- Email: [email protected]
Role of chymotrypsin-like serine proteinase in white spot syndrome virus infection in Fenneropenaeus chinensis
Fish & Shellfish Immunology 34 (2013) 403e409
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Role of chymotrypsin-like serine proteinase in white spot syndrome virus infection in Fenneropenaeus chinensis Shuxia Xue a, b, Weijun Yang a, *, Jinsheng Sun c, * a
Institute of Cell Biology and Genetics, College of Life Sciences, Zhejiang University, Zijingang Campus, Hangzhou, Zhejiang 310058, China Tianjin Center for Control and Prevention of Aquatic Animal Infectious Disease, 442 Jiefang South Road, Tianjin 300221, China c Tianjin Key Laboratory of Cyto-Genetical and Molecular Regulation, Tianjin Normal University, 393 Binshui West Road, Tianjin 300387, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 July 2012 Received in revised form 11 October 2012 Accepted 11 October 2012 Available online 7 November 2012
White spot syndrome virus (WSSV) caused a great economic loss in shrimp aquaculture. Although great efforts have been undertaken to characterize the virus disease during the last two decades, there are still lack of effective methods to prevent or cure it. In this study, we investigated the transcriptional expression profiles of 18 key immune-related genes in the Chinese shrimp Fenneropenaeus chinensis which was severely infected by WSSV. We found that the expression levels of 6 genes including chymotrypsin-like serine proteinase (CH-SPase), heat shock protein 70 cognate (HSP70), penaeidin (PEN), peroxinectin (PO), proliferating cell nuclear antigen (PCNA) and argonaute (AGO) changed significantly, while the expression of the other 12 genes had no significant changes compared to the control group. Among the 6 screened genes, CH-SPase showed significantly up-regulation, while the other 5 ones were significantly down-regulated. Knockdown of the expression of CH-SPase in WSSVinfected Chinese shrimp reduced the copy number of WSSV and delayed cumulative mortalities, suggesting that CH-SPase is important for WSSV infection. This study will be helpful to control the disease in shrimp caused by WSSV. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Immune-related genes Fenneropenaeus chinensis Chymotrypsin-like serine proteinase White spot syndrome virus
1. Introduction Chinese shrimp is one of the locally cultured shrimp in China and plays a major role in the Chinese mariculture industry. However, white spot syndrome virus (WSSV) has severely affected the shrimp industry, with WSSV infections causing 100% cumulative mortality in cultured shrimp in just 3e10 days [1]. Because of its rapid spread and high associated mortality rates, WSSV is the most serious threats to shrimp culture all over the world. Great efforts have been made to prevent and control the disease including completing WSSV genome sequencing [2e4], identifying WSSV structural proteins [5e8], exploring advanced WSSV detecting methods [9,10]. Recently, an increasing number of immune related genes of shrimp have been reported [14e17] and different strategies have been developed to control the infection by WSSV [19e21], however, there is still no effective treatment available to interfere with the unrestrained occurrence and the spread of the disease.
* Corresponding author. Tel.: þ86 22 88250781; fax: þ86 22 88254270. E-mail addresses: [email protected], [email protected] (J. Sun). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.10.017
It is widely accepted that crustaceans lack a true adaptive immune response system and its defense against pathogens relies largely on various innate immune mechanisms, including both cellular and humoral responses [11e13]. Understanding the interaction between host and pathogen will be helpful in controlling the infectious diseases in shrimp. In previous studies, expression profiles of shrimp immune-related genes were investigated under different challenge conditions and at certain time points, the expression of most genes were, however, variable in the process of virus infection [18,24e26], and therefore it is hard to analyze the role of the gene in the immune defense system. Viruses can recruit both cellular and viral factors and take advantages of the cell endocytic machinery for a successful infection. Meanwhile, hosts can trigger antiviral responses to combat the viral invaders [22,23]. In this game, WSSV is usually the winner upon most occasions since high mortality of shrimp infected by the virus. Although a great number of shrimp immune-related genes have been identified and showed being involved in the innate immune reactions according to the different regulating patterns after WSSV challenge, real roles of most of them in antiviral immune response remain unclear. We assume that some immune genes may just have transient effect on antiviral responses because of its variable expression profiles after WSSV challenge, and some
404
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
host genes may be recruited by the smart virus to accomplish a successful infection, and also some genes are the key defenders to the virus. For the key defenders, the virus probably explores effective strategies to suppress them. Based on these ideas, we speculated that screening of those whose expression profiles change significantly when the game is almost over (shrimp are dying because of the WSSV infection) may supply deep insight into the responses of shrimp immune-related genes in WSSV infections. In the present study, we analyzed the responses of 18 immunerelated genes in the hemocytes of Chinese shrimp which was severely infected by WSSV using quantitative real-time PCR. Our results showed that expression levels of 6 genes changed significantly, while the expression of the other 12 ones had no significant changes. Among the 6 screened genes 5 ones showed significantly down-regulation, while the CH-SPase was significantly upregulated. We also investigated the potential roles of CH-SPase in the process of WSSV infection.
1.0 ml of W235F and W235R primers (10 mM), 0.5 ml of Taq polymerase (5 U/ml) (TaKaRa), 39.5 ml of distilled water and 2.0 ml of DNA extracted from gills. The amplification regime was 4 min at 94 C, followed by 30 cycles of 94 C for 45 s, 58 C for 30 s and 72 C for 1 min, then final elongation for 5 min at 72 C. PCR products were electrophoresed on a 1% agarose gel to document the specific products. 2.4. Preparation of WSSV stock suspension Gills of WSSV-infected shrimp were homogenized in TNE buffer (50 mM TriseHCl, 400 mM NaCl, 5 mM EDTA, pH 8.5) and centrifuged at 3500 g for 5 min at 4 C. Then, the supernatant was centrifuged at 30,000 g for 30 min at 4 C. The pellet was suspended in 10 ml TN buffer (20 mM Tris/HCl, 400 mM NaCl, and pH 7.4). After centrifugation at 3500 g for 5 min, the virus particles were sedimented by centrifugation at 30,000 g for 20 min at 4 C and then suspended in 1 ml TN buffer as virus stock.
2. Materials and methods 2.5. WSSV quantification assay 2.1. Experimental animals Diseased Chinese shrimp with mean body weights (MBW) 13.0 2.5 g were collected from a pond in a local farm in July 2011. Healthy Chinese shrimp with MBW 14.2 2.0 g were collected from a pond in the same farm served as a control. Diseased Chinese shrimp showed obvious WSSV-infecting symptoms as lethargy, empty stomach, red discoloration of body and appendages, and a loose cuticle. 2.2. Experimental design 12 shrimp were randomly collected from the diseased and healthy ponds, respectively, by a hand net. The immune-related gene expressions and virus diagnosis of all shrimp from both ponds were analyzed. After sampling, hemolymph was immediately sampled separately using a 1 ml syringe containing 0.4 ml of pre-cooled anticoagulant solution (336 mM NaCl, 115 mM glucose, 27 mM sodium citrate, 9 mM EDTA), mixed well and then centrifuged at 800 g for 10 min at 4 C. The hemolytic pellet was suspended in 1 ml TRIzol reagent (Invitrogen) and placed on ice. Simultaneously, gills of each shrimp were excised in correspondence for WSSV detection. All samples were carefully marked and taken back to the laboratory for further analysis of the expression profiles of 18 immune related genes in WSSV-infected shrimp using RT-qPCR method. Thereafter, approximately two hundred shrimp from the healthy pond were transferred to a running aerated seawater (salinity 25&) at 21 C and fed with cooked clam worm for the following gene function analysis experiments. Chymotrypsinlike serine proteinase gene was knocked down by double-strand RNA synthesized in vitro. The experimental group was injected with 30 mg CH-SPase dsRNA per shrimp by intramuscular injection while the control group was injected with same amount of EGFP dsRNA. Then, the cumulative mortalities of shrimp and WSSV proliferation following time course were investigated.
