Blocking the large extracellular loop (LEL) domain of FcTetraspanin-3 could inhibit the infection of white spot syndrome virus (WSSV) in Chinese shrimp, Fenneropenaeus chinensis

Fish & Shellfish Immunology 32 (2012) 1008e1015

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Blocking the large extracellular loop (LEL) domain of FcTetraspanin-3 could inhibit the infection of white spot syndrome virus (WSSV) in Chinese shrimp, Fenneropenaeus chinensis Lang Gui a, b, Bing Wang a, Fu-Hua Li a, Yu-Miao Sun a, b, Zhan Luo a, b, Jian-Hai Xiang a, * a b

Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, PR China Graduate University of Chinese Academy of Sciences, Beijing100049, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 17 October 2011 Received in revised form 18 February 2012 Accepted 19 February 2012 Available online 2 March 2012

Tetraspanins belong to the transmembrane 4 superfamily (TM4SF), which span the cell membrane 4 times and act as bridges or connectors. Increasing evidences have shown that tetraspanins play important role in virus infection. The large extracellular loop (LEL) of a tetraspanin is considered as a possible target of some virus. Tetraspanins are widely found in invertebrates, but the functional roles of most invertebrate tetraspanins have remained unknown. Recently, a tetraspanin, called FcTetraspanin-3, was cloned from the cDNA library of Chinese shrimp, Fenneropenaeus chinensis. The FcTetraspanin-3 constitutive expression in all examined tissues and the expression of the gene were highly induced in hepatopancreas, lymphoid organ and intestine by white spot syndrome virus (WSSV) challenge. In this study, we expressed and purified the recombinant peptide containing the LEL domain of FcTetraspanin-3, and produced the anti-LEL polyclone antibody. The expression of FcTetraspanin-3 was observed by realtime PCR and Western blot. Also, the localization of FcTetraspanin-3-positive cells in intestine and hepatopancreas were revealed by immunofluorescence. The results of anti-LEL antibody blocking experiments shown that the antibody can significantly reduce the mortality of shrimp challenged by WSSV. Additionally, dsRNA interference was utilized to examine the functional role of FcTetraspanin-3 in response to WSSV infection, and a sensible decrease of the viral copy number in the tetraspanin knockdown shrimp. These results suggested the blocking of LEL domain of FcTetraspanin-3 could inhibit the infection of WSSV. FcTetraspanin-3 might play an important role in response to WSSV infection, and the LEL domain of FcTetraspanin-3 might mediate the entry of WSSV. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Fenneropenaeus chinensis Tetraspanin WSSV Antibody blocking assay RNAi

1. Introduction Tetraspanins belong to the transmembrane 4 superfamily (TM4SF), a large family of evolutionarily conserved cell-surface proteins that include at least 33 members in mammals [1]. They are widely distributed in many cell types of eukaryotic organisms [2]. As transmembrane proteins, tetraspanins can act as a bridge to connect the proteins outside or inside the cell membrane. A tetraspanins web is formed by the tetraspaninseproteins complex, and the web is believed to involve in fundamental functions of immunity system, and consequently, signaling between cells and inside cells, regulating cell activation and adhesion, participating in recognition and infection of some viruses [2e4].

* Corresponding author. Tel.: þ86 532 82898568; fax: þ86 532 82898578. E-mail addresses: [email protected], [email protected] (J.-H. Xiang). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2012.02.022

The common structure of tetraspanin protein consists of four transmembrane (TM) domains, a small extracellular loop (SEL) and a large extracellular loop (LEL) [5]. The four highly conserved cysteine residues maintained in LEL can form a mushroom-like shape [6], which defines an important structure in their specific functions [7,8]. At least 20 tetraspanin proteins express on the surface of leukocytes in human, which belong to CD molecules, and are highlighted by the important functions observed in the immune system [9]. Specific tetraspanin family members are selectively associated with specific viruses and affect multiple stages of infection, including initial cellular attachment to syncytium formation and viral particle release [7]. CD9 is considered to be involved in feline immunodeficiency virus (FIV), canine distemper virus and human immunodeficiency virus-1 (HIV-1) infections [10e12]. The antibody of CD9 could inhibit FIV [13]. CD9 and CD81 can modulate HIV-1-induced membrane fusion [14], and the specific antibody which recognized the LEL of CD9 could suppress

L. Gui et al. / Fish & Shellfish Immunology 32 (2012) 1008e1015

the release of HIV-1 [15]. CD81 is the receptor protein identified by hepatitis C virus (HCV) [6,16,17]. LEL blocking by antibody could prevent the invasion of HCV, the LEL of CD81 was proved to interact specifically with HCV [17]. CD63 relates to the entrance and egress of HIV-1 [18]. HIV-1 infection can be inhibited by antibodies which bind to the LEL of CD63 [19]. CD82 participates in the infection of human T-cell leukemia/lymphoma virus type 1 (HTLV-1) [7,20,21]. Research confirms that the association of HTLV-1 with tetraspaninenriched microdomain is mediated by the inner loop of CD82 [22]. CD151 could cooperate in porcine reproductive and respiratory syndrome virus (PRRSV) infection, and antibody treatment of CD151 completely blocked PRRSV infection [23]. There were compelling evidences proved by using antibody that tetraspanins and especially the extracellular structure of LEL play key role in the route of pathogens infection. Our previous study cloned and identified the full length cDNA of one tetraspanin (FcTetraspanin-3) from Chinese shrimp Fenneropenaeus chinensis, and observed that it was markedly up-regulated in the live WSSV-challenged shrimp tissues [24]. In order to understand the function of FcTetraspanin-3 during the WSSV infection, the LEL motif sequence of FcTetraspanin-3 was cloned into pGEX-4T-1 vector and the recombinant peptide was expressed in Escherichia coli BL21 (DE3). Subsequently, the anti-LEL polyclone antibody was prepared and used to analyze the expression profiles in different tissues and to perform antibody blocking experiments for WSSV infection. Additionally, dsRNA interference was utilized to examine the functional role of FcTetraspanin-3 in response of WSSV infection. 2. Materials and methods 2.1. Experimental animals and virus Chinese shrimp F. chinensis with a body length of 6.5 cm  1 cm (weighing 4e5 g) were fed with clam meat at our lab. Before doing experiments, the shrimp were tested by a WSSV-specific PCR reaction as described previously [25], and only WSSV-free shrimp were used for the experiments. WSSV virus was originally isolated from the infected F. chinensis. Intact WSSV virions were purified as described previously [25]. The purified WSSV used for infection experiments was calculated to be 6  105 copies/ml in the viral genomic copies by quantitative realtime PCR. 2.2. Expression and isolation of recombinant peptide FcTetraspanin-3 (EF032649) contains a 720 bp open reading frame (ORF), which encodes 239 amino acids [24]. The position of LEL motif in FcTetraspanin-3 is from 104 to 205, containing 101 amino acids, and the molecular weight (MW) of LEL is about 11 kDa. Based on the LEL motif nucleotide sequence, a pair of primers, LEL-f and LEL-r (shown in Table 1) were designed by Primer Premier 5.0 program. The few sequences located on the both sides of LEL motif were either cloned by the primers. Restriction enzyme cutting site sequence of BamHⅠ and SalⅠ were introduced separately to the 50 end of LEL-f and LEL-r, and obtained LEL-F and LEL-R (shown in Table 1). PCR was performed using the previously cloned shrimp cDNA [24] and primers LEL-F and LEL-R, under the following conditions: one cycle of 94  C for 5 min; 35 cycles including denaturation at 94  C for 30 s, annealing at 58  C for 30 s and extension at 72  C for 30 s; followed by one cycle of 72  C for 10 min. Then the amplified fragment was ligated into pMD-19T vector (Invitrogen). The positive transformant pMD-LEL was amplified and gel-purified. Plasmid pMD-LEL was restriction double digested and the gene portion of LEL was ligated into the

