- Email: [email protected]
Interaction between Kazal serine proteinase inhibitor SPIPm2 and viral protein WSV477 reduces the replication of white spot syndrome virus
Fish & Shellfish Immunology 35 (2013) 957e964
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Interaction between Kazal serine proteinase inhibitor SPIPm2 and viral protein WSV477 reduces the replication of white spot syndrome virus Sirikwan Ponprateep a, Kornsunee Phiwsaiya b, c, Anchalee Tassanakajon a, Vichien Rimphanitchayakit a, * a
Center of Excellence for Molecular Biology and Genomics of Shrimp, Department of Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand Center of Excellence for Shrimp Molecular Biology and Biotechnology, Mahidol University, Rama VI Rd., Bangkok 10400, Thailand c National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Pathumthani 12120, Thailand b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 8 May 2013 Received in revised form 8 July 2013 Accepted 8 July 2013 Available online 16 July 2013
White spot syndrome (WSS) is a viral disease caused by white spot syndrome virus (WSSV) which leads to severe mortality in cultured penaeid shrimp. In response to WSSV infection in Penaeus monodon, a Kazal serine proteinase inhibitor SPIPm2, normally stored in the granules of granular and semi-granular hemocytes is up-regulated and found to deter the viral replication. By using yeast two-hybrid screening, we have identified a viral target protein, namely WSV477. Instead of being a proteinase, the WSV477 was reported to be a Cys2/Cys2-type zinc finger regulatory protein having ATP/GTP-binding activity. In vitro pull down assay confirmed the proteineprotein interaction between rSPIPm2 and rWSV477. Confocal laser scanning microscopy demonstrated that the SPIPm2 and WSV477 were co-localized in the cytoplasm of shrimp hemocytes. Using RNA interference, the silencing of WSV477 resulted in downregulated of viral late gene VP28, the same result obtained with SPIPm2. In this instance, the SPIPm2 does not function as proteinase inhibitor but inhibit the regulatory function of WSV477. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Kazal-type serine proteinase inhibitor Penaeus monodon White spot syndrome virus Yeast two-hybrid screening WSV477
1. Introduction Several biological processes in multicellular organisms are catalyzed or activated by proteinases or proteinase cascades, such as food digestion, blood coagulation, tissue repair and modeling, morphogenesis, melanization, gelatinolysis in male reproductive system, etc. [1e4]. The proteinases are deleterious to the tissues and have to be controlled effectively by proteinase inhibitors. There are several types of proteinase inhibitors in the organisms. Those widely known inhibitors are serpins, Kazal-type inhibitors, Kunitztype inhibitors, Bowman-Birk inhibitors, pacifastin, etc [5e7]. The Kazal-type serine proteinase inhibitors are well characterized. They are usually composed of more than one Kazal inhibitory domain of about 40e60 amino acid residues [8,9]. A Kazal domain is formed and stabilized by three conserved intradomain disulfide bridges among six conserved cysteine residues. Its proteinase
* Corresponding author. Tel.: þ66 2 2185436; fax: þ66 2 2185418. E-mail addresses: [email protected], [email protected] (V. Rimphanitchayakit). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.07.009
inhibitory specificity is depending on the so-called P1 amino acid which is the second amino acid downstream of the second cysteine residue. The side chain of P1 amino acid is able to fit into a pocket within the active site of a cognate proteinase [10]. For instance, an inhibitor with P1 Lys or Arg preferentially inhibits trypsin and trypsin-like proteinases. The inhibition is competitive in nature with potent inhibitory constants in the range of nanomolar. In crustaceans, the Kazal-type inhibitors are abundant [11]. They have been reported in many crustacean species such as penaeid shrimp, prawn and crayfish, for example SPIPm inhibitors from Penaeus monodon [12], a FcKPI from Fenneropenaeus chinensis [13], a MrKPI from Macrobrachium rosenbergii [4] and PlKPIs from Pacifastacus leniusculus [14]. More recently, a five-domain Kazal serine proteinase inhibitor was identified from the crayfish Procambarus clarkii [15]. A cDNA clone coding for a one-domain Kazal serine proteinase inhibitor PtKPI has been identified in the swimming crab Portunus trituberculatus [16]. A four-Kazal domain-containing protein has been isolated from the cDNA library of Penaeus vannamei [17]. The expression of these Kazal inhibitors is changed, mostly up-regulated, in response to pathogenic infection. They are, then, claimed to be involved in immunity against pathogens.
958
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
White spot syndrome virus (WSSV) is an enveloped, ellipsoid, double-stranded DNA virus that causes white spot syndrome (WSS) in aquaculture of shrimp [18]. The disease is highly virulent and contagious resulting in completely loss of the penaeid culture without any possible remedies. The outbreak of WSS in several Asian countries has prompted the studies of shrimp immunity and WSSV in order to understand the immune response of shrimp and the pathogenicity of WSSV which may help pave way for the prevention and possible remedy of WSS. The SPIPm2 from P. monodon is a 5-domain Kazal serine proteinase inhibitor with inhibitory activity against elastase and subtilisin [19]. The SPIPm2 is expressed in the shrimp hemocytes and stored in the cells readily to be secreted upon activation [20]. Some amount of SPIPm2 is already in the shrimp circulation [21]. The expression of SPIPm2 in P. monodon is up-regulated after yellow head virus and WSSV infection [22,23]. By treating the WSSV or hemocytes with recombinant SPIPm2 prior to infection, the viral replication is retarded [20]. It is, then, expected that the SPIPm2 may in some ways interact with the virus or its component leading to the disruption of the viral replication process. In this study, the immunogold labeling and transmission electron microscope were used to locate the SPIPm2 inside the hemocytes from normal and WSSV-infected shrimp. We also used a yeast two-hybrid screening technique to identify the target protein of SPIPm2 and study the protein in order to understand the mechanism of action of SPIPm2 on the viral replication process. 2. Materials and methods 2.1. Localization of SPIPm2 in shrimp hemocytes using immunogold labeling The shrimp hemolymph was directly collected into a fixative solution (4% paraformaldehyde in PBS pH 7.4) and incubated for 1 h at room temperature. Shrimp hemocytes were collected by centrifugation at 800 g and washed twice with PBS. The hemocytes were, then, embedded in LR White (Polysciences) according to a standard protocol recommended by the manufacturer. Briefly, cells were quickly dehydrated for 10 min each in a series of precooled ethanol solutions (30, 50, 70, 96 and 100%). The ethanol was then replaced with a 2:1 mixture of ethanol/resin for 20 min, followed by a 1:2 mixture of ethanol/resin for 20 min, and pure resin for 1 h. Samples were infiltrated overnight with pure resin at 4 C and incubated the next day for 2 h with fresh resin. The resin was polymerized at 60 C for 72 h. Thin sections of 80 nm thick were cut with a glass knife and mounted on 200-mesh gilded nickel grids (Polysciences). The grids were incubated in 0.1 M glycine in PBS buffer for 20 min to block free aldehydes. Non-specific labeling was blocked by preincubation with Aurion blocking solution (Electron Microscopy Sciences) in PBS for 30 min at room temperature. The grids were washed in PBS 1 min for 3 times. The sections were, then, incubated with primary antibody, rabbit anti-SPIPm2 [21], diluted in PBS containing 1% (v/v) cold water fish gelatin for 1 h at room temperature, washed with 1% (v/v) cold water fish gelatin in PBS 3 min for 6 times, incubated with secondary gold-conjugated antibody having gold particle size of 10 nm (Electron Microscopy Sciences) in PBS containing 1% (w/v) BSA, 0.1% (v/v) Tween-20 and 0.1% (v/v) Triton X-100 for 1 h at room temperature, washed again in PBS 3 min for 6 times and, then, postfixed with 2.5% (v/v) glutaraldehyde in PBS for 5 min at room temperature. The grids were rinsed with double-distilled water 3 min for 3 times at room temperature and air-dried. Finally, sections were contrasted with a saturated solution of uranyl acetate in water for 4 min and lead citrate for 1 min.