The WSSV clone was amplified from WSSV-infected shrimp with primers W1447F and W1447R [27]. The amplified 1447 bp product was purified using a QIAquick PCR Purification Kit (Qiagen). Purified DNA was cloned into the pMD-18T vector (TaKaRa) and transformed into TOP10 competent cells. The positive clone was identified by sequencing. Then the plasmid DNA was purified using the Perfectprep Plasmid Mini Kit (Qiagen), and quantified with UV spectrophotometer. This DNA was used as PCR positive control template for determination of the stand curve of the real-time PCR. Specific primers and probe were designed from the 1447 bp products. The primer sequences of W71F and W71R are 50 -ACAATGGTCCCGTCCTCATC-30 , 50 -TGCCTTGCCGGAAATTAGTG-30 , respectively. The predicted size of the real-time PCR products was 71 bp. The TaqMan probe (50 - CAGAAGCCATGAAGAATGCCGTCTATCAC-30 ) was synthesized and labeled with fluorescent dyes TET on the 50 end and TAMRA on the 30 end. The concentrations of primer and TaqMan probe were optimized, and real-time PCR reactions were performed in a volume of 20 ml with Premix Ex TaqÔ (TaKaRa), 0.1 mM of each primer, 0.2 mM of TagMan probe and 2.0 ml of template DNA (diluted into 100 ng/ml per sample). The real-time PCR consisted of 30 s at 95 C, followed by 40 cycles of 5 s at 95 C and 20 s at 60 C. Amplification, detection and data analysis were performed on the Lightcycler iQÔ5 (Roche). 2.6. RNA isolation and cDNA synthesis Hemolymph was centrifuged at 800 g for 10 min at 4 C, and then the hemocyte pellet was suspended in 1 ml TRIzol reagent (Invitrogen) and stored at 80 C. Subsequently, total RNA was extracted using TRIzol Reagent according to the manufacturer’s instructions, and the first-strand cDNA synthesis was performed using M-MLV Reverse Transcriptase (Promega) and oligo-dT primer. 2.7. Quantitative real-time PCR (RT-qPCR) analysis of shrimp immune-related genes
2.3. WSSV diagnosis Total DNA from gills was extracted using a High Pure DNA Template Preparation Kit (Roche) according to the manufacturer’s instructions. PCR was carried out using primers as follows: W235F, 50 -CCAAGACATACTAGCGGATA-30 , W235R, 50 -GACGACCCTGACAGAATTAC-30 . The size of the PCR products was 235 bp. PCR was performed in 50 ml reaction volumes containing 5.0 ml of 10 PCR Buffer, 1.0 ml of dNTP mixture (2.5 mM each dATP, dCTP, dGTP, dTTP),
For analysis of the transcriptional expression profiles of immune-related genes in WSSV severely infected shrimp, RNA of 6 shrimp collected from the diseased pond was pooled as the experimental sample. Similarly, RNA of 6 shrimp collected from the healthy pond was pooled as the control sample. For the RT-qPCR, specific primers of immune-related genes were designed based on published Fenneropenaeus chinensis cDNA sequences of arginine kinase, catalase, chymotrypsin-like serine
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409 Table 1 Primer sequences used for RT-qPCR detection of P. chinesis immune-related genes. Target gene
GeneBank no.
Arginine kinase
AY661542 AKase
Catalase Chymotrypsin-like serine proteinasea C-type lectin
Abb. name
Primer sequence (50 -30 )
F-CGGTGATGTTACCTCCTTCGT R-CTTCTGCTGGACTTCCTT EU102287 CTase F-CGACGGCAATCAGGAAAG R-ATCAGCACTGTTGTAGCGAT EU433385 CH-SPase F-GCCAGCCAGGTCTCCATT R-GCAGTCTGACGGTCTTGATGTT AY871270 C-L F-GAGACGGTTGACTTGTGC R-TTCTACTTCATCGGTTGCT AY748350 HSP70 F-ATCCACCCGTATCCCTAA R-CTTGTCACCGCACAGAAT EU375464 KPI F-ACGAGGAACAAGAGCCAAGA R-CAGAAGCGGGCACAAGGT
Heat shock protein 70 cognate Kazal-type proteinase inhibitor Lipopolysaccharide and beta-1, 3-glucan binding protein Lysozyme
AY871267 LGBP
F-GTTGACTGGACCAAGGAGA R-GAAGAAGCCGTTCGTGCC
AY661543 LYZ
Penaeidin
AY669323 PEN
Peroxinectin
DQ172834 PO
Proliferating cell nuclear antigen Prophenoloxidase
EF051247
PCNA
FJ594415
proPO
Serine protease
FJ770383
SP
Serine protease-like protein Serpin serine protease inhibitor Thioredoxin peroxidase Triosephosphate isomerasea Argonaute
FJ770384
SPLP
F-AGACTGTCCGCCGTGAAA R-TATCCAGTATCTGCCGTG F-CGTCCAATCACTCGTC R-TCCATCAGCCAGTCTAT F-ACCTTCGTCGTGCTTAC R-TCACCAACCACGCACAGA F-GAGCATTGTCATTGCCTGTA R-TGGAAAGCGAAACCTGTG F-CGAGGCAGGACGATAC R-AACGGGAATTTACGCTA F-GCCGTCGTTGGTTATG R-CCTGCGGGTGTTGATA F- ACCACAACGTCCACAAAG R-TATCCCGAAGACACCCTC F-CGTGGCAGTTCCAGTTCA R-AGCCTTGTGGTCCCTCCT
Dicer
DQ318857 SPI
DQ205423 TPase DQ207952 TPI a*
AGO
b*
Dicer
F-AGCCAGACTTTGTTCAGA R-CAATGCCTTCGTCCTCCTT F-AGCCAGACTTTGTTCAGA R-TACCCAAGTTCAAGCATCTG F-GACCCAGACAACTGACTTTCGC R-TGATGCCAGGCTTGTAGTCC F-CCGGAGATAGAACGGTTCAGTG R-CGATAATTCCTCCCAACACCTG
a* and b* partial sequence was cloned by Zhang in our lab and not registered in GennBank yet. a primers used for RT-qPCR and RT-PCR simultaneously.
proteinase, C-type lectin, heat shock protein 70 cognate, kazal-type proteinase inhibitor, lipopolysaccharide and beta-1,3-glucan binding protein, lysozyme, penaeidin, peroxinectin, proliferating cell nuclear antigen, prophenoloxidase, serine protease, serine protease-like protein, serpin serine protease inhibitor, thioredoxin peroxidase, argonaute, dicer and triosephophate isomerase for internal control (Table 1). Standard curves were produced for each primer set and compared to the standard curve for the TPI internal control. qPCR were done on the Lightcycler iQÔ5 (Roche), with
405
SYBR PrimeScript RT-PCR Kit (TaKaRa Biotechnology Co., Ltd.), according to the manufacturer’s instructions. Thermal cycling conditions for the qPCR consisted of denaturation at 95 C for 30 s, followed by 40 cycles at 95 C for 5 s, 60 C for 30 s and a final hold at 60 C for 1 min. Each sample was analyzed in triplicate and the OOCt average threshold cycle (Ct) was calculated with the 2 method. The results were normalized to the expression level of TPI and relative to the control sample. 2.8. Expression of CH-SPase in hemocytes when challenge with WSSV To investigate the expression patterns of CH-SPase when challenge with certain amount WSSV, Chinese shrimp were injected with 10 ml WSSV stock suspension (5.96 105 copies/ml) by intramuscular injection and shrimp in control group were injected with same amount of TN Buffer. Hemolymph of three live infected shrimp was randomly collected at 0, 5, 24, 48 and 72 h post injection (h.p.i.). Hemocytes were obtained through centrifugation. RNA isolation and cDNA synthesis performed as described above. The expression pattern of CH-SPase, upon time course WSSV infection, was determined by qPCR assay. 2.9. Knock-down of CH-SPase in vivo expression by dsRNA For double-stranded RNA (dsRNA) synthesis, specific primers for CH-SPase and EGFP genes were designed and T7 promoter sequence was then incorporated to the 50 end of gene-specific primers to generate dsRNAs by using in vitro transcription T7 kit (TaKaRa) following the manufacturer’s instructions. Briefly, the PCR products were purified using a High Pure PCR Product Purification Kit (Roche) and sequenced to confirm that they corresponded to the target genes. Purified PCR products were transcribed to yield dsRNA. After purification, dsRNA were verified by agarose gel electrophoresis, quantified by UV spectrophotometer and stored at 80 C for the in vivo RNAi experiments. The oligonucleotide sequences used for synthesis of dsRNA were shown in Table 2. For gene knock-down experiments, the experimental group was injected with 30 mg CH-SPase dsRNA per shrimp by intramuscular injection while the control group was injected with same amount of EGFP dsRNA. Hemolymph sample from three shrimps of each treatment were collected at hour 5, 24, 48, 72 and 96 post injections. Total RNA isolation and cDNA synthesis performed as described above. The efficiency of gene knock-down was examined using RT-PCR and RT-qPCR method. The optimum time point of gene silencing was at 24 h after dsRNA injection. 2.10. Bioassay of WSSV challenge test in CH-SPase knock-down shrimp A total of 60 WSSV absent shrimp were divided into two groups (30 specimens per group) for WSSV and PBS challenge tests. Each
Table 2 Primer sequences used for dsRNA production. Target gene
Abb. name
Primer sequence (50 e30 )a
Chymotrypsin-like serine proteinase
CH-SPase
Enhanced green fluorescent protein
EGFP
CHiF-GCCAGCCAGGTCTCCATT CHiR-GGAGTGACGCCGGTCTTCT CHiTF-GATCACTAATACGACTCACTATAGGGGCCAGCCAGGTCTCCAT CHiTR-GATCACTAATACGACTCACTATAGGGGGAGTGACGCCGGTCTTT EiF- CAGTGCTTCAGCCGCTACCC EiR- AGTTCACCTTGATGCCGTTCTT EiTF-GATCACTAATACGACTCACTATAGGGCAGTGCTTCAGCCGCTACCC EiTR-GATCACTAATACGACTCACTATAGGGAGTTCACCTTGATGCCGTTT
a
Promoter sequence of T7 RNA polymerase is underlined.