1009

Table 1 The primers list. Primer

Sequences (50 e30 )

NCBI accession number

Annealing temperature ( C)

LEL-F

CGAGGATCCGCCATC CTTATCTTCGTCTA CGAGTCGACCTAAGCA ACCACAACATTCTG GCCATCCTTATCTTCGTCTA CTAAGCAACCACAACATTCTG CAGTGCTTCAGCCGCTACCC AGTTCACCTTGATGCCGTTCTT ATGGATCTTTCTTTCACTCTTTC GGTCTCAGTGCCAG TATACGCTAGTGGAGCTGGAA GGGGAGGTAGTGACGAAAAAT

EF032649.1

58

LEL-R LEL-f LEL-r EGFP-f EGFP-r vp28-f vp28-r 18s rRNA-f 18s rRNA-r

55 EU716633.1

58

EU414753.1

55

AY438005.1

58

pGEX-4T-1 vector (Invitrogen) at the BamHⅠ and SalⅠ sites. LEL sequence was expressed in E. coli BL21 (DE3) by induction with 1 mM IPTG (Promega). Cells were harvested by centrifugation 10000 rpm for 5 min and resuspended in phosphate-buffered saline (PBS, pH 7.4: 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 2 mM KH2PO4), with Triton X-100 added to a final concentration of 1%. The cell suspension was disrupted by sonication in 400 w for 30 min. The cell lysate was centrifuged at 12,000 rpm for 20 min at 4  C to collect the inclusion bodies, which were then solubilized in denaturing solution (0.1 M PBS, pH 7.4, 8 M Urea, and 10 mM DTT), Under the condition of 4  C, the denaturing proteins were dialyzed against renaturing solution (0.1 M PBS, pH 7.4, 4 M Urea, and 10 mM DTT) for 24 h, and then dialyzed against 0.1 M PBS, pH 7.4 for 24 h. The vacuum filter was performed through a 0.45 mm nitrocellulose membrane. The recombinant GST-LEL peptide was purified using glutathione-agarose column (GSTrap HP 1 ml, GE Healthcare) according to the recommended protocol (GE). A denaturing SDS-12%(w/v) PAGE gel was used to analyze all the samples, and the band at 38 KDa (presumed to be GST-LEL) stained strongly by Coomassie Blue was excised from the gel and confirmed by Mass Spectrometry after tryptic digest using the reported method [26]. 2.3. Antiserum preparation Antiserum against the recombinant LEL peptide was made separately by immunizing white rabbit according to the reported method [27,28]. And, the anti-LEL antibody was purified with protein A-Agarose Kit (Beyotime, Shanghai, China) as described [29], and quantified by Bradford Method according to the Kit (Sangon, Shanghai, China). Final concentration of the purified antiLEL was 2 mg/ml and stored at 80  C. 2.4. Western blot detection and immunofluorescence localization To analyses the expression level of FcTetraspanin-3 in shrimp tissues, nine different shrimp tissues, including stomach, epidermis, heart, ventral nerve cord, hemocyte, gill, intestine, lymphoid organ and hepatopancreas were collected from 9 untreated individuals and each tissue from three individuals was pooled together and grinded in liquid nitrogen. Tissue debris was lysed by Ripa lysis buffer (Solarbio, Beijing, China), and about 50 mg extracted proteins were separated by SDS-PAGE using a 12% acrylamide tris/tricine gel. Proteins were then electro-transferred onto 0.45 mm PVDF membranes (Millipore) in an electrophoretic transfer (Bio-Rad) using a 50-mM TriseHCl buffer, pH8.0 with constant voltage at 100 V for 60 min. Following blocked with 5%BSA and 0.1%Tween20 (v/v) in PBS at 4  C overnight, the membrane was

