIV re-infection [35]. However, once activated RBIV was not easily inactivated in fish body, the fish need at least 40 days to 50 days from final mortality to not to activate the virus again, and completely eliminating them from their body. Thus, in this study, survivors from experiment III were maintained for an additional 40 days from final mortality (around 60 dpi) and protective immunity was evaluated by re-infection of RBIV at 100 dpi. Survivors re-infected by RBIV (1.1 107 gene MCP gene copy/fish) at 100 dpi used 1000 times higher virus concentration than 1st infection, and fish showed 100% survival rates at 2nd virus infection. In 3rd virus infection at 400 dpi showed 100% survival rates with low virus copy (below 102) at 450 dpi. This suggests that virus completely eliminated from fish body under the threshold of causing mortality. This was evident from the previous report demonstrated that the once virus decrease under limit threshold (below 102) to cause mortality, possibility is less to cause fish mortality again [35]. Moreover, protective immunity from CpG ODN 1668 administration can provide significantly higher protection from re-exposure to the virus infection for about 15 months (450 days). This observation indicates that the immune defense systems of surviving fish can protect them from RBIV re-infection. In conclusion, the present study demonstrated, for the first time, the possibility of development of control measures against RBIV using CpG ODN 1668. Therefore, CpG ODN 1668 is efficient and safe for rock bream and can offer an appropriate strategy to prevent RBIV. Acknowledgements This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT & Future Planning (2015R1C1A1A01053685). References [1] Williams T. The iridoviruses. Adv Virus Res 1996;46:345–412. [2] Eaton HE, Metcalf J, Penny E, Tcherepanov V, Upton C, Brunetti CR. Comparative genomic analysis of the family Iridoviridae: re-annotating and defining the core set of iridovirus genes. Virol J 2007;4:11. [3] Inouye K, Yamano K, Maeno Y, Nakajima K, Matsuoka M, Wada Y, et al. Iridovirus infection of cultured red sea bream, Pagrus major. Fish Pathol 1992;27:19–27. [4] Nakajima K, Sorimachi M. Biological and physico-chemical properties of the iridovirus isolated from cultured red sea bream, Pagrus major. Fish Pathol 1994;29:29–33. [5] Chua FHC, Ng ML, Ng KL, Loo JJ, Wee JY. Investigation of outbreaks of a novel disease, ‘Sleepy Grouper Disease’, affecting the brown-spotted grouper, Epinephelus tauvina Forskal. J Fish Dis 1994;17:417–27. [6] Matsuoke S, Inouye K, Nakajima K. Cultured fish species affected by red sea bream iridoviral disease from 1991 to 1995. Fish Pathol 1996;31:233–4.
[7] Miyata M, Matsuno K, Jung SJ, Danayadol Y, Miyazaki T. Genetic similarity of iridoviruses from Japan and Thailand. J Fish Dis 1997;20:127–34. [8] Chou HY, Hsu CC, Peng TY. Isolation and characterization of a pathogenic iridovirus from cultured grouper (Epinephelus sp.) in Taiwan. Fish Pathol 1998;33:201–6. [9] Do JW, Cha SJ, Kim JS, An EJ, Lee NS, Choi HJ, et al. Phylogenetic analysis of the major capsid protein gene of iridovirus isolates from cultured flounders Paralichthys olivaceus in Korea. Dis Aquat Organisms 2005;64:193–200. [10] Kim WS, Oh MJ, Jung SJ, Kim YJ, Kitamura SI. Characterization of an iridovirus detected from cultured turbot Scophthalmus maximus in Korea. Dis Aquat Organisms 2005;64:175–80. [11] Kurita