- Email: [email protected]
Effect of white spot syndrome virus infection on a Ras gene in the Chinese shrimp Fenneropenaeus chinensis
Aquaculture 516 (2020) 734604
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Effect of white spot syndrome virus infection on a Ras gene in the Chinese shrimp Fenneropenaeus chinensis
T
Xupeng Lia,b, Xianhong Menga,b, Sheng Luana,b, Kun Luoa,b, Baoxiang Caoa, Baolong Chena,b, Jie Konga,b,∗ a Key Laboratory for Sustainable Utilization of Marine Fisheries Resources, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao, 266071, PR China b Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao Pilot National Laboratory for Marine Science and Technology, 1 Wenhai Road, Qingdao, 266300, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Ras Fenneropenaeus chinensis White spot syndrome virus (WSSV) Expression
Ras is a small GTP-binding protein that is involved in the regulation of diverse cellular processes, including cell cycle progression, proliferation, and apoptosis. In the present study, a cDNA encoding Ras protein in Chinese shrimp Fenneropenaeus chinensis (designated FcRas) was cloned. The cDNA of FcRas contained a 564 bp open reading frame (ORF), five conserved regions involved in GTP metabolism, and a CAAX motif. Multiple sequence alignment showed that the C-terminal of Ras was less conserved than the N-terminal. In healthy F. chinensis, the FcRas mRNA level in the hepatopancreas and gill were both significantly (P < 0.05) higher than the level in muscle. Following challenge with white spot syndrome virus (WSSV), the FcRas mRNA level in the muscle was significantly (P < 0.05) upregulated at 48 h post-infection (hpi). In the hepatopancreas, the FcRas mRNA level was significantly downregulated at 12 hpi (P < 0.01) and 24 hpi (P < 0.05). The protein level of FcRas in the hepatopancreas was significantly downregulated at 6, 12, 24, and 48 hpi (P < 0.05). These results suggested that the FcRas expression level was influenced by WSSV infection.
1. Introduction Ras, a small GTP-binding protein, is involved in the regulation of diverse cellular processes including cell proliferation, cell cycle progression, and apoptosis, and is also important in the spread of malignancies (Chang et al., 2003; Bharate et al., 2012). Research on Ras was first reported in 1964, and the nucleotide sequences of v-H-Ras and v-KRas oncogenes were published in 1982 (Malumbres and Barbacid, 2003). The functions of Ras have been researched widely in mammals, particularly in anti-tumor research. To date, three Ras genes in the human genome have been reported, which encode four isoforms of Ras (H-Ras, N-Ras, K-Ras-4a, and K-Ras-4b). The two isoforms of K-Ras can be synthesized by alternative splicing (Lowy and Willumsen, 1993). Ras is an important member of signal transduction pathways. In addition, mutations in Ras can lead to aberrant signaling, which can result in abnormalities (DeClue et al., 1992; Rozenblum et al., 1997; Heidorn et al., 2010). However, there is a paucity of information on the characteristics and functions of Ras in invertebrates, particularly aquatic crustaceans.
The Chinese shrimp Fenneropenaeus chinensis is a traditional aquaculture variety in China. The natural population of F. chinensis is mainly distributed in the Yellow Sea, the Bohai Sea, and the west coast of the Korean peninsula. White spot disease (WSD) affects shrimp aquaculture worldwide, causing tremendous economic losses (Lightner, 1996). White spot syndrome virus (WSSV) is the causative agent of WSD. In shrimps infected with WSSV, death occurs quickly and the mortality rate is almost 100%. WSSV is a double-stranded DNA virus (van Hulten et al., 2001; Yang et al., 2001) able to infect nearly all commercial shrimp species including F. chinensis, Litopenaeus vannamei, Penaeus monodon and Marsupenaeus japonicus (Huang et al., 2002; EscobedoBonilla et al., 2008; Flegel, 2009; Song et al., 2010; Yingvilasprasert et al., 2014; Yao et al., 2015). Because of its considerable impact on shrimp aquaculture, much research has been conducted on the antiWSSV response of shrimp (Tendencia et al., 2011, 2012; Zhu and Zhang, 2011; Lin et al., 2012; Chen et al., 2013). A previous study reported that Rab and Ran, which are two members of the Ras superfamily, were upregulated in WSSV-infected Penaeus japonica; this suggested that Rab and Ran might be involved in the anti-
∗ Corresponding author. Key Laboratory for Sustainable Utilization of Marine Fisheries Resources, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao, 266071, PR China. E-mail address: [email protected] (J. Kong).
https://doi.org/10.1016/j.aquaculture.2019.734604 Received 29 December 2018; Received in revised form 16 October 2019; Accepted 16 October 2019 Available online 20 October 2019 0044-8486/ © 2019 Published by Elsevier B.V.
Aquaculture 516 (2020) 734604
X. Li, et al.
total RNA using the 5′-Full RACE kit (TaKaRa) and the 3′-Full RACE Core Set with PrimerScript™ RTase (TaKaRa) according to the manufacturer's instructions. Total protein was extracted from the hepatopancreas using Precellys® 24 homogenizer (Bertin Technologies, Montigny-leBretonneux, France) in lysis buffer for protein level detection.
virus response in shrimp (Wu et al., 2008). Another study reported that in Vibrio anguillarum-infected Eriocheir sinensis, two Rab genes were upregulated, and Rab has been shown to play an important role in crustacean anti-bacterial activity (Wang et al., 2013). To our knowledge, the role of Ras in host–WSSV interactions in F. chinensis is yet to be reported. The tissues originating from the ectoderm and mesoderm are the primary target tissues of WSSV, while tissues originating from the entoderm are not the main target tissues. In the present study, we show a comparison of the mRNA and protein levels of Ras of F. chinensis (designated FcRas) in the hepatopancreas (entoderm), gill (ectoderm), and muscle (mesoderm).
2.4. Cloning of FcRas The primers used for RACE (5′ Ras out, 5′ Ras in, 3′ Ras out, 3′ Ras in) were designed according to the cDNA sequence of FcRas from the transcriptome sequencing data acquired in a previous study (unpublished), and are listed in Table 1. The PCR reaction mixture and cycling parameters were the same as used in a previous study (Li et al., 2016). The PCR products were purified and subcloned into a vector (pMD® 19-T, TaKaRa). The vector was then transformed into Escherichia coli DH5α competent cells (TaKaRa) according to the manufacturer's instructions. Positive clones were identified using the primers RV-M and M13-47 (Table 1), and the FcRas clone was sequenced.
2. Materials and methods 2.1. Animals In the present study, a new variety of F. chinensis named “Yellow Sea No.2” bred by the genetic breeding center of the Chinese Academy of Fishery Sciences Yellow Sea Fisheries Research Institute was used.
2.5. cDNA and protein analysis
2.2. WSSV challenge experiment
Multiple sequence alignment was performed using the DNAMAN program (Version 6.0.3.40, Lynnon Corporation, St-Louis, PointeClaire, Quebec, Canada) and Ras sequences from other species in the NCBI database. MEGA software (http://www.megasoftware.net) was used to perform phylogenetic relationship analysis using the bootstrap neighbor-joining method. The reliability of each branch was tested by 1000 bootstrap replications. SMART software (http://smart.emblheidelberg.de) was used to identify any protein motifs.