1010

L. Gui et al. / Fish & Shellfish Immunology 32 (2012) 1008e1015

divided into two parts from 35 kDa by the protein mark. The membrane with high molecular weight protein was incubated with a 1:200 diluted rabbit polyclonal anti-b-actin antibody (ZSGBBIO,Beijing,China) for 1 h at room temperature. Besides, the membrane with low molecular weight proteins was incubated with a 1:250 diluted rabbit polyclonal anti-LEL antibody for 1 h at room temperature. Passing trough three washes of PBS with 0.1% Tween for 10 min, each at room temperature, the two membranes were incubated in a 1:5000 diluted secondary goat anti-rabbit IgG conjugated with horseradish peroxidase antibody (ZSGB-BIO, Beijing, China) for 1 h at room temperature. Protein bands were visualized by DAB detection method following the instructions of manufacturer (ZSGB-BIO, Beijing, China). Western blots were quantified using the ImageJ 1.44 software, with b-actin providing normalization. Immunofluorescence localization was performed as described previously [30] using the anti-LEL. Briefly, the fresh tissues of intestine and hepatopancreas from three pathogen-free Chinese shrimp were cut into 5 mm3 small pieces and fixed in 4% paraformalclehyde (sigma) at 4  C for 1 h, and then dehydrated in 30% sucrose solution for 2 days until felled down to the bottom. The tissue pieces were embedded in agent OTC (Leica) and frozen in liquid nitrogen and stored at 80  C. Frozen sections (7e8 mm) were made by freezing microtome (Microm, HM505E) and dried at 37  C for 1 h, washed with ddH2O and equilibrium with PBS for 10 min, following blocked with goat serum at 4  C overnight. Sections were washed by PBS three times for 10 min and incubated for 1 h at 37  C with 1:50 diluted rabbit polyclonal anti-LEL antibody in PBS, washed 3 times with PBS for 10 min, and mounted with a 1:50 diluted solution containing fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit antibody (ZSGB-BIO, Beijing, China) for 1 h at 37  C. Tissue sections were washed by ddH2O and analyzed by fluorescence microscopy (Leica). The rabbit polyclonal antibody against GST (anti-GST) (ZSGB-BIO, Beijing, China) was 1:50 diluted as control of the first antibody, and the following steps were carried out the same as described before. 2.5. Anti-LEL antibody blocking and WSSV challenge One hundred and twenty specific pathogen-free shrimp were divided into four groups with four different treatments. Each treatment was performed with three replicates of ten shrimp. Each replicate of shrimp was placed in a plastic bucket provided with adequate aeration at 25  C. Shrimp were injected intramuscularly with 5 ml of 2 mg anti-LEL (treatment 1) or 5 ml of 2 mg anti-GST (treatment 2) or PBS (treatment 3 and 4). At 48 h of postinjection, shrimp were injected with 5 ml PBS containing 106 copy of WSSV virions (treatments 1, 2 and 3) or PBS as negative control (treatment 4). Ultimate survival rates were calculated and compared statistically by SPSS software 16.0. Individuals that died in these days were examined by PCR. 2.6. dsRNA preparation Double-stranded RNAs (dsRNA) were generated by transcription in vitro as described previously [31]. For dsLEL, a 345 bp sequence of tetraspanin was amplified with primers LEL-f and LEL-r (shown in Table 1) from the template of Fenneropenaeus chinensis cDNA. Subsequently, the fragment was ligased into pGEM-T easy vector (Invitrogen) and transformed TOP 10 competent cells, according to the protocol of manufacturer. Plasmid pGEM-LEL was purified and linearized with either BamHⅠ or SalⅠ restriction enzymes. Plasmid pGEM-EGFP was constructed using a 289 bp enhanced green fluorescence protein (EGFP) gene (EU716633.1) fragment from pEGFPN1 plasmid (Invitrogen) amplified with EGFP-f and EGFP-r primers

(Table 1). Nucleotide sequences of the recombinant plasmids were confirmed by automated DNA sequencing. Single-stranded RNA (ssRNA) was transcribed using Sp6 or T7 RNA polymerases (Invitrogen), following instructions from manufacturer. Each batch of ssRNA was quantified at 260 nm and equal amounts of sense and antisense transcripts were mixed and annealed by incubations at 95  C for 5 min, and at room temperature overnight. In the mixture, the DNA templates were degraded by the addition of DNase 1 by incubations at 37  C for 15 min, and remaining transcripts of ssRNA was hydrolyzed by RNase A by incubations at 37  C for 30 min. The dsRNA was purified using phenol:chloroform:isoamylalcohol (25:24:1) extraction and subsequent ethanol precipitation. The formation of dsRNA was monitored by mobility shift in 1% agarose gel electrophoresis. The dsRNA was diluted to a working concentration of 1.2 mg/ml in PBS and stored at 80  C. 2.7. dsRNA interference and WSSV infection To test the efficiency of dsRNA interference, 36 healthy shrimp were divided into 3 groups, with 12 shrimp each. Each group of shrimp was placed in a plastic bucket provided with adequate aeration at 25  C. The groups were labeled as i) PBS, ii) dsLEL, iii) dsEGFP. 5 ml of 6 mg dsLEL, 6 mg dsEGFP and PBS were respectively injected intramuscularly to shrimp. The injection was done using a 50 mL syringe with 22 s gauge needle. 4 shrimp of each group were collected at 48 h, 72 h and 96 h past injection. Cephalothorax of each shrimp was cut longitudinally into two equal pieces and stored separately at 80  C to determine the level of knockdown of both FcTetraspanin-3 in transcript level by real-time PCR, as well as in translation level by Western blot. After the gene silence was demonstrated, other 20 specific pathogen-free shrimp were divided into four groups with four different treatments. They were respectively injected intramuscularly with 5 ml of 6 mg dsLEL (treatment 1) or 5 ml of 6 mg dsEGFP (treatment 2) or PBS (treatment 3 and 4). At 48 h of post-injection, the shrimp were respectively injected with 5 ml PBS containing 106 copy of WSSV virions (treatment 1e3) or alone PBS as negative control (treatment 4). Animals were kept in culture tanks for 2 days after virus injections, and gill tissue of each shrimp was collected and used for following analysis by quantitative real-time PCR. 2.8. Real-time PCR and quantitative real-time PCR Expression of FcTetraspanin-3 mRNA was assessed by quantitative real-time assay method using Mastercycler ep realplex (Eppendorf, Germany) and the fluorescent dye SYBR Green (EvagreenÔ, Biotium). The 18S rRNA gene of F. chinensis (AY438005.1) was quantified as a stably-expressed reference gene using forward primer 18s-f and reverse primer 18s-r. The expression of target gene FcTetraspanin-3 was detected using forward primer LEL-f and reverse primer LEL-r (Table 1), and the cDNA templates from shrimp were synthesized as described previously [25]. The expected fragments of FcTetraspanin-3 and 18S rRNA were 345 bp and 147 bp in length, respectively. The real-time PCR for 18S rRNA was carried out according to the program of 35 cycles of 95  C for 15 s, 55  C for 20 s followed by an extension of 72  C for 20 s. The PCR conditions for FcTetraspanin-3 gene was 35 cycles of 95  C for 20 s, 55  C for 20 s followed by an extension of 72  C for 20 s. All reactions were run in triplicates and NTC (no template controls) were included for each primer set. The data were stated as the relative fold change of the expression of 18S rRNA as described [32]. Quantitative real-time PCR was performed to determine the WSSV viral loads in WSSV-infected shrimp. Shrimp DNA was extracted from 50 mg gill tissue that collected at 2 days post infection by using the QIAamp DNA tissue kit (Qiangen) according