J, Nakajima K. Megalocytiviruses. Viruses 2012;4:521–38. [12] Jung SJ, Oh MJ. Iridovirus-like infection associated with high mortalities of striped beakperch, Oplegnathus fasciatus (Temminck et Schlegel), in southern coastal areas of the Korean peninsula. J Fish Dis 2000;23:223–6. [13] Bird AP. CpG islands as gene markers in the vertebrate nucleus. Trends Genet 1987;3:342–7. [14] Cardon LR, Burge C, Clayton DA, Karlin S. Pervasive CpG suppression in animal mitochondrial genomes. Proc Natl Acad Sci 1994;91:3799–803. [15] Krieg AM. CPG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 2002;20:709–60. [16] Bauer S, Kirschning CJ, Häcker H, Redecke V, Hausmann S, Akira S, et al. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc Natl Acad Sci 2001;98:9237–42. [17] Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, et al. A Toll-like receptor recognizes bacterial DNA. Nature 2000;408:740–5. [18] Martin-Orozco E, Kobayashi H, Van Uden J, Nguyen MD, Kornbluth RS, Raz E. Enhancement of antigen-presenting cell surface molecules involved in cognate interactions by immunostimulatory DNA sequences. Int Immunol 1999;11:1111–8. [19] Krieg AM. Therapeutic potential of Toll-like receptor 9 activation. Nat Rev Drug Discovery 2006;5:471–84. [20] Shima F, Uto T, Akagi T, Akashi M. Synergistic stimulation of antigen presenting cells via TLR by combining CpG ODN and poly (c-glutamic acid)based nanoparticles as vaccine adjuvants. Bioconjug Chem 2013;24:926–33. [21] Ioannou XP, Griebel P, Hecker R, Babiuk LA. The immunogenicity and protective efficacy of bovine herpesvirus 1 glycoprotein D plus Emulsigen are increased by formulation with CpG oligodeoxy nucleotides. J Virol 2002;76:9002–10. [22] Oxenius A, Martinic MM, Hengartner H, Klenerman P. CpG-containing oligonucleotides are efficient adjuvants for induction of protective antiviral immune responses with T-cell peptide vaccines. J Virol 1999;73:4120–6. [23] Martinez-Alonso S, Martinez-Lopez A, Estepa A, Cuesta A, Tafalla C. The introduction of multi-copy CpG motifs into an antiviral DNA vaccine strongly up-regulates its immunogenicity in fish. Vaccine 2011;29:1289–96. [24] Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 1995;374:546–9. [25] Lee CH, Jeong HD, Chung JK, Lee HH, Kim KH. CpG motif in synthetic ODN primes respiratory burst of olive flounder Paralichthys olivaceus phagocytes and enhances protection against Edwardsiella tarda. Dis Aquat Organisms 2003;56:43–8. [26] Rhodes LD, Rathbone CK, Corbett SC, Harrell LW, Strom MS. Efficacy of cellular vaccines and genetic adjuvants against bacterial kidney disease in chinook salmon (Oncorhynchus tshawytscha). Fish Shellfish Immunol 2004;16:461–74. [27] Jørgensen JB, Johansen LH, Steiro K, Johansen A. CpG DNA induces protective antiviral immune responses in Atlantic salmon (Salmo salar L.). J Virol 2003;77:11471–9. [28] Kang YJ, Kim KH. Effect of CpG-ODNs belonging to different classes on resistance of olive flounder (Paralichthys olivaceus) against viral hemorrhagic septicemia virus (VHSV) and Miamiensis avidus (Ciliata; Scuticociliatia) infections. Aquaculture 2012;324:39–43. [29] Thim HL, Iliev DB, Christie KE, Villoing S, McLoughlin MF, Strandskog G, et al. Immunoprotective activity of a Salmonid Alphavirus Vaccine: comparison of the immune responses induced by inactivated whole virus antigen formulations based on CpG class B oligonucleotides and poly I: C alone or