2.2. Yeast two-hybrid screening Yeast two-hybrid screening was carried out using the Matchmaker Gold Yeast Two-Hybrid System (Clontech). As a bait protein gene, the SPIPm2 gene was amplified by PCR from pSPIPm2_NS2 [19] using SPIPm2-F and SPIPm2-R primers (Table 1). The gene was, then, cloned into the NcoI and BamHI sites fused to the GAL4 DNAbinding domain sequence in the pGBKT7 DNA-BD vector. The constructed pGBKT7-SPIPm2 was transformed into the Y2HGold competent cells and tested for auto-activation and toxicity. The two-hybrid library was constructed from the hemocyte cDNA (Somboonwiwat, unpublished) and the open reading frames of WSSV (Sangsuriya et al., submitted). Sub-adult black tiger shrimp weighing about 15 g were injected with diluted WSSV solution having an LD50 of 3 days. The P. monodon hemocytes were collected at 24 h post WSSV infection for total RNA extraction. The Mate & PlateÔ Library (Clontech) was used to construct the cDNA library. The various open reading frames of WSSV were cloned into the pGADT7 AD vector containing the GAL4 activation domain and transformed into the Y187 competent yeast cells using Matchmaker Library Construction and Screening Kits (Clontech). The yeast cells containing the bait vector and pray vector were mated following the manufacturer instruction. The positive clones were selected on the synthetic medium SD/-Leu/-Trp supplemented with X-a-Gal and aureobasidin A (AbA) (DDO/X/A). From the positive mating colonies, the prey plasmids were rescued. The positive interaction between the bait and prey was verified by co-transforming the bait vector and pray vector into the Y2HGold yeast cells and tested for the interaction on SD/-Leu/-Trp/ X-a-Gal (DDO/X) and SD/-Ade/-His/-Leu/-Trp/X-a-Gal/AbA (QDO/ X/A) agar. The positive prey vectors were subjected to DNA sequencing, annotation and analysis using bioinformatics tools. 2.3. Expression of rSPIPm2 and prey protein The bait protein, rSPIPm2 with 6 His-tag at its C-terminus, was produced using a plasmid pSPIPm2-NS2 and purified following a method described by Donpudsa et al., 2010 [19,21]. The purified rSPIPm2 was dialyzed against PBS pH 7.4 before used. For the expression of prey protein, a full-length WSV477 gene was PCR-amplified using primers rWSV477-F and rWSV477-R (Table 1) and cloned into the NcoI and EcoRI sites in the pBAD/ Table 1 Primers used in this study. Primer
Sequence (50 e30 )
Usage
SPIPm2-F SPIPm2-R
ATCGCCATGGGGAAAATCCGCC TAGCGGATCCTTAATATCCCTT
rWSV477-F rWSV477-R
ATAGCCATGGATATCTTCGTCGAA ATAGCCATGGATATCTTCGTCGAA
WSV477-F WSV477-R GFP-F GFP-R WSV477-FRT WSV477-RRT VP28-FRT VP28-RRT SPIPm2-FRT SPIPm2-RRT ie1-FRT ie1-RRT b-actin-FRT b-actin-RRT
CATGTGGAATGTCTTTCCTC ACTTTTATTTCTTGAATATT ATGGTGAGCAAGGGCGAGGA AGAAGGAAGGGCGCTGAC CGCGGATCCATGTATATCTTCGTCGA CCGGAATTCTTATAAGAAATGTACAA TCACTCTTTCGGTCGTGTCG CCACACACAAAGGTGCCAAC ATGCAACCACGTCTGTACTG CTGCAAGGTTCCACATCT GACTCTACAAATCTCTTTGCCA CTACCTTTGCACCAATTGCTAG GCTTGCTGATCCACATCTGCT ATCACCATCGGCAACGAGA
Cloning of SPIPm2 as bait protein gene in yeast two-hybrid screening Cloning of WSV477 gene into an expression vector WSV477 dsRNA synthesis GFP dsRNA synthesis RT-PCR of WSV477 [24] RT-PCR of VR28 RT-PCR of SPIPm2 [21] RT-PCR of ie1 RT-PCR of b-actin
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
Myc-His A vector fused at its 30 end to the myc epitope and 6 Histag. The constructed expression plasmid (pBAD-WSV477) was transformed into an E. coli strain TOP10. The cells were grown and the recombinant WSV477 (rWSV477) expression was induced by adding arabinose to 0.02%. The rWSV477 was prepared from the cells, purified using Ni-NTA (GE Healthcare) and dialyzed against PBS pH 7.4 before used. 2.4. Co-immunoprecipitation The co-immunoprecipitation was carried out to test the proteineprotein interaction in vitro. The rabbit antibody specific to rSPIPm2 [21] was immobilized and cross-linked with protein A sepharose CL4B (GE Healthcare) using dimethyl pimelimidate (Sigma) as described by Meyer et al., 1984 [25]. The cross-linked bead (50 ml bed volume) was equilibrated with PBS pH 7.4 supplemented with 1 M NaCl as a binding buffer. Then, 20 mg rSPIPm2 and/or 20 mg rWSV477 were loaded and incubated for 1 h at room temperature. The column was washed with 500 ml binding buffer for 15 times to eliminate the unbound protein. The proteins were eluted with 50 ml 100 mM glycine pH 2.5, neutralized with 1 M TriseHCl pH 9.5 and subjected to SDSePAGE. The SDSePAGE was western blotted and the proteins were detected using anti-His antibody (GE Healthcare) as primary antibody and goat alkaline phosphatase conjugated anti-mouse antibody as secondary antibody (Jackson ImmunoResearch). 2.5. Gene silencing of WSV477 in WSSV-infected hemocyte cell culture and shrimp To study the importance of WSV477 in viral replication, the RNA interference technique was employed. The WSV477 dsRNA was synthesized by T7 RiboMAXÔ Express Large Scale RNA Production System (Promega) from the selected sequence of WSV477 gene in pBAD-WSV477 using WSV477eF/R primers (Table 1). The control GFP dsRNA was also synthesized as described above from pEGFP-1 (Clontech) [26] using GFP-F/R primers (Table 1). The RNA interference was done for both hemocyte cell culture and shrimp. To prepare the hemocyte primary cell culture, the shrimp hemocytes were collected and cultured in the 96-well microtiterplate [20]. Briefly, hemocytes were separated by centrifugation and resuspended in L15 medium supplemented with 20% fetal bovine serum (GIBCO). The cell suspension was aliquot into each well of the 96-well plate (2 104 cells/100 ml/well) and incubated at 27 C overnight. Fresh L15 medium supplemented with 20% fetal bovine serum was replenished and incubated further for 2 h. The dsRNA was pre-incubated with histone H2A (calf thymus, type II-A; Sigma) for 10 min at room temperature before used [26]. The hemocyte cell cultures were divided into 3 groups of 3 wells. Each group was incubated with PBS, 5 mg of GFP dsRNA or WSV477 dsRNA. The purified WSSV (1 105 copies) was, then, added and incubated at 27 C for 24 h. The cultures were collected for total RNA preparation. Three groups of 5 shrimp each weighted about 5 g were injected with 50 ml of 0.85% NaCl, GFP dsRNA (10 mg/g shrimp) and WSSV dsRNA (10 mg/g shrimp), respectively. After 3 h, the shrimp were injected with 50 ml of 0.85% NaCl, GFP dsRNA (10 mg/g) and WSSV dsRNA (10 mg/g), respectively, along with purified WSSV (1 103 copies). After rearing normally for 24 h, the shrimp hemocytes were collected for total RNA preparation. Hemocytes from cell culture and shrimp were subjected to total RNA extraction using a TRI reagent (Molecular Research Center). The total RNA was treated with RQ1 RNase-free DNase (Promega) and used as a template for the first strand cDNA synthesis using a RevertAid First Strand cDNA Synthesis Kit (Fermentas). The cDNA was
959
analyzed for the expression of WSV477, VP28, SPIPm2, ie1 (intermediate early gene 1) and b-actin genes by RT-PCR using gene specific primers (Table 1). The b-actin gene was an internal control gene. An RT-PCR reaction of 25 ml total volume contained 1 PCR buffer, 200 mM dNTP, 0.2 mM of each specific primer, 1 unit of Taq DNA polymerase (RBC) and 4 ml of 1:10 dilution of the cDNA preparation. The reaction were carried out using the following conditions: an initial denaturation at 94 C for 5 min, followed by 30 cycles of denaturation at 94 C for 30 s, annealing at 60 C for 30 s, elongation at 72 C for 30 s, and the final extension at 72 C for 10 min. The PCR reactions were analyzed by agarose gel electrophoresis. The intensity of PCR product was detected using GeneCam Flexi, a gel documentation system (SynGene) and further quantified using the GeneTools image analysis software. The expression levels were calculated relative to that of bactin transcripts. The data were statistically analyzed for significant differences between groups using one way analysis of variance (ANOVA) followed by a post hoc test (Duncan’s new multiple range test). Significant differences are indicated at P < 0.05. 2.6. Co-localization between SPIPm2 and WSV477 Hemolymph from healthy shrimp and WSSV-infected shrimp (6, 24 and 48 h post infection) were collected, fixed in 4% (w/v) paraformaldehyde for 10 min and centrifuged at 800x g at 4 C for 10 min to separate the hemocytes. The hemocytes were resuspended in PBS and centrifuged onto the poly-L-lysine coated slides at 1000x g for 5 min. The hemocytes were permeabilyzed with 0.1% Triton X-100 for 5 min and blocked with blocking buffer (PBS containing 10% fetal bovine serum) at room temperature for 1 h. The slides were probed with purified rabbit and mouse polyclonal antibodies specific to rSPIPm2 and WSV477, respectively, for 1 h at room temperature. The slides were washed 3 times with washing buffer (PBS containing 0.05% Tween-20) and incubated with the secondary antibodies conjugated with fluorescence dyes, Alexa 488 or Alexa 568, at room temperature for 1 h. The slides were washed 3 times with washing buffer to remove non-specific binding, incubated with Topo-3 (Invitrogen) and then with mounting medium, ProLongÒ antifade reagent (Invitrogen). The slides were, finally, examined under a confocal laser scanning electron microscopy. 2.7. Proteinase activity assay Since SPIPm2 is a serine proteinase inhibitor, its target protein is thought to be a proteinase. The rWSV477 protein was tested for its proteinase activity using gelatin zymography [27]. The rWSV477 was loaded into an SDS-PAGE containing 0.1% gelatin. After electrophoresis, the acrylamide gel was incubated in phosphate buffer pH 7.8 containing 1% Triton X-100 at room temperature for an overnight. The gel was stained with Coomassie Blue Stain. Upon destaining, the gel became dark blue except the lighter area that had proteinase activity. 3. Results 3.1. SPIPm2 was synthesized and stored in the hemocyte granules Previously, we have found that the SPIPm2 is expressed and stored in the granules in the cytoplasm of semi-granular and granular but not the hyaline cells. The SPIPm2 is secreted upon WSSV infection [20]. To make certain the location of SPIPm2 in the hemocytes, we further used an immunogold labeling technique and a transmission electron microscope in our study. Hemocytes of healthy shrimp and WSSV-infected shrimp were subjected to immunogold labeling and visualization under the transmission electron microscope.
960
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
Agreeing well with our previous finding, the SPIPm2 molecules as dark spots were found in the granules of granular and semigranular hemocytes in normal shrimp (Fig. 1A and B) but not in the hyaline cell (Fig. 1C). The number of SPIPm2 molecules
increased drastically in the granular hemocyte derived from the WSSV-infected shrimp (Fig. 1D) indicating that the biosynthesis of SPIPm2 was up-regulated. Whether the granular hemocyte in Fig. 1D was infected or not was not known.