L. Gui et al. / Fish & Shellfish Immunology 32 (2012) 1008e1015

to the manufacturer’s instructions, and resuspended in 50 ml of DNaseeRNaseeproteinase-free water. The primers vp28-f and vp28-r (Table 1) were used to amplify a 612 bp fragment from the vp28 gene of WSSV (EU414753.1). Then vp28 fragment was purified from PCR product and cloned into pMD-19T vector (pMD-vp28). A standard curve was obtained using serial dilutions of plasmid pMDvp28 and was used to quantify the WSSV viral genomic copy number. The quantitative real-time PCR parameters consisted of 35 cycles of denaturation at 94  C for 30 s, annealing at 55  C for 30 s, and extension at 72  C for 30 s. The geometric mean of viral genomic copies per reaction was calculated for each group. Each assay was carried out in triplicates. The data obtained from real-time PCR and quantitative realtime PCR analysis were analyzed using the comparative CT method according to the user manual of ABI PRISM 7700 Sequence Detection System and then subjected to one-way analysis of variance (one-way ANOVA) using SPSS software 16.0. The P values less than 0.05 were considered statistically significant. 3. Results 3.1. Recombinant expression The LEL specific primers (LEL-F and LEL-R) were used to amplify the LEL of FcTetraspanin-3 for ligation into the recombinant expression vector pGEX-4T-1. The ORF encode GST-LEL precursor of 340 amino acids with a calculated MW about 38.9 kDa. Recombinant expression the LEL of FcTetraspanin-3 using an E. coli system was successful for recombinant sequence GST-LEL with a yield of 6e7 mg/ml of culture (Fig. 1A). A w39 kDa protein was purified and confirmed as GST-LEL after peptide fingerprinting by mass spectrometry (date not shown). Analysis of the cell lysate, soluble and insoluble fractions (inclusion body) by SDS-PAGE resolution and Western blot showed that a major protein with the expected size

1011

(w39 kDa) was principally located in the inclusion bodies. The inclusion bodies and purified GST-LEL protein were identified at 39 kDa by western immunoblotting using rabbit polyclonal antiLEL antibody (Fig. 1B). 3.2. Constitutive and differential expression of FcTetraspanin-3 in healthy shrimp Following primer synthesis and the anti-LEL antibody preparation, the expression patterns of FcTetraspanin-3 were analyzed by Western blot at protein levels among different tissues of the healthy Chinese shrimp, such as stomach, epidermis, heart, ventral nerve cord, hemocyte, gill, intestine, lymphoid organ, and hepatopancreas. As shown in Fig. 2. Western blot detects constitutive expression in these tissues, and highly differential expression appears in hepatopancreas, ventral nerve cord and intestine. 3.3. Cellular localization of FcTetraspanin-3 in intestine and hepatopancreas Immunofluorescence localization of FcTetraspanin-3 protein was performed in intestine and hepatopancreas tissues of the healthy Chinese shrimp. As shown in Fig. 3, intensive immunofluorescence signal appears in columnar epithelial cells (CEC) of the intestine bulb, and is mainly localized at the membrane of CEC. Significantly, the FcTetraspanin-3-positive CEC cell layer constitutes the folded fingerlike intestinal villi, whereas the FcTetraspanin-3negative basal lamina (BL) cells rests on the outer layer of connective tissue (CT) and muscle (Fig. 3A). In hepatopancreas, the green fluorescence signal of FcTetraspanin-3 distributes in glandular cells (GC), and the FcTetraspanin-3-positive glandular cells compose numerous tubules, and the tubules are surrounded by a basal lamina separating the glandular cells (GC) from the haemal sinuses (HS) between the tubules. Again, the FcTetraspanin-3 fluorescence signal is mainly localized on the membranes of glandular cells. 3.4. The blocking of LEL domain in FcTetraspanin-3 reduces mortality of WSSV challenge To test the functional role of FcTetraspanin-3 in vivo, the pathogen-free shrimp were injected with the purified anti-LEL

Fig. 1. The expression and purification of the recombinant GST-LEL protein. (A) 12% SDS-PAGE analysis showing E. coli BL21 (DE3) host cells without inducing (lane 1), inductive host cells containing GST-LEL (lane 2), and the purified GST-LEL protein (lane 3). (B) Western blot analysis of the purified GST-LEL protein (lane 1) and inclusion bodies from induced E. coli BL21 (DE3) host cells (lane 2) by anti-LEL antibody. Lane M indicates protein marker.

Fig. 2. Western blot detection of FcTetraspanin-3 expression at protein levels among different tissues of Chinese shrimp. The FcTetraspanin-3 protein levels from different tissues were normalized against the expression of b-actin. Lane 1, stomach; lane 2, epidermis; lane 3, heart; lane 4, ventral nerve cord; lane 5, hemocyte; lane 6, gill; lane 7, intestine; lane 8, lymphoid organ; lane 9, hepatopancreas. The results are based on three independent experiments.

1012

L. Gui et al. / Fish & Shellfish Immunology 32 (2012) 1008e1015

Fig. 3. Immunofluorescence localization of FcTetraspanin-3 in intestine (A and B) and hepatopancreas (C and D). The green fluorescence is stained by the anti-LEL antibody and red fluorescence is autofluorescent background. In A and C, the green fluorescence signal of FcTetraspanin-3 is marked by arrows, and no staining signal is seen in C and D control samples using anti-GST antiserum. Bar length ¼ 50 mm (A) Note folded columnar epithelial cells (CEC), basal lamina (BL), and outer layer of connective tissue and muscle (CT). (C) Note folded tubular lumen (L), glandular cells (GC), and haemal sinuses (HS).

antibody to block LEL domain of FcTetraspanin-3 for two days before WSSV challenges were carried out. In comparison with two control challenge groups including PBS þ WSSV and antiGST þ WSSV, the initial death time was delayed for two days in the anti-LEL þ WSSV blocking group, in which the shrimp started to die at 5 days post infection (dpi), whereas the shrimp in the control challenge groups of PBS þ WSSV and anti-GST þ WSSV began to die at 3 dpi. And, the accumulated mortality was significantly reduced, in which only 34.8% mortality occurred within 20 dpi in the antiLEL þ WSSV blocking group, whereas 100% mortality appeared within 15 dpi in the two control challenge groups (Fig. 4). Moreover, a subtle difference was observed between the two control challenge groups. A higher cumulative mortality appeared from 5 dpi in the anti-GST þ WSSV group than in the PBS þ WSSV, and reached 100% at 12 dpi, whereas 100% mortality emerged until 15 dpi in the PBS þ WSSV group. In the treatment with PBS only, no shrimp died during the period of experiment. PCR detection demonstrated that all dead shrimp were WSSV-positive (data not shown).

expression of FcTetraspanin-3 than that in the control shrimp injected with PBS at 72 h in mRNA level (Fig. 5A) and at 96 h in protein level (Fig. 5B). The data indicated that the knockdown of FcTetraspanin-3 was specific to dsLEL. Subsequently, we investigated the influence of dsRNA interference on WSSV proliferation by two day challenge of WSSV infection in the different group shrimp that were treated for two