The WSSV suspension was obtained by mincing 1 g of the muscle of WSSV-infected shrimps in 10 mL of PBS, and then centrifuging at 4000 × g for 5 min. The supernatant was passed through a filter membrane. The WSSV content in the suspension was detected by real-time PCR using an ABI 7500 fluorescent quantitative PCR system (Applied Biosystems, Foster City, CA, USA) and Premix ExTaq™ (Probe qPCR) kits (TaKaRa, Dalian, China). The primers (WSSV forward and WSSV reverse) and probe (WSSV probe) used in this study are listed in Table 1. The WSSV suspension was then diluted to a concentration of 1×107 virions/μL. Shrimps were then challenged with WSSV. In the challenge group, the third abdominal segment of the shrimps was injected with 10 μL of WSSV suspension containing 1×108 virions. In the control group, the third abdominal segment of the shrimps was injected with 10 μL of PBS. Three parallel samples of the hepatopancreas, gill, and muscle of F. chinensis at 0, 6, 12, 24, and 48 h post-infection (hpi) were obtained and stored at −80 °C for RNA and protein extraction.
2.6. FcRas expression analysis A real-time RT-PCR assay was performed to detect the FcRas mRNA level in the hepatopancreas, gill, and muscle of healthy and WSSV-infected F. chinensis with a SYBR® Premix Ex Taq™ II kit (TaKaRa). As an internal control, the mRNA level of 18S ribosomal RNA (18S rRNA) of F. chinensis was detected. All experiments were repeated in triplicate. The PCR reaction mixture and cycling parameters were the same as those used in a previous study (Li et al., 2016), and the primers (RQ forward, RQ reverse, 18S rRNA forward, 18S rRNA reverse) are listed in Table 1. An unpaired, two-tailed t-test was used for statistical analysis.
2.3. Preparation of RNA, protein and cDNA synthesis Total RNA was extracted from the hepatopancreas, gill, and muscle using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). For the real-time RT-PCR assay, the first-strand cDNA was synthesized from total RNA using the PrimeScript® RT reagent kit with gDNA Eraser (TaKaRa) according to the manufacturer's instructions. For the rapid amplification of cDNA ends (RACE) assay, the first-strand cDNA was synthesized from
2.7. Prokaryotic expression and antibody preparation Sequences of the FcRas open reading frame (ORF) were artificially synthesized and amplified by a PCR assay using primers ORF forward and ORF reverse (Table 1). The FcRas ORF was cloned into plasmid PET28a using the restriction enzymes BamHⅠ and SacⅠ. The recombinant plasmid was then introduced into E. coli BL21(DE3), and incubated overnight at 37 °C. The bacteria were inoculated at a ratio of 1:100 into fresh media, and incubated at 37 °C with shaking until an OD600 of 0.6 was reached. Then, IPTG was added to the media and further incubated for 3 h at 37 °C. The bacteria were centrifuged at 6000 × g for 10 min and then 40 mL of NTA-0 buffer solution was added. The bacteria were split by ultrasonic waves and centrifuged at 1000 × g for 5 min. An SDS-PAGE assay was performed to analyze the sediment and supernatant, respectively. Inclusion bodies were collected by centrifugation at 12000 × g for 30 min, then washed and solubilized in 4 M urea solution. The FcRas protein was purified by Ni-NTA resin and used to immunize healthy rabbits. An enzyme-linked immunosorbent assay (ELISA) was performed to measure the antibody titer.
Table 1 Primers and probes information. Designation
Sequences
WSSV forward WSSV reverse WSSV probe 5′ Ras out 5′ Ras in 3′ Ras out 3′ Ras in M13-47 RV-M RQ forward RQ reverse 18S rRNA forward 18S rRNA reverse ORF forward ORF reverse
TGGTCCCGTCCTCATCTCAG GCTGCCTTGCCGGAAATTA AGCCATGAAGAATGCCGTCTATCACACA CACTTCCTCTTGCTGTTCCTACTTC GCAGAGGTCTCAATGAAAGGAAT AACGAGTAAAGGACGCAGATGTGGT TTGGTGGGCAACAAATGCGACT CGCCAGGGTTTTCCCAGTCACGAC GAGCGGATAACAATTTCACACAGG TTGGTGGGCAACAAATGCGACT GCAGAGGTCTCAATGAAAGGAAT TATACGCTAGTGGAGCTGGAA GGGGAGGTAGTGACGAAAAAT GCGCGGATCCCATGACGG GCCCGAGCTCCCTAGAACAC
2.8. Western blot The FcRas protein level in the hepatopancreas and muscle of WSSV2
Aquaculture 516 (2020) 734604
X. Li, et al.
infected F. chinensis was detected by western blot analysis. The β-actin protein level in the hepatopancreas and muscle was also detected as a control. The hepatopancreas and muscle of WSSV-infected F. chinensis at 0, 6, 12, 24, and 48 hpi were homogenized on ice in lysis buffer, then the supernatant was collected by centrifugation (10,000 × g, 5 min). An equal volume of loading buffer was added to the supernatant and samples were loaded onto gels for SDS-PAGE. The concentrations of the stacking gel and separating gel were 5% and 15%, respectively. After electrophoresis, the total protein was transferred to a PVDF membrane. The membrane was then washed three times in PBST and blocked with blocking buffer (1% casein). The membrane was incubated with the primary antibody at 37 °C for 1 h and then washed three times with PBST. The membrane was then incubated with the secondary antibody at 37 °C for 1 h. After three more washes with PBST, the membrane was incubated with luminescent reagent (Western Luminescent Detection kit; Vigorous Biotechnology Beijing Co., Ltd., Beijing, China) for film developing. The protein level of FcRas was analyzed using Quantity One software (BioRad, Munich, Germany).
Fig. 2. FcRas mRNA level in tissues of healthy F. chinensis. The bars correspond to standard deviation (SD) of the means. H: hepatopancreas; G: gill; M: muscle. Data without shared letters were significantly different (n = 3, P < 0.05).
clustered into another clade. Furthermore, the FcRas and Ras proteins from M. japonicas and L. vannamei were clustered into a clade (Fig. 1).