Fig. 1. Transmission electron micrographs of semi-granular, granular and hyaline hemocytes from Penaeus monodon in which the SPIPm2 was localized using immunogold labeling. The right micrographs are the magnification of the left micrographs. (A), (B) (C) and (D) are granular cell (GC), semi-granular cell (SGC), hyaline cell (HC) and granular cell from WSSV-infected shrimp, respectively. Black bar ¼ 0.5 mm and white bar ¼ 0.2 mm.
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
961
3.2. Yeast two-hybrid screening for binding target of SPIPm2 Previous study using ELISA showed that the SPIPm2 bound to the shrimp hemocyte membrane and WSSV [20]. To search for the binding target(s) of SPIPm2, the yeast two-hybrid screening was carried out using SPIPm2 as a bait protein for the screening of two libraries constructed from the hemocyte cDNA and the open reading frames in WSSV genome. Upon the screening of hemocyte cDNA library, several simple repetitive DNA sequences were obtained which could not be used for further sequence analysis (data not shown). On the other hand, the screening of WSSV library led us identify 5 viral sequences as listed in Table 2. Five proteins of WSSV that could interact with SPIPm2 were WSV020, WSV399, WSV267, WSV061 and WSV477. The WSV020, WSV399, WSV267 and WSV061 were unknown. The WSV477 was known for it was previously studied and found to be an early gene of WSSV that encoded a protein of 208 amino acid residues. It was interesting because it was possibly a type of zinc finger regulatory protein with a GTPbinding activity [24]. 3.3. Verification of proteineprotein interaction using coimmunoprecipitation assay To ascertain that the interaction of SPIPm2 and WSV477 was genuine, recombinant proteins rWSV477 and rSPIPm2 were produced and tested for their interaction by co-immunoprecipitation assay. The SPIPm2 was incubated with WSV477 and loaded through a column of protein A agarose beads cross-linked to rabbit anti-SPIPm2. If there was no strong interaction between the two proteins, WSV477 would be flow through during washing step and would not co-eluted with SPIPm2. As shown in Fig. 2, SPIPm2 was trapped by the anti-SPIPm2 in the column but not WSV477 (Fig. 2 lanes A and B). When they are incubated together prior to loading into the column, they were trapped by the anti-SPIPm2 and co-eluted from the column (Fig. 2 lane C). 3.4. WSV477 possessed no proteinase activity It has been known for sometimes that the SPIPm2 is a proteinase inhibitor that is inhibitory to elastase and subtilisin [19,28]. A protein that interacts with proteinase inhibitor is usually assumed to be a proteinase. Therefore, the rWSV477 was tested for its proteinase activity using gelatin zymography [27]. It was to our surprise that WSV477 possessed no proteinase activity (data not shown).
Fig. 2. Co-immunoprecipitation assay of the interaction between SPIPm2 and WSV477. The SPIPm2 was incubated with WSV477 (C) and loaded into a column of protein A sepharose CL4B crosslinked with rabbit anti-SPIPm2. After washing with high salt buffer, the proteins were co-eluted with acidic glycine buffer. Either SPIPm2 (A) or WSV477 (B) alone were used as controls. The eluted samples were analyzed by western blot analysis using anti-His antibody.
same cell during the course of WSSV infection. Hemolymph from shrimp infected with WSSV at different time points was collected and the hemocytes were detected for the WSV477 and SPIPm2 therein. The confocal laser scanning micrographs shown in Fig. 3 revealed that the SPIPm2 (green) was detected in the cytoplasm of granular hemocyte in normal shrimp. At 6 h post infection (hpi), a semi-granular hemocyte was also shown to bear SPIPm2 in its cytoplasm. As the WSSV infection progressed, the hemocytes seemed to be degranulated and, hence, difficult to distinguish between the semi-granular and granular hemocytes. The hemocytes bearing SPIPm2 were observed till 48 hpi. These very same cells were WSSV-infected cells for the WSV477 (red) was detected. The WSV477 was detected as early as 6 h and up to 48 h after viral infection. Interestingly, the WSV477 was only detected in the cytoplasm of SPIPm2-bearing hemocytes. A hemocyte with lesser SPIPm2 and WSV477 was also observed at time point 24 hpi. We did not observe the un-infected SPIPm2-bearing cells in this investigation.
3.5. Co-localization of SPIPm2 and WSV477 WSV477 is an early gene in WSSV infection [24] while the SPIPm2 is synthesized by the shrimp hemocytes [20]. It is, then, interesting to find out how the two proteins interact in the hemocytes. We employed a confocal laser scanning microscopy in this experiment to see whether the 2 proteins were co-localized in the Table 2 Clones detected by yeast two-hybrid from the WSSV open reading frame library. Clone number
BLAST result
Remark
Clone1/AD and Clone35/AD Clone2/AD Clone4/AD Clone14/AD Clone46/AD
WSSV076/WSV020
Unknown protein
WSSV458/WSV399 WSSV322/WSV267 WSSV118/WSV061 WSSV004/WSV477
Unknown protein Unknown protein Unknown protein Cys2/Cys2-type zinc finger, ATP/GTP-binding motif
3.6. Gene silencing of WSV477 in WSSV-infected hemocyte cell culture Previously, we had determined that the SPIPm2 was able to inhibit the propagation of WSSV. In this study, after having determined that the SPIPm2 interacted and co-localized with WSV477, it was, then, important to find out whether the interaction of SPIPm2 to WSV477 could inhibit the viral replication. However, the effect of such interaction on viral replication could not be directly traced. The importance of WSV477 on WSSV replication was, thus, determined using RNA interference. The WSV477 was silenced by transfecting the primary shrimp hemocyte culture with WSV477 dsRNA along with WSSV infection. The expression of WSV477, VP28 (the late viral protein gene) and SPIPm2 was determined using RTPCR. The control shrimp hemocytes were transfected with normal saline and GFP dsRNA. The expression of b-actin gene was the internal control expression.
962
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
Fig. 3. Confocal laser scanning micrographs of the WSSV-infected hemocytes. Hemocytes from shrimp infected with WSSV at 0, 6, 24 and 48 h post infection (hpi) were collected and fixed. The SPIPm2 and WSV477 were detected using purified rabbit polyclonal anti-SPIPm2 and mouse anti-WSV477. The positive cells were visualized using secondary antibody conjugated with fluorescent dyes, Alexa Flour 488 (green) for SPIPm2 and Alexa Flour 568 (red) for WSV477. Nuclei (adjusted to blue color) were stained with TO-PRO-3 iodide. HC, SCG and GC are hyaline, semi-granular and granular hemocytes, respectively. BFs are bright field images. Bars represent 5 mm.
In this RNA interference experiment, the expression of WSV477 in the cell culture was suppressed at 24 h after dsRNA transfection (Fig. 4A). The knockdown of WSV477 led to considerably lower expression of viral late gene, VP28, and reduced slightly the expression of SPIPm2. Similar results were obtained when the live shrimp were used (Fig. 4B). In this latter experiment, the effect of WSV477 knockdown on the ie1 and VP28 was investigated. The knockdown of WSV477 had no significant effect on the expression of ie1 but caused substantially reduced expression of VP28 by 66% as compared to that of GFP control (Fig. 2B). The results indicated the importance of WSV477 gene product in WSSV replication and it was the binding of SPIPm2 to WSV477 that impeded the replication of WSSV. 4. Discussion Of the nine different kinds of Kazal serine proteinase inhibitors in P. monodon, the SPIPm2 is the most abundant one [12,29]. The SPIPm2 is synthesized, stored in the shrimp granular cells (GC) and semi-granular cells (SGC), and secreted into the circulation as a hemolymph protein [20,21]. In this study, by using the immunogold labeling technique, we were able to show that the SPIPm2 protein was stored in the granules of SGC and GC. The hyaline cells (HC) lacked the storage granule and, hence, did not accommodate
SPIPm2 protein. Upon WSSV infection, the synthesis of SPIPm2 was increased as well as the storage of SPIPm2 in the granules. It had been shown that the very same cell types that produce SPIPm2, namely SGC and GC, in Penaeus merguiensis and Penaeus chinensis are also targets of WSSV attack [30,31]. By unknown mechanism, the WSSV causes the hemocytes to secrete SPIPm2 into the hemolymph. In turn, the SPIPm2 is able to interact with the WSSV as well as the hemocytes. In doing so, the SPIPm2 impedes the WSSV replication [20]. In this study, we used the yeast two-hybrid screening to search for both the cellular and viral targets. Unfortunately, only five viral candidate proteins were identified. All but one was unknown. The only known protein was the 208-amino acid WSV477. The WSV477 was an early protein in WSSV life cycle which might play a key role in DNA replication and virus proliferation. It was possibly a zinc finger regulatory protein with GTP-binding activity [24]. Since the SPIPm2 is a proteinase inhibitor, it is accustomed to think that the interacting counterpart is a proteinase. It was found out that the WSV477 was not a proteinase as anticipated. To test whether the interaction was genuine, the coimmunoprecipitation assay was employed and the specific interaction between SPIPm2 and WSV477 was confirmed. The results also indicated that the SPIPm2 did not function as a proteinase inhibitor in this instance.
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
963
Fig. 4. The affect of WSV477 silencing on the expression of VP28, SPIPm2 and ie1 in WSSV-infected shrimp hemocyte culture and shrimp. (A) The shrimp hemocyte cultures were transfected with normal saline, GFP dsRNA and WSV477 dsRNA followed by WSSV infection. After 24 h, the hemocyte cultures were harvested for RT-PCR analysis. The expression of WSV477, VP28, SPIPm2 and b-actin were determined. (B) Three groups of 5 shrimp were doubly injected with normal saline, GFP dsRNA and WSV477 dsRNA. The WSSV was included in the second injection. The shrimp hemocytes were collected for RTePCR analysis of WSV477, ie1 and VP28 expression. The data are means of three replicate experiments SDs. Asterisk indicates significance at P < 0.05.