3.5. Knockdown of FcTetraspanin-3 inhibits WSSV proliferation Moreover, we observed that intramuscular injection of the 345 bp dsLEL caused significant reduction of FcTetraspanin-3 within the cephalothorax from 48 h to 96 h of post-injection. In comparison with the control shrimp injected with PBS, about 50% suppression of FcTetraspanin-3 mRNA was detected by real-time PCR (Fig. 5A), and almost complete knockdown of FcTetraspanin3 expression was observed at the protein level from 48 h to 96 h of dsLEL post-injection as analyzed by Western blot (Fig. 5B). However, the shrimp injected by non-specific dsEGFP show higher

Fig. 4. Time-mortality relationship of antibody blocking experiments. After the pathogen-free shrimp were injected with the purified anti-LEL antibody, anti-GST or PBS for 2 days, they were respectively challenged with WSSV or PBS buffer (antiLEL þ WSSV, anti-GST þ WSSV, PBS þ WSSV), and one group with only PBS treatment was also performed as a negative control (PBS þ PBS). During 20 days of postchallenge, the dead individuals were collected at every day and the cumulative mortalities were counted and analyzed statistically. All experiments were conducted in triplicate. Statistical analysis was performed by SPSS software 16.0. Asterisks denote significant differences (*P < 0.05, **P < 0.001) compared with the positive control group.

L. Gui et al. / Fish & Shellfish Immunology 32 (2012) 1008e1015

1013

Fig. 6. Viral copy numbers of WSSV calculated by real-time PCR quantification. The DNA samples were respectively extracted from the two day challenged shrimp of dsLEL þ WSSV, dsEGFP þ WSSV, PBS þ WSSV and PBS þ PBS, and assayed by quantitative real-time PCR with the primers vp28-f and vp28-r. All experiments were conducted in triplicate. The averages of WSSV copies in every treatment were shown. Statistical analysis was performed by SPSS software 16.0. No significant differences between dsRNA and PBS treated group.

Fig. 5. Knockdown of FcTetraspanin-3 by dsLEL injection. Shrimp were injected with dsLEL, and dsEGFP was used as a non-specific dsRNA control, PBS as a negative control. Samples were taken at 48 h, 72 h and 96 h post-injection. (A) Real-time PCR analysis of FcTetraspanin-3 in mRNA transcription level. RNAs extracted from cephalothorax were reverse-transcribed to cDNAs to serve as templates and relative expression levels were normalized with 18s rRNA. (B) Western blot analysis of FcTetraspanin-3 in protein level. The FcTetraspanin-3 protein levels from cephalothorax were normalized against the expression of b-actin. The results are based on three independent experiments. Statistical analysis was performed by SPSS software 16.0. Asterisks denote significant differences (*P < 0.05, **P < 0.001) between samples and PBS treated group.

days by dsLEL, dsEGFP, or PBS (Fig. 6). Significantly, in the experiment group (dsLEL þ WSSV), the WSSV copy number was reduced to 106.680.38 WSSV copies mg1 total DNA from 107.270.46 WSSV copies mg1 total DNA in the control group (PBS þ WSSV) (Fig. 6). However, the decrease was not significant (P > 0.05). Moreover, the viral copy number of non-specific dsRNA control group (dsEGFP þ WSSV) was 107.040.63 WSSV copies mg1 total DNA, almost no difference compared with the PBS þ WSSV control. In the treatment with PBS only, shrimp were confirmed to be negative to the WSSV detection. 4. Discussion As a family of conservative transmembrane proteins, tetraspanins also exist widely in invertebrate. At least 37 members of tetraspanins have been found in Drosophila melanogaster genome, 4 in Manduca sexta, 4 in Apis mellifera and 20 in Caemorhabditis [3,33]. Despite their abundance and wide distribution, however, the studies on invertebrate tetraspanins have lagged behind. The purpose of our study was to characterize the spatial distribution of FcTetraspanin-3 and block the expression of FcTetraspanin-3 in vivo to gain further insight into its function in the WSSV infection. The function of tetraspanin was mostly studied in cellular immunity of mammal [34e36]. Up to now, about 66 different proteins of tetraspanin-3 had been identified in different eukaryote species [37], but only 6 were found in invertebrates, including 4 in three species of ants [38], and 2 in flatworm [39]. Human

tetraspanin-3 (hTetraspanin-3) was demonstrated to express at high levels in every examined tissues, including human heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas [40]. Mouse OAP-1 was likely the homolog of hTetraspanin-3, and it also showed widespread tissue expression. Especially, the protein expressed in the central nervous system (CNS) could form a complex with integrin in regulating proliferation, migration and interactions between cells and extracellular matrix [41,42]. The wide expression of FcTetraspanin-3 among multiple tissues was confirmed in protein level detected by Western blot (Fig. 2), which illuminated the FcTetraspanin-3 might be important and constitutive. The transcript level of FcTetraspanin-3 was detected also in all the examined tissues, and high transcription was observed in intestine and ventral nerve cord [24]. However, the relation between mRNA and protein was not strictly linear. That might be explained by the different regulation mechanisms acting on bathe the synthesized mRNA and the synthesized protein, which affected the amount the two molecules differentially [43]. The FcTetraspanin-3 protein level was much higher in hepatopancreas, ventral nerve cord and intestine, which was different from the mRNA distribution. The high expression of FcTetraspanin-3 in ventral nerve cord might indicate its role as regulating proliferation or migration, as described in mouse tetraspanin-3 expressed in CNS [41]. Other tetraspanins, such as CD81, CD9, tetraspanin-7 and tetraspanin-2 are known to be present in CNS [44]. It would be interesting to see the FcTetraspanin-3 function in ventral nerve cord. However, our research was focus on the tissues which related to WSSV infection. Hepatopancreas is the digestive organ in crustaceans that performs functions similar to those of the liver and pancreas in vertebrates, it is crucial in the immune system in penaeid shrimp [45]. The human Tetraspanin-3 could express highly in liver [40], and the three tetraspanins found in shrimp, including FcTetraspanin-3, FcCD63 and FcCD9 were observed in hepatopancreas [24]. It can be concluded that hepatopancreas not only initiates the humoral immune response in shrimp, but also maintains highly specialized phagocytes and cells that function in the cellular immune response [46,47]. It is presumably a primary site for the production of immune response factors after WSSV infection. Further more, tissue of intestine was one of major WSSVinfected organs [48]. The foregut and midgut epithelium was described as primary sites of WSSV replication [49,50]. Location of FcTetraspanin-3 in intestine and hepatopancreas was detected by