3. Results 3.1. FcRas cDNA and protein sequence
3.2. FcRas mRNA level in healthy F. chinensis
The ORF of FcRas (GenBank accession no: KC522602) was 564 bp in length, encoding a protein of 187 amino acid residues. The molecular mass of the predicted FcRas protein was 21.33 kDa. The pI value of the predicted FcRas protein was 7.01. The five conserved regions, which are involved in GTP metabolism, were observed at residues 10 to 17, residues 33 to 35, residues 57 to 60, residues 116 to 119, and residues 144 to 146. The CAAX motif was observed at the carboxyl-terminal (Suppl. Fig. 1). Multiple sequence alignment revealed that FcRas protein shared sequence identity of 74.3%–100.0% with Ras proteins from other species, showing the highest identity with the Ras proteins of M. japonicas (GenBank accession no: AAK14389) at 100.0% and L. vannamei (GenBank accession no: AET71737) at 99.5% identity. The FcRas protein had the lowest identity with K-Ras-4B of Homo sapiens (GenBank accession no: NP_004976) at 75.9%. The CAAX motifs were also identified in the Ras proteins from different species, and the C-terminals of Ras were less conserved than the N-terminals (Suppl. Fig. 2). A phylogenetic tree was constructed that could be divided into vertebrate and invertebrate subclades. The H-Ras proteins from Homo sapiens, Mus musculus and Rattus norvegicus were clustered into one clade and the NRas proteins from H. sapiens, M. musculus and R. norvegicus were
The mRNA level of FcRas in the muscle of F. chinensis was significantly (P < 0.05) lower than the levels in the hepatopancreas and gill. The mRNA level of FcRas in the gill was approximately 0.9-fold the level in the hepatopancreas. The mRNA level of FcRas in the muscle was approximately 0.4-fold the level in the hepatopancreas (Fig. 2). 3.3. Prokaryotic expression Analysis of prokaryotic expression revealed that recombinant FcRas was contained in the inclusion body sediment of bacterial cultures. The molecular mass of recombinant FcRas was approximately 28 kDa (Fig. 3). 3.4. Responses of FcRas to WSSV challenge The FcRas mRNA level was significantly downregulated in the hepatopancreas at 12 hpi (P < 0.01) and 24 hpi (P < 0.05). The FcRas mRNA level was significantly (P < 0.05) upregulated in the muscle at 48 hpi. In the gill, despite obvious upregulation of the transcript, no Fig. 1. Phylogenetic analysis of the deduced amino acid sequences of Ras. Sequences used for construction of the phylogenetic tree are FcRas (GenBank: KC522602), Ras of Litopenaeus vannamei (GenBank: AET71737), Ras of Marsupenaeus japonicas (GenBank: AAK14389), Ras of Aedes aegypti (GenBank: XP_001662234), Ras of Danaus plexippus (GenBank: EHJ75188), Ras of Harpegnathos saltator (GenBank: EFN76426), H-Ras of Homo sapiens (GenBank: CAG47067), N-Ras of Homo sapiens (GenBank: NP_002515), K-Ras-4a of Homo sapiens (GenBank: NP_203524), K-Ras-4b of Homo sapiens (GenBank: NP_004976), H-Ras of Mus musculus (GenBank: NP_032310), N-Ras of Mus musculus (GenBank: CAJ18567), K-Ras of Mus musculus (GenBank: NP_067259), H-Ras of Rattus norvegicus (GenBank: NP_001123913), N-Ras of Rattus norvegicus (GenBank: NP_542944), K-Ras of Rattus norvegicus (GenBank: NP_113703).
3
Aquaculture 516 (2020) 734604
X. Li, et al.
statistically significant difference (P < 0.05) was observed between the challenge and control groups (Fig. 4). The FcRas protein concentration in the hepatopancreas was significantly (P < 0.05) decreased to 0.24-, 0.36-, 0.37-, and 0.40-fold that of the concentration in the control at 6, 12, 24, and 48 hpi, respectively. The FcRas protein concentration in the muscle was not significantly changed post WSSV challenge (Fig. 5). 4. Discussion The findings from this study confirmed that FcRas is a conserved gene. The deduced amino acid sequence of FcRas contained most of the common features of Ras proteins, including the five conserved regions involved in GTP metabolism and the CAAX motif (Suppl. Figs. 1 and 2). Sequence identity was highest between FcRas and homologues in M. japonicas and L. vannamei (100.0% and 99.5%, respectively), and lowest with H. sapiens, a vertebrate species (75.9%). These results were consistent with the taxonomy. The findings also revealed that the sequence of the N-terminal of Ras was more highly conserved than the sequence of the C-terminal (Suppl. Fig. 2), possibly indicating that the N-terminal of Ras may play an important role in signal transduction. The sequence diversity of the C-terminal indicated that this region had evolved rapidly. The results in Fig. 2 showed that the expression level of FcRas in muscle was significantly different (P < 0.05) from the expression level in the hepatopancreas and gill of healthy F. chinensis. The FcRas expression level in the gill was similar to that in the hepatopancreas. Similarly, in F. chinensis, it has been reported that Rap, which is a Ras family GTPase, was highly expressed in the hepatopancreas and gill, and that the Rap gene expression level in the heart and intestine was lower than that in the hepatopancreas and gill (Ren et al., 2012). The FcRas expression profile in WSSV-infected F. chinensis showed that FcRas displays different responses to WSSV infection in the tissues originating from different embryonic blastophyllums. To our knowledge, no previous study has focused on the role of Ras in the response of F. chinensis to WSSV infection. The gill and muscle are the two main target tissues of WSSV (Lo et al., 1997). It is worth noting that post WSSV challenge, the expression levels of FcRas in the gill and muscle were highly similar. The hepatopancreas was previously reported not to be the main target tissue of WSSV (Lo et al., 1997). In this study, the FcRas mRNA expression profile in the hepatopancreas differed considerably from that in the muscle and gill. Although WSSV hardly infects the hepatopancreas, as a tissue that plays an important role in immune function, the gene expression levels in the hepatopancreas were also significantly affected by WSSV infection. We propose that WSSV may suppress the immune function of the hepatopancreas by downregulating the expression of immune-related genes. By contrast, the significant upregulation of FcRas gene expression in the muscle might be the result of hijacking by WSSV for viral replication. This hypothesis needs further investigation. The significant downregulation of the FcRas protein level in the hepatopancreas of WSSV-infected F. chinensis further indicated that the FcRas level was influenced by WSSV infection. Obviously, the FcRas expression level in the hepatopancreas was affected more markedly by WSSV challenge than the level in the muscle and gill. In the muscle, the mRNA level was significantly altered, but no significant change in the protein level was detected. A previous report in F. chinensis showed that post WSSV infection, Rap gene expression was upregulated in hemocytes and the gill at 6 hpi, suggesting that Rap expression was influenced by WSSV infection (Ren et al., 2012). Another study showed that in P. japonicus, the expression level of small GTPases, such as Ranbp, Rho and Rab, were all influenced by WSSV infection (Pan et al., 2005). A previous study in M. japonicas showed that following WSSV infection, ADP ribosylation factors (Arfs), which are also small GTPases, were upregulated in the hepatopancreas (Zhang et al., 2010). Taken together, these results suggest that not only Ras but also other small GTPases could be influenced by the WSSV
Fig. 3. SDS-PAGE and Western-blot analysis of FcRas expressed in Escherichia coli. A: Profile of SDS-PAGE. Lane 1, supernant; Lane 2, sediment. B: Profile of SDS-PAGE. Lane 1, purified FcRas.
Fig. 4. FcRas mRNA level in tissues of WSSV-infected F. chinensis. A: hepatopancreas; B: gill; C: muscle. The bars correspond to standard deviation (SD) of the means. The significant differences (n = 3, P < 0.05) between the challenged group and control group are indicated with one asterisk. The extremely significant differences (n = 3, P < 0.01) between the challenged group and control group are indicated with two asterisks.