406
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
shrimp were injected with 30 mg of CH-SPase dsRNA in one group and the other group was injected with PBS. Then, 10 ml WSSV stock suspensions were injected per shrimp 24 h later. Ten shrimp were used for each group. The cumulative mortality was recorded each 12 h and the experiment was repeated three times. 2.11. WSSV propagation in CH-SPase knocked-down shrimp To explore the possible involvement of CH-SPase in response to WSSV infection, we knocked down the expression of CH-SPase in shrimp by dsRNA-mediated RNA interference, same amount PBS were injected in the control group, and at 1 day post injection, shrimp were challenged with an infectious WSSV stock suspension described as above. Total RNA of hemocytes from three shrimp was extracted at day 1, 2 and 3 post WSSV infections respectively. WSSV VP28 transcripts were determined by RT-qPCR described above. The primers of WSSV VP28 used were as follows: VP28F, 50 CTCTTTCGGTCGTGTC-30 ; VP28R, 50 -GTCTGTGCGGGTTTC-30 . Simultaneously, Total DNA from gills of the three shrimp was extracted using a High Pure DNA Template Preparation Kit (Roche) according to the manufacturer’s instructions. WSSV copies in gills were also determined.
Fig. 2. Study of quantitative relative mRNA abundance of genes which expression levels changed significantly in hemocytes of WSSV severely infected F. chinensis. The data represent the fold-change of each gene after normalization relative to TPI and the basal expression level of shrimp in control group. The experiment was repeated three times and the error bars indicate standard deviations.
infection induced the expression of the CH-SPase and the highly expression patterns could probably maintain during the WSSV infection.
2.12. Statistical analysis 3.3. In vivo knock-down of CH-SPase by RNA interference Data obtained from qPCR and cumulative mortality analysis were subjected to one-way analysis of variance (one-way ANOVA) followed by an unpaired t-test. A probability value of less than 0.05 was considered as statistically significant. The results were expressed as the mean the standard error. 3. Results 3.1. Transcriptional expression of immune-related genes in WSSVinfected shrimp Through the WSSV detection approach, shrimp from the diseased pond were determined as WSSV strong positive, while shrimp from the normal pond showed WSSV absence (Fig. 1). Among the 18 immune related genes, expression levels of 6 genes including CH-SPase, HSP70, PEN, PO, PCNA and AGO changed significantly, while the expression of the other 12 genes had no significant changes (data not shown). Of the 6 genes screened from the 18 shrimp immune related genes, 5 genes showed significantly down-regulation, while CH-SPase showed significantly upregulation with expression level being 14.3 greater than in the control group (Fig. 2).
A reduction of CH-SPase mRNA expression was observed using RT-PCR assay at 24 hpi (Fig. 4). While in the RT-qPCR assay, a significant reduction was observed at 5 hpi (0.29 less than the control group) and the expression of CH-SPase reached a minimum at 48 hpi (0.06 less than the control group) (Fig. 5) following the time course. The expression of CH-SPase was not affected by EGFP dsRNA injection in both assays. 3.4. Effects of knockdown of CH-SPase expression on WSSV-infected shrimp Cumulative mortality in the experimental group was significantly lower than in the control group at 12 hpi (P ¼ 0.04), 24 hpi (P ¼ 0.01) and 36 hpi (P ¼ 0.004). After 48 hpi, the cumulative mortality in both groups had no significant difference (Fig. 6.).
3.2. Expression patterns of CH-SPase during WSSV infection in hemocytes of Chinese shrimp The expression levels of CH-SPase were significantly highly upregulated over the time course of the virus infection and reached a maximum at 5 hpi (18.8 greater than the control group) (Fig. 3). Combined with the previous results, we concluded that WSSV
Fig. 1. Detection of WSSV in gill samples of shrimp by PCR. Lane 1: DL 2000 DNA marker; lanes 2e7: shrimp from the diseased pond; lanes 8e13: shrimp from the healthy pond; lane 14: positive control; lane 15: negative control. All the products were electrophoresed on a 1% agarose gel and stained with ethidium bromide.
Fig. 3. Expression profiles of CH-SPase mRNA in hemocytes of F. chinensis at 5, 24, 48 and 72 h post WSSV injection, determined by RT-qPCR. TPI mRNA levels were used as an internal control. Data were presented as mean SD of triplicates. Column bars with asterisks indicated values that were significantly different from those on day 0 (P < 0.05).
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
407
Fig. 4. Time course showed CH-SPase expression in F. chinensis hemocytes after knockdown by dsRNA-mediated RNAi determined by RT-PCR. Injection of enhanced green fluorescent protein-dsRNA (EGFP dsRNA) was used as dsRNA control. TPI was used as an internal control of RT-PCR.
3.5. Suppression of CH-SPase inhibited WSSV replication Compared to the control group, VP28 transcripts in the experimental group were decreased significantly. The transcriptional level of VP28 reached a minimum at 1 dpi (0.01 less than the control group), and subsequently recovered at 2 (0.34 less than the control group) and 3 (0.24 less than the control group) dpi, but still less than the control group (Fig. 7). WSSV copies in gills of the experimental group were less than the control group at 1 dpi (105.67 copies/ml compared to 107.33 copies/ml), while the WSSV copies increased at 2 dpi (107.77 copies/ml compared to 107.41 copies/ml) and decreased again at 3 dpi (107.13 copies/ml compared to 108.39 copies/ml) (Fig. 8). Transcripts of CH-SPase in the experimental group were decreased significantly (0.05, 0.33and 0.34at 1, 2 and 3 dpi respectively) (Fig. 9). 4. Discussion There are nearly 20 different viruses recognized in penaeid shrimp, with only four, including WSSV, yellow head virus (YHV), taura syndrome virus (TSV) and hematopoietic nerosis virus (IHHNV), seeming to stand out as being especially important for their historical, current, and potential future adverse effects on the international shrimp farming industry [28]. Thus before the research, we investigated the epidemic viral pathogens in several
Fig. 5. Expression profiles of CH-SPase mRNA in hemocytes after knock-down by dsRNA determined by RT-qPCR. Injection of EGFP dsRNA was used as dsRNA control. TPI was used as an internal control of RT-qPCR. Data were presented as mean SD of triplicates. Column bars with asterisks indicated values that were significantly different from those on day 0 (P < 0.05).
Fig. 6. Cumulative mortality of F. chinensis infected with CH-SPase dsRNA and WSSV stock suspension. Injection of PBS and WSSV stock suspension was used as control group. Ten shrimp were used for each group. The mortality was recorded each 12 h. The experiment was repeated three times. Significant differences in shrimp mortality are marked with asterisks and the error bars indicated standard deviations.
shrimp farms and found that WSSV was the only viral pathogen in local farms in July 2011 when the study was conducted (data not shown). Four chymotrypsins have been identified in shrimp to date. These include chymotrypsin BⅠ and BⅡ from Litopenaeus vannamei [33,34], a chymotrypsin-like serine protease from F. chinensis [14] and a chymotrypsin-like protease from Marsupenaeus japonicas [35]. Serine proteases of chymotrypsin family participate in a wide range of biological reactions including digestive and degradative processes, blood clotting, humoral and cellular immunity, tissue remodeling, and embryonic development [29]. In addition, chymotrypsins are involved in the immune defense reaction against bacteria in the fruit fly Drosophila melanogaster [36]. Bonnie et al. [30] reported that chymotrypsin enhanced fowlpox virus plaque formation in chick embryo cell cultures. Gifford and Klapper [31,32] demonstrated that the number and size of vaccinia virus plaques were increased in the presence of trypsin or
Fig. 7. Effect of CH-SPase silencing on the variation of VP28 transcripts in hemocytes of F. chinensis at day 1, 2 and 3 post WSSV injections. The quantitative RT-qPCR was performed for WSSV VP28 by using TPI as an internal control, and the data were analyzed by comparative quantization. The experiment had been carried out three times, the data represented means of three replicates, and the error bars indicated standard deviations. Column bars with asterisks indicated values that were significantly different from control group (P < 0.05).
408
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
Among the 18 immune-related genes, there were 12 genes showed no significant changes. Based on these results, we speculated that the 12 genes may just have transient effect on innate antiviral responses. When the virus breaks through the defense system, they are powerless to the WSSV infection. In the presence of CH-SPase dsRNA, the number of WSSV copies was distinctly lower than that in the control group 24 h after WSSV injection, but recovered at certain degree at 48 and 72 h post WSSV injection. The recovery of WSSV copies mainly because the inducing of the expression of CH-SPase by WSSV. This study screened 6 genes from Chinese shrimp which severely infected by WSSV. Functional analysis showed that CHSPase was important to WSSV infection. The down-regulation of CH-SPase may be exploited as a target to prevent WSSV infection in future. Acknowledgments Fig. 8. Log values of WSSV copies in gills of F. chinensis at day 1, 2 and 3 post WSSV injections when CH-SPase was silenced by dsRNA. WSSV copies were determined by quantification assay. The experiment had been carried out three times, the data represented means of three replicates, and the error bars indicated standard deviations.
chymotrypsin. These researches indicated that chymotrypsin was likely to participate in the process of virus propagation. However, the mechanisms of chymotrypsins in assisting virus propagation remain unclear. As we know, virus can induce apoptosis to assist their own dissemination, which was also confirmed in shrimp infected with WSSV. Henderson and Stuck [37] reported that apoptosis levels were increased in Penaeus vannamei during WSSV infection. Sahtout et al. [38] also demonstrated that apoptosis was induced in WSSV-infected Penaeus monodon. Furthermore, there is evidence in the literature that chymotrypsin-like serine proteases are activated during apoptosis [39]. Therefore, we speculated that CH-SPase in F. chinensis possibly was an important factor in the apoptosis pathway WSSV induced. Silence of CH-SPase might block or slow down the progress of apoptosis activated by WSSV, thus inhibit or reduce the propagation of WSSV to some extent. The mechanisms of the interaction between CH-SPase and apoptosis induced by WSSV needs further study.