combined with an oil adjuvant. Vaccine 2012;30:4828–34. [30] Zhou ZX, Zhang J, Sun L. C7: A CpG oligodeoxynucleotide that induces protective immune response against megalocytivirus in Japanese flounder (Paralichthys olivaceus) via toll-like receptor 9-mediated signaling pathway. Dev Comp Immunol 2014;44:124–32. [31] Bridle AR, Butler B, Nowak BF. Immunostimulatory CpG oligodeoxynucleotides increase resistance against amoebic gill disease in Atlantic salmon, Salmo salar L. J Fish Dis 2003;26:367–71. [32] Lee EH, Kim KH. Immobilization antigen-independent protection of olive flounder (Paralichthys olivaceus) against Philasterides dicentrarchi (Ciliophora: Scuticociliatia) infection. Aquaculture 2008;279:211–3. [33] Alcorn SW, Murray AL, Pascho RJ. Effects of rearing temperature on immune functions in sockeye salmon (Oncorhynchus nerka). Fish Shellfish Immunol 2002;12:303–34. [34] Bly JE, Clem LW. Temperature and teleost immune functions. Fish Shellfish Immunol 1992;2:159–71. [35] Jung MH, Jung SJ, Vinay TN, Nikapitiya C, Kim JO, Lee JH, et al. Effects of water temperature on mortality in Megalocytivirus-infected rock bream Oplegnathus fasciatus (Temminck et Schlegel) and development of protective immunity. J Fish Dis 2015;38:729–37.
M.-H. Jung et al. / Vaccine 35 (2017) 3691–3699 [36] Jung MH, Nikapitiya C, Song JY, Lee JH, Lee JH, Oh MJ, et al. Gene expression of proand anti-apoptotic proteins in rock bream (Oplegnathus fasciatus) infected with Megalocytivirus (family Iridoviridae). Fish Shellfish Immunol 2014;37:122–30. [37] Krug A, Rothenfusser S, Hornung V, Jahrsdörfer B, Blackwell S, Ballas ZK, et al. Identification of CpG oligonucleotide sequences with high induction of IFN-a/b in plasmacytoid dendritic cells. Eur J Immunol 2001;31:2154–63. [38] Strandskog G, Skjæveland I, Ellingsen T, Jørgensen JB. Double-stranded RNAand CpG DNA-induced immune responses in Atlantic salmon: comparison and synergies. Vaccine 2008;26:4704–15. [39] Jørgensen JB, Zou J, Johansen A, Secombes CJ. Immunostimulatory CpG oligodeoxynucleotides stimulate expression of IL-1b and interferon-like cytokines in rainbow trout macrophages via a chloroquine-sensitive mechanism. Fish Shellfish Immunol 2001;11:673–82. [40] Carrington AC, Collet B, Holland JW, Secombes CJ. CpG oligodeoxynucleotides stimulate immune cell proliferation but not specific antibody production in rainbow trout (Oncorhynchus mykiss). Vet Immunol Immunopathol 2004;101:211–22.
3699
[41] Vollmer J, Weeratna R, Payette P, Jurk M, Schetter C, Laucht M, et al. Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur J Immunol 2004;34:251–62. [42] Lin JY, Hu GB, Yu CH, Li S, Liu QM, Zhang SC. Molecular cloning and expression studies of the adapter molecule myeloid differentiation factor 88 (MyD88) in turbot (Scophthalmus maximus). Dev Comp Immunol 2015;52:166–71. [43] Amend DF. Potency testing of fish vaccines. In: Anderson DP, Hennessen W, editors. Developments in biological standardization, vol. 49. Basel: Fish biologics. Serodiagnostics and Vaccines; 1981. p. 447–54. [44] Jung MH, Lee J, Jung SJ. Low pathogenicity of FLIV (flounder iridovirus) and the absence of cross-protection between FLIV and RBIV (rock bream iridovirus). J Fish Dis 2016;39:1325–33. [45] Hong S, Jin JW, Park JH, Kim JK, Jeong HD. Analysis of proinflammatory gene expression by RBIV infection in rock bream Oplegnathus faciatus. Fish Shellfish Immunol 2016;50:317–26.