4
Aquaculture 516 (2020) 734604
X. Li, et al.
Fig. 5. FcRas protein level in the hepatopancreas and muscle of WSSV-infected F. chinensis. The bars correspond to standard deviation (SD) of the means. The significant differences (n = 3, P < 0.05) between the challenged group and control group are indicated with one asterisk.
infection process. However, the specific function of the small GTPases in the shrimp–WSSV interaction remains to be determined. Whether expression changes are a defense response by the shrimp to WSSV infection, or whether the genes are suppressed by WSSV for viral replication, warrants further investigation.
pathway (Review). Int. J. Oncol. 22, 469–480. Chen, D.D., Meng, X.L., Xu, J.P., Yu, J.Y., Meng, M.X., Wang, J., 2013. PcLT, a novel Ctype lectin from Procambarus clarkii, is involved in the innate defense against Vibrio alginolyticus and WSSV. Dev. Comp. Immunol. 39, 255–264. DeClue, J.E., Papageorge, A.G., Fletcher, J.A., Diehl, S.R., Ratner, N., Vass, W.C., et al., 1992. Abnormal regulation of mammalian p21ras contributes to malignant tumor growth in von Recklinghausen (type 1) neurofibromatosis. Cell 69, 265–273. Escobedo-Bonilla, C.M., Alday-Sanz, V., Wille, M., Sorgeloos, P., Pensaert, M.B., Nauwynck, H.J., 2008. A review on the morphology, molecular characterization, morphogenesis and pathogenesis of white spot syndrome virus. J. Fish Dis. 31, 1–18. Flegel, T.W., 2009. Current status of viral diseases in Asian shrimp aquaculture. Israeli J. Aquacult. – Bamidgeh 61, 229–239. Heidorn, S.J., Milagre, C., Whittaker, S., Nourry, A., Niculescu-Duvas, I., Dhomen, N., et al., 2010. Kinase-dead BRAF and oncogenic RAS cooperate to drive tumor progression through CRAF. Cell 140, 209–221. Huang, C., Zhang, X., Lin, Q., Xu, X., Hu, Z., Hew, C.L., 2002. Proteomic analysis of shrimp white spot syndrome viral proteins and characterization of a novel envelope protein VP466. Mol. Cell. Proteom. 1, 223–231. Li, X., Kong, J., Meng, X., Luo, K., Luan, S., Cao, B., Liu, N., 2016. Isolation and expression analysis of an MAPKK gene from Fenneropenaeus chinensis in response to white spot syndrome virus infection. Fish Shellfish Immunol. 55, 116–122. Lightner, D.V., 1996. A Handbook of Pathology and Diagnostic Procedures for Diseases of Penaeid Shrimp. World Aquaculture Society, Baton Rouge, Louisiana, USA. Lin, S.J., Hsia, H.L., Liu, W.J., Huang, J.Y., Liu, K.F., Chen, W.Y., et al., 2012. Spawning stress triggers WSSV replication in brooders via the activation of shrimp STAT. Dev. Comp. Immunol. 38, 128–135. Lo, C.F., Ho, C.H., Chen, C.H., Liu, K.F., Chiu, Y.L., Yeh, P.Y., et al., 1997. Detection and tissue tropism of white spot syndrome baculovirus (WSBV) in captured brooders of Penaeus monodon with a special emphasis on reproductive organs. Dis. Aquat. Org. 30, 53–72. Lowy, D.R., Willumsen, B.M., 1993. Function and regulation of ras. Annu. Rev. Biochem. 62, 851–891. Malumbres, M., Barbacid, M., 2003. RAS oncogenes: the first 30 years. Nat. Rev. Cancer 3, 459–465. Pan, D., He, N., Yang, Z., Liu, H., Xu, X., 2005. Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization. Dev. Comp. Immunol. 29, 103–112. Ren, Q., Zhou, J., Jia, Y.P., Wang, X.W., Zhao, X.F., Wang, J.X., 2012. Cloning and characterization of Rap GTPase from the Chinese white shrimp Fenneropenaeus chinensis. Dev. Comp. Immunol. 36, 247–252. Rozenblum, E., Schutte, M., Goggins, M., Hahn, S.A., Panzer, S., Zahurak, M., et al., 1997.
Declaration of competing interest The authors have declared that no conflict of interest exist. Acknowledgments This work was financially supported by the National Key R&D Program of China (2018YFD0900303-06); the Joint Fund of the National Natural Science Foundation of China (U1706203); the Central Public-interest Scientific Institution Basal Research Fund, CAFS (2018GH10); the Shandong Provincial Natural Science Foundation (ZR2014CQ001); the National Natural Science Foundation of China (41676148 & 31572616); the Taishan Scholar Program for Seed Industry; and the China Agricultural Research System (CARS-48). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.aquaculture.2019.734604. References Bharate, S.B., Singh, B., Vishwakarma, R.A., 2012. Modulation of k-ras signaling by natural products. Curr. Med. Chem. 19, 2273–2291. Chang, F., Steelman, L.S., Shelton, J.G., Lee, J.T., Navolanic, P.M., Blalock, W.L., et al., 2003. Regulation of cell cycle progression and apoptosis by the Ras/Raf/MEK/ERK
5
Aquaculture 516 (2020) 734604
X. Li, et al.
Eriocheir sinensis. Fish Shellfish Immunol. 35, 1007–1015. Wu, W., Zong, R., Xu, J., Zhang, X., 2008. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicas. J. Proteome Res. 7, 424–431. Yang, F., He, J., Lin, X., Li, Q., Pan, D., Zhang, X., et al., 2001. Complete genome sequence of the shrimp white spot bacilliform virus. J. Virol. 75, 11811–11820. Yao, D., Ruan, L., Xu, X., Shi, H., 2015. Identification of a c-Jun homolog from Litopenaeus vannamei as a downstream substrate of JNK in response to WSSV infection. Dev. Comp. Immunol. 49, 282–289. Yingvilasprasert, W., Supungul, P., Tassanakajon, A., 2014. PmTBC1D20, a Rab GTPaseactivating protein from the black tiger shrimp, Penaeus monodon, is involved in white spot syndrome virus infection. Dev. Comp. Immunol. 42, 302–310. Zhang, M., Ma, J., Lei, K., Xu, X., 2010. Molecular cloning and characterization of a class II ADP ribosylation factor from the shrimp Marsupenaeus japonicas. Fish Shellfish Immunol. 28, 128–133. Zhu, F., Zhang, X., 2011. The antiviral vp28-siRNA expressed in bacteria protects shrimp against white spot syndrome virus (WSSV). Aquaculture 319, 311–314.