Since the SPIPm2 hindered the replication of WSSV as mentioned above, we asked whether its affect on the replication was through the binding of SPIPm2 to WSV477, and how importance of WSV477 was to the virus. The test showing that the binding affected the replication of virus was not straightforward. We, then, tested whether the two proteins could be localized in the same cells. We used a confocal laser scanning microscope to visualize the hemocytes from WSSV-infected shrimp. The results revealed that in the granular and semigranular hemocytes with which the WSSV-infected, the SPIPm2 and WSV477 were always co-localized in the cytoplasm of the same infected cells. Previously, we observed that in the late phase of infection, the WSSV-infected cells contained VR28 in the nucleus where the maturation of WSSV progenies took place. These WSSV-infected cells did not contain SPIPm2 [20]. The WSSV-infected cells observed in this study contained SPIPm2 and could be considered to be in an early phase of infection. A hemocyte with less SPIPm2 and WSV477 observed at 24 hpi was possibly progressing towards the late phase of infection. The results suggested that the SPIPm2 was involved in WSSV response only during the early phase of infection by binding to the WSV477 in the infected cells. It was expected that the binding of SPIPm2 to WSV477 retarded the function of WSV477 resulting in the decrease in WSSV replication. We, then, showed how importance the WSV477 to the virus. By using the RNA interference, the WSV477 expression was knocked down, and the expression of the late gene VP28 was down-regulated too. This result was exactly the affect of SPIPm2 on WSV477 replication. However, the knocked down of WSV477 had no significant affect on ie1 expression since the expression of ie1 was as early as 2 hpi whereas the expression of WSV477 began at 4 hpi [24,32]. How the SPIPm2 finds and binds to WSV477 has not yet been answered. A possible scenario is that the abundant SPIPm2 in the hemolymph binds and enter the cell along with the virus. If this is the case, then we have to find way to distinguish the SPIPm2 attach to the virus from that inside the hemocytes. This hypothesis still remains to be elucidated. Besides response to WSSV infection, we believed that the SPIPm2 might have proteinase inhibitory function as well for it has three out of five active proteinase inhibitory domains [28]. Acknowledgments This work was supported by research grants from the Higher Education Research Promotion and National Research University Project of Thailand, Office of the Higher Education Commission
(FW643A) and the TRF Senior Research Scholar (RTA5580008), Thailand Research Fund. A Ph.D. student fellowship to Miss Sirikwan Ponprateep for the Strategic Scholarships Fellowships Frontier Research Networks from the Commission on Higher Education is greatly appreciated. We also thank the 90th Anniversary of Chulalongkorn University Fund and Chulalongkorn University for the support to the Center of Excellence for Molecular Biology and Genomics of Shrimp under the Ratchadaphisek Somphot Endowment Fund. References [1] Laskowski M, Kato I. Protein inhibitors of proteinases. Annu Rev Biochem 1980;49:593e626. [2] Kanost MR. Serine protease inhibitors in arthropod immunity. Dev Comp Immunol 1999;23:291e301. [3] Jiravanichpaisal P, Lee BL, Söderhäll K. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006;211:213e36. [4] Cao JX, Dai JQ, Dai ZM, Yin GL, Yang WJ. A male-reproduction related Kazal-type peptidase inhibitor gene in the prawn, Macrobrachium rosenbergii: molecular characterization and expression patterns. Mar Biotechnol 2007;9:45e55. [5] Liang Z, Sottrup-Jensen L, Aspán A, Hall M, Söderhäll K. Pacifastin, a novel 155kDa heterodimeric proteinase inhibitor containing a unique transferrin chain. Proc Natl Acad Sci U S A 1997;94(13):6682e7. [6] Simonet G, Claeys I, Broeck JV. Structural and functional properties of a novel serine protease inhibiting peptide family in arthropods. Comp Biochem Phys B 2002;132:247e55. [7] Whisstock JC, Silverman GA, Bird PI, Bottomley SP, Kaiserman D, Luke CJ, et al. Serpins flex their muscle: II. Structural insights into target peptidase recognition, polymerization, and transport functions. J Biol Chem 2010;285:24307e12. [8] Laskowski M, Qasim MA. What can the structures of enzyme-inhibitor complexes tell us about the structures of enzyme substrate complexes? Biochim Biophys Acta 2000;1477:324e37. [9] Rimphanitchayakit V, Tassanakajon A. Structure and function of invertebrate Kazal-type serine proteinase inhibitors. Dev Comp Immunol 2010;34:377e86. [10] van de Locht A, Lamba D, Bauer M, Huber R, Friedrich T, Kröger B, et al. Two heads are better than one: crystal structure of the insect derived double domain Kazal inhibitor rhodniin in complex with thrombin. EMBO J 1995;14: 5149e57. [11] van Hoef V, Breugelmans B, Spit J, Simonet G, Zels S, Vanden Broeck J. Phylogenetic distribution of protease inhibitors of the Kazal-family within the Arthropoda. Peptides 2013;41:59e65. [12] Visetnan S, Donpudsa S, Supungul P, Tassanakajon A, Rimphanitchayakit V. Kazal-type serine proteinase inhibitors from the black tiger shrimp Penaeus monodon and the inhibitory activities of SPIPm4 and 5. Fish Shellfish Immunol 2009;27:266e74. [13] Kong HJ, Cho HK, Park EM, Hong GE, Kim YO, Nam BH, et al. Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol 2009;26:109e14. [14] Donpudsa S, Söderhäll I, Rimphanitchayakit V, Cerenius L, Tassanakajon A, Söderhäll K. Proteinase inhibitory activities of two two-domain Kazal proteinase inhibitors from the freshwater crayfish Pacifastacus leniusculus and the importance of the P2 position in proteinase inhibitory activity. Fish Shellfish Immunol 2010;29:716e23. [15] Zeng Y, Wang WC. Molecular cloning and tissue-specific expression of a fivekazal domain serine proteinase inhibitor from crayfish Procambarus clarkii hemocytes. Aquaculture 2011;321:8e12.
964
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
[16] Wang S, Cui Z, Liu Y, Li Q, Song C. The first Kazal-type serine proteinase inhibitor in the swimming crab Portunus trituberculatus involved in immune response to bacteria and fungi. Aquaculture 2012;356e357:55e60. [17] Vargas-Albores F, Villalpando E. A new type of Kazal proteinase inhibitor related to shrimp Penaeus (Litopenaeus) vannamei immunity. Fish Shellfish Immunol 2012;33:134e7. [18] van Hulten MC, Westenberg M, Goodall SD, Vlak JM. Identification of two major virion protein genes of white spot syndrome virus of shrimp. Virology 2000;266:227e36. [19] Somprasong N, Rimphanitchayakit V, Tassanakajon A. A five-domain Kazaltype serine proteinase inhibitor from black tiger shrimp Penaeus monodon and its inhibitory activities. Dev Comp Immunol 2006;30:998e1008. [20] Ponprateep S, Tassanakajon A, Rimphanitchayakit VA. Kazal type serine proteinase SPIPm2 from the black tiger shrimp Penaeus monodon is capable of neutralization and protection of hemocytes from the white spot syndrome virus. Fish Shellfish Immunol 2011;31:1179e85. [21] Donpudsa S, Ponprateep S, Prapavorarat A, Visetnan S, Tassanakajon A, Rimphanitchayakit VA. Kazal-type serine proteinase inhibitor SPIPm2 from the black tiger shrimp Penaeus monodon is involved in antiviral responses. Dev Comp Immunol 2010;34:1101e8. [22] Prapavorarat A, Pongsomboon S, Tassanakajon A. Identification of genes expressed in response to yellow head virus infection in the black tiger shrimp, Penaeus monodon, by suppression subtractive hybridization. Dev Comp Immunol 2010;34:611e7. [23] Pongsomboon S, Tang S, Boonda S, Aoki T, Hirono I, Tassanakajon A. A cDNA microarray approach for analyzing transcriptional changes in Penaeus monodon after infection by pathogens. Fish Shellfish Immunol 2011;30:439e46.
[24] Han F, Xu J, Zhang X. Characterization of an early gene (wsv477) from shrimp white spot syndrome virus (WSSV). Virus Genes 2007;34:193e8. [25] Meyer RF, Miller L, Bennett RW, MacMillan JD. Development of a monoclonal antibody capable of interacting with five serotypes of Staphylococcus aureus enterotoxin. Appl Environ Microbiol 1984;47:283e7. [26] Liu H, Jiravanichpaisal P, Söderhäll I, Cerenius L, Söderhäll K. Antilipopolysaccharide factor interferes with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus. J Virol 2006;80:10365e71. [27] Lantz MS, Ciborowski P. Zymographic techniques for detection and characterization of microbial proteases. Methods Enzymol 1994;235: 563e94. [28] Donpudsa S, Tassanakajon A, Rimphanitchayakit V. Domain inhibitory and bacteriostatic activities of the five-domain Kazal-type serine proteinase inhibitor from black tiger shrimp Penaeus monodon. Dev Comp Immunol 2009;33:481e8. [29] Supungul P, Klinbunga S, Pichyangkura R, Jitrapakdee S, Hirono I, Aoki T, et al. Identification of immune-related genes in hemocytes of black tiger shrimp (Penaeus monodon). Mar Biotechnol (NY) 2002;4:487e94. [30] Wang YT, Liu W, Seah JN, Lam CS, Xiang JH, Korzh V, et al. White spot syndrome virus (WSSV) infects specific hemocytes of the shrimp Penaeus merguiensis. Dis Aquat Organ 2002;52:249e59. [31] Jiang YS, Zhan WB, Wang SB, Xing J. Development of primary shrimp hemocyte cultures of Penaeus chinensis to study white spot syndrome virus (WSSV) infection. Aquaculture 2006;253:114e9. [32] Li F, Li M, Ke W, Ji Y, Bian X, Yan X. Identification of the immediate-early genes of white spot syndrome virus. Virology 2009;385:267e74.