1014

L. Gui et al. / Fish & Shellfish Immunology 32 (2012) 1008e1015

immunohistochemistry at our lab (Fig. 3). The results strengthened the above study of the location of tetraspanin in cell membranes. The minute hair-like structures of intestine epithelial cells and glandular cells of hepatopancreas were surrounded intensely by tetraspanin, which implied its microdomains might have functions in cell receptor. WSSV has become the most threatening infectious agent in shrimp aquaculture since it first appeared in 1992 [51]. To reduce the risk of a WSSV outbreak, several control methods have been discovered under experimental conditions. Antibody blocking is one of the efficient approaches: polyclonal antibody against vp28 could neutralize the WSSV and block an infection with the virus [52]; a shrimp integrin were found to interact with WSSV envelope protein vp187, the integrin-specific antibody could block WSSV infection in vivo and in vitro [53]. As the specific and complex mushroom-like structure, LEL of tetraspanin is considered as possible target of some virus. It can be confirmed by the infectivity inhibition of the virus using antibodies against such LEL. A proper dilution of 5 ml of 106 copy of WSSV was determined by injecting shrimp with serial dilutions of virions (date not shown). It was chosen to assess the vaccination efficiency, which was less virulent but could cause 100% mortality at a period of 13e15 days. Once the infection occurred, no notable diversity in mortality was observed between the irrelevant antibody control animals (antiGST þ WSSV) and positive control (PBS þ WSSV), but the mortality of anti-LEL treated animals gradually showed significant difference. Shrimp vaccinated with anti-LEL, a survival rate of 65.2% was obtained at 20 dpv (Fig. 4.). The results also suggested that the infection blockade induced by the anti-LEL remains for a long period of time (from 0 dpi to 20 dpi). Interestingly, the group treated with anti-GST showed higher sensitivity to WSSV infection, the shrimp all died at 12 dpv. The mortality of positive control reached 100% at 15 dpv. This phenomena happened might be explained by the homolog of GST protein exists in shrimp [54]. Although the GST protein used to produce antibody was made from synthetic construct, a large amount of such antibody might probably cause the non-specific binding of shrimp GST, and affect the normal physiological activities in shrimp. This research strongly supported the LEL of FcTetraspanin-3 as a potential target for WSSV entrance. Viral copy numbers of individual shrimp could be observed and compared by quantitative real-time PCR [55]. The amount of viral copy number indicated the state of infection. Therefore, we used the method to study the degree of WSSV infection in the FcTetraspanin-3 knockdown shrimp by RNAi. RNAi-based approach has greater concerned to combat viral disease in shrimp [56]. Some recent evidence suggests that targeting WSSV envelop protein vp28 by RNAi technology should be therapeutically beneficial [57]. And some host immune related genes were also discovered to involve in WSSV infection by RNAi, such as caspase [58], myosin light chain [59], antilipopolysaccharide factor [60] and GTPase protein [61]. Moreover, the function of tetraspanins in human or mammal immunity by RNAi had been studied a lot [62]. To evaluate whether dsLEL were enough to silence the FcTetraspanin-3 in shrimp, we performed three dose of 1 mg, 3 mg and 6 mg per shrimp (date not shown). Shrimp injected with the high does of dsLEL show higher level of reduction of FcTetraspanin-3, and apparently significant at protein level (Fig. 5.). The decrease of the viral copy numbers in the FcTetraspanin-3 depressed shrimp may be possibly due to WSSV particles unable localization to the host cell membrane. However, the decrease was not significant (P > 0.05). This might be explained by the compensatory change of other tetraspanins [63], defects of FcTetraspanin-3 could be rectified or compensated by changes on other tetraspanins in shrimp. Moreover, the period between the WSSV

injection and the samples collection might probably affect the result of WSSV viral number. If it was long, dsRNA might loose the power to silence the gene. If it was short, WSSV might just be in the beginning of replication, and difficult to distinguish the difference of samples. GTPases gene silencing by RNAi caused the change in the number of WSSV copies was not significant [64]. It happened probably because they detected WSSV just 24 h past WSSV injection. Contrast to the significant reduces of WSSV copies at 7 dpi [65], we could assume that the decrease of WSSV copy number in FcTetraspanin-3 knockdown shrimp could be denoted after extending infection time. Further more, our observation that shrimp injection by non-specific dsRNA (EGFP) showed greater effect of FcTetraspanin-3 at 72 h in mRNA level and at 96 h in protein level, and viral copy numbers detected in the dsEGFP injected shrimp were slightly reduced compared with the PBS groups. As the hypothesis described, dsRNA induces both sequence-specific as well as non-specific immunity in shrimp [66]. This should indicate that non-specific dsRNA might affect the immune system of shrimp, and consequently generated the up regulation of FcTetraspanin-3 as well as other innate related antiviral phenomena, which might probably improve shrimp antiviral ability to a certain degree. In summary, our results presented the location of shrimp tetraspanin FcTetraspanin-3 in tissue intestine and hepatopancreas, and demonstrated for the first time that the antibody of FcTetraspanin-3 in shrimp could block WSSV infection. FcTetraspanin-3 gene silencing by RNAi caused the decrease in the number of WSSV copies. These results suggested that FcTetraspanin-3 might play an important role in WSSV infection in vivo, and LEL of FcTetraspanin-3 might mediate the entry of WSSV. However, more research should be done to indicate if FcTetraspanin-3 could interact directly with WSSV or not. Acknowledgments We thank Prof. Wenbin Zhan for help with the immunohistochemistry; T.A. Jose Priya for the help of dsRNA production; Kuijie Yu for the shrimp culture; and other members of our laboratory for help in the research and for insightful discussions. This work was financially supported by grants from the National Natural Science Foundation of China (No.41076101) and Major State Basic Research Development Program of China (973 Programme) 2006CB101804. References [1] Kovalenko OV, Yang XH, Hemler ME. A novel cysteine cross-linking method reveals a direct association between claudin-1 and tetraspanin CD9. Mol Cell Proteomics 2007;6:1855e67. [2] Hemler ME. Tetraspanin proteins mediate cellular penetration, invasion, and fusion events and define a novel type of membrane microdomain. Annu Rev Cell Dev Biol 2003;19:397e422. [3] Todres E, Nardi JB, Robertson HM. The tetraspanin superfamily in insects. Insect Mol Biol 2000;9:581e90. [4] Wright MD, Moseley GW, van Spriel AB. Tetraspanin microdomains in immune cell signalling and malignant disease. Tissue Antigens 2004;64: 533e42. [5] Wright MD, Tomlinson MG. The ins and outs of the transmembrane 4 superfamily. Immunol Today 1994;15:588e94. [6] Kitadokoro K, Bordo D, Galli G, Petracca R, Falugi F, Abrignani S, et al. CD81 extracellular domain 3D structure: insight into the tetraspanin superfamily structural motifs. EMBO J 2001;20:12e8. [7] Martin F, Roth DM, Jans DA, Pouton CW, Partridge LJ, Monk PN, et al. Tetraspanins in viral infections: a fundamental role in viral biology? J Virol 2005; 79:10839e51. [8] Seigneuret M, Delaguillaumie A, Lagaudriere-Gesbert C, Conjeaud H. Structure of the tetraspanin main extracellular domain. A partially conserved fold with a structurally variable domain insertion. J Biol Chem 2001;276:40055e64. [9] Tarrant JM, Robb L, van Spriel AB, Wright MD. Tetraspanins: molecular organisers of the leukocyte surface. Trends Immunol 2003;24:610e7. [10] de Parseval A, Lerner DL, Borrow P, Willett BJ, Elder JH. Blocking of feline immunodeficiency virus infection by a monoclonal antibody to CD9 is via