Tumor-suppressive pathways in pancreatic carcinoma. Cancer Res. 57, 1731–1734. Song, K.K., Li, D.F., Zhang, M.C., Yang, H.J., Ruan, L.W., Xu, X., 2010. Cloning and characterization of three novel WSSV recognizing lectins from shrimp Marsupenaeus japonicus. Fish Shellfish Immunol. 28, 596–603. Tendencia, E.A., Bosma, R.H., Primavera, J.H., Verreth, J.A.J., 2012. Effect of different mangrove-to-pond area ratios on influent water quality and WSSV occurrence in Penaeus monodon semi-intensive farms using the greenwater culture technique. Aquaculture 362-363 72–39. Tendencia, E.A., Bosma, R.H., Verreth, J.A.J., 2011. White spot syndrome virus (WSSV) risk factors associated with shrimp farming practices in polyculture and monoculture farms in the Philippines. Aquaculture 311, 87–93. van Hulten, M.C.W., Witteveldt, J., Peters, S., Kloosterboer, N., Tarchini, R., Fiers, M., et al., 2001. The white spot syndrome virus DNA genome sequence. Virology 286, 7–22. Wang, L., Li, L., Wang, L., Yang, J., Wang, J., Zhou, Z., et al., 2013. Two Rab GTPases, EsRab-1 and EsRab-3, involved in anti-bacterial response of Chinese mitten crab
6
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Effect of white spot syndrome virus infection on a Ras gene in the Chinese shrimp Fenneropenaeus chinensis
T
Xupeng Lia,b, Xianhong Menga,b, Sheng Luana,b, Kun Luoa,b, Baoxiang Caoa, Baolong Chena,b, Jie Konga,b,∗ a Key Laboratory for Sustainable Utilization of Marine Fisheries Resources, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao, 266071, PR China b Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao Pilot National Laboratory for Marine Science and Technology, 1 Wenhai Road, Qingdao, 266300, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Ras Fenneropenaeus chinensis White spot syndrome virus (WSSV) Expression
Ras is a small GTP-binding protein that is involved in the regulation of diverse cellular processes, including cell cycle progression, proliferation, and apoptosis. In the present study, a cDNA encoding Ras protein in Chinese shrimp Fenneropenaeus chinensis (designated FcRas) was cloned. The cDNA of FcRas contained a 564 bp open reading frame (ORF), five conserved regions involved in GTP metabolism, and a CAAX motif. Multiple sequence alignment showed that the C-terminal of Ras was less conserved than the N-terminal. In healthy F. chinensis, the FcRas mRNA level in the hepatopancreas and gill were both significantly (P < 0.05) higher than the level in muscle. Following challenge with white spot syndrome virus (WSSV), the FcRas mRNA level in the muscle was significantly (P < 0.05) upregulated at 48 h post-infection (hpi). In the hepatopancreas, the FcRas mRNA level was significantly downregulated at 12 hpi (P < 0.01) and 24 hpi (P < 0.05). The protein level of FcRas in the hepatopancreas was significantly downregulated at 6, 12, 24, and 48 hpi (P < 0.05). These results suggested that the FcRas expression level was influenced by WSSV infection.
1. Introduction Ras, a small GTP-binding protein, is involved in the regulation of diverse cellular processes including cell proliferation, cell cycle progression, and apoptosis, and is also important in the spread of malignancies (Chang et al., 2003; Bharate et al., 2012). Research on Ras was first reported in 1964, and the nucleotide sequences of v-H-Ras and v-KRas oncogenes were published in 1982 (Malumbres and Barbacid, 2003). The functions of Ras have been researched widely in mammals, particularly in anti-tumor research. To date, three Ras genes in the human genome have been reported, which encode four isoforms of Ras (H-Ras, N-Ras, K-Ras-4a, and K-Ras-4b). The two isoforms of K-Ras can be synthesized by alternative splicing (Lowy and Willumsen, 1993). Ras is an important member of signal transduction pathways. In addition, mutations in Ras can lead to aberrant signaling, which can result in abnormalities (DeClue et al., 1992; Rozenblum et al., 1997; Heidorn et al., 2010). However, there is a paucity of information on the characteristics and functions of Ras in invertebrates, particularly aquatic crustaceans.
The Chinese shrimp Fenneropenaeus chinensis is a traditional aquaculture variety in China. The natural population of F. chinensis is mainly distributed in the Yellow Sea, the Bohai Sea, and the west coast of the Korean peninsula. White spot disease (WSD) affects shrimp aquaculture worldwide, causing tremendous economic losses (Lightner, 1996). White spot syndrome virus (WSSV) is the causative agent of WSD. In shrimps infected with WSSV, death occurs quickly and the mortality rate is almost 100%. WSSV is a double-stranded DNA virus (van Hulten et al., 2001; Yang et al., 2001) able to infect nearly all commercial shrimp species including F. chinensis, Litopenaeus vannamei, Penaeus monodon and Marsupenaeus japonicus (Huang et al., 2002; EscobedoBonilla et al., 2008; Flegel, 2009; Song et al., 2010; Yingvilasprasert et al., 2014; Yao et al., 2015). Because of its considerable impact on shrimp aquaculture, much research has been conducted on the antiWSSV response of shrimp (Tendencia et al., 2011, 2012; Zhu and Zhang, 2011; Lin et al., 2012; Chen et al., 2013). A previous study reported that Rab and Ran, which are two members of the Ras superfamily, were upregulated in WSSV-infected Penaeus japonica; this suggested that Rab and Ran might be involved in the anti-
∗ Corresponding author. Key Laboratory for Sustainable Utilization of Marine Fisheries Resources, Ministry of Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao, 266071, PR China. E-mail address: [email protected] (J. Kong).
https://doi.org/10.1016/j.aquaculture.2019.734604 Received 29 December 2018; Received in revised form 16 October 2019; Accepted 16 October 2019 Available online 20 October 2019 0044-8486/ © 2019 Published by Elsevier B.V.
Aquaculture 516 (2020) 734604
X. Li, et al.
total RNA using the 5′-Full RACE kit (TaKaRa) and the 3′-Full RACE Core Set with PrimerScript™ RTase (TaKaRa) according to the manufacturer's instructions. Total protein was extracted from the hepatopancreas using Precellys® 24 homogenizer (Bertin Technologies, Montigny-leBretonneux, France) in lysis buffer for protein level detection.
virus response in shrimp (Wu et al., 2008). Another study reported that in Vibrio anguillarum-infected Eriocheir sinensis, two Rab genes were upregulated, and Rab has been shown to play an important role in crustacean anti-bacterial activity (Wang et al., 2013). To our knowledge, the role of Ras in host–WSSV interactions in F. chinensis is yet to be reported. The tissues originating from the ectoderm and mesoderm are the primary target tissues of WSSV, while tissues originating from the entoderm are not the main target tissues. In the present study, we show a comparison of the mRNA and protein levels of Ras of F. chinensis (designated FcRas) in the hepatopancreas (entoderm), gill (ectoderm), and muscle (mesoderm).
2.4. Cloning of FcRas The primers used for RACE (5′ Ras out, 5′ Ras in, 3′ Ras out, 3′ Ras in) were designed according to the cDNA sequence of FcRas from the transcriptome sequencing data acquired in a previous study (unpublished), and are listed in Table 1. The PCR reaction mixture and cycling parameters were the same as used in a previous study (Li et al., 2016). The PCR products were purified and subcloned into a vector (pMD® 19-T, TaKaRa). The vector was then transformed into Escherichia coli DH5α competent cells (TaKaRa) according to the manufacturer's instructions. Positive clones were identified using the primers RV-M and M13-47 (Table 1), and the FcRas clone was sequenced.
2. Materials and methods 2.1. Animals In the present study, a new variety of F. chinensis named “Yellow Sea No.2” bred by the genetic breeding center of the Chinese Academy of Fishery Sciences Yellow Sea Fisheries Research Institute was used.
2.5. cDNA and protein analysis
2.2. WSSV challenge experiment
Multiple sequence alignment was performed using the DNAMAN program (Version 6.0.3.40, Lynnon Corporation, St-Louis, PointeClaire, Quebec, Canada) and Ras sequences from other species in the NCBI database. MEGA software (http://www.megasoftware.net) was used to perform phylogenetic relationship analysis using the bootstrap neighbor-joining method. The reliability of each branch was tested by 1000 bootstrap replications. SMART software (http://smart.emblheidelberg.de) was used to identify any protein motifs.