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Interaction between Kazal serine proteinase inhibitor SPIPm2 and viral protein WSV477 reduces the replication of white spot syndrome virus Sirikwan Ponprateep a, Kornsunee Phiwsaiya b, c, Anchalee Tassanakajon a, Vichien Rimphanitchayakit a, * a
Center of Excellence for Molecular Biology and Genomics of Shrimp, Department of Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand Center of Excellence for Shrimp Molecular Biology and Biotechnology, Mahidol University, Rama VI Rd., Bangkok 10400, Thailand c National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Pathumthani 12120, Thailand b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 8 May 2013 Received in revised form 8 July 2013 Accepted 8 July 2013 Available online 16 July 2013
White spot syndrome (WSS) is a viral disease caused by white spot syndrome virus (WSSV) which leads to severe mortality in cultured penaeid shrimp. In response to WSSV infection in Penaeus monodon, a Kazal serine proteinase inhibitor SPIPm2, normally stored in the granules of granular and semi-granular hemocytes is up-regulated and found to deter the viral replication. By using yeast two-hybrid screening, we have identified a viral target protein, namely WSV477. Instead of being a proteinase, the WSV477 was reported to be a Cys2/Cys2-type zinc finger regulatory protein having ATP/GTP-binding activity. In vitro pull down assay confirmed the proteineprotein interaction between rSPIPm2 and rWSV477. Confocal laser scanning microscopy demonstrated that the SPIPm2 and WSV477 were co-localized in the cytoplasm of shrimp hemocytes. Using RNA interference, the silencing of WSV477 resulted in downregulated of viral late gene VP28, the same result obtained with SPIPm2. In this instance, the SPIPm2 does not function as proteinase inhibitor but inhibit the regulatory function of WSV477. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Kazal-type serine proteinase inhibitor Penaeus monodon White spot syndrome virus Yeast two-hybrid screening WSV477
1. Introduction Several biological processes in multicellular organisms are catalyzed or activated by proteinases or proteinase cascades, such as food digestion, blood coagulation, tissue repair and modeling, morphogenesis, melanization, gelatinolysis in male reproductive system, etc. [1e4]. The proteinases are deleterious to the tissues and have to be controlled effectively by proteinase inhibitors. There are several types of proteinase inhibitors in the organisms. Those widely known inhibitors are serpins, Kazal-type inhibitors, Kunitztype inhibitors, Bowman-Birk inhibitors, pacifastin, etc [5e7]. The Kazal-type serine proteinase inhibitors are well characterized. They are usually composed of more than one Kazal inhibitory domain of about 40e60 amino acid residues [8,9]. A Kazal domain is formed and stabilized by three conserved intradomain disulfide bridges among six conserved cysteine residues. Its proteinase
* Corresponding author. Tel.: þ66 2 2185436; fax: þ66 2 2185418. E-mail addresses: [email protected], [email protected] (V. Rimphanitchayakit). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.07.009
inhibitory specificity is depending on the so-called P1 amino acid which is the second amino acid downstream of the second cysteine residue. The side chain of P1 amino acid is able to fit into a pocket within the active site of a cognate proteinase [10]. For instance, an inhibitor with P1 Lys or Arg preferentially inhibits trypsin and trypsin-like proteinases. The inhibition is competitive in nature with potent inhibitory constants in the range of nanomolar. In crustaceans, the Kazal-type inhibitors are abundant [11]. They have been reported in many crustacean species such as penaeid shrimp, prawn and crayfish, for example SPIPm inhibitors from Penaeus monodon [12], a FcKPI from Fenneropenaeus chinensis [13], a MrKPI from Macrobrachium rosenbergii [4] and PlKPIs from Pacifastacus leniusculus [14]. More recently, a five-domain Kazal serine proteinase inhibitor was identified from the crayfish Procambarus clarkii [15]. A cDNA clone coding for a one-domain Kazal serine proteinase inhibitor PtKPI has been identified in the swimming crab Portunus trituberculatus [16]. A four-Kazal domain-containing protein has been isolated from the cDNA library of Penaeus vannamei [17]. The expression of these Kazal inhibitors is changed, mostly up-regulated, in response to pathogenic infection. They are, then, claimed to be involved in immunity against pathogens.
958
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
White spot syndrome virus (WSSV) is an enveloped, ellipsoid, double-stranded DNA virus that causes white spot syndrome (WSS) in aquaculture of shrimp [18]. The disease is highly virulent and contagious resulting in completely loss of the penaeid culture without any possible remedies. The outbreak of WSS in several Asian countries has prompted the studies of shrimp immunity and WSSV in order to understand the immune response of shrimp and the pathogenicity of WSSV which may help pave way for the prevention and possible remedy of WSS. The SPIPm2 from P. monodon is a 5-domain Kazal serine proteinase inhibitor with inhibitory activity against elastase and subtilisin [19]. The SPIPm2 is expressed in the shrimp hemocytes and stored in the cells readily to be secreted upon activation [20]. Some amount of SPIPm2 is already in the shrimp circulation [21]. The expression of SPIPm2 in P. monodon is up-regulated after yellow head virus and WSSV infection [22,23]. By treating the WSSV or hemocytes with recombinant SPIPm2 prior to infection, the viral replication is retarded [20]. It is, then, expected that the SPIPm2 may in some ways interact with the virus or its component leading to the disruption of the viral replication process. In this study, the immunogold labeling and transmission electron microscope were used to locate the SPIPm2 inside the hemocytes from normal and WSSV-infected shrimp. We also used a yeast two-hybrid screening technique to identify the target protein of SPIPm2 and study the protein in order to understand the mechanism of action of SPIPm2 on the viral replication process. 2. Materials and methods 2.1. Localization of SPIPm2 in shrimp hemocytes using immunogold labeling The shrimp hemolymph was directly collected into a fixative solution (4% paraformaldehyde in PBS pH 7.4) and incubated for 1 h at room temperature. Shrimp hemocytes were collected by centrifugation at 800 g and washed twice with PBS. The hemocytes were, then, embedded in LR White (Polysciences) according to a standard protocol recommended by the manufacturer. Briefly, cells were quickly dehydrated for 10 min each in a series of precooled ethanol solutions (30, 50, 70, 96 and 100%). The ethanol was then replaced with a 2:1 mixture of ethanol/resin for 20 min, followed by a 1:2 mixture of ethanol/resin for 20 min, and pure resin for 1 h. Samples were infiltrated overnight with pure resin at 4 C and incubated the next day for 2 h with fresh resin. The resin was polymerized at 60 C for 72 h. Thin sections of 80 nm thick were cut with a glass knife and mounted on 200-mesh gilded nickel grids (Polysciences). The grids were incubated in 0.1 M glycine in PBS buffer for 20 min to block free aldehydes. Non-specific labeling was blocked by preincubation with Aurion blocking solution (Electron Microscopy Sciences) in PBS for 30 min at room temperature. The grids were washed in PBS 1 min for 3 times. The sections were, then, incubated with primary antibody, rabbit anti-SPIPm2 [21], diluted in PBS containing 1% (v/v) cold water fish gelatin for 1 h at room temperature, washed with 1% (v/v) cold water fish gelatin in PBS 3 min for 6 times, incubated with secondary gold-conjugated antibody having gold particle size of 10 nm (Electron Microscopy Sciences) in PBS containing 1% (w/v) BSA, 0.1% (v/v) Tween-20 and 0.1% (v/v) Triton X-100 for 1 h at room temperature, washed again in PBS 3 min for 6 times and, then, postfixed with 2.5% (v/v) glutaraldehyde in PBS for 5 min at room temperature. The grids were rinsed with double-distilled water 3 min for 3 times at room temperature and air-dried. Finally, sections were contrasted with a saturated solution of uranyl acetate in water for 4 min and lead citrate for 1 min.
