Interleukin-17A induces renal fibrosis through the ERK and Smad signaling pathways

Biomedicine & Pharmacotherapy 123 (2020) 109741

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Interleukin-17A induces renal fibrosis through the ERK and Smad signaling pathways

T

Cheng-Hao Wenga,b,c, Yi-Jung Lia,b, Hsin-Hsu Wua,b,c, Shou-Hsuan Liua,b,c, Hsiang-Hao Hsua,b, Yung-Chang Chena,b, Chih-Wei Yanga,b, Pao-Hsien Chud, Ya-Chung Tiana,b,* a

Kidney Research Center, Department of Nephrology, Linkou Chang Gung Memorial Hospital, Taiwan Department of Medicine, Chang Gung University, Taoyuan, Taiwan c Graduate Institute of Clinical Medical Sciences, College of Medicine, Chang Gung University, Taiwan d Department of Cardiology, Linkou Chang Gung Memorial Hospital, Taiwan b

A R T I C LE I N FO

A B S T R A C T

Keywords: IL-17A ERK Smad Kidney Fibrosis

Interleukin (IL)-17A is upregulated in several renal diseases and plays a crucial role in renal inflammation. However, it remains unclear how IL-17A contributes to renal fibrosis. Our result demonstrated that IL-17A expression was upregulated in the obstructed kidney of unilateral ureter obstruction (UUO) mice when compared to the contralateral control kidney. Inhibition of IL-17A functions by the intravenous administration of an anti-IL-17A receptor antibody (100 μg) 2 h prior to UUO and on post-UUO day 1 and 3 significantly reduced fibronectin expression in the UUO kidney. The addition of IL-17A (25–100 μg) to human renal proximal tubular cells or renal fibroblasts caused an increase in fibronectin production and extracellular signal-regulated kinase (ERK)1/2 activation, which were reduced upon pretreatment with the ERK inhibitor U0126. The level of phosphorylated (p)-ERK1/2 was increased in the UUO kidney, but reduced by the administration of the anti-IL17A receptor antibody, verifying the importance of the ERK pathway in vivo. TGF-β1 mRNA expression and protein were increased in the UUO kidney and in IL-17A–stimulated cultured cells. The administration of an antiTGF-β1 neutralizing antibody or TGF-β1 receptor I inhibitor (SB431542) to cells abrogated the IL-17A–mediated increase of fibronectin production. IL-17A induced an increase in p-Smad2 and p-Smad3 expression at 7.5 min and 24 h and pretreatment with the anti-TGF-β1 neutralizing antibody, and SB431542 reduced the IL17A–stimulated increase of p-Smad2. Knockdown of Smad2 or Smad3 expression inhibited the IL-17A–enhanced production of fibronectin. These results suggest an essential role for the TGF-β/Smad pathway in the IL17A–mediated increase of fibronectin production. This study demonstrates that IL-17A contributes to the production of extracellular matrix, and targeting its associated signaling pathways could provide a therapeutic target for preventing renal fibrosis.

1. Introduction Interleukin (IL)-17 is upregulated in several renal diseases, including lupus nephritis, human anti-neutrophil cytoplasmic antibodyassociated glomerulonephritis, and during acute rejection of renal transplants [1–4]. Although the contribution of IL-17 to renal inflammation was discovered a decade ago [5], it was only recently that IL-17–producing CD4+ effector T cells, T-helper 17 (Th17) cells, were identified in mice undergoing unilateral ureter obstruction (UUO) [6].

In addition to Th17 cells, IL-17A is produced by multiple cell types, including neutrophils, macrophages, dendritic cells, and plasma cells [7]. Following its secretion, IL-17A stimulates renal tubular cells and mesangial cells to produce other proinflammatory mediators and chemoattractants for T cells, macrophages, and neutrophils [8,9]. Neutrophil recruitment and migration are mediated by IL-17A through the induction of granulopoiesis and the production of granulocyte-colony stimulating factor, IL-1β, IL-6, tumor necrosis factor (TNF)-α, monocyte chemoattractant protein-1 (MCP-1), and neutrophil chemoattractants

Abbreviations: IL-17A, interleukin-17A; UUO, unilateral ureter obstruction; TGF-β1, transforming growth factor-β1; siRNA, small interfering RNA; ERK1/2, extracellular signal-regulated kinase 1/2; U0126, ERK inhibitor; SB431542, TGF-β1 receptor I inhibitor; Th17 cells, T-helper 17 cells; TNF-α, tumor necrosis factor-α; MCP-1, monocyte chemoattractant protein-1; HRPTEC, human renal proximal tubular epithelial cell; qPCR, quantitative real-time polymerase chain reaction; IFN-γ, interferon-γ; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SDS, sodium dodecyl sulfate; p-ERK1/2, phosphorylated-ERK1/2; ECM, extracellular matrix ⁎ Corresponding author at: Department of Nephrology, Chang Gung Memorial Hospital, 199 Tun-Hwa North Road, Taipei, 105, Taiwan. E-mail address: [email protected] (Y.-C. Tian). https://doi.org/10.1016/j.biopha.2019.109741 Received 25 August 2019; Received in revised form 26 November 2019; Accepted 4 December 2019 0753-3322/ © 2019 The Author(s). Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

[7]. All of these inflammatory cells and proinflammatory cytokines contribute to renal fibrosis. In a murine model of crescentic glomerulonephritis, renal injury is attenuated in IL-17−/− mice, suggesting the functional importance of IL-17 in glomerulonephritis [10]. Recently, Krebs et al. demonstrated that following deoxycorticosterone and angiotensin II-induced hypertension, glomerular injury and albuminuria were less severe in IL-17–deficient mice compared to wild-type mice [11]. Despite our understanding of the importance of IL-17 in renal inflammation and injury that can proceed to renal fibrosis, its role in the development of tubulointerstitial fibrosis remains unclear. Among the IL-17 cytokine family, IL-17A is the most potent member and binds to the receptors IL-17RA and IL-17RC [12]. Following binding of IL-17A to IL-17RA, several signaling pathways are activated, such as the NF-κB pathway and mitogen-activated protein kinase signaling pathway [13,14]. Among these pathways, extracellular signalregulated kinase (ERK) is generally the most strongly and rapidly phosphorylated upon IL-17A stimulation [14–16]. Vittal et al. [17] noted an approximately 5-fold upregulation of transforming growth factor (TGF)-β transcripts after the incubation of immortalized normal rat lung alveolar type II epithelial cells with IL-17 for 6 h. However, Xue et al. showed that the administration of an antiIL-17A antibody to mice during ischemia/reperfusion injury of the kidney substantially increased the plasma and renal levels of TGF-β [18]. TGF-β exerts its diverse effects through the classic Smads signaling cascade [19]. Upon binding of TGF-β1 to its receptors, Smad2 and Smad3 are recruited and phosphorylated to form a complex with Smad4 to turn on/off the transcription of many TGF-β-responsive genes [20]. Whether the Smad signaling pathway is implicated in IL17A–mediated actions remains unclear. In this study, we examined whether IL-17A plays a crucial role in renal fibrosis and whether the ERK and TGF-β/Smad signaling pathways are involved in this process.