The WSSV suspension was obtained by mincing 1 g of the muscle of WSSV-infected shrimps in 10 mL of PBS, and then centrifuging at 4000 × g for 5 min. The supernatant was passed through a filter membrane. The WSSV content in the suspension was detected by real-time PCR using an ABI 7500 fluorescent quantitative PCR system (Applied Biosystems, Foster City, CA, USA) and Premix ExTaq™ (Probe qPCR) kits (TaKaRa, Dalian, China). The primers (WSSV forward and WSSV reverse) and probe (WSSV probe) used in this study are listed in Table 1. The WSSV suspension was then diluted to a concentration of 1×107 virions/μL. Shrimps were then challenged with WSSV. In the challenge group, the third abdominal segment of the shrimps was injected with 10 μL of WSSV suspension containing 1×108 virions. In the control group, the third abdominal segment of the shrimps was injected with 10 μL of PBS. Three parallel samples of the hepatopancreas, gill, and muscle of F. chinensis at 0, 6, 12, 24, and 48 h post-infection (hpi) were obtained and stored at −80 °C for RNA and protein extraction.
2.6. FcRas expression analysis A real-time RT-PCR assay was performed to detect the FcRas mRNA level in the hepatopancreas, gill, and muscle of healthy and WSSV-infected F. chinensis with a SYBR® Premix Ex Taq™ II kit (TaKaRa). As an internal control, the mRNA level of 18S ribosomal RNA (18S rRNA) of F. chinensis was detected. All experiments were repeated in triplicate. The PCR reaction mixture and cycling parameters were the same as those used in a previous study (Li et al., 2016), and the primers (RQ forward, RQ reverse, 18S rRNA forward, 18S rRNA reverse) are listed in Table 1. An unpaired, two-tailed t-test was used for statistical analysis.
2.3. Preparation of RNA, protein and cDNA synthesis Total RNA was extracted from the hepatopancreas, gill, and muscle using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). For the real-time RT-PCR assay, the first-strand cDNA was synthesized from total RNA using the PrimeScript® RT reagent kit with gDNA Eraser (TaKaRa) according to the manufacturer's instructions. For the rapid amplification of cDNA ends (RACE) assay, the first-strand cDNA was synthesized from
2.7. Prokaryotic expression and antibody preparation Sequences of the FcRas open reading frame (ORF) were artificially synthesized and amplified by a PCR assay using primers ORF forward and ORF reverse (Table 1). The FcRas ORF was cloned into plasmid PET28a using the restriction enzymes BamHⅠ and SacⅠ. The recombinant plasmid was then introduced into E. coli BL21(DE3), and incubated overnight at 37 °C. The bacteria were inoculated at a ratio of 1:100 into fresh media, and incubated at 37 °C with shaking until an OD600 of 0.6 was reached. Then, IPTG was added to the media and further incubated for 3 h at 37 °C. The bacteria were centrifuged at 6000 × g for 10 min and then 40 mL of NTA-0 buffer solution was added. The bacteria were split by ultrasonic waves and centrifuged at 1000 × g for 5 min. An SDS-PAGE assay was performed to analyze the sediment and supernatant, respectively. Inclusion bodies were collected by centrifugation at 12000 × g for 30 min, then washed and solubilized in 4 M urea solution. The FcRas protein was purified by Ni-NTA resin and used to immunize healthy rabbits. An enzyme-linked immunosorbent assay (ELISA) was performed to measure the antibody titer.
Table 1 Primers and probes information. Designation
Sequences
WSSV forward WSSV reverse WSSV probe 5′ Ras out 5′ Ras in 3′ Ras out 3′ Ras in M13-47 RV-M RQ forward RQ reverse 18S rRNA forward 18S rRNA reverse ORF forward ORF reverse
TGGTCCCGTCCTCATCTCAG GCTGCCTTGCCGGAAATTA AGCCATGAAGAATGCCGTCTATCACACA CACTTCCTCTTGCTGTTCCTACTTC GCAGAGGTCTCAATGAAAGGAAT AACGAGTAAAGGACGCAGATGTGGT TTGGTGGGCAACAAATGCGACT CGCCAGGGTTTTCCCAGTCACGAC GAGCGGATAACAATTTCACACAGG TTGGTGGGCAACAAATGCGACT GCAGAGGTCTCAATGAAAGGAAT TATACGCTAGTGGAGCTGGAA GGGGAGGTAGTGACGAAAAAT GCGCGGATCCCATGACGG GCCCGAGCTCCCTAGAACAC
2.8. Western blot The FcRas protein level in the hepatopancreas and muscle of WSSV2
Aquaculture 516 (2020) 734604
X. Li, et al.
infected F. chinensis was detected by western blot analysis. The β-actin protein level in the hepatopancreas and muscle was also detected as a control. The hepatopancreas and muscle of WSSV-infected F. chinensis at 0, 6, 12, 24, and 48 hpi were homogenized on ice in lysis buffer, then the supernatant was collected by centrifugation (10,000 × g, 5 min). An equal volume of loading buffer was added to the supernatant and samples were loaded onto gels for SDS-PAGE. The concentrations of the stacking gel and separating gel were 5% and 15%, respectively. After electrophoresis, the total protein was transferred to a PVDF membrane. The membrane was then washed three times in PBST and blocked with blocking buffer (1% casein). The membrane was incubated with the primary antibody at 37 °C for 1 h and then washed three times with PBST. The membrane was then incubated with the secondary antibody at 37 °C for 1 h. After three more washes with PBST, the membrane was incubated with luminescent reagent (Western Luminescent Detection kit; Vigorous Biotechnology Beijing Co., Ltd., Beijing, China) for film developing. The protein level of FcRas was analyzed using Quantity One software (BioRad, Munich, Germany).
Fig. 2. FcRas mRNA level in tissues of healthy F. chinensis. The bars correspond to standard deviation (SD) of the means. H: hepatopancreas; G: gill; M: muscle. Data without shared letters were significantly different (n = 3, P < 0.05).
clustered into another clade. Furthermore, the FcRas and Ras proteins from M. japonicas and L. vannamei were clustered into a clade (Fig. 1).