2.2. Yeast two-hybrid screening Yeast two-hybrid screening was carried out using the Matchmaker Gold Yeast Two-Hybrid System (Clontech). As a bait protein gene, the SPIPm2 gene was amplified by PCR from pSPIPm2_NS2 [19] using SPIPm2-F and SPIPm2-R primers (Table 1). The gene was, then, cloned into the NcoI and BamHI sites fused to the GAL4 DNAbinding domain sequence in the pGBKT7 DNA-BD vector. The constructed pGBKT7-SPIPm2 was transformed into the Y2HGold competent cells and tested for auto-activation and toxicity. The two-hybrid library was constructed from the hemocyte cDNA (Somboonwiwat, unpublished) and the open reading frames of WSSV (Sangsuriya et al., submitted). Sub-adult black tiger shrimp weighing about 15 g were injected with diluted WSSV solution having an LD50 of 3 days. The P. monodon hemocytes were collected at 24 h post WSSV infection for total RNA extraction. The Mate & PlateÔ Library (Clontech) was used to construct the cDNA library. The various open reading frames of WSSV were cloned into the pGADT7 AD vector containing the GAL4 activation domain and transformed into the Y187 competent yeast cells using Matchmaker Library Construction and Screening Kits (Clontech). The yeast cells containing the bait vector and pray vector were mated following the manufacturer instruction. The positive clones were selected on the synthetic medium SD/-Leu/-Trp supplemented with X-a-Gal and aureobasidin A (AbA) (DDO/X/A). From the positive mating colonies, the prey plasmids were rescued. The positive interaction between the bait and prey was verified by co-transforming the bait vector and pray vector into the Y2HGold yeast cells and tested for the interaction on SD/-Leu/-Trp/ X-a-Gal (DDO/X) and SD/-Ade/-His/-Leu/-Trp/X-a-Gal/AbA (QDO/ X/A) agar. The positive prey vectors were subjected to DNA sequencing, annotation and analysis using bioinformatics tools. 2.3. Expression of rSPIPm2 and prey protein The bait protein, rSPIPm2 with 6 His-tag at its C-terminus, was produced using a plasmid pSPIPm2-NS2 and purified following a method described by Donpudsa et al., 2010 [19,21]. The purified rSPIPm2 was dialyzed against PBS pH 7.4 before used. For the expression of prey protein, a full-length WSV477 gene was PCR-amplified using primers rWSV477-F and rWSV477-R (Table 1) and cloned into the NcoI and EcoRI sites in the pBAD/ Table 1 Primers used in this study. Primer
Sequence (50 e30 )
Usage
SPIPm2-F SPIPm2-R
ATCGCCATGGGGAAAATCCGCC TAGCGGATCCTTAATATCCCTT
rWSV477-F rWSV477-R
ATAGCCATGGATATCTTCGTCGAA ATAGCCATGGATATCTTCGTCGAA
WSV477-F WSV477-R GFP-F GFP-R WSV477-FRT WSV477-RRT VP28-FRT VP28-RRT SPIPm2-FRT SPIPm2-RRT ie1-FRT ie1-RRT b-actin-FRT b-actin-RRT
CATGTGGAATGTCTTTCCTC ACTTTTATTTCTTGAATATT ATGGTGAGCAAGGGCGAGGA AGAAGGAAGGGCGCTGAC CGCGGATCCATGTATATCTTCGTCGA CCGGAATTCTTATAAGAAATGTACAA TCACTCTTTCGGTCGTGTCG CCACACACAAAGGTGCCAAC ATGCAACCACGTCTGTACTG CTGCAAGGTTCCACATCT GACTCTACAAATCTCTTTGCCA CTACCTTTGCACCAATTGCTAG GCTTGCTGATCCACATCTGCT ATCACCATCGGCAACGAGA
Cloning of SPIPm2 as bait protein gene in yeast two-hybrid screening Cloning of WSV477 gene into an expression vector WSV477 dsRNA synthesis GFP dsRNA synthesis RT-PCR of WSV477 [24] RT-PCR of VR28 RT-PCR of SPIPm2 [21] RT-PCR of ie1 RT-PCR of b-actin
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
Myc-His A vector fused at its 30 end to the myc epitope and 6 Histag. The constructed expression plasmid (pBAD-WSV477) was transformed into an E. coli strain TOP10. The cells were grown and the recombinant WSV477 (rWSV477) expression was induced by adding arabinose to 0.02%. The rWSV477 was prepared from the cells, purified using Ni-NTA (GE Healthcare) and dialyzed against PBS pH 7.4 before used. 2.4. Co-immunoprecipitation The co-immunoprecipitation was carried out to test the proteineprotein interaction in vitro. The rabbit antibody specific to rSPIPm2 [21] was immobilized and cross-linked with protein A sepharose CL4B (GE Healthcare) using dimethyl pimelimidate (Sigma) as described by Meyer et al., 1984 [25]. The cross-linked bead (50 ml bed volume) was equilibrated with PBS pH 7.4 supplemented with 1 M NaCl as a binding buffer. Then, 20 mg rSPIPm2 and/or 20 mg rWSV477 were loaded and incubated for 1 h at room temperature. The column was washed with 500 ml binding buffer for 15 times to eliminate the unbound protein. The proteins were eluted with 50 ml 100 mM glycine pH 2.5, neutralized with 1 M TriseHCl pH 9.5 and subjected to SDSePAGE. The SDSePAGE was western blotted and the proteins were detected using anti-His antibody (GE Healthcare) as primary antibody and goat alkaline phosphatase conjugated anti-mouse antibody as secondary antibody (Jackson ImmunoResearch). 2.5. Gene silencing of WSV477 in WSSV-infected hemocyte cell culture and shrimp To study the importance of WSV477 in viral replication, the RNA interference technique was employed. The WSV477 dsRNA was synthesized by T7 RiboMAXÔ Express Large Scale RNA Production System (Promega) from the selected sequence of WSV477 gene in pBAD-WSV477 using WSV477eF/R primers (Table 1). The control GFP dsRNA was also synthesized as described above from pEGFP-1 (Clontech) [26] using GFP-F/R primers (Table 1). The RNA interference was done for both hemocyte cell culture and shrimp. To prepare the hemocyte primary cell culture, the shrimp hemocytes were collected and cultured in the 96-well microtiterplate [20]. Briefly, hemocytes were separated by centrifugation and resuspended in L15 medium supplemented with 20% fetal bovine serum (GIBCO). The cell suspension was aliquot into each well of the 96-well plate (2 104 cells/100 ml/well) and incubated at 27 C overnight. Fresh L15 medium supplemented with 20% fetal bovine serum was replenished and incubated further for 2 h. The dsRNA was pre-incubated with histone H2A (calf thymus, type II-A; Sigma) for 10 min at room temperature before used [26]. The hemocyte cell cultures were divided into 3 groups of 3 wells. Each group was incubated with PBS, 5 mg of GFP dsRNA or WSV477 dsRNA. The purified WSSV (1 105 copies) was, then, added and incubated at 27 C for 24 h. The cultures were collected for total RNA preparation. Three groups of 5 shrimp each weighted about 5 g were injected with 50 ml of 0.85% NaCl, GFP dsRNA (10 mg/g shrimp) and WSSV dsRNA (10 mg/g shrimp), respectively. After 3 h, the shrimp were injected with 50 ml of 0.85% NaCl, GFP dsRNA (10 mg/g) and WSSV dsRNA (10 mg/g), respectively, along with purified WSSV (1 103 copies). After rearing normally for 24 h, the shrimp hemocytes were collected for total RNA preparation. Hemocytes from cell culture and shrimp were subjected to total RNA extraction using a TRI reagent (Molecular Research Center). The total RNA was treated with RQ1 RNase-free DNase (Promega) and used as a template for the first strand cDNA synthesis using a RevertAid First Strand cDNA Synthesis Kit (Fermentas). The cDNA was
959
analyzed for the expression of WSV477, VP28, SPIPm2, ie1 (intermediate early gene 1) and b-actin genes by RT-PCR using gene specific primers (Table 1). The b-actin gene was an internal control gene. An RT-PCR reaction of 25 ml total volume contained 1 PCR buffer, 200 mM dNTP, 0.2 mM of each specific primer, 1 unit of Taq DNA polymerase (RBC) and 4 ml of 1:10 dilution of the cDNA preparation. The reaction were carried out using the following conditions: an initial denaturation at 94 C for 5 min, followed by 30 cycles of denaturation at 94 C for 30 s, annealing at 60 C for 30 s, elongation at 72 C for 30 s, and the final extension at 72 C for 10 min. The PCR reactions were analyzed by agarose gel electrophoresis. The intensity of PCR product was detected using GeneCam Flexi, a gel documentation system (SynGene) and further quantified using the GeneTools image analysis software. The expression levels were calculated relative to that of bactin transcripts. The data were statistically analyzed for significant differences between groups using one way analysis of variance (ANOVA) followed by a post hoc test (Duncan’s new multiple range test). Significant differences are indicated at P < 0.05. 2.6. Co-localization between SPIPm2 and WSV477 Hemolymph from healthy shrimp and WSSV-infected shrimp (6, 24 and 48 h post infection) were collected, fixed in 4% (w/v) paraformaldehyde for 10 min and centrifuged at 800x g at 4 C for 10 min to separate the hemocytes. The hemocytes were resuspended in PBS and centrifuged onto the poly-L-lysine coated slides at 1000x g for 5 min. The hemocytes were permeabilyzed with 0.1% Triton X-100 for 5 min and blocked with blocking buffer (PBS containing 10% fetal bovine serum) at room temperature for 1 h. The slides were probed with purified rabbit and mouse polyclonal antibodies specific to rSPIPm2 and WSV477, respectively, for 1 h at room temperature. The slides were washed 3 times with washing buffer (PBS containing 0.05% Tween-20) and incubated with the secondary antibodies conjugated with fluorescence dyes, Alexa 488 or Alexa 568, at room temperature for 1 h. The slides were washed 3 times with washing buffer to remove non-specific binding, incubated with Topo-3 (Invitrogen) and then with mounting medium, ProLongÒ antifade reagent (Invitrogen). The slides were, finally, examined under a confocal laser scanning electron microscopy. 2.7. Proteinase activity assay Since SPIPm2 is a serine proteinase inhibitor, its target protein is thought to be a proteinase. The rWSV477 protein was tested for its proteinase activity using gelatin zymography [27]. The rWSV477 was loaded into an SDS-PAGE containing 0.1% gelatin. After electrophoresis, the acrylamide gel was incubated in phosphate buffer pH 7.8 containing 1% Triton X-100 at room temperature for an overnight. The gel was stained with Coomassie Blue Stain. Upon destaining, the gel became dark blue except the lighter area that had proteinase activity. 3. Results 3.1. SPIPm2 was synthesized and stored in the hemocyte granules Previously, we have found that the SPIPm2 is expressed and stored in the granules in the cytoplasm of semi-granular and granular but not the hyaline cells. The SPIPm2 is secreted upon WSSV infection [20]. To make certain the location of SPIPm2 in the hemocytes, we further used an immunogold labeling technique and a transmission electron microscope in our study. Hemocytes of healthy shrimp and WSSV-infected shrimp were subjected to immunogold labeling and visualization under the transmission electron microscope.
960
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
Agreeing well with our previous finding, the SPIPm2 molecules as dark spots were found in the granules of granular and semigranular hemocytes in normal shrimp (Fig. 1A and B) but not in the hyaline cell (Fig. 1C). The number of SPIPm2 molecules
increased drastically in the granular hemocyte derived from the WSSV-infected shrimp (Fig. 1D) indicating that the biosynthesis of SPIPm2 was up-regulated. Whether the granular hemocyte in Fig. 1D was infected or not was not known.