Table 1 Primer sequences. Genes

Sequence (5′- 3′)

Human IL-17A

Forward Reverse

GACTTTGAGGTTGACCTTCACAT TCAGCGTGTCCAAACACTGAG

IFN-γ

Forward Reverse

AACTGGAGAGAGGAGAGTGACAAAA GTCTTCCTTGATGGTATCCATGC

IL-1β

Forward Reverse

CCTGGTGCTGTATAACTCGTATGAG TTGGTTCACACTAGTTCCGTTGA

IL-6

Forward Reverse

GCAGAGAACAACCTAAATCTTCCAA TGATTGAATTGAGACTGGAAGCA

IL-23

Forward Reverse

TCAGTGCCAGCAGCTTTCAC TCTCTTAGATCCATGTGTCCCAC

MCP-1

Forward Reverse

GCAGCAAGTGTCCCAAAGAAG GACTGGGGTCAGCGCAGAT

TNF-α

Forward Reverse

TGCCATCAGACGGGCTGTA ACATCCTCGGCCCTTGAAG

TGF-β1

Forward Reverse

CCCAGCATCTGCAAAGCTC GTCAATGTACAGCTGCCGCA

GAPDH

Forward Reverse

TTCCAGGAGCGAGATCCCT CACCCATGACGAACATGGG

Abbrevations: IL-17: interleukin-17; IFN-γ: interferon-γ; MCP-1: monocyte chemoattractant protein-1; TNF-α: tumor necrosis factor-α; TGF-β1: transforming growth factor-β1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

used were listed in Table 1. The primers were constructed to be compatible with a single reverse transcription-PCR thermal profile of 95 °C for 10 min and 40 cycles of 95 °C for 30 s and 60 °C for 1 min. Experimental results are presented as the transcript level of the analyzed gene relative to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript level.

2. Materials and methods Human renal proximal tubular epithelial cells (HRPTECs) were cultured in REBM containing 0.5 mL hEGF, 0.5 mL hydrocortisone, 0.5 mL epinephrine, 0.5 mL insulin, 0.5 mL triiodothyronine, 0.5 mL transferrin, 0.5 mL GA-1000, and 2.5 mL fetal bovine serum (SingleQuots, Lonza, Basel, Switzerland) per 500 mL medium, according to the manufacturer’s instructions.

2.3. Flow cytometry Renal mononuclear cells were fixed using a Cytofix/Cytoperm kit (BD Biosciences, San Jose, CA) and stained with fluorescein-conjugated monoclonal antibodies with isotopes against IL-17A, CD4, and F4/F80. CD4+IL-17+ and IL-17+F4/F80+ T cells were identified by flow cytometry (FC500; Beckman Coulter, Fullerton, CA).

2.1. Murine UUO model of renal fibrosis The animal studies were approved by the Laboratory Animal Center of Linkou Chang Gung Memorial Hospital. BALB/c mice were obtained from the National Animal Laboratories. Female mice at 8–10 weeks of age received ligation of the left ureter under general anesthesia through an abdominal incision, and the unobstructed contralateral kidney was severed as a control. In the experiments with IL-17A receptor antibody injection, the mice were injected intravenously with 100 μg anti-IL-17A receptor antibody (R&D Systems, Minneapolis, MN) through the tail vein at 2 h before UUO and on days 1 and 3 after UUO. The mice were sacrificed on day 7 after UUO. The Laboratory Animal Committee at Linkou Chang Gung Memorial Hospital approved all animal procedures and experiments. All experiments and methods were performed in accordance with the guidelines and regulations set by the Ministry of Science and Technology of Taiwan for the care and use of laboratory animals.

2.4. Gene silencing by small interfering RNA (siRNA) RNA interference was used to reduce the expression of Smad2 and Smad3. Briefly, 0.5–1.5 μg siRNA against Smad2 or Smad3 or control siRNA was diluted in serum-free medium to give a final volume of 100 μL. Subsequently, the RNAiFectI transfection reagent was mixed with the diluted siRNA at a ratio from 6:1 to 3:1. Following incubation for 15 min at room temperature, the mixture was added to the culture medium. 2.5. Western blot analysis Total cellular protein extraction was performed as described previously [22]. Protein samples mixed with reducing sodium dodecyl sulfate (SDS) sample buffer were resolved by 10 % SDS-polyacrylamide gel electrophoresis and then electroblotted. Nonspecific binding was blocked with a 5 % nonfat milk solution. The membrane was incubated with a primary antibody overnight at 4 °C followed by incubation with a horseradish peroxidase-conjugated secondary antibody. Proteins were visualized using enhanced chemiluminescence (Amersham Biosciences,

2.2. Quantitative real-time polymerase chain reaction Quantitative real-time polymerase chain reaction (qPCR) was performed as described previously [21]. Briefly, total RNA was isolated from cells and reverse-transcribed to cDNA. qPCR was performed according to the manufacturer’s instructions using an ABI-Prism 7700 with SYBR Green I (PE-Applied Biosystems, Cheshire, UK). The primers 2