L. Gui et al. / Fish & Shellfish Immunology 32 (2012) 1008e1015

[11]

[12] [13]

[14]

[15]

[16] [17] [18] [19]

[20]

[21]

[22]

[23] [24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37] [38]

inhibition of virus release rather than interference with receptor binding. J Virol 1997;71:5742e9. Trabado S, Van Binh PN, Martin C, Lafarge-Frayssinet C, Lone YC, Trojan J, et al. Stimulation of anti-melanoma immune effectors via modified tumour cells exhibiting inhibited IGF-I and low CD9. Biomed Pharmacother 2007;61:494e8. Krementsov DN, Weng J, Lambele M, Roy NH, Thali M. Tetraspanins regulate cell-to-cell transmission of HIV-1. Retrovirology 2009;6:64. Willett B, Hosie M, Shaw A, Neil J. Inhibition of feline immunodeficiency virus infection by CD9 antibody operates after virus entry and is independent of virus tropism. J Gen Virol 1997;78(Pt 3):611e8. Gordon-Alonso M, Yanez-Mo M, Barreiro O, Alvarez S, Munoz-Fernandez MA, Valenzuela-Fernandez A, et al. Tetraspanins CD9 and CD81 modulate HIV-1induced membrane fusion. J Immunol 2006;177:5129e37. Singethan K, Schneider-Schaulies J. Tetraspanins: small transmembrane proteins with big impact on membrane microdomain structures. Commun Integr Biol 2008;1:11e3. Lauer GM, Walker BD. Hepatitis C virus infection. N Engl J Med 2001;345: 41e52. Pileri P, Uematsu Y, Campagnoli S, Galli G, Falugi F, Petracca R, et al. Binding of hepatitis C virus to CD81. Science 1998;282:938e41. Marsh M, Theusner K, Pelchen-Matthews A. HIV assembly and budding in macrophages. Biochem Soc Trans 2009;37:185e9. Ho SH, Martin F, Higginbottom A, Partridge LJ, Parthasarathy V, Moseley GW, et al. Recombinant extracellular domains of tetraspanin proteins are potent inhibitors of the infection of macrophages by human immunodeficiency virus type 1. J Virol 2006;80:6487e96. Pique C, Lagaudriere-Gesbert C, Delamarre L, Rosenberg AR, Conjeaud H, Dokhelar MC. Interaction of CD82 tetraspanin proteins with HTLV-1 envelope glycoproteins inhibits cell-to-cell fusion and virus transmission. Virology 2000;276:455e65. Mazurov D, Heidecker G, Derse D. HTLV-1 Gag protein associates with CD82 tetraspanin microdomains at the plasma membrane. Virology 2006;346: 194e204. Mazurov D, Heidecker G, Derse D. The inner loop of tetraspanins CD82 and CD81 mediates interactions with human T cell lymphotrophic virus type 1 Gag protein. J Biol Chem 2007;282:3896e903. Shanmukhappa K, Kim JK, Kapil S. Role of CD151, A tetraspanin, in porcine reproductive and respiratory syndrome virus infection. Virol J 2007;4:62. Wang B, Li F, Xiang J, Gui L, Luo Z, Yan H. Three tetraspanins from Chinese shrimp, Fenneropenaeus chinensis, may play important roles in WSSV infection. J Fish Dis 2010;33:15e29. Wang B, Li F, Dong B, Zhang X, Zhang C, Xiang J. Discovery of the genes in response to white spot syndrome virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray. Mar Biotechnol (NY) 2006;8:491e500. Shevchenko AA, Kost OA. A method of calculation of accessibility to solvent of aromatic amino acid residues of proteins in watereorganic mixtures. Biokhimiia 1996;61:2092e8. Xia W, Zhou L, Yao B, Li CJ, Gui JF. Differential and spermatogenic cell-specific expression of DMRT1 during sex reversal in protogynous hermaphroditic groupers. Mol Cell Endocrinol 2007;263:156e72. Mei J, Zhang QY, Li Z, Lin S, Gui JF. C1q-like inhibits p53-mediated apoptosis and controls normal hematopoiesis during zebrafish embryogenesis. Dev Biol 2008;319:273e84. Sun M, Li Z, Gui JF. Dynamic distribution of spindlin in nucleoli, nucleoplasm and spindle from primary oocytes to mature eggs and its critical function for oocyte-to-embryo transition in gibel carp. J Exp Zool A Ecol Genet Physiol 2010;313:461e73. Peng JX, Xie JL, Zhou L, Hong YH, Gui JF. Evolutionary conservation of Dazl genomic organization and its continuous and dynamic distribution throughout germline development in gynogenetic gibel carp. J Exp Zool B Mol Dev Evol 2009;312:855e71. Robalino J, Browdy CL, Prior S, Metz A, Parnell P, Gross P, et al. Induction of antiviral immunity by double-stranded RNA in a marine invertebrate. J Virol 2004;78:10442e8. Zhu R, Zhang YB, Zhang QY, Gui JF. Functional domains and the antiviral effect of the double-stranded RNA-dependent protein kinase PKR from Paralichthys olivaceus. J Virol 2008;82:6889e901. Fradkin LG, Kamphorst JT, DiAntonio A, Goodman CS, Noordermeer JN. Genomewide analysis of the Drosophila tetraspanins reveals a subset with similar function in the formation of the embryonic synapse. Proc Natl Acad Sci U S A 2002;99:13663e8. Gartlan KH, Belz GT, Tarrant JM, Minigo G, Katsara M, Sheng KC, et al. A complementary role for the tetraspanins CD37 and Tssc6 in cellular immunity. J Immunol 2010;185:3158e66. Suzuki M, Tachibana I, Takeda Y, He P, Minami S, Iwasaki T, et al. Tetraspanin CD9 negatively regulates lipopolysaccharide-induced macrophage activation and lung inflammation. J Immunol 2009;182:6485e93. Cariappa A, Shoham T, Liu H, Levy S, Boucheix C, Pillai S. The CD9 tetraspanin is not required for the development of peripheral B cells or for humoral immunity. J Immunol 2005;175:2925e30. NCBI. Tetraspanin-3, ; 7 Dec. 2012. Bonasio R, Zhang G, Ye C, Mutti NS, Fang X, Qin N, et al. Genomic comparison of the ants Camponotus floridanus and Harpegnathos saltator. Science 2010; 329:1068e71.