3. Results 3.1. FcRas cDNA and protein sequence
3.2. FcRas mRNA level in healthy F. chinensis
The ORF of FcRas (GenBank accession no: KC522602) was 564 bp in length, encoding a protein of 187 amino acid residues. The molecular mass of the predicted FcRas protein was 21.33 kDa. The pI value of the predicted FcRas protein was 7.01. The five conserved regions, which are involved in GTP metabolism, were observed at residues 10 to 17, residues 33 to 35, residues 57 to 60, residues 116 to 119, and residues 144 to 146. The CAAX motif was observed at the carboxyl-terminal (Suppl. Fig. 1). Multiple sequence alignment revealed that FcRas protein shared sequence identity of 74.3%–100.0% with Ras proteins from other species, showing the highest identity with the Ras proteins of M. japonicas (GenBank accession no: AAK14389) at 100.0% and L. vannamei (GenBank accession no: AET71737) at 99.5% identity. The FcRas protein had the lowest identity with K-Ras-4B of Homo sapiens (GenBank accession no: NP_004976) at 75.9%. The CAAX motifs were also identified in the Ras proteins from different species, and the C-terminals of Ras were less conserved than the N-terminals (Suppl. Fig. 2). A phylogenetic tree was constructed that could be divided into vertebrate and invertebrate subclades. The H-Ras proteins from Homo sapiens, Mus musculus and Rattus norvegicus were clustered into one clade and the NRas proteins from H. sapiens, M. musculus and R. norvegicus were
The mRNA level of FcRas in the muscle of F. chinensis was significantly (P < 0.05) lower than the levels in the hepatopancreas and gill. The mRNA level of FcRas in the gill was approximately 0.9-fold the level in the hepatopancreas. The mRNA level of FcRas in the muscle was approximately 0.4-fold the level in the hepatopancreas (Fig. 2). 3.3. Prokaryotic expression Analysis of prokaryotic expression revealed that recombinant FcRas was contained in the inclusion body sediment of bacterial cultures. The molecular mass of recombinant FcRas was approximately 28 kDa (Fig. 3). 3.4. Responses of FcRas to WSSV challenge The FcRas mRNA level was significantly downregulated in the hepatopancreas at 12 hpi (P < 0.01) and 24 hpi (P < 0.05). The FcRas mRNA level was significantly (P < 0.05) upregulated in the muscle at 48 hpi. In the gill, despite obvious upregulation of the transcript, no Fig. 1. Phylogenetic analysis of the deduced amino acid sequences of Ras. Sequences used for construction of the phylogenetic tree are FcRas (GenBank: KC522602), Ras of Litopenaeus vannamei (GenBank: AET71737), Ras of Marsupenaeus japonicas (GenBank: AAK14389), Ras of Aedes aegypti (GenBank: XP_001662234), Ras of Danaus plexippus (GenBank: EHJ75188), Ras of Harpegnathos saltator (GenBank: EFN76426), H-Ras of Homo sapiens (GenBank: CAG47067), N-Ras of Homo sapiens (GenBank: NP_002515), K-Ras-4a of Homo sapiens (GenBank: NP_203524), K-Ras-4b of Homo sapiens (GenBank: NP_004976), H-Ras of Mus musculus (GenBank: NP_032310), N-Ras of Mus musculus (GenBank: CAJ18567), K-Ras of Mus musculus (GenBank: NP_067259), H-Ras of Rattus norvegicus (GenBank: NP_001123913), N-Ras of Rattus norvegicus (GenBank: NP_542944), K-Ras of Rattus norvegicus (GenBank: NP_113703).
3
Aquaculture 516 (2020) 734604
X. Li, et al.
statistically significant difference (P < 0.05) was observed between the challenge and control groups (Fig. 4). The FcRas protein concentration in the hepatopancreas was significantly (P < 0.05) decreased to 0.24-, 0.36-, 0.37-, and 0.40-fold that of the concentration in the control at 6, 12, 24, and 48 hpi, respectively. The FcRas protein concentration in the muscle was not significantly changed post WSSV challenge (Fig. 5). 4. Discussion The findings from this study confirmed that FcRas is a conserved gene. The deduced amino acid sequence of FcRas contained most of the common features of Ras proteins, including the five conserved regions involved in GTP metabolism and the CAAX motif (Suppl. Figs. 1 and 2). Sequence identity was highest between FcRas and homologues in M. japonicas and L. vannamei (100.0% and 99.5%, respectively), and lowest with H. sapiens, a vertebrate species (75.9%). These results were consistent with the taxonomy. The findings also revealed that the sequence of the N-terminal of Ras was more highly conserved than the sequence of the C-terminal (Suppl. Fig. 2), possibly indicating that the N-terminal of Ras may play an important role in signal transduction. The sequence diversity of the C-terminal indicated that this region had evolved rapidly. The results in Fig. 2 showed that the expression level of FcRas in muscle was significantly different (P < 0.05) from the expression level in the hepatopancreas and gill of healthy F. chinensis. The FcRas expression level in the gill was similar to that in the hepatopancreas. Similarly, in F. chinensis, it has been reported that Rap, which is a Ras family GTPase, was highly expressed in the hepatopancreas and gill, and that the Rap gene expression level in the heart and intestine was lower than that in the hepatopancreas and gill (Ren et al., 2012). The FcRas expression profile in WSSV-infected F. chinensis showed that FcRas displays different responses to WSSV infection in the tissues originating from different embryonic blastophyllums. To our knowledge, no previous study has focused on the role of Ras in the response of F. chinensis to WSSV infection. The gill and muscle are the two main target tissues of WSSV (Lo et al., 1997). It is worth noting that post WSSV challenge, the expression levels of FcRas in the gill and muscle were highly similar. The hepatopancreas was previously reported not to be the main target tissue of WSSV (Lo et al., 1997). In this study, the FcRas mRNA expression profile in the hepatopancreas differed considerably from that in the muscle and gill. Although WSSV hardly infects the hepatopancreas, as a tissue that plays an important role in immune function, the gene expression levels in the hepatopancreas were also significantly affected by WSSV infection. We propose that WSSV may suppress the immune function of the hepatopancreas by downregulating the expression of immune-related genes. By contrast, the significant upregulation of FcRas gene expression in the muscle might be the result of hijacking by WSSV for viral replication. This hypothesis needs further investigation. The significant downregulation of the FcRas protein level in the hepatopancreas of WSSV-infected F. chinensis further indicated that the FcRas level was influenced by WSSV infection. Obviously, the FcRas expression level in the hepatopancreas was affected more markedly by WSSV challenge than the level in the muscle and gill. In the muscle, the mRNA level was significantly altered, but no significant change in the protein level was detected. A previous report in F. chinensis showed that post WSSV infection, Rap gene expression was upregulated in hemocytes and the gill at 6 hpi, suggesting that Rap expression was influenced by WSSV infection (Ren et al., 2012). Another study showed that in P. japonicus, the expression level of small GTPases, such as Ranbp, Rho and Rab, were all influenced by WSSV infection (Pan et al., 2005). A previous study in M. japonicas showed that following WSSV infection, ADP ribosylation factors (Arfs), which are also small GTPases, were upregulated in the hepatopancreas (Zhang et al., 2010). Taken together, these results suggest that not only Ras but also other small GTPases could be influenced by the WSSV
Fig. 3. SDS-PAGE and Western-blot analysis of FcRas expressed in Escherichia coli. A: Profile of SDS-PAGE. Lane 1, supernant; Lane 2, sediment. B: Profile of SDS-PAGE. Lane 1, purified FcRas.
Fig. 4. FcRas mRNA level in tissues of WSSV-infected F. chinensis. A: hepatopancreas; B: gill; C: muscle. The bars correspond to standard deviation (SD) of the means. The significant differences (n = 3, P < 0.05) between the challenged group and control group are indicated with one asterisk. The extremely significant differences (n = 3, P < 0.01) between the challenged group and control group are indicated with two asterisks.
4
Aquaculture 516 (2020) 734604
X. Li, et al.
Fig. 5. FcRas protein level in the hepatopancreas and muscle of WSSV-infected F. chinensis. The bars correspond to standard deviation (SD) of the means. The significant differences (n = 3, P < 0.05) between the challenged group and control group are indicated with one asterisk.
infection process. However, the specific function of the small GTPases in the shrimp–WSSV interaction remains to be determined. Whether expression changes are a defense response by the shrimp to WSSV infection, or whether the genes are suppressed by WSSV for viral replication, warrants further investigation.
pathway (Review). Int. J. Oncol. 22, 469–480. Chen, D.D., Meng, X.L., Xu, J.P., Yu, J.Y., Meng, M.X., Wang, J., 2013. PcLT, a novel Ctype lectin from Procambarus clarkii, is involved in the innate defense against Vibrio alginolyticus and WSSV. Dev. Comp. Immunol. 39, 255–264. DeClue, J.E., Papageorge, A.G., Fletcher, J.A., Diehl, S.R., Ratner, N., Vass, W.C., et al., 1992. Abnormal regulation of mammalian p21ras contributes to malignant tumor growth in von Recklinghausen (type 1) neurofibromatosis. Cell 69, 265–273. Escobedo-Bonilla, C.M., Alday-Sanz, V., Wille, M., Sorgeloos, P., Pensaert, M.B., Nauwynck, H.J., 2008. A review on the morphology, molecular characterization, morphogenesis and pathogenesis of white spot syndrome virus. J. Fish Dis. 31, 1–18. Flegel, T.W., 2009. Current status of viral diseases in Asian shrimp aquaculture. Israeli J. Aquacult. – Bamidgeh 61, 229–239. Heidorn, S.J., Milagre, C., Whittaker, S., Nourry, A., Niculescu-Duvas, I., Dhomen, N., et al., 2010. Kinase-dead BRAF and oncogenic RAS cooperate to drive tumor progression through CRAF. Cell 140, 209–221. Huang, C., Zhang, X., Lin, Q., Xu, X., Hu, Z., Hew, C.L., 2002. Proteomic analysis of shrimp white spot syndrome viral proteins and characterization of a novel envelope protein VP466. Mol. Cell. Proteom. 1, 223–231. Li, X., Kong, J., Meng, X., Luo, K., Luan, S., Cao, B., Liu, N., 2016. Isolation and expression analysis of an MAPKK gene from Fenneropenaeus chinensis in response to white spot syndrome virus infection. Fish Shellfish Immunol. 55, 116–122. Lightner, D.V., 1996. A Handbook of Pathology and Diagnostic Procedures for Diseases of Penaeid Shrimp. World Aquaculture Society, Baton Rouge, Louisiana, USA. Lin, S.J., Hsia, H.L., Liu, W.J., Huang, J.Y., Liu, K.F., Chen, W.Y., et al., 2012. Spawning stress triggers WSSV replication in brooders via the activation of shrimp STAT. Dev. Comp. Immunol. 38, 128–135. Lo, C.F., Ho, C.H., Chen, C.H., Liu, K.F., Chiu, Y.L., Yeh, P.Y., et al., 1997. Detection and tissue tropism of white spot syndrome baculovirus (WSBV) in captured brooders of Penaeus monodon with a special emphasis on reproductive organs. Dis. Aquat. Org. 30, 53–72. Lowy, D.R., Willumsen, B.M., 1993. Function and regulation of ras. Annu. Rev. Biochem. 62, 851–891. Malumbres, M., Barbacid, M., 2003. RAS oncogenes: the first 30 years. Nat. Rev. Cancer 3, 459–465. Pan, D., He, N., Yang, Z., Liu, H., Xu, X., 2005. Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization. Dev. Comp. Immunol. 29, 103–112. Ren, Q., Zhou, J., Jia, Y.P., Wang, X.W., Zhao, X.F., Wang, J.X., 2012. Cloning and characterization of Rap GTPase from the Chinese white shrimp Fenneropenaeus chinensis. Dev. Comp. Immunol. 36, 247–252. Rozenblum, E., Schutte, M., Goggins, M., Hahn, S.A., Panzer, S., Zahurak, M., et al., 1997.
Declaration of competing interest The authors have declared that no conflict of interest exist. Acknowledgments This work was financially supported by the National Key R&D Program of China (2018YFD0900303-06); the Joint Fund of the National Natural Science Foundation of China (U1706203); the Central Public-interest Scientific Institution Basal Research Fund, CAFS (2018GH10); the Shandong Provincial Natural Science Foundation (ZR2014CQ001); the National Natural Science Foundation of China (41676148 & 31572616); the Taishan Scholar Program for Seed Industry; and the China Agricultural Research System (CARS-48). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.aquaculture.2019.734604. References Bharate, S.B., Singh, B., Vishwakarma, R.A., 2012. Modulation of k-ras signaling by natural products. Curr. Med. Chem. 19, 2273–2291. Chang, F., Steelman, L.S., Shelton, J.G., Lee, J.T., Navolanic, P.M., Blalock, W.L., et al., 2003. Regulation of cell cycle progression and apoptosis by the Ras/Raf/MEK/ERK
5
Aquaculture 516 (2020) 734604
X. Li, et al.
Eriocheir sinensis. Fish Shellfish Immunol. 35, 1007–1015. Wu, W., Zong, R., Xu, J., Zhang, X., 2008. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicas. J. Proteome Res. 7, 424–431. Yang, F., He, J., Lin, X., Li, Q., Pan, D., Zhang, X., et al., 2001. Complete genome sequence of the shrimp white spot bacilliform virus. J. Virol. 75, 11811–11820. Yao, D., Ruan, L., Xu, X., Shi, H., 2015. Identification of a c-Jun homolog from Litopenaeus vannamei as a downstream substrate of JNK in response to WSSV infection. Dev. Comp. Immunol. 49, 282–289. Yingvilasprasert, W., Supungul, P., Tassanakajon, A., 2014. PmTBC1D20, a Rab GTPaseactivating protein from the black tiger shrimp, Penaeus monodon, is involved in white spot syndrome virus infection. Dev. Comp. Immunol. 42, 302–310. Zhang, M., Ma, J., Lei, K., Xu, X., 2010. Molecular cloning and characterization of a class II ADP ribosylation factor from the shrimp Marsupenaeus japonicas. Fish Shellfish Immunol. 28, 128–133. Zhu, F., Zhang, X., 2011. The antiviral vp28-siRNA expressed in bacteria protects shrimp against white spot syndrome virus (WSSV). Aquaculture 319, 311–314.
Tumor-suppressive pathways in pancreatic carcinoma. Cancer Res. 57, 1731–1734. Song, K.K., Li, D.F., Zhang, M.C., Yang, H.J., Ruan, L.W., Xu, X., 2010. Cloning and characterization of three novel WSSV recognizing lectins from shrimp Marsupenaeus japonicus. Fish Shellfish Immunol. 28, 596–603. Tendencia, E.A., Bosma, R.H., Primavera, J.H., Verreth, J.A.J., 2012. Effect of different mangrove-to-pond area ratios on influent water quality and WSSV occurrence in Penaeus monodon semi-intensive farms using the greenwater culture technique. Aquaculture 362-363 72–39. Tendencia, E.A., Bosma, R.H., Verreth, J.A.J., 2011. White spot syndrome virus (WSSV) risk factors associated with shrimp farming practices in polyculture and monoculture farms in the Philippines. Aquaculture 311, 87–93. van Hulten, M.C.W., Witteveldt, J., Peters, S., Kloosterboer, N., Tarchini, R., Fiers, M., et al., 2001. The white spot syndrome virus DNA genome sequence. Virology 286, 7–22. Wang, L., Li, L., Wang, L., Yang, J., Wang, J., Zhou, Z., et al., 2013. Two Rab GTPases, EsRab-1 and EsRab-3, involved in anti-bacterial response of Chinese mitten crab
6