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Amersham, UK). Protein bands were quantified using Quantity One software (Bio-Rad, Hercules, CA). The density of each protein band was normalized with that of tubulin. The catalog number of fibronectin antibody was MAB1918 (R&D Systems) with 1:100 dilutions. The catalog number of IL-17A antibody was AF-317-NA (R&D Systems) with 1:2000 dilutions. The catalog number of p-ERK 1/2 antibody was AF1018 (R&D Systems) with 1:1000 dilutions (phosphorylation sites of ERK1: T202/Y204 and of ERK2: T185/Y187). The catalog number of type I collagen antibody was AF-6220 (R&D Systems) with 1:1000 dilutions. The catalog number of p-Smad2 antibody was ab53100 (phospho-S467) (abcam) with 1:1000 dilutions. The catalog number of p-Smad3 antibody was EP823Y (ab52903) (phospho-S423 + S425) (abcam) with 1:2000 dilutions. Results of quantitative analysis of immunoblotting were displayed in the figures or in the supplement data (Supplemental Figs. S1–S15).

reduced upon administration of the anti-IL-17A receptor antibody (Fig. 2e). This result may suggest that blockade of the function of IL17A by the anti-IL-17A receptor antibody in the UUO kidney was related to ERK inhibition. TGF-β1 is a master cytokine for the development of fibrosis in different organs [23–27]. To determine whether TGF-β1 was altered following treatment of the UUO mice with the anti-IL-17A receptor antibody, TGF-β1 mRNA expression was assessed in the UUO kidney by qPCR. TGF-β1 mRNA expression was increased in the UUO kidney compared with that in the contralateral control kidney. Increased TGFβ1 mRNA expression in the UUO kidney was inhibited by treatment with the anti-IL-17 receptor antibody (Fig. 2f). Western blot analysis also verified that TGF-β1 expression was increased in the UUO kidney when compared with that in the contralateral control kidney. Increased TGF-β1 expression in the UUO kidney was reduced upon treatment of anti-IL-17 receptor antibody (Fig. 2g). These results suggest that the attenuating effect of blocking IL-17A on renal fibrosis may act through a reduction of TGF-β1 expression. As multiple inflammatory cells and cytokines can contribute to the development of renal fibrosis, alterations of the levels of inflammatory cytokines were assessed by qPCR, and inflammatory cells were determined by flow cytometry. In addition to IL-17A, TGF-β, IL-1β, IL-6, IL-23, MCP-1, IFN-γ, and TNF-α were also significantly elevated in UUO kidney compared with the contralateral kidney (Fig. 3a). Flow cytometry analysis revealed increased numbers of CD11b+F4/80+IL-17A+ cells (macrophages) (contralateral vs. UUO: 4.09 ± 2.32 % vs. 17.03 ± 2.67 %, respectively, p < 0.001, n = 4 in each group) (Fig. 3b) and CD4+IL-17A+ T cells (Th17 cells) (contralateral vs. UUO: 0.65 ± 0.32 % vs. 4.95 ± 1.09 %, respectively, p < 0.001; n = 4 in each group) (Fig. 3c) in the UUO kidney at 3 days post-UUO as compared with the contralateral kidney.

2.6. Immunohistochemistry Kidney specimens were fixed in 4 % paraformaldehyde and embedded in paraffin. Following deparaffinization, the sections were immersed in 3 % H2O2 in methanol and blocked with 5 % bovine serum albumin/phosphate-buffered saline for 20 min. Following incubation with an anti-fibronectin antibody for 1 h, the sections were treated with relevant biotin-conjugated antibodies, and fibronectin immunostaining was detected using a VECTASTAIN ABC kit (Vector Laboratories, Burlingame, CA). Masson’s Trichrome stain was used to demonstrate the renal fibrosis. The intensity of IL-17A and fibronectin immunostainings and Masson’s Trichrome stain were quantified in four different specimens using Image J software. 2.7. Statistical analysis All data are presented as the mean ± standard error of the mean. Statistical analysis was performed using an unpaired Student’s t-test. Data were analyzed using SPSS, version 23 for Windows 10. A value of p < 0.05 was considered to represent a significant difference.

3.2. A direct effect of IL-17A on the enhancement of extracellular matrix production To assess whether IL-17A has a direct effect on the development of renal fibrosis, IL-17A was added to HRPTECs. Following treatment with IL-17A, fibronectin production was increased in a dose-dependent manner (Fig. 4a). The addition of IL-17A also led to a time-dependent increase in fibronectin production with the maximal response at 48 h (Fig. 4b). These results suggest that IL-17A has a stimulatory effect on fibronectin production in renal proximal tubular cells.

3. Results 3.1. Inhibition of IL-17A reduces fibrosis in the kidney of UUO model mice To determine whether IL-17A plays a role in the development of renal fibrosis, IL-17A expression was first determined in the UUO mice. Immunohistochemistry revealed an increase of IL-17A and fibronectin expression in the UUO kidney (Fig. 1b and d) in comparison with the contralateral kidney (Fig. 1a and c). Fibronectin expression was also prominently increased in the UUO kidney compared with the contralateral kidney. To determine whether inhibition of IL-17A can attenuate the development of renal fibrosis, the function of IL-17A was suppressed by pretreatment of mice with an anti-IL-17A receptor antibody before UUO. The result of Masson's Trichrome staining verified an increase in accumulation of extracellular matrix (ECM) in the UUO kidney when compared with the contralateral control kidney (Fig. 2a and b). Blocking IL-17A function using the anti-IL-17A receptor antibody significantly reduced accumulation of ECM in the UUO kidney (Fig. 2c). Western blot analysis also demonstrated that fibronectin expression in the UUO kidney was increased when compared to that in the contralateral control kidney (Fig. 2d). Administration of anti-IL-17A receptor antibody also reduced fibronectin expression. To verify IL-17A mainly functions through the ERK cascade to activate downstream processes. In the kidney of the UUO mice, immunoblotting analysis demonstrated that the level of phosphorylated (p)-ERK1/2 was increased at 7 days after UUO compared with the contralateral control kidney (Fig. 2e). The effect of the anti-IL-17A receptor antibody was confirmed as the p-ERK1/2 level was increased after UUO, but was