1015

[39] The Schistosoma japonicum genome reveals features of hosteparasite interplay. Nature 2009;460:345e51. [40] Todd SC, Doctor VS, Levy S. Sequences and expression of six new members of the tetraspanin/TM4SF family. Biochim Biophys Acta 1998; 1399:101e4. [41] Tiwari-Woodruff SK, Buznikov AG, Vu TQ, Micevych PE, Chen K, Kornblum HI, et al. OSP/claudin-11 forms a complex with a novel member of the tetraspanin super family and beta1 integrin and regulates proliferation and migration of oligodendrocytes. J Cell Biol 2001;153:295e305. [42] Tiwari-Woodruff SK, Kaplan R, Kornblum HI, Bronstein JM. Developmental expression of OAP-1/Tspan-3, a member of the tetraspanin superfamily. J Neurosci Res 2004;77:166e73. [43] Stromberg S, Bjorklund MG, Asplund C, Skollermo A, Persson A, Wester K, et al. A high-throughput strategy for protein profiling in cell microarrays using automated image analysis. Proteomics 2007;7:2142e50. [44] Charrin S, le Naour F, Silvie O, Milhiet PE, Boucheix C, Rubinstein E. Lateral organization of membrane proteins: tetraspanins spin their web. Biochem J 2009;420:133e54. [45] Pan D, He N, Yang Z, Liu H, Xu X. Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization. Dev Comp Immunol 2005;29:103e12. [46] Chai YM, Yu SS, Zhao XF, Zhu Q, Wang JX. Comparative proteomic profiles of the hepatopancreas in Fenneropenaeus chinensis response to white spot syndrome virus. Fish Shellfish Immunol 2010;29:480e6. [47] Ji PF, Yao CL, Wang ZY. Immune response and gene expression in shrimp (Litopenaeus vannamei) hemocytes and hepatopancreas against some pathogen-associated molecular patterns. Fish Shellfish Immunol 2009;27: 563e70. [48] Escobedo-Bonilla CM, Wille M, Sanz VA, Sorgeloos P, Pensaert MB, Nauwynck HJ. Pathogenesis of a Thai strain of white spot syndrome virus (WSSV) in juvenile, specific pathogen-free Litopenaeus vannamei. Dis Aquat Org 2007;74:85e94. [49] Chang PS, Lo CF, Wang YC, Kou GH. Identification of white spot syndrome associated baculovirus (WSBV) target organs in the shrimp Penaeus monodon by in situ hybridization. Dis Aquat Org 1996;27:131e9. [50] Di Leonardo VA, Bonnichon V, Roch P, Parrinello N, Bonami JR. Comparative WSSV infection routes in the shrimp genera Marsupenaeus and Palaemon. J Fish Dis 2005;28:565e9. [51] Escobedo-Bonilla CM, Alday-Sanz V, Wille M, Sorgeloos P, Pensaert MB, Nauwynck HJ. A review on the morphology, molecular characterization, morphogenesis and pathogenesis of white spot syndrome virus. J Fish Dis 2008;31:1e18. [52] Yi G, Wang Z, Qi Y, Yao L, Qian J, Hu L. Vp28 of shrimp white spot syndrome virus is involved in the attachment and penetration into shrimp cells. J Biochem Mol Biol 2004;37:726e34. [53] Li DF, Zhang MC, Yang HJ, Zhu YB, Xu X. Beta-integrin mediates WSSV infection. Virology 2007;368:122e32. [54] Contreras-Vergara CA, Valenzuela-Soto E, Garcia-Orozco KD, SoteloMundo RR, Yepiz-Plascencia G. A Mu-class glutathione S-transferase from gills of the marine shrimp Litopenaeus vannamei: purification and characterization. J Biochem Mol Toxicol 2007;21:62e7. [55] Tang KF, Lightner DV. Detection and quantification of infectious hypodermal and hematopoietic necrosis virus in penaeid shrimp by real-time PCR. Dis Aquat Org 2001;44:79e85. [56] Krishnan P, Gireesh-Babu P, Rajendran KV, Chaudhari A. RNA interferencebased therapeutics for shrimp viral diseases. Dis Aquat Org 2009;86: 263e72. [57] Xu J, Han F, Zhang X. Silencing shrimp white spot syndrome virus (WSSV) genes by siRNA. Antiviral Res 2007;73:126e31. [58] Wang L, Zhi B, Wu W, Zhang X. Requirement for shrimp caspase in apoptosis against virus infection. Dev Comp Immunol 2008;32:706e15. [59] Han F, Wang Z, Wang X. Characterization of myosin light chain in shrimp hemocytic phagocytosis. Fish Shellfish Immunol 2010;29:875e83. [60] Liu H, Jiravanichpaisal P, Soderhall I, Cerenius L, Soderhall K. Antilipopolysaccharide factor interferes with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus. J Virol 2006; 80:10365e71. [61] Ongvarrasopone C, Chanasakulniyom M, Sritunyalucksana K, Panyim S. Suppression of PmRab7 by dsRNA inhibits WSSV or YHV infection in shrimp. Mar Biotechnol (NY) 2008;10:374e81. [62] Hemler ME. Targeting of tetraspanin proteins e potential benefits and strategies. Nat Rev Drug Discov 2008;7:747e58. [63] Huang S, Tian H, Chen Z, Yu T, Xu A. The evolution of vertebrate tetraspanins: gene loss, retention, and massive positive selection after whole genome duplications. BMC Evol Biol 2010;10:306. [64] Wu W, Zong R, Xu J, Zhang X. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicus. J Proteome Res 2008;7: 424e31. [65] Syed Musthaq S, Madhan S, Sahul Hameed AS, Kwang J. Localization of VP28 on the baculovirus envelope and its immunogenicity against white spot syndrome virus in Penaeus monodon. Virology 2009;391:315e24. [66] Robalino J, Bartlett TC, Chapman RW, Gross PS, Browdy CL, Warr GW. Doublestranded RNA and antiviral immunity in marine shrimp: inducible host mechanisms and evidence for the evolution of viral counter-responses. Dev Comp Immunol 2007;31:539e47.