Fig. 9. Time course showed CH-SPase expression in F. chinensis hemocytes when injected with CH-SPase dsRNA and WSSV stock suspension. Injection of PBS was used as control. Data were presented as mean SD of triplicates. Column bars with asterisks indicated values that were significantly different from those on day 0 (P < 0.05).
We want to thank Xu-Yun Geng, Jun-Li Wei and Yi Yang for their assist in collecting of samples. This work was supported by the Grants from the National Basic Research Program of China (2012CB114405) and National Key Technology R&D Program (2012AA10A401 and 2012AA092205). References [1] Wang HC, Leu JH, Kou GH, Wang AH, Lo CF. Protein expression profiling of the shrimp cellular response to white spot syndrome virus infection. Dev Comp Immunol 2007;31:672e86. [2] Yang F, He J, Lin XH, Li Q, Pan D, Zhang X, et al. Complete genome sequence of the shrimp white spot bacilliform virus. J Virol 2001;75:11811e20. [3] Van Hulten MC, Witteveldt J, Peters S, Kloosterboer N, Tarchini R, Fiers M, et al. The white spot syndrome virus DNA genome sequence. Virology 2001; 286:7e22. [4] Lo CF, Kou GH. Shrimp white spot syndrome virus, complete genome; 2001. AF440570 GenBank. [5] Yan Feng, Xia Ding, lv Songya, Qi Yipeng, Xu Hua. Functional analysis of the orf390 gene of the white spot syndrome virus. Virus Res 2010;151:39e44. [6] Tsai Jyh-Ming, Wang Han-Ching, Leu Jiann-Horng, . Wang Andrew H-J, Zhuang Ying, Walker Peter J, et al. Identification of the nucleocapsid, tegument, and envelope proteins of the shrimp white spot syndrome virus virion. J Virol 2006;80:3021e9. [7] Wu Wenlin, Wang Lei, Zhang Xiaobo. Identification of white spot syndrome virus (WSSV) envelope proteins involved in shrimp infection. Virology 2005; 332:578e83. [8] Lin Yi, Xu Limei, Yang Feng. Tetramerization of white spot syndrome virus envelope protein VP33 and its interaction with VP24. Arch Virol 2010;155: 833e8. [9] Kono Tomoya, Savan Ram, Sakai Masahiro, Itami Toshiaki. Detection of white spot syndrome virus in shrimp by loop-mediated isothermal amplification. J Virol Methods 2004;115:59e65. [10] Yoganandhan K, Syed Musthaq S, Narayanan RB, Sahul Hameed AS. Production of polyclonal antiserum against recombinant VP28 protein and its application for the detection of white spot syndrome virus in crustaceans. J Fish Dis 2004;27:517e22. [11] Jiravanichpaisal P, Lee BL, Söderhäll K. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006;211:213e36. [12] Cerenius L, Söderhäll K. The prophenoloxidase-activating system in invertebrates. Immunol Rev 2004;198:116e26. [13] Lee SY, Söderhäll K. Early events in crustacean innate immunity. Fish Shellfish Immunol 2002;12:421e37. [14] Shi XZ, Zhao XF, Wang JX. Molecular cloning and expression analysis of chymotrypsin-like serine protease from the Chinese shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2008;25:589e97. [15] Dechklar M, Udomkit A, Panyim S. Characterization of Argonaute cDNA from Penaeus monodon and implication of its role in RNA interference. Biochem Biophys Res Commun 2008;367:768e74. [16] Liu YC, Li FH, Dong B, Wang B, Luan W, Zhang XJ, et al. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol Immunol 2007;44: 598e607. [17] Dong B, Liu F, Gao H, Wang B, Xiang J. cDNA cloning and gene expression pattern following bacterial challenge of peroxinectin in Chinese shrimp Fenneropenaeus chinensis. Mol Biol Rep 2009;36:2333e9. [18] Wang KC Han-Ching, Tseng Chun-Wei, Lin Han-You, Chen I-Tung, Chen YaHui, Chen Yi-Min, et al. RNAi knock-down of the Litopenaeus vannamei Toll
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
[19]
[20]
[21]
[22] [23] [24]
[25]
[26]
[27] [28]
gene (LvToll) significantly increases mortality and reduces bacterial clearance after challenge with Vibrio harveyi. Dev Comp Immunol 2010;34:49e58. Robalino J, Browdy CL, Prior S, Metz A, Parnell P, Gross P, et al. Induction of antiviral immunity by double-stranded RNA in a marine invertebrate. J Virol 2004;78:10442e8. Robalino J, Bartlett T, Shepard E, Prior S, Jaramillo G, Scura E, et al. Doublestranded RNA induces sequence-specific antiviral silencing in addition to nonspecific immunity in a marine shrimp: convergence of RNA interference and innate immunity in the invertebrate antiviral response? J Virol 2005;79: 13561e71. Westenberg M, Heinhuis B, Zuidema D, Vlak JM. siRNA injection induces sequence-independent protection in Penaeus monodon against white spot syndrome virus. Virus Res 2005;114:133e9. Klasse PJ, Bron R, Marsh M. Mechanisms of enveloped virus entry into animal cells. Adv Drug Deliv Rev 1998;34:65e91. Kawai T, Akira S. Innate immune recognition of viral infection. Nat Immunol 2006;7:131e7. Chai YM, Yu SS, Zhao XF, Zhu Q, Wang JX. Comparative proteomic profiles of the hepatopancreas in Fenneropenaeus chinensis response to white spot syndrome virus. Fish Shellfish Immunol 2010;29:480e6. Yeh SP, Chen YN, Hsien SL, Cheng W, Liu CH. Immune response of white shrimp, Litopenaeus vannamei, after a concurrent infection with white spot syndrome virus and infectious hypodermal and hematopoietic necrosis virus. Fish Shellfish Immunol 2009;26:582e8. Xie Y, Wang B, Li F, Jiang H, Xiang J. Molecular cloning and characterization of proliferating cell nuclear antigen (PCNA) from Chinese shrimp Fenneropenaeus chinensis. Comp Biochem Physiol B Biochem Mol Biol 2008;151:225e9. Office International Des Epizooties. Diagnostic manual for aquatic animal diseases[M]. 3rd ed. Paris: OIE; 2000. p. 220e9. Lightner DV. The penaeid shrimp viruses TSV, IHHNV, WSSV, and YHV: current status in the Americas, available diagnostic methods, and management strategies. J Appl Aquacult 1999;9:27e52.
409
[29] Maxwell MK, Enrico DC. Evolution of enzyme cascades from embryonic development to blood coagulation. Trends Biochem Sci 2002;27(2):67e74. [30] Asch Bonnie B, Gifford George E. Accelerated plaque formation by fowlpox virus in the presence of chymotrypsin. J Appl Microbiol 1969;18:897e900. [31] Gifford GE, Klapper DG. Enhancement of vaccinia virus plaque formation by trypsin. Proc Soc Exp.Biol Med 1967;126:515e7. [32] Gifford GE, Klapper DG. Effect of proteolytic enzymes on vaccinia virus replication. Arch Gesamte Virusforsch 1969;26:321e33. [33] Sellos D, Van Wormhoudt A. Molecular cloning of a cDNA that encodes a serine protease with chymotrypic and collagenolytic activities in the hepatopancreas of the shrimp Penaeus vanameii (Crustacea, Decapoda). FEBS Lett 1992;309:219e24. [34] Sellos D, Van Wormhoudt A. Polymorphism and evolution of collagenolytic serine protease genes in crustaceans. Biochim Biophys Acta 1999;1432:419e24. [35] Danwattananusorn Threechada, Kondo Hidehiro, Aoki Takashi, Hirono Ikuo. Molecular cloning, characterization and expression analysis of a chymotrypsin-like serine protease from kuruma shrimp Marsupenaeus japonicas. Fish Sci 2009:1231e8. [36] de Morais Guedes S, Vitorino R, Domingues R, Tomer K, Correia AJ, Amado F. Proteomics of immune-challenged Drosophila melanogaster larvae hemolymph. Biochem Biophys Res Commun 2005;328:106e15. [37] Henderson T, Stuck K. Induction of apoptosis in response to white spot syndrome virus in the pacific white shrimp, Penaeus vannamei. In: Anon, editor. Book of abstracts, aquaculture America 1999, Tampa, Florida. Baton Rouge, LA: World Aquaculture Society; 1999. Abstract #67. [38] Sahtout AH, Hassan MD, Shariff M. DNA fragmentation, an indicator of apoptosis, in cultured black tiger shrimp Penaeus monodon infected with white spot syndrome virus (WSSV). Dis Aqust Org 2001;44:155e9. [39] Grabarek J, Dragan M, Lee BW, Johnson GL, Darzynkiewicz Z. Activation of chymotrypsin-like serine protease(s) during apoptosis detected by affinitylabeling of the enzymatic center with fluoresceinated inhibitor. Int J Oncol 2002;20:225e33.