3.3. IL-17A–mediated increase of fibronectin expression requires the activation of the ERK signaling pathway IL-17A has been implicated in many crucial biological processes through the ERK signaling pathway [14,28]. To elucidate whether the ERK cascade is also required in the IL-17A–mediated increase of fibronectin expression, ERK1/2 activation following the addition of IL17A to cells was determined by western blot analysis. Following the addition of IL-17A, ERK1/2 was rapidly phosphorylated at 7.5 min but returned to the unstimulated level at 30 min (Fig. 5a). p-ERK levels were further increased at 24 and 48 h. To verify the importance of ERK activation in the IL-17A–mediated increase of fibronectin production, an ERK inhibitor, U0126, was added to the cells prior to stimulation with IL-17A. Western blot analysis showed that the IL-17A–activated rapid phosphorylation of ERK1/2 at 7.5 min and late phosphorylation of ERK1/2 at 48 h were significantly inhibited by U0126 (Fig. 5b and c). Blockade of ERK activation by U0126 led to a reduction in the IL-17A–enhanced increase of fibronectin production. Similarly, inhibition of the ERK cascade by U0126 also abrogated the IL-17A–induced increase of fibronectin expression at 48 h (Fig. 5c). These results suggest that the IL-17A–stimulated increase in fibronectin production requires the activation of the ERK signaling pathway. 3

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Fig. 1. Inhibition of fibronectin expression in UUO kidney by blockade of IL-17A. (a ∼ d). IL-17A (a & b) and fibronectin expression (c & d) in 7-day post-UUO kidney (b & d) and unobstructed contralateral kidney (control) (a & c) was determined by immunohistochemistry. Faint staining of IL-17A was observed in normal tubular cells of the control kidney, whereas strong staining IL-17A was found in tubular cells of UUO kidney. Fig. 1, Panel a represents relative percentage of IL-17A staining using immunohistochemistry (IHC) of Fig. 1a and b. Fig. 1, Panel b represents relative percentage of fibronectin staining using IHC of Fig. 1c and d. One represented section is demonstrated in figures (a–d). Magnification: a, b, c, d: ×400.

pretreatment with U0126 inhibited the IL-17A–induced rapid phosphorylation of ERK1/2 at 7.5 min (Fig. 6b). Similarly, pretreatment with U0126 also blocked the IL-17A–induced phosphorylation of ERK1/ 2 at 48 h (Fig. 6c). The IL-17A–induced production of fibronectin and type I collagen was inhibited by the addition of U0126 prior to IL-17A stimulation. These results suggest that, similar to the findings in renal proximal tubular cells, the IL-17A–stimulated increase in extracellular matrix (ECM) production in renal fibroblasts also requires the activation of the ERK signaling pathway.

3.4. Confirmation of the essential role of ERK in the IL-17A–mediated increase of extracellular matrix production in renal fibroblasts Since fibroblasts are another major culprit in the pathogenesis of renal fibrosis [29], the effect of IL-17A on the expression of fibronectin and type I collagen was assessed in human renal fibroblasts. Immunoblotting analysis demonstrated that the addition of IL-17A to Hs891 T cells led to an increase in the expression of fibronectin and type I collagen (Fig. 6a). The addition of IL-17A to Hs891 T cells also led to an increase in the expression of α- smooth muscle actin (Supplemental Fig. S1). In line with the findings in HRPTECs, the addition of IL-17A to Hs891 T cells led to an increase in p-ERK1/2 expression, and 4

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Fig. 2. Decreased fibronectin expression, ERK1/2 activation, and TGF-β1 expression by blockade of IL-17A function. Mice received UUO for 7 days and extracellular matrix in kidney specimens was stained with Masson's Trichrome (a: the contralateral control kidney; b: the UUO kidney). Mice were injected intravenously with 100 μg anti-IL-17A receptor antibody through the tail vein at 2 h before UUO and on days 1 and 3 after UUO (c). One represented section is demonstrated in figures. Fig. 2a, Panel a represents relative percentage of fibrosis staining using IHC of Fig. 2a, 2b, and 2c. Kidney parenchymal lysate was subjected to immunoblotting analysis to determine IL-17A and fibronectin expression (d) and p-ERK1/2 and total ERK1/2 levels (e). The density of each protein band was normalized with that of GAPDH, and relative fold changes compared to the control of Fig. 2d are displayed in the Fig. 2d, Panel a (white bars: fibronectin expression; black bars: IL-17A expression) and relative fold changes compared to the control of Fig. 2e are displayed in the Fig. 2e, Panel a. One representative result from three independent experiments is shown (*p < 0.05). TGF-β1 mRNA expression was analyzed by qPCR. TGF-β1 mRNA expression was normalized to GAPDH, and relative fold changes compared to the control are displayed (n = 4 in each group; *p < 0.05) (f). Kidney parenchymal lysate was subjected to immunoblotting analysis to determine TGF-β1 expression (g). Fig. 2g, Panel a represents western blot analysis shown in Fig. 2g. The groupings of gels were cropped from different parts of the same gel. Magnification: a, b, c: ×200.

3.5. TGF- β1 is implicated in the IL-17A–mediated increase of fibronectin production

comparison with the non-obstructed kidney. To verify this in vivo finding, HRPTECs were stimulated with IL-17A (100 ng/mL), and the expression of TGF-β1 mRNA was determined by qPCR. The results demonstrated that TGF-β1 mRNA expression was significantly increased

In the obstructed kidney, TGF-β1 mRNA expression was increased in 5

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Fig. 2. (continued)

3.6. The TGF-β receptor/Smad signaling pathway is required for the IL17A–induced increase of fibronectin production

after the administration of IL-17A (Fig. 7a). To further assess whether TGF-β1 was implicated in the IL17A–induced increase in fibronectin production, an anti-TGF-β1 neutralizing antibody was added to the cells prior to IL-17A stimulation. Immunoblotting analysis demonstrated that the IL-17A–induced increase in fibronectin production was reduced by pretreatment with the anti-TGF-β1 neutralizing antibody (Fig. 7b and c). These results suggest an important role of TGF-β1 in the IL-17A–induced increase of fibronectin production.