Fig. 1. Transmission electron micrographs of semi-granular, granular and hyaline hemocytes from Penaeus monodon in which the SPIPm2 was localized using immunogold labeling. The right micrographs are the magnification of the left micrographs. (A), (B) (C) and (D) are granular cell (GC), semi-granular cell (SGC), hyaline cell (HC) and granular cell from WSSV-infected shrimp, respectively. Black bar ¼ 0.5 mm and white bar ¼ 0.2 mm.
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
961
3.2. Yeast two-hybrid screening for binding target of SPIPm2 Previous study using ELISA showed that the SPIPm2 bound to the shrimp hemocyte membrane and WSSV [20]. To search for the binding target(s) of SPIPm2, the yeast two-hybrid screening was carried out using SPIPm2 as a bait protein for the screening of two libraries constructed from the hemocyte cDNA and the open reading frames in WSSV genome. Upon the screening of hemocyte cDNA library, several simple repetitive DNA sequences were obtained which could not be used for further sequence analysis (data not shown). On the other hand, the screening of WSSV library led us identify 5 viral sequences as listed in Table 2. Five proteins of WSSV that could interact with SPIPm2 were WSV020, WSV399, WSV267, WSV061 and WSV477. The WSV020, WSV399, WSV267 and WSV061 were unknown. The WSV477 was known for it was previously studied and found to be an early gene of WSSV that encoded a protein of 208 amino acid residues. It was interesting because it was possibly a type of zinc finger regulatory protein with a GTPbinding activity [24]. 3.3. Verification of proteineprotein interaction using coimmunoprecipitation assay To ascertain that the interaction of SPIPm2 and WSV477 was genuine, recombinant proteins rWSV477 and rSPIPm2 were produced and tested for their interaction by co-immunoprecipitation assay. The SPIPm2 was incubated with WSV477 and loaded through a column of protein A agarose beads cross-linked to rabbit anti-SPIPm2. If there was no strong interaction between the two proteins, WSV477 would be flow through during washing step and would not co-eluted with SPIPm2. As shown in Fig. 2, SPIPm2 was trapped by the anti-SPIPm2 in the column but not WSV477 (Fig. 2 lanes A and B). When they are incubated together prior to loading into the column, they were trapped by the anti-SPIPm2 and co-eluted from the column (Fig. 2 lane C). 3.4. WSV477 possessed no proteinase activity It has been known for sometimes that the SPIPm2 is a proteinase inhibitor that is inhibitory to elastase and subtilisin [19,28]. A protein that interacts with proteinase inhibitor is usually assumed to be a proteinase. Therefore, the rWSV477 was tested for its proteinase activity using gelatin zymography [27]. It was to our surprise that WSV477 possessed no proteinase activity (data not shown).
Fig. 2. Co-immunoprecipitation assay of the interaction between SPIPm2 and WSV477. The SPIPm2 was incubated with WSV477 (C) and loaded into a column of protein A sepharose CL4B crosslinked with rabbit anti-SPIPm2. After washing with high salt buffer, the proteins were co-eluted with acidic glycine buffer. Either SPIPm2 (A) or WSV477 (B) alone were used as controls. The eluted samples were analyzed by western blot analysis using anti-His antibody.
same cell during the course of WSSV infection. Hemolymph from shrimp infected with WSSV at different time points was collected and the hemocytes were detected for the WSV477 and SPIPm2 therein. The confocal laser scanning micrographs shown in Fig. 3 revealed that the SPIPm2 (green) was detected in the cytoplasm of granular hemocyte in normal shrimp. At 6 h post infection (hpi), a semi-granular hemocyte was also shown to bear SPIPm2 in its cytoplasm. As the WSSV infection progressed, the hemocytes seemed to be degranulated and, hence, difficult to distinguish between the semi-granular and granular hemocytes. The hemocytes bearing SPIPm2 were observed till 48 hpi. These very same cells were WSSV-infected cells for the WSV477 (red) was detected. The WSV477 was detected as early as 6 h and up to 48 h after viral infection. Interestingly, the WSV477 was only detected in the cytoplasm of SPIPm2-bearing hemocytes. A hemocyte with lesser SPIPm2 and WSV477 was also observed at time point 24 hpi. We did not observe the un-infected SPIPm2-bearing cells in this investigation.
3.5. Co-localization of SPIPm2 and WSV477 WSV477 is an early gene in WSSV infection [24] while the SPIPm2 is synthesized by the shrimp hemocytes [20]. It is, then, interesting to find out how the two proteins interact in the hemocytes. We employed a confocal laser scanning microscopy in this experiment to see whether the 2 proteins were co-localized in the Table 2 Clones detected by yeast two-hybrid from the WSSV open reading frame library. Clone number
BLAST result
Remark
Clone1/AD and Clone35/AD Clone2/AD Clone4/AD Clone14/AD Clone46/AD
WSSV076/WSV020
Unknown protein
WSSV458/WSV399 WSSV322/WSV267 WSSV118/WSV061 WSSV004/WSV477
Unknown protein Unknown protein Unknown protein Cys2/Cys2-type zinc finger, ATP/GTP-binding motif
3.6. Gene silencing of WSV477 in WSSV-infected hemocyte cell culture Previously, we had determined that the SPIPm2 was able to inhibit the propagation of WSSV. In this study, after having determined that the SPIPm2 interacted and co-localized with WSV477, it was, then, important to find out whether the interaction of SPIPm2 to WSV477 could inhibit the viral replication. However, the effect of such interaction on viral replication could not be directly traced. The importance of WSV477 on WSSV replication was, thus, determined using RNA interference. The WSV477 was silenced by transfecting the primary shrimp hemocyte culture with WSV477 dsRNA along with WSSV infection. The expression of WSV477, VP28 (the late viral protein gene) and SPIPm2 was determined using RTPCR. The control shrimp hemocytes were transfected with normal saline and GFP dsRNA. The expression of b-actin gene was the internal control expression.
962
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
Fig. 3. Confocal laser scanning micrographs of the WSSV-infected hemocytes. Hemocytes from shrimp infected with WSSV at 0, 6, 24 and 48 h post infection (hpi) were collected and fixed. The SPIPm2 and WSV477 were detected using purified rabbit polyclonal anti-SPIPm2 and mouse anti-WSV477. The positive cells were visualized using secondary antibody conjugated with fluorescent dyes, Alexa Flour 488 (green) for SPIPm2 and Alexa Flour 568 (red) for WSV477. Nuclei (adjusted to blue color) were stained with TO-PRO-3 iodide. HC, SCG and GC are hyaline, semi-granular and granular hemocytes, respectively. BFs are bright field images. Bars represent 5 mm.
In this RNA interference experiment, the expression of WSV477 in the cell culture was suppressed at 24 h after dsRNA transfection (Fig. 4A). The knockdown of WSV477 led to considerably lower expression of viral late gene, VP28, and reduced slightly the expression of SPIPm2. Similar results were obtained when the live shrimp were used (Fig. 4B). In this latter experiment, the effect of WSV477 knockdown on the ie1 and VP28 was investigated. The knockdown of WSV477 had no significant effect on the expression of ie1 but caused substantially reduced expression of VP28 by 66% as compared to that of GFP control (Fig. 2B). The results indicated the importance of WSV477 gene product in WSSV replication and it was the binding of SPIPm2 to WSV477 that impeded the replication of WSSV. 4. Discussion Of the nine different kinds of Kazal serine proteinase inhibitors in P. monodon, the SPIPm2 is the most abundant one [12,29]. The SPIPm2 is synthesized, stored in the shrimp granular cells (GC) and semi-granular cells (SGC), and secreted into the circulation as a hemolymph protein [20,21]. In this study, by using the immunogold labeling technique, we were able to show that the SPIPm2 protein was stored in the granules of SGC and GC. The hyaline cells (HC) lacked the storage granule and, hence, did not accommodate
SPIPm2 protein. Upon WSSV infection, the synthesis of SPIPm2 was increased as well as the storage of SPIPm2 in the granules. It had been shown that the very same cell types that produce SPIPm2, namely SGC and GC, in Penaeus merguiensis and Penaeus chinensis are also targets of WSSV attack [30,31]. By unknown mechanism, the WSSV causes the hemocytes to secrete SPIPm2 into the hemolymph. In turn, the SPIPm2 is able to interact with the WSSV as well as the hemocytes. In doing so, the SPIPm2 impedes the WSSV replication [20]. In this study, we used the yeast two-hybrid screening to search for both the cellular and viral targets. Unfortunately, only five viral candidate proteins were identified. All but one was unknown. The only known protein was the 208-amino acid WSV477. The WSV477 was an early protein in WSSV life cycle which might play a key role in DNA replication and virus proliferation. It was possibly a zinc finger regulatory protein with GTP-binding activity [24]. Since the SPIPm2 is a proteinase inhibitor, it is accustomed to think that the interacting counterpart is a proteinase. It was found out that the WSV477 was not a proteinase as anticipated. To test whether the interaction was genuine, the coimmunoprecipitation assay was employed and the specific interaction between SPIPm2 and WSV477 was confirmed. The results also indicated that the SPIPm2 did not function as a proteinase inhibitor in this instance.
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
963
Fig. 4. The affect of WSV477 silencing on the expression of VP28, SPIPm2 and ie1 in WSSV-infected shrimp hemocyte culture and shrimp. (A) The shrimp hemocyte cultures were transfected with normal saline, GFP dsRNA and WSV477 dsRNA followed by WSSV infection. After 24 h, the hemocyte cultures were harvested for RT-PCR analysis. The expression of WSV477, VP28, SPIPm2 and b-actin were determined. (B) Three groups of 5 shrimp were doubly injected with normal saline, GFP dsRNA and WSV477 dsRNA. The WSSV was included in the second injection. The shrimp hemocytes were collected for RTePCR analysis of WSV477, ie1 and VP28 expression. The data are means of three replicate experiments SDs. Asterisk indicates significance at P < 0.05.
Since the SPIPm2 hindered the replication of WSSV as mentioned above, we asked whether its affect on the replication was through the binding of SPIPm2 to WSV477, and how importance of WSV477 was to the virus. The test showing that the binding affected the replication of virus was not straightforward. We, then, tested whether the two proteins could be localized in the same cells. We used a confocal laser scanning microscope to visualize the hemocytes from WSSV-infected shrimp. The results revealed that in the granular and semigranular hemocytes with which the WSSV-infected, the SPIPm2 and WSV477 were always co-localized in the cytoplasm of the same infected cells. Previously, we observed that in the late phase of infection, the WSSV-infected cells contained VR28 in the nucleus where the maturation of WSSV progenies took place. These WSSV-infected cells did not contain SPIPm2 [20]. The WSSV-infected cells observed in this study contained SPIPm2 and could be considered to be in an early phase of infection. A hemocyte with less SPIPm2 and WSV477 observed at 24 hpi was possibly progressing towards the late phase of infection. The results suggested that the SPIPm2 was involved in WSSV response only during the early phase of infection by binding to the WSV477 in the infected cells. It was expected that the binding of SPIPm2 to WSV477 retarded the function of WSV477 resulting in the decrease in WSSV replication. We, then, showed how importance the WSV477 to the virus. By using the RNA interference, the WSV477 expression was knocked down, and the expression of the late gene VP28 was down-regulated too. This result was exactly the affect of SPIPm2 on WSV477 replication. However, the knocked down of WSV477 had no significant affect on ie1 expression since the expression of ie1 was as early as 2 hpi whereas the expression of WSV477 began at 4 hpi [24,32]. How the SPIPm2 finds and binds to WSV477 has not yet been answered. A possible scenario is that the abundant SPIPm2 in the hemolymph binds and enter the cell along with the virus. If this is the case, then we have to find way to distinguish the SPIPm2 attach to the virus from that inside the hemocytes. This hypothesis still remains to be elucidated. Besides response to WSSV infection, we believed that the SPIPm2 might have proteinase inhibitory function as well for it has three out of five active proteinase inhibitory domains [28]. Acknowledgments This work was supported by research grants from the Higher Education Research Promotion and National Research University Project of Thailand, Office of the Higher Education Commission
(FW643A) and the TRF Senior Research Scholar (RTA5580008), Thailand Research Fund. A Ph.D. student fellowship to Miss Sirikwan Ponprateep for the Strategic Scholarships Fellowships Frontier Research Networks from the Commission on Higher Education is greatly appreciated. We also thank the 90th Anniversary of Chulalongkorn University Fund and Chulalongkorn University for the support to the Center of Excellence for Molecular Biology and Genomics of Shrimp under the Ratchadaphisek Somphot Endowment Fund. References [1] Laskowski M, Kato I. Protein inhibitors of proteinases. Annu Rev Biochem 1980;49:593e626. [2] Kanost MR. Serine protease inhibitors in arthropod immunity. Dev Comp Immunol 1999;23:291e301. [3] Jiravanichpaisal P, Lee BL, Söderhäll K. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006;211:213e36. [4] Cao JX, Dai JQ, Dai ZM, Yin GL, Yang WJ. A male-reproduction related Kazal-type peptidase inhibitor gene in the prawn, Macrobrachium rosenbergii: molecular characterization and expression patterns. Mar Biotechnol 2007;9:45e55. [5] Liang Z, Sottrup-Jensen L, Aspán A, Hall M, Söderhäll K. Pacifastin, a novel 155kDa heterodimeric proteinase inhibitor containing a unique transferrin chain. Proc Natl Acad Sci U S A 1997;94(13):6682e7. [6] Simonet G, Claeys I, Broeck JV. Structural and functional properties of a novel serine protease inhibiting peptide family in arthropods. Comp Biochem Phys B 2002;132:247e55. [7] Whisstock JC, Silverman GA, Bird PI, Bottomley SP, Kaiserman D, Luke CJ, et al. Serpins flex their muscle: II. Structural insights into target peptidase recognition, polymerization, and transport functions. J Biol Chem 2010;285:24307e12. [8] Laskowski M, Qasim MA. What can the structures of enzyme-inhibitor complexes tell us about the structures of enzyme substrate complexes? Biochim Biophys Acta 2000;1477:324e37. [9] Rimphanitchayakit V, Tassanakajon A. Structure and function of invertebrate Kazal-type serine proteinase inhibitors. Dev Comp Immunol 2010;34:377e86. [10] van de Locht A, Lamba D, Bauer M, Huber R, Friedrich T, Kröger B, et al. Two heads are better than one: crystal structure of the insect derived double domain Kazal inhibitor rhodniin in complex with thrombin. EMBO J 1995;14: 5149e57. [11] van Hoef V, Breugelmans B, Spit J, Simonet G, Zels S, Vanden Broeck J. Phylogenetic distribution of protease inhibitors of the Kazal-family within the Arthropoda. Peptides 2013;41:59e65. [12] Visetnan S, Donpudsa S, Supungul P, Tassanakajon A, Rimphanitchayakit V. Kazal-type serine proteinase inhibitors from the black tiger shrimp Penaeus monodon and the inhibitory activities of SPIPm4 and 5. Fish Shellfish Immunol 2009;27:266e74. [13] Kong HJ, Cho HK, Park EM, Hong GE, Kim YO, Nam BH, et al. Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol 2009;26:109e14. [14] Donpudsa S, Söderhäll I, Rimphanitchayakit V, Cerenius L, Tassanakajon A, Söderhäll K. Proteinase inhibitory activities of two two-domain Kazal proteinase inhibitors from the freshwater crayfish Pacifastacus leniusculus and the importance of the P2 position in proteinase inhibitory activity. Fish Shellfish Immunol 2010;29:716e23. [15] Zeng Y, Wang WC. Molecular cloning and tissue-specific expression of a fivekazal domain serine proteinase inhibitor from crayfish Procambarus clarkii hemocytes. Aquaculture 2011;321:8e12.
964
S. Ponprateep et al. / Fish & Shellfish Immunology 35 (2013) 957e964
[16] Wang S, Cui Z, Liu Y, Li Q, Song C. The first Kazal-type serine proteinase inhibitor in the swimming crab Portunus trituberculatus involved in immune response to bacteria and fungi. Aquaculture 2012;356e357:55e60. [17] Vargas-Albores F, Villalpando E. A new type of Kazal proteinase inhibitor related to shrimp Penaeus (Litopenaeus) vannamei immunity. Fish Shellfish Immunol 2012;33:134e7. [18] van Hulten MC, Westenberg M, Goodall SD, Vlak JM. Identification of two major virion protein genes of white spot syndrome virus of shrimp. Virology 2000;266:227e36. [19] Somprasong N, Rimphanitchayakit V, Tassanakajon A. A five-domain Kazaltype serine proteinase inhibitor from black tiger shrimp Penaeus monodon and its inhibitory activities. Dev Comp Immunol 2006;30:998e1008. [20] Ponprateep S, Tassanakajon A, Rimphanitchayakit VA. Kazal type serine proteinase SPIPm2 from the black tiger shrimp Penaeus monodon is capable of neutralization and protection of hemocytes from the white spot syndrome virus. Fish Shellfish Immunol 2011;31:1179e85. [21] Donpudsa S, Ponprateep S, Prapavorarat A, Visetnan S, Tassanakajon A, Rimphanitchayakit VA. Kazal-type serine proteinase inhibitor SPIPm2 from the black tiger shrimp Penaeus monodon is involved in antiviral responses. Dev Comp Immunol 2010;34:1101e8. [22] Prapavorarat A, Pongsomboon S, Tassanakajon A. Identification of genes expressed in response to yellow head virus infection in the black tiger shrimp, Penaeus monodon, by suppression subtractive hybridization. Dev Comp Immunol 2010;34:611e7. [23] Pongsomboon S, Tang S, Boonda S, Aoki T, Hirono I, Tassanakajon A. A cDNA microarray approach for analyzing transcriptional changes in Penaeus monodon after infection by pathogens. Fish Shellfish Immunol 2011;30:439e46.
[24] Han F, Xu J, Zhang X. Characterization of an early gene (wsv477) from shrimp white spot syndrome virus (WSSV). Virus Genes 2007;34:193e8. [25] Meyer RF, Miller L, Bennett RW, MacMillan JD. Development of a monoclonal antibody capable of interacting with five serotypes of Staphylococcus aureus enterotoxin. Appl Environ Microbiol 1984;47:283e7. [26] Liu H, Jiravanichpaisal P, Söderhäll I, Cerenius L, Söderhäll K. Antilipopolysaccharide factor interferes with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus. J Virol 2006;80:10365e71. [27] Lantz MS, Ciborowski P. Zymographic techniques for detection and characterization of microbial proteases. Methods Enzymol 1994;235: 563e94. [28] Donpudsa S, Tassanakajon A, Rimphanitchayakit V. Domain inhibitory and bacteriostatic activities of the five-domain Kazal-type serine proteinase inhibitor from black tiger shrimp Penaeus monodon. Dev Comp Immunol 2009;33:481e8. [29] Supungul P, Klinbunga S, Pichyangkura R, Jitrapakdee S, Hirono I, Aoki T, et al. Identification of immune-related genes in hemocytes of black tiger shrimp (Penaeus monodon). Mar Biotechnol (NY) 2002;4:487e94. [30] Wang YT, Liu W, Seah JN, Lam CS, Xiang JH, Korzh V, et al. White spot syndrome virus (WSSV) infects specific hemocytes of the shrimp Penaeus merguiensis. Dis Aquat Organ 2002;52:249e59. [31] Jiang YS, Zhan WB, Wang SB, Xing J. Development of primary shrimp hemocyte cultures of Penaeus chinensis to study white spot syndrome virus (WSSV) infection. Aquaculture 2006;253:114e9. [32] Li F, Li M, Ke W, Ji Y, Bian X, Yan X. Identification of the immediate-early genes of white spot syndrome virus. Virology 2009;385:267e74.