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Role of chymotrypsin-like serine proteinase in white spot syndrome virus infection in Fenneropenaeus chinensis Shuxia Xue a, b, Weijun Yang a, *, Jinsheng Sun c, * a
Institute of Cell Biology and Genetics, College of Life Sciences, Zhejiang University, Zijingang Campus, Hangzhou, Zhejiang 310058, China Tianjin Center for Control and Prevention of Aquatic Animal Infectious Disease, 442 Jiefang South Road, Tianjin 300221, China c Tianjin Key Laboratory of Cyto-Genetical and Molecular Regulation, Tianjin Normal University, 393 Binshui West Road, Tianjin 300387, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 July 2012 Received in revised form 11 October 2012 Accepted 11 October 2012 Available online 7 November 2012
White spot syndrome virus (WSSV) caused a great economic loss in shrimp aquaculture. Although great efforts have been undertaken to characterize the virus disease during the last two decades, there are still lack of effective methods to prevent or cure it. In this study, we investigated the transcriptional expression profiles of 18 key immune-related genes in the Chinese shrimp Fenneropenaeus chinensis which was severely infected by WSSV. We found that the expression levels of 6 genes including chymotrypsin-like serine proteinase (CH-SPase), heat shock protein 70 cognate (HSP70), penaeidin (PEN), peroxinectin (PO), proliferating cell nuclear antigen (PCNA) and argonaute (AGO) changed significantly, while the expression of the other 12 genes had no significant changes compared to the control group. Among the 6 screened genes, CH-SPase showed significantly up-regulation, while the other 5 ones were significantly down-regulated. Knockdown of the expression of CH-SPase in WSSVinfected Chinese shrimp reduced the copy number of WSSV and delayed cumulative mortalities, suggesting that CH-SPase is important for WSSV infection. This study will be helpful to control the disease in shrimp caused by WSSV. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Immune-related genes Fenneropenaeus chinensis Chymotrypsin-like serine proteinase White spot syndrome virus
1. Introduction Chinese shrimp is one of the locally cultured shrimp in China and plays a major role in the Chinese mariculture industry. However, white spot syndrome virus (WSSV) has severely affected the shrimp industry, with WSSV infections causing 100% cumulative mortality in cultured shrimp in just 3e10 days [1]. Because of its rapid spread and high associated mortality rates, WSSV is the most serious threats to shrimp culture all over the world. Great efforts have been made to prevent and control the disease including completing WSSV genome sequencing [2e4], identifying WSSV structural proteins [5e8], exploring advanced WSSV detecting methods [9,10]. Recently, an increasing number of immune related genes of shrimp have been reported [14e17] and different strategies have been developed to control the infection by WSSV [19e21], however, there is still no effective treatment available to interfere with the unrestrained occurrence and the spread of the disease.
* Corresponding author. Tel.: þ86 22 88250781; fax: þ86 22 88254270. E-mail addresses: [email protected], [email protected] (J. Sun). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.10.017
It is widely accepted that crustaceans lack a true adaptive immune response system and its defense against pathogens relies largely on various innate immune mechanisms, including both cellular and humoral responses [11e13]. Understanding the interaction between host and pathogen will be helpful in controlling the infectious diseases in shrimp. In previous studies, expression profiles of shrimp immune-related genes were investigated under different challenge conditions and at certain time points, the expression of most genes were, however, variable in the process of virus infection [18,24e26], and therefore it is hard to analyze the role of the gene in the immune defense system. Viruses can recruit both cellular and viral factors and take advantages of the cell endocytic machinery for a successful infection. Meanwhile, hosts can trigger antiviral responses to combat the viral invaders [22,23]. In this game, WSSV is usually the winner upon most occasions since high mortality of shrimp infected by the virus. Although a great number of shrimp immune-related genes have been identified and showed being involved in the innate immune reactions according to the different regulating patterns after WSSV challenge, real roles of most of them in antiviral immune response remain unclear. We assume that some immune genes may just have transient effect on antiviral responses because of its variable expression profiles after WSSV challenge, and some
404
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
host genes may be recruited by the smart virus to accomplish a successful infection, and also some genes are the key defenders to the virus. For the key defenders, the virus probably explores effective strategies to suppress them. Based on these ideas, we speculated that screening of those whose expression profiles change significantly when the game is almost over (shrimp are dying because of the WSSV infection) may supply deep insight into the responses of shrimp immune-related genes in WSSV infections. In the present study, we analyzed the responses of 18 immunerelated genes in the hemocytes of Chinese shrimp which was severely infected by WSSV using quantitative real-time PCR. Our results showed that expression levels of 6 genes changed significantly, while the expression of the other 12 ones had no significant changes. Among the 6 screened genes 5 ones showed significantly down-regulation, while the CH-SPase was significantly upregulated. We also investigated the potential roles of CH-SPase in the process of WSSV infection.
1.0 ml of W235F and W235R primers (10 mM), 0.5 ml of Taq polymerase (5 U/ml) (TaKaRa), 39.5 ml of distilled water and 2.0 ml of DNA extracted from gills. The amplification regime was 4 min at 94 C, followed by 30 cycles of 94 C for 45 s, 58 C for 30 s and 72 C for 1 min, then final elongation for 5 min at 72 C. PCR products were electrophoresed on a 1% agarose gel to document the specific products. 2.4. Preparation of WSSV stock suspension Gills of WSSV-infected shrimp were homogenized in TNE buffer (50 mM TriseHCl, 400 mM NaCl, 5 mM EDTA, pH 8.5) and centrifuged at 3500 g for 5 min at 4 C. Then, the supernatant was centrifuged at 30,000 g for 30 min at 4 C. The pellet was suspended in 10 ml TN buffer (20 mM Tris/HCl, 400 mM NaCl, and pH 7.4). After centrifugation at 3500 g for 5 min, the virus particles were sedimented by centrifugation at 30,000 g for 20 min at 4 C and then suspended in 1 ml TN buffer as virus stock.
2. Materials and methods 2.5. WSSV quantification assay 2.1. Experimental animals Diseased Chinese shrimp with mean body weights (MBW) 13.0 2.5 g were collected from a pond in a local farm in July 2011. Healthy Chinese shrimp with MBW 14.2 2.0 g were collected from a pond in the same farm served as a control. Diseased Chinese shrimp showed obvious WSSV-infecting symptoms as lethargy, empty stomach, red discoloration of body and appendages, and a loose cuticle. 2.2. Experimental design 12 shrimp were randomly collected from the diseased and healthy ponds, respectively, by a hand net. The immune-related gene expressions and virus diagnosis of all shrimp from both ponds were analyzed. After sampling, hemolymph was immediately sampled separately using a 1 ml syringe containing 0.4 ml of pre-cooled anticoagulant solution (336 mM NaCl, 115 mM glucose, 27 mM sodium citrate, 9 mM EDTA), mixed well and then centrifuged at 800 g for 10 min at 4 C. The hemolytic pellet was suspended in 1 ml TRIzol reagent (Invitrogen) and placed on ice. Simultaneously, gills of each shrimp were excised in correspondence for WSSV detection. All samples were carefully marked and taken back to the laboratory for further analysis of the expression profiles of 18 immune related genes in WSSV-infected shrimp using RT-qPCR method. Thereafter, approximately two hundred shrimp from the healthy pond were transferred to a running aerated seawater (salinity 25&) at 21 C and fed with cooked clam worm for the following gene function analysis experiments. Chymotrypsinlike serine proteinase gene was knocked down by double-strand RNA synthesized in vitro. The experimental group was injected with 30 mg CH-SPase dsRNA per shrimp by intramuscular injection while the control group was injected with same amount of EGFP dsRNA. Then, the cumulative mortalities of shrimp and WSSV proliferation following time course were investigated.
The WSSV clone was amplified from WSSV-infected shrimp with primers W1447F and W1447R [27]. The amplified 1447 bp product was purified using a QIAquick PCR Purification Kit (Qiagen). Purified DNA was cloned into the pMD-18T vector (TaKaRa) and transformed into TOP10 competent cells. The positive clone was identified by sequencing. Then the plasmid DNA was purified using the Perfectprep Plasmid Mini Kit (Qiagen), and quantified with UV spectrophotometer. This DNA was used as PCR positive control template for determination of the stand curve of the real-time PCR. Specific primers and probe were designed from the 1447 bp products. The primer sequences of W71F and W71R are 50 -ACAATGGTCCCGTCCTCATC-30 , 50 -TGCCTTGCCGGAAATTAGTG-30 , respectively. The predicted size of the real-time PCR products was 71 bp. The TaqMan probe (50 - CAGAAGCCATGAAGAATGCCGTCTATCAC-30 ) was synthesized and labeled with fluorescent dyes TET on the 50 end and TAMRA on the 30 end. The concentrations of primer and TaqMan probe were optimized, and real-time PCR reactions were performed in a volume of 20 ml with Premix Ex TaqÔ (TaKaRa), 0.1 mM of each primer, 0.2 mM of TagMan probe and 2.0 ml of template DNA (diluted into 100 ng/ml per sample). The real-time PCR consisted of 30 s at 95 C, followed by 40 cycles of 5 s at 95 C and 20 s at 60 C. Amplification, detection and data analysis were performed on the Lightcycler iQÔ5 (Roche). 2.6. RNA isolation and cDNA synthesis Hemolymph was centrifuged at 800 g for 10 min at 4 C, and then the hemocyte pellet was suspended in 1 ml TRIzol reagent (Invitrogen) and stored at 80 C. Subsequently, total RNA was extracted using TRIzol Reagent according to the manufacturer’s instructions, and the first-strand cDNA synthesis was performed using M-MLV Reverse Transcriptase (Promega) and oligo-dT primer. 2.7. Quantitative real-time PCR (RT-qPCR) analysis of shrimp immune-related genes
2.3. WSSV diagnosis Total DNA from gills was extracted using a High Pure DNA Template Preparation Kit (Roche) according to the manufacturer’s instructions. PCR was carried out using primers as follows: W235F, 50 -CCAAGACATACTAGCGGATA-30 , W235R, 50 -GACGACCCTGACAGAATTAC-30 . The size of the PCR products was 235 bp. PCR was performed in 50 ml reaction volumes containing 5.0 ml of 10 PCR Buffer, 1.0 ml of dNTP mixture (2.5 mM each dATP, dCTP, dGTP, dTTP),
For analysis of the transcriptional expression profiles of immune-related genes in WSSV severely infected shrimp, RNA of 6 shrimp collected from the diseased pond was pooled as the experimental sample. Similarly, RNA of 6 shrimp collected from the healthy pond was pooled as the control sample. For the RT-qPCR, specific primers of immune-related genes were designed based on published Fenneropenaeus chinensis cDNA sequences of arginine kinase, catalase, chymotrypsin-like serine
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409 Table 1 Primer sequences used for RT-qPCR detection of P. chinesis immune-related genes. Target gene
GeneBank no.
Arginine kinase
AY661542 AKase
Catalase Chymotrypsin-like serine proteinasea C-type lectin
Abb. name
Primer sequence (50 -30 )
F-CGGTGATGTTACCTCCTTCGT R-CTTCTGCTGGACTTCCTT EU102287 CTase F-CGACGGCAATCAGGAAAG R-ATCAGCACTGTTGTAGCGAT EU433385 CH-SPase F-GCCAGCCAGGTCTCCATT R-GCAGTCTGACGGTCTTGATGTT AY871270 C-L F-GAGACGGTTGACTTGTGC R-TTCTACTTCATCGGTTGCT AY748350 HSP70 F-ATCCACCCGTATCCCTAA R-CTTGTCACCGCACAGAAT EU375464 KPI F-ACGAGGAACAAGAGCCAAGA R-CAGAAGCGGGCACAAGGT
Heat shock protein 70 cognate Kazal-type proteinase inhibitor Lipopolysaccharide and beta-1, 3-glucan binding protein Lysozyme
AY871267 LGBP
F-GTTGACTGGACCAAGGAGA R-GAAGAAGCCGTTCGTGCC
AY661543 LYZ
Penaeidin
AY669323 PEN
Peroxinectin
DQ172834 PO
Proliferating cell nuclear antigen Prophenoloxidase
EF051247
PCNA
FJ594415
proPO
Serine protease
FJ770383
SP
Serine protease-like protein Serpin serine protease inhibitor Thioredoxin peroxidase Triosephosphate isomerasea Argonaute
FJ770384
SPLP
F-AGACTGTCCGCCGTGAAA R-TATCCAGTATCTGCCGTG F-CGTCCAATCACTCGTC R-TCCATCAGCCAGTCTAT F-ACCTTCGTCGTGCTTAC R-TCACCAACCACGCACAGA F-GAGCATTGTCATTGCCTGTA R-TGGAAAGCGAAACCTGTG F-CGAGGCAGGACGATAC R-AACGGGAATTTACGCTA F-GCCGTCGTTGGTTATG R-CCTGCGGGTGTTGATA F- ACCACAACGTCCACAAAG R-TATCCCGAAGACACCCTC F-CGTGGCAGTTCCAGTTCA R-AGCCTTGTGGTCCCTCCT
Dicer
DQ318857 SPI
DQ205423 TPase DQ207952 TPI a*
AGO
b*
Dicer
F-AGCCAGACTTTGTTCAGA R-CAATGCCTTCGTCCTCCTT F-AGCCAGACTTTGTTCAGA R-TACCCAAGTTCAAGCATCTG F-GACCCAGACAACTGACTTTCGC R-TGATGCCAGGCTTGTAGTCC F-CCGGAGATAGAACGGTTCAGTG R-CGATAATTCCTCCCAACACCTG
a* and b* partial sequence was cloned by Zhang in our lab and not registered in GennBank yet. a primers used for RT-qPCR and RT-PCR simultaneously.
proteinase, C-type lectin, heat shock protein 70 cognate, kazal-type proteinase inhibitor, lipopolysaccharide and beta-1,3-glucan binding protein, lysozyme, penaeidin, peroxinectin, proliferating cell nuclear antigen, prophenoloxidase, serine protease, serine protease-like protein, serpin serine protease inhibitor, thioredoxin peroxidase, argonaute, dicer and triosephophate isomerase for internal control (Table 1). Standard curves were produced for each primer set and compared to the standard curve for the TPI internal control. qPCR were done on the Lightcycler iQÔ5 (Roche), with
405
SYBR PrimeScript RT-PCR Kit (TaKaRa Biotechnology Co., Ltd.), according to the manufacturer’s instructions. Thermal cycling conditions for the qPCR consisted of denaturation at 95 C for 30 s, followed by 40 cycles at 95 C for 5 s, 60 C for 30 s and a final hold at 60 C for 1 min. Each sample was analyzed in triplicate and the OOCt average threshold cycle (Ct) was calculated with the 2 method. The results were normalized to the expression level of TPI and relative to the control sample. 2.8. Expression of CH-SPase in hemocytes when challenge with WSSV To investigate the expression patterns of CH-SPase when challenge with certain amount WSSV, Chinese shrimp were injected with 10 ml WSSV stock suspension (5.96 105 copies/ml) by intramuscular injection and shrimp in control group were injected with same amount of TN Buffer. Hemolymph of three live infected shrimp was randomly collected at 0, 5, 24, 48 and 72 h post injection (h.p.i.). Hemocytes were obtained through centrifugation. RNA isolation and cDNA synthesis performed as described above. The expression pattern of CH-SPase, upon time course WSSV infection, was determined by qPCR assay. 2.9. Knock-down of CH-SPase in vivo expression by dsRNA For double-stranded RNA (dsRNA) synthesis, specific primers for CH-SPase and EGFP genes were designed and T7 promoter sequence was then incorporated to the 50 end of gene-specific primers to generate dsRNAs by using in vitro transcription T7 kit (TaKaRa) following the manufacturer’s instructions. Briefly, the PCR products were purified using a High Pure PCR Product Purification Kit (Roche) and sequenced to confirm that they corresponded to the target genes. Purified PCR products were transcribed to yield dsRNA. After purification, dsRNA were verified by agarose gel electrophoresis, quantified by UV spectrophotometer and stored at 80 C for the in vivo RNAi experiments. The oligonucleotide sequences used for synthesis of dsRNA were shown in Table 2. For gene knock-down experiments, the experimental group was injected with 30 mg CH-SPase dsRNA per shrimp by intramuscular injection while the control group was injected with same amount of EGFP dsRNA. Hemolymph sample from three shrimps of each treatment were collected at hour 5, 24, 48, 72 and 96 post injections. Total RNA isolation and cDNA synthesis performed as described above. The efficiency of gene knock-down was examined using RT-PCR and RT-qPCR method. The optimum time point of gene silencing was at 24 h after dsRNA injection. 2.10. Bioassay of WSSV challenge test in CH-SPase knock-down shrimp A total of 60 WSSV absent shrimp were divided into two groups (30 specimens per group) for WSSV and PBS challenge tests. Each
Table 2 Primer sequences used for dsRNA production. Target gene
Abb. name
Primer sequence (50 e30 )a
Chymotrypsin-like serine proteinase
CH-SPase
Enhanced green fluorescent protein
EGFP
CHiF-GCCAGCCAGGTCTCCATT CHiR-GGAGTGACGCCGGTCTTCT CHiTF-GATCACTAATACGACTCACTATAGGGGCCAGCCAGGTCTCCAT CHiTR-GATCACTAATACGACTCACTATAGGGGGAGTGACGCCGGTCTTT EiF- CAGTGCTTCAGCCGCTACCC EiR- AGTTCACCTTGATGCCGTTCTT EiTF-GATCACTAATACGACTCACTATAGGGCAGTGCTTCAGCCGCTACCC EiTR-GATCACTAATACGACTCACTATAGGGAGTTCACCTTGATGCCGTTT
a
Promoter sequence of T7 RNA polymerase is underlined.
406
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
shrimp were injected with 30 mg of CH-SPase dsRNA in one group and the other group was injected with PBS. Then, 10 ml WSSV stock suspensions were injected per shrimp 24 h later. Ten shrimp were used for each group. The cumulative mortality was recorded each 12 h and the experiment was repeated three times. 2.11. WSSV propagation in CH-SPase knocked-down shrimp To explore the possible involvement of CH-SPase in response to WSSV infection, we knocked down the expression of CH-SPase in shrimp by dsRNA-mediated RNA interference, same amount PBS were injected in the control group, and at 1 day post injection, shrimp were challenged with an infectious WSSV stock suspension described as above. Total RNA of hemocytes from three shrimp was extracted at day 1, 2 and 3 post WSSV infections respectively. WSSV VP28 transcripts were determined by RT-qPCR described above. The primers of WSSV VP28 used were as follows: VP28F, 50 CTCTTTCGGTCGTGTC-30 ; VP28R, 50 -GTCTGTGCGGGTTTC-30 . Simultaneously, Total DNA from gills of the three shrimp was extracted using a High Pure DNA Template Preparation Kit (Roche) according to the manufacturer’s instructions. WSSV copies in gills were also determined.
Fig. 2. Study of quantitative relative mRNA abundance of genes which expression levels changed significantly in hemocytes of WSSV severely infected F. chinensis. The data represent the fold-change of each gene after normalization relative to TPI and the basal expression level of shrimp in control group. The experiment was repeated three times and the error bars indicate standard deviations.
infection induced the expression of the CH-SPase and the highly expression patterns could probably maintain during the WSSV infection.
2.12. Statistical analysis 3.3. In vivo knock-down of CH-SPase by RNA interference Data obtained from qPCR and cumulative mortality analysis were subjected to one-way analysis of variance (one-way ANOVA) followed by an unpaired t-test. A probability value of less than 0.05 was considered as statistically significant. The results were expressed as the mean the standard error. 3. Results 3.1. Transcriptional expression of immune-related genes in WSSVinfected shrimp Through the WSSV detection approach, shrimp from the diseased pond were determined as WSSV strong positive, while shrimp from the normal pond showed WSSV absence (Fig. 1). Among the 18 immune related genes, expression levels of 6 genes including CH-SPase, HSP70, PEN, PO, PCNA and AGO changed significantly, while the expression of the other 12 genes had no significant changes (data not shown). Of the 6 genes screened from the 18 shrimp immune related genes, 5 genes showed significantly down-regulation, while CH-SPase showed significantly upregulation with expression level being 14.3 greater than in the control group (Fig. 2).
A reduction of CH-SPase mRNA expression was observed using RT-PCR assay at 24 hpi (Fig. 4). While in the RT-qPCR assay, a significant reduction was observed at 5 hpi (0.29 less than the control group) and the expression of CH-SPase reached a minimum at 48 hpi (0.06 less than the control group) (Fig. 5) following the time course. The expression of CH-SPase was not affected by EGFP dsRNA injection in both assays. 3.4. Effects of knockdown of CH-SPase expression on WSSV-infected shrimp Cumulative mortality in the experimental group was significantly lower than in the control group at 12 hpi (P ¼ 0.04), 24 hpi (P ¼ 0.01) and 36 hpi (P ¼ 0.004). After 48 hpi, the cumulative mortality in both groups had no significant difference (Fig. 6.).
3.2. Expression patterns of CH-SPase during WSSV infection in hemocytes of Chinese shrimp The expression levels of CH-SPase were significantly highly upregulated over the time course of the virus infection and reached a maximum at 5 hpi (18.8 greater than the control group) (Fig. 3). Combined with the previous results, we concluded that WSSV
Fig. 1. Detection of WSSV in gill samples of shrimp by PCR. Lane 1: DL 2000 DNA marker; lanes 2e7: shrimp from the diseased pond; lanes 8e13: shrimp from the healthy pond; lane 14: positive control; lane 15: negative control. All the products were electrophoresed on a 1% agarose gel and stained with ethidium bromide.
Fig. 3. Expression profiles of CH-SPase mRNA in hemocytes of F. chinensis at 5, 24, 48 and 72 h post WSSV injection, determined by RT-qPCR. TPI mRNA levels were used as an internal control. Data were presented as mean SD of triplicates. Column bars with asterisks indicated values that were significantly different from those on day 0 (P < 0.05).
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
407
Fig. 4. Time course showed CH-SPase expression in F. chinensis hemocytes after knockdown by dsRNA-mediated RNAi determined by RT-PCR. Injection of enhanced green fluorescent protein-dsRNA (EGFP dsRNA) was used as dsRNA control. TPI was used as an internal control of RT-PCR.
3.5. Suppression of CH-SPase inhibited WSSV replication Compared to the control group, VP28 transcripts in the experimental group were decreased significantly. The transcriptional level of VP28 reached a minimum at 1 dpi (0.01 less than the control group), and subsequently recovered at 2 (0.34 less than the control group) and 3 (0.24 less than the control group) dpi, but still less than the control group (Fig. 7). WSSV copies in gills of the experimental group were less than the control group at 1 dpi (105.67 copies/ml compared to 107.33 copies/ml), while the WSSV copies increased at 2 dpi (107.77 copies/ml compared to 107.41 copies/ml) and decreased again at 3 dpi (107.13 copies/ml compared to 108.39 copies/ml) (Fig. 8). Transcripts of CH-SPase in the experimental group were decreased significantly (0.05, 0.33and 0.34at 1, 2 and 3 dpi respectively) (Fig. 9). 4. Discussion There are nearly 20 different viruses recognized in penaeid shrimp, with only four, including WSSV, yellow head virus (YHV), taura syndrome virus (TSV) and hematopoietic nerosis virus (IHHNV), seeming to stand out as being especially important for their historical, current, and potential future adverse effects on the international shrimp farming industry [28]. Thus before the research, we investigated the epidemic viral pathogens in several
Fig. 5. Expression profiles of CH-SPase mRNA in hemocytes after knock-down by dsRNA determined by RT-qPCR. Injection of EGFP dsRNA was used as dsRNA control. TPI was used as an internal control of RT-qPCR. Data were presented as mean SD of triplicates. Column bars with asterisks indicated values that were significantly different from those on day 0 (P < 0.05).
Fig. 6. Cumulative mortality of F. chinensis infected with CH-SPase dsRNA and WSSV stock suspension. Injection of PBS and WSSV stock suspension was used as control group. Ten shrimp were used for each group. The mortality was recorded each 12 h. The experiment was repeated three times. Significant differences in shrimp mortality are marked with asterisks and the error bars indicated standard deviations.
shrimp farms and found that WSSV was the only viral pathogen in local farms in July 2011 when the study was conducted (data not shown). Four chymotrypsins have been identified in shrimp to date. These include chymotrypsin BⅠ and BⅡ from Litopenaeus vannamei [33,34], a chymotrypsin-like serine protease from F. chinensis [14] and a chymotrypsin-like protease from Marsupenaeus japonicas [35]. Serine proteases of chymotrypsin family participate in a wide range of biological reactions including digestive and degradative processes, blood clotting, humoral and cellular immunity, tissue remodeling, and embryonic development [29]. In addition, chymotrypsins are involved in the immune defense reaction against bacteria in the fruit fly Drosophila melanogaster [36]. Bonnie et al. [30] reported that chymotrypsin enhanced fowlpox virus plaque formation in chick embryo cell cultures. Gifford and Klapper [31,32] demonstrated that the number and size of vaccinia virus plaques were increased in the presence of trypsin or
Fig. 7. Effect of CH-SPase silencing on the variation of VP28 transcripts in hemocytes of F. chinensis at day 1, 2 and 3 post WSSV injections. The quantitative RT-qPCR was performed for WSSV VP28 by using TPI as an internal control, and the data were analyzed by comparative quantization. The experiment had been carried out three times, the data represented means of three replicates, and the error bars indicated standard deviations. Column bars with asterisks indicated values that were significantly different from control group (P < 0.05).
408
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
Among the 18 immune-related genes, there were 12 genes showed no significant changes. Based on these results, we speculated that the 12 genes may just have transient effect on innate antiviral responses. When the virus breaks through the defense system, they are powerless to the WSSV infection. In the presence of CH-SPase dsRNA, the number of WSSV copies was distinctly lower than that in the control group 24 h after WSSV injection, but recovered at certain degree at 48 and 72 h post WSSV injection. The recovery of WSSV copies mainly because the inducing of the expression of CH-SPase by WSSV. This study screened 6 genes from Chinese shrimp which severely infected by WSSV. Functional analysis showed that CHSPase was important to WSSV infection. The down-regulation of CH-SPase may be exploited as a target to prevent WSSV infection in future. Acknowledgments Fig. 8. Log values of WSSV copies in gills of F. chinensis at day 1, 2 and 3 post WSSV injections when CH-SPase was silenced by dsRNA. WSSV copies were determined by quantification assay. The experiment had been carried out three times, the data represented means of three replicates, and the error bars indicated standard deviations.
chymotrypsin. These researches indicated that chymotrypsin was likely to participate in the process of virus propagation. However, the mechanisms of chymotrypsins in assisting virus propagation remain unclear. As we know, virus can induce apoptosis to assist their own dissemination, which was also confirmed in shrimp infected with WSSV. Henderson and Stuck [37] reported that apoptosis levels were increased in Penaeus vannamei during WSSV infection. Sahtout et al. [38] also demonstrated that apoptosis was induced in WSSV-infected Penaeus monodon. Furthermore, there is evidence in the literature that chymotrypsin-like serine proteases are activated during apoptosis [39]. Therefore, we speculated that CH-SPase in F. chinensis possibly was an important factor in the apoptosis pathway WSSV induced. Silence of CH-SPase might block or slow down the progress of apoptosis activated by WSSV, thus inhibit or reduce the propagation of WSSV to some extent. The mechanisms of the interaction between CH-SPase and apoptosis induced by WSSV needs further study.
Fig. 9. Time course showed CH-SPase expression in F. chinensis hemocytes when injected with CH-SPase dsRNA and WSSV stock suspension. Injection of PBS was used as control. Data were presented as mean SD of triplicates. Column bars with asterisks indicated values that were significantly different from those on day 0 (P < 0.05).
We want to thank Xu-Yun Geng, Jun-Li Wei and Yi Yang for their assist in collecting of samples. This work was supported by the Grants from the National Basic Research Program of China (2012CB114405) and National Key Technology R&D Program (2012AA10A401 and 2012AA092205). References [1] Wang HC, Leu JH, Kou GH, Wang AH, Lo CF. Protein expression profiling of the shrimp cellular response to white spot syndrome virus infection. Dev Comp Immunol 2007;31:672e86. [2] Yang F, He J, Lin XH, Li Q, Pan D, Zhang X, et al. Complete genome sequence of the shrimp white spot bacilliform virus. J Virol 2001;75:11811e20. [3] Van Hulten MC, Witteveldt J, Peters S, Kloosterboer N, Tarchini R, Fiers M, et al. The white spot syndrome virus DNA genome sequence. Virology 2001; 286:7e22. [4] Lo CF, Kou GH. Shrimp white spot syndrome virus, complete genome; 2001. AF440570 GenBank. [5] Yan Feng, Xia Ding, lv Songya, Qi Yipeng, Xu Hua. Functional analysis of the orf390 gene of the white spot syndrome virus. Virus Res 2010;151:39e44. [6] Tsai Jyh-Ming, Wang Han-Ching, Leu Jiann-Horng, . Wang Andrew H-J, Zhuang Ying, Walker Peter J, et al. Identification of the nucleocapsid, tegument, and envelope proteins of the shrimp white spot syndrome virus virion. J Virol 2006;80:3021e9. [7] Wu Wenlin, Wang Lei, Zhang Xiaobo. Identification of white spot syndrome virus (WSSV) envelope proteins involved in shrimp infection. Virology 2005; 332:578e83. [8] Lin Yi, Xu Limei, Yang Feng. Tetramerization of white spot syndrome virus envelope protein VP33 and its interaction with VP24. Arch Virol 2010;155: 833e8. [9] Kono Tomoya, Savan Ram, Sakai Masahiro, Itami Toshiaki. Detection of white spot syndrome virus in shrimp by loop-mediated isothermal amplification. J Virol Methods 2004;115:59e65. [10] Yoganandhan K, Syed Musthaq S, Narayanan RB, Sahul Hameed AS. Production of polyclonal antiserum against recombinant VP28 protein and its application for the detection of white spot syndrome virus in crustaceans. J Fish Dis 2004;27:517e22. [11] Jiravanichpaisal P, Lee BL, Söderhäll K. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006;211:213e36. [12] Cerenius L, Söderhäll K. The prophenoloxidase-activating system in invertebrates. Immunol Rev 2004;198:116e26. [13] Lee SY, Söderhäll K. Early events in crustacean innate immunity. Fish Shellfish Immunol 2002;12:421e37. [14] Shi XZ, Zhao XF, Wang JX. Molecular cloning and expression analysis of chymotrypsin-like serine protease from the Chinese shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2008;25:589e97. [15] Dechklar M, Udomkit A, Panyim S. Characterization of Argonaute cDNA from Penaeus monodon and implication of its role in RNA interference. Biochem Biophys Res Commun 2008;367:768e74. [16] Liu YC, Li FH, Dong B, Wang B, Luan W, Zhang XJ, et al. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol Immunol 2007;44: 598e607. [17] Dong B, Liu F, Gao H, Wang B, Xiang J. cDNA cloning and gene expression pattern following bacterial challenge of peroxinectin in Chinese shrimp Fenneropenaeus chinensis. Mol Biol Rep 2009;36:2333e9. [18] Wang KC Han-Ching, Tseng Chun-Wei, Lin Han-You, Chen I-Tung, Chen YaHui, Chen Yi-Min, et al. RNAi knock-down of the Litopenaeus vannamei Toll
S. Xue et al. / Fish & Shellfish Immunology 34 (2013) 403e409
[19]
[20]
[21]
[22] [23] [24]
[25]
[26]
[27] [28]
gene (LvToll) significantly increases mortality and reduces bacterial clearance after challenge with Vibrio harveyi. Dev Comp Immunol 2010;34:49e58. Robalino J, Browdy CL, Prior S, Metz A, Parnell P, Gross P, et al. Induction of antiviral immunity by double-stranded RNA in a marine invertebrate. J Virol 2004;78:10442e8. Robalino J, Bartlett T, Shepard E, Prior S, Jaramillo G, Scura E, et al. Doublestranded RNA induces sequence-specific antiviral silencing in addition to nonspecific immunity in a marine shrimp: convergence of RNA interference and innate immunity in the invertebrate antiviral response? J Virol 2005;79: 13561e71. Westenberg M, Heinhuis B, Zuidema D, Vlak JM. siRNA injection induces sequence-independent protection in Penaeus monodon against white spot syndrome virus. Virus Res 2005;114:133e9. Klasse PJ, Bron R, Marsh M. Mechanisms of enveloped virus entry into animal cells. Adv Drug Deliv Rev 1998;34:65e91. Kawai T, Akira S. Innate immune recognition of viral infection. Nat Immunol 2006;7:131e7. Chai YM, Yu SS, Zhao XF, Zhu Q, Wang JX. Comparative proteomic profiles of the hepatopancreas in Fenneropenaeus chinensis response to white spot syndrome virus. Fish Shellfish Immunol 2010;29:480e6. Yeh SP, Chen YN, Hsien SL, Cheng W, Liu CH. Immune response of white shrimp, Litopenaeus vannamei, after a concurrent infection with white spot syndrome virus and infectious hypodermal and hematopoietic necrosis virus. Fish Shellfish Immunol 2009;26:582e8. Xie Y, Wang B, Li F, Jiang H, Xiang J. Molecular cloning and characterization of proliferating cell nuclear antigen (PCNA) from Chinese shrimp Fenneropenaeus chinensis. Comp Biochem Physiol B Biochem Mol Biol 2008;151:225e9. Office International Des Epizooties. Diagnostic manual for aquatic animal diseases[M]. 3rd ed. Paris: OIE; 2000. p. 220e9. Lightner DV. The penaeid shrimp viruses TSV, IHHNV, WSSV, and YHV: current status in the Americas, available diagnostic methods, and management strategies. J Appl Aquacult 1999;9:27e52.
409
[29] Maxwell MK, Enrico DC. Evolution of enzyme cascades from embryonic development to blood coagulation. Trends Biochem Sci 2002;27(2):67e74. [30] Asch Bonnie B, Gifford George E. Accelerated plaque formation by fowlpox virus in the presence of chymotrypsin. J Appl Microbiol 1969;18:897e900. [31] Gifford GE, Klapper DG. Enhancement of vaccinia virus plaque formation by trypsin. Proc Soc Exp.Biol Med 1967;126:515e7. [32] Gifford GE, Klapper DG. Effect of proteolytic enzymes on vaccinia virus replication. Arch Gesamte Virusforsch 1969;26:321e33. [33] Sellos D, Van Wormhoudt A. Molecular cloning of a cDNA that encodes a serine protease with chymotrypic and collagenolytic activities in the hepatopancreas of the shrimp Penaeus vanameii (Crustacea, Decapoda). FEBS Lett 1992;309:219e24. [34] Sellos D, Van Wormhoudt A. Polymorphism and evolution of collagenolytic serine protease genes in crustaceans. Biochim Biophys Acta 1999;1432:419e24. [35] Danwattananusorn Threechada, Kondo Hidehiro, Aoki Takashi, Hirono Ikuo. Molecular cloning, characterization and expression analysis of a chymotrypsin-like serine protease from kuruma shrimp Marsupenaeus japonicas. Fish Sci 2009:1231e8. [36] de Morais Guedes S, Vitorino R, Domingues R, Tomer K, Correia AJ, Amado F. Proteomics of immune-challenged Drosophila melanogaster larvae hemolymph. Biochem Biophys Res Commun 2005;328:106e15. [37] Henderson T, Stuck K. Induction of apoptosis in response to white spot syndrome virus in the pacific white shrimp, Penaeus vannamei. In: Anon, editor. Book of abstracts, aquaculture America 1999, Tampa, Florida. Baton Rouge, LA: World Aquaculture Society; 1999. Abstract #67. [38] Sahtout AH, Hassan MD, Shariff M. DNA fragmentation, an indicator of apoptosis, in cultured black tiger shrimp Penaeus monodon infected with white spot syndrome virus (WSSV). Dis Aqust Org 2001;44:155e9. [39] Grabarek J, Dragan M, Lee BW, Johnson GL, Darzynkiewicz Z. Activation of chymotrypsin-like serine protease(s) during apoptosis detected by affinitylabeling of the enzymatic center with fluoresceinated inhibitor. Int J Oncol 2002;20:225e33.