To determine whether the classic TGF-β/Smad signaling pathway was activated upon IL-17A stimulation, phosphorylation of Smads was assessed following IL-17A administration. Immunoblotting analysis demonstrated two peaks of increased p-Smad2 levels at 7.5−15 min and 24−48 h following IL-17A administration (Fig. 8a). Similarly, the peak levels of p-Smad3 following IL-17A stimulation were also observed at 7.5−15 min and 24−48 h. This result may suggest that IL-17A stimulated Smad2/3 activation at two different time points, with rapid activation at 7.5−15 min and late activation at 24−48 h.

Fig. 2. (continued) 6

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Fig. 3. Inflammatory cells responding to IL-17A production and cytokine production in the obstructed kidney of mice with UUO. (a). mRNA expression of various cytokines (IL-17A, TGF-β, IL-1β, IL-6, IL-23, MCP-1, IFN-γ, and TNF-α) in 3-day post-UUO obstructed kidney and non-obstructed contralateral kidney (control) in UUO mice was analyzed by qPCR. Cytokine mRNA expression was normalized to that of GAPDH, and relative fold changes compared to the control are displayed. (b & c). CD11b+F4/80+IL-17A+ cells and CD4+IL-17A+ T cells in 3-day post-UUO kidney and contralateral kidney (n = 4 in each group) in UUO mice were analyzed by flow cytometry. Cells in a representative post-UUO obstructed kidney and contralateral kidney are shown. b. Blue curve: isotype cells; red curve: IL17A+F4/80+ cells; C: CD4+IL-17A+-producing cells. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article). 7

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Fig. 3. (continued)

fibronectin production (Fig. 8e), indicating that the Smad2/3-associated cascade is indispensable in this response.

To assess whether Smad2 was activated through the IL-17A–induced secretion of TGF-β1, an anti-TGF-β1 neutralizing antibody was added to the cells in the presence of IL-17A stimulation for 7.5 min or 24 h. Immunoblotting analysis demonstrated that the neutralization of secreted TGF-β1 inhibited IL-17A–induced p-Smad2 expression at 24 h (Fig. 8b). In contrast, the anti-TGF-β1 neutralizing antibody did not abrogate IL-17A–stimulated p-Smad2 expression at 7.5 min (data not shown). To assess whether IL-17A induced an increase of p-Smad2 via activation of the TGF-β receptor, cells were treated with a TGF-β RI inhibitor, SB431542, in the presence of IL-17A for 24 h. As shown in Fig. 8c, inhibition of TGF-β RI activation by SB431542 abrogated the IL17A–induced increase of p-Smad2 expression. In addition, SB431542 administration also abrogated the IL-17A–induced increase of fibronectin expression (Fig. 8d). To further verify the importance of Smad2 and Smad3 in IL17A–induced fibronectin production, Smad2 or Smad3 expression was knocked down by siRNA followed by IL-17A stimulation. Knockdown of Smad2 or Smad3 protein blocked the IL-17A–induced increase of

3.7. Blockade of ERK1/2 activation inhibits the IL-17A–induced activation of Smad2 and Smad3 Both the Smad and ERK signaling pathways have been reported to cooperatively regulate TGF-β1-mediated cell functions [30–33]. As Smad2/3 and ERK1/2 activation was induced by IL-17A in a similar time frame, we assessed whether IL-17A–induced ERK1/2 activation was required for the rapid activation of Smad2 and Smad3. Immunoblotting analysis demonstrated that the rapid increase of p-Smad2 and p-Smad3 expression stimulated by IL-17A was blocked by pre-incubation with U0126 (Fig. 9). This result suggests that the rapid activation of Smad2 and Smad3 triggered by IL-17A is through IL17A–induced ERK1/2 activation.

8

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Fig. 4. IL-17A–induced increase in fibronectin production. (a). HRPTECs were serum-deprived for 24 h and then grown in the presence or absence of different concentrations of IL-17A (5−100 ng/mL) under serum-free conditions for 2 days. Fig. 4a, Panel a represents wester blot analysis shown in Fig. 4a. (b). Cells were treated with 50 ng/mL IL-17A for different periods, as indicated. Quantitative analysis of each protein band was displayed in the supplemental Fig. S2. Cell lysates were subjected to immunoblotting analysis for the measurement of fibronectin production. GAPDH expression was used as a loading control. One representative experiment from at least three independent experiments is shown. The groupings of gels were cropped from different parts of the same gel.

4. Discussion

therapeutic targeting of IL-17A–mediated inflammation may have some advantages in the prevention of further kidney damage that can lead to the development of renal fibrosis. However, it remains unclear whether IL-17A can directly enhance renal fibrosis. In this study, we demonstrated that IL-17A expression was increased in the UUO kidney, in

IL-17A plays a role in diverse renal diseases by regulating T cell functionality and modulating renal inflammation [34–39]. As renal inflammation is an early marker of different types of kidney injury,

Fig. 5. Blockade of the IL-17A–stimulated increase of ERK1/2 activation and fibronectin expression by an ERK1/2 inhibitor. (a). HRPTECs were stimulated with IL-17A (50 ng/mL) under serum-free conditions for the designated periods. (b & c). Cells were pre-treated with different concentrations of U0126 (2.5−10 μM/mL) in the presence or absence of IL-17A (50 ng/mL) under serum-free conditions for 7.5 min (b) or 48 h (c). ERK1/2 kinase activity was determined by immunoblotting with an anti-p-ERK1/2 antibody, and the same immunoblot membrane was probed again and total ERK1/2 proteins were then determined. GAPDH expression was used as a loading control. Quantitative analysis of these Western blot analyses was displayed in the supplemental Fig. S3∼5. The groupings of gels were cropped from different parts of the different gels of the same specimen.

9

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Fig. 6. Inhibition of ERK1/2 activation blocks IL17A–induced ECM expression in renal fibroblasts. (a). Hs891 T cells were stimulated with different concentrations of IL-17A (5−100 ng/mL) and grown under serum-free conditions for 2 days. Cell lysates were subjected to immunoblotting to determine the expression of fibronectin and type I collagen. (b & c). Cells were pre-treated with different concentrations of U0126 (b: 5−10 μM/mL; c: 2.5−10 μM/mL) in the presence or absence of IL-17A (50 ng/mL) under serum-free conditions for 7.5 min (b) or 48 h (c). ERK1/2 kinase activity was determined by immunoblotting with an anti-p-ERK1/2 antibody, and the same immunoblot membrane was probed again and total ERK1/2 proteins were then determined. Fibronectin and type I collagen levels in the supernatant were determined by immunoblotting (c). Quantitative analysis of these Western blot analyses was displayed in the supplemental Figs. S6–S8. The groupings of gels were cropped from different parts of the different gels of the same specimen.

accordance with the findings of other reports [6,40,41]. These studies demonstrated IL-17A–associated kidney injury through the activation of IL-17A–secreting Th17 cells. In addition to Th17 cells, neutrophils, macrophages, dendritic cells, and plasma cells can also produce IL-17A [7]. Our study demonstrated that IL-17A–producing cells, including Th17 cells and macrophages, were increased in the UUO kidney and contributed to the increased expression of IL-17A. In addition, our study revealed that several inflammatory cytokines, including IL-1β, IL-6, IL23, MCP-1, IFN-γ, and TNF-α, were concurrently increased in the UUO kidney. As IL-17A can stimulate the release of these proinflammatory cytokines, it is tempting to postulate that IL-17A contributes to renal inflammation and subsequent renal fibrosis. Interestingly, our study showed that the direct administration of IL-17A to cultured renal proximal tubular cells in the absence of T cells caused an increase in the production of ECM protein. These results suggest that IL-17A may have a direct effect on the development of renal fibrosis independently of its role in T cell regulation. Our study also demonstrated that abrogating IL-17A function by an anti-IL-17A receptor antibody reduced fibronectin accumulation in the UUO kidney. Baldeviano et al. demonstrated that blockade of IL-17A ameliorated postmyocarditis-cardiac fibrosis [42]. Mi et al. found that blocking IL-17A reduced the severity of bleomycin-induced pulmonary fibrosis [43]. Our study provides further evidence that abrogating IL-17A function attenuates the progression of organ fibrosis. Interestingly, a recent study reported that the

administration of a low dose IL-17A to diabetic mice prevented the progression of diabetic nephropathy through the inhibition of proinflammatory cytokines [44]. These results may imply that appropriate amount or function of IL-17A is required to prevent renal fibrosis. The suppression of IL-17A function by an anti-IL-17A receptor antibody alleviated renal fibrosis in our UUO mouse model, suggesting that an excessive amount of IL-17A may enhance renal fibrosis. In contrast, low dose IL-17A therapy reduces chronic kidney damage and fibrosis in diabetic mice, indicating that sufficient IL-17A may prevent the development of chronic renal fibrosis. Sun et al. showed that IL-17−/− mice develop more severe renal interstitial fibrosis than wild-type mice after UUO [45]. Thorenz et al. demonstrated that ischemia/reperfusion injury-induced renal inflammation in IL-17−/− mice was not different from that in wild-type mice, and the administration of an anti-IL-17A blocking antibody did not reduce renal inflammation [46]. These studies imply that a complete deficiency of IL-17A may facilitate kidney injury and worsen renal fibrosis. A sufficient level of IL-17A is required to prevent overwhelming renal inflammation and the subsequent development of renal fibrosis. IL-17A has been shown to regulate different cell processes through the ERK signaling pathway. Our study demonstrated that the administration of IL-17A led to ERK activation at two different time points. Rapid phosphorylation of ERK1/2 was observed at 7.5 min, which was 10

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Importantly, blockade of ERK activation by ERK inhibitors abrogated the IL-17A–induced increase of fibronectin production, suggesting a crucial role for the ERK signaling pathway in IL-17A–induced ECM accumulation. In line with this finding, the suppression of IL-17A function by an anti-IL-17A receptor antibody reduced the levels of pERK1/2 in the UUO kidney tissue. Renal proximal tubular cells and renal fibroblasts are two major cell types that contribute to ECM accumulation during the development of renal fibrosis. In this study, IL-17A also stimulated fibronectin and type I collagen production in renal fibroblasts. This stimulation was inhibited by an ERK inhibitor, suggesting that, similar to the findings in renal proximal tubular cells, the ERK signaling cascade is also crucial for the IL-17A–stimulated increase of ECM production in renal fibroblasts. We and others have shown that TGF-β1 and its downstream Smad signaling pathway play a crucial role in the development of tubulointerstitial fibrosis [26,49–51]. Our study demonstrated an increase in TGF-β1 expression in the UUO kidney, and blockade of IL-17A functionality by an anti-IL-17A receptor antibody reduced TGF-β1 expression in the UUO kidney. These results suggest that TGF-β1 is implicated in IL-17A–induced fibronectin production and renal fibrosis. Vittal et al. observed that IL-17 induced the expression of TGF-β in pulmonary epithelial cells in vitro and in vivo, and neutralization of IL-17 bioactivity in a murine obliterative bronchiolitis model suppressed TGF-β expression [17]. Xue et al. also showed that the administration of an anti-IL-17A receptor antibody substantially reduced TGF-β1 expression in mouse kidney after renal ischemia/reperfusion injury [18]. Our results also support these studies, displaying the importance of TGF-β1 in IL-17A–induced fibronectin production and renal fibrosis. In cultured renal proximal tubular cells, we also demonstrated that IL-17A stimulated TGF-β1 transcription, and the addition of an anti-TGF-β1–neutralizing antibody blocked IL-17A–induced fibronectin production. These in vitro findings also confirmed the crucial role of TGF-β1 in IL17A–mediated ECM accumulation. Although IL-17A–enhanced TGF-β1 expression has been observed in different cell types [43,52], it is unclear whether IL-17A can activate the Smad signaling pathway. The present study demonstrated that IL17A increased p-Smad2 and p-Smad3 levels, indicating that the activation of Smad2/3 was triggered by IL-17A. Interestingly, IL-17A induced Smad2/3 activation at two time points, with the first peak at 7.5−15 min and the second peak at 24−48 h, which were identical to the activation peaks of ERK1/2 (Figs. 5a and 8 a). The rapid activation of Smad2/3 was blocked by the administration of an ERK1/2 inhibitor, suggesting ERK-mediated Smad activation. Hayashida et al. reported that ERK-mediated Smad activation was blocked by ERK inhibitors in mesangial cells [33]. Our finding that rapid Smad2 activation was blocked by U0126 also suggested ERK-mediated Smad activation. In addition, the late activation of Smad2 was mainly induced by secreted TGF-β1 as both an anti-TGF-β1 neutralizing antibody and a TGF-β RI inhibitor reduced p-Smad2 levels. Importantly, blockade of the Smad signaling pathway by a TGF-β RI inhibitor or by silencing Smad2 or Smad3 expression reduced IL-17A–induced fibronectin production, suggesting the importance of the Smad cascade in the IL-17A–mediated increase of ECM production.

Fig. 7. Inhibition of IL-17A–stimulated fibronectin using a neutralizing anti-TGF-β1 antibody. a. Cells were serum-deprived for 48 h and stimulated with IL-17A (50 ng/mL) for a further 30 min to 4 h (a). TGF-β1 mRNA expression was analyzed by qPCR. TGF-β1 mRNA expression was normalized to GAPDH, and relative fold changes compared to the control are displayed (n = 5 in each group; *p < 0.05). (b). Cells were treated with an anti-TGF-β1 neutralizing antibody (100 ng/mL) in the presence or absence of IL-17A (50 ng/ mL) or TGF-β (5 ng/mL, positive control) for 48 h. (c). Cells were pretreated with different concentrations of an anti-TGF-β1 neutralizing antibody (10−100 ng/mL) followed by stimulation with IL-17A (50 ng/mL) for 48 h. Cell lysates were subjected to immunoblotting to determine fibronectin expression. Quantitative analysis of these Western blot analyses was displayed in the supplemental Fig. S9∼S10. The groupings of gels were cropped from different parts of the same gel.

followed by a second peak of ERK activation at 24−48 h. Rapid and late ERK activation was blocked by the ERK inhibitors U0126 (Fig. 5) or PD98059 (data not shown). It has been reported that IL-17A activates ERK signaling rapidly within 30 min in different cell types [15,28,47,48]. Our study also demonstrated that rapid ERK activation was triggered by IL-17A in renal proximal tubular cells. Interestingly, the second peak of ERK activation was observed after IL-17A stimulation for 24 h. We speculate that rapid ERK activation may be directly induced by IL-17A as an anti-TGF-β1 neutralizing antibody did not alter IL-17A–stimulated ERK activation at 7.5 min (data not shown). In contrast, late ERK activation may be triggered by TGF-β1 as a TGF-β RI inhibitor, SB431542, suppressed this late activation (data not shown).

5. Conclusions This study shows evidence that IL-17A contributes to ECM production, and blockade of its functionality alleviates the development of renal fibrosis. Our finding that abrogation of the TGF-β/Smad or ERK signaling pathway reduces IL-17A–induced ECM accumulation also provides a potential therapeutic target for the prevention of renal fibrosis.

11

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

Fig. 8. Inhibition of IL-17A–induced fibronectin expression by inhibiting Smad2/3 activation. (a). Cells were stimulated with IL-17A (50 ng/mL) under serumfree conditions for different periods, as indicated. Cell lysates were subjected to immunoblotting to assess p-Smad2 and p-Smad3 levels. (b ∼ d). Cells were pretreated with different concentrations of an anti-TGF-β1 neutralizing antibody (10−100 ng/mL) or SB431542 (5 or 10 μM/mL) followed by stimulation with IL-17A (50 ng/ mL) for 24 h. p-Smad2 or fibronectin levels were determined by immunoblotting. (e). Cells were treated with 50 nM/mL p-Smad2 or p-Smad3 siRNA overnight and incubated with 50 ng/mL IL-17A for 48 h. Fig. 8e, Panel a represents western blot analysis shown in Fig. 8e. Cell lysates were subjected to immunoblotting to determine Smad2, Smad3, and fibronectin levels. The presented results are representative of three independent experiments. Quantitative analysis of these Western blot analyses was displayed in the supplemental Fig. S11∼S14. The groupings of gels were cropped from different parts of the different gels of the same specimen.

and interpreted data. CHW and YCT wrote and reviewed the manuscript. PHC, CWY and YCT supervised the study. Declaration of Competing Interest The authors declare no competing interests. Acknowledgements This study was supported by grants from the National Science Council of Taiwan to Dr. Y-C Tian and Dr. Y-J Li (NSC 102-2628-B182A-004-MY3, 102-2314-B-182A-103-MY3) and grants from the Chang Gang Medical Research Project to Dr. Y-C Tian and Dr. I-J Li (CMRPG3E0641∼3, CMRPG3E1581-2) and Dr. C-H Weng (CMRPG5H0111). The authors thanked the research assistant WenShiuan Lin for her outstanding technical support.

Fig. 9. IL-17A–induced activation of Smad2 and Smad3 is reduced by blockade of ERK1/2 activation. Cells were pretreated with U0126 (5 or 10 μM/mL) followed by stimulation with IL-17A (50 ng/mL) for 7.5 min. Cell lysates were subjected to immunoblotting to determine p-Smad2 and p-Smad3 levels. The presented results are representative of three independent experiments. Quantitative analysis of these Western blot analyses was displayed in the supplemental Fig. S15. The groupings of gels were cropped from different parts of the different gels of the same specimen.

References [1] J.Y. Li, K. McNicholas, T.Y. Yong, N. Rao, P.T. Coates, G.D. Higgins, R.P. Carroll, R.J. Woodman, M.Z. Michael, J.M. Gleadle, BK virus encoded microRNAs are present in blood of renal transplant recipients with BK viral nephropathy, Am. J. Transplant. 14 (5) (2014) 1183–1190. [2] U. Yapici, J. Kers, F.J. Bemelman, J.J. Roelofs, J.W. Groothoff, C.M. van der Loos, K.A. van Donselaar-van der Pant, M.M. Idu, N. Claessen, I.J. ten Berge, S. Florquin, Interleukin-17 positive cells accumulate in renal allografts during acute rejection

Authors’ contributions CHW conceived and performed most of the experiments. CHW, YJL, and HHW developed the methodology. HHH, SHL, and YCC analyzed 12

Biomedicine & Pharmacotherapy 123 (2020) 109741

C.-H. Weng, et al.

[3] [4]

[5]

[6]

[7]

[8]

[9] [10]

[11]

[12] [13] [14]

[15]

[16]

[17]

[18]

[19] [20] [21]

[22] [23]

[24]

[25]

[26]

[27]

[28]

oligodendrocyte progenitor cells, Glia 63 (5) (2015) 768–779. [29] A.A. Eddy, Overview of the cellular and molecular basis of kidney fibrosis, Kidney Int. Suppl. (2011) 4 (1) (2014) 2–8. [30] M. Zhang, D. Fraser, A. Phillips, ERK, p38, and Smad signaling pathways differentially regulate transforming growth factor-beta1 autoinduction in proximal tubular epithelial cells, Am. J. Pathol. 169 (4) (2006) 1282–1293. [31] F. Caraci, E. Gili, M. Calafiore, M. Failla, C. La Rosa, N. Crimi, M.A. Sortino, F. Nicoletti, A. Copani, C. Vancheri, TGF-beta1 targets the GSK-3beta/beta-catenin pathway via ERK activation in the transition of human lung fibroblasts into myofibroblasts, Pharmacol. Res. 57 (4) (2008) 274–282. [32] H.S. Kim, L. Luo, S.C. Pflugfelder, D.Q. Li, Doxycycline inhibits TGF-beta1-induced MMP-9 via Smad and MAPK pathways in human corneal epithelial cells, Invest. Ophthalmol. Vis. Sci. 46 (3) (2005) 840–848. [33] T. Hayashida, M. Decaestecker, H.W. Schnaper, Cross-talk between ERK MAP kinase and Smad signaling pathways enhances TGF-beta-dependent responses in human mesangial cells, FASEB J. 17 (11) (2003) 1576–1578. [34] P.J. Beisswenger, W.V. Brown, A. Ceriello, N.A. Le, R.B. Goldberg, J.P. Cooke, D.C. Robbins, S. Sarwat, H. Yuan, C.A. Jones, M.H. Tan, Meal-induced increases in C-reactive protein, interleukin-6 and tumour necrosis factor alpha are attenuated by prandial + basal insulin in patients with Type 2 diabetes, Diabet. Med. 28 (9) (2011) 1088–1095. [35] M. Tanaka, H. Ishii, Improvement in bedtime plasma glucose level serves as a predictor of long-term blood glucose control in patients with Type 2 diabetes: a study with monotherapy of 50/50 premixed insulin analogue three times daily injection, J. Diabetes Complicat. 25 (2) (2011) 83–89. [36] J.E. Turner, H.J. Paust, O.M. Steinmetz, U. Panzer, The Th17 immune response in renal inflammation, Kidney Int. 77 (12) (2010) 1070–1075. [37] S.A. Summers, D. Odobasic, M.B. Khouri, O.M. Steinmetz, Y. Yang, S.R. Holdsworth, A.R. Kitching, Endogenous IL-17A promotes pristane-induced systemic autoimmunity and lupus nephritis induced by pristane, Clin. Exp. Immunol. 176 (Jun. (3)) (2014) 341–350, https://doi.org/10.1111/cei.12287. [38] S.A. Summers, O.M. Steinmetz, M. Li, J.Y. Kausman, T. Semple, K.L. Edgtton, D.B. Borza, H. Braley, S.R. Holdsworth, A.R. Kitching, Th1 and Th17 cells induce proliferative glomerulonephritis, J. Am. Soc. Nephrol.: JASN 20 (12) (2009) 2518–2524. [39] Q. Zhang, H. Luan, L. Wang, F. He, H. Zhou, X. Xu, X. Li, Q. Xu, T. Niki, M. Hirashima, G. Xu, Y. Lv, J. Yuan, Galectin-9 ameliorates anti-GBM glomerulonephritis by inhibiting Th1 and Th17 immune responses in mice, American journal of physiology, Ren. Physiol. 306 (Apr. (8)) (2014) F822–F832. [40] J. Pindjakova, S.A. Hanley, M.M. Duffy, C.E. Sutton, G.A. Weidhofer, M.N. Miller, K.A. Nath, K.H. Mills, R. Ceredig, M.D. Griffin, Interleukin-1 accounts for intrarenal Th17 cell activation during ureteral obstruction, Kidney Int. 81 (4) (2012) 379–390. [41] X. Peng, Z. Xiao, J. Zhang, Y. Li, Y. Dong, J. Du, IL-17A produced by both gammadelta T and Th17 cells promotes renal fibrosis via RANTES-mediated leukocyte infiltration after renal obstruction, J. Pathol. 235 (1) (2015) 79–89. [42] G.C. Baldeviano, J.G. Barin, M.V. Talor, S. Srinivasan, D. Bedja, D. Zheng, K. Gabrielson, Y. Iwakura, N.R. Rose, D. Cihakova, Interleukin-17A is dispensable for myocarditis but essential for the progression to dilated cardiomyopathy, Circ. Res. 106 (10) (2010) 1646–1655. [43] S. Mi, Z. Li, H.Z. Yang, H. Liu, J.P. Wang, Y.G. Ma, X.X. Wang, H.Z. Liu, W. Sun, Z.W. Hu, Blocking IL-17A promotes the resolution of pulmonary inflammation and fibrosis via TGF-beta1-dependent and -independent mechanisms, J. Immunol. 187 (6) (2011) 3003–3014. [44] R. Mohamed, C. Jayakumar, F. Chen, D. Fulton, D. Stepp, R.T. Gansevoort, G. Ramesh, Low-dose IL-17 therapy prevents and reverses diabetic nephropathy, metabolic syndrome, and associated organ fibrosis, J. Am. Soc. Nephrol.: JASN 27 (3) (2016) 745–765. [45] B. Sun, H. Wang, L. Zhang, X. Yang, M. Zhang, X. Zhu, X. Ji, H. Wang, Role of interleukin 17 in TGF-beta signaling-mediated renal interstitial fibrosis, Cytokine 106 (2018) 80–88. [46] A. Thorenz, N. Volker, J.H. Brasen, R. Chen, M.S. Jang, S. Rong, H. Haller, T. Kirsch, G. Vieten, C. Klemann, F. Gueler, IL-17A blockade or deficiency does not affect progressive renal fibrosis following renal ischaemia reperfusion injury in mice, J. Pharm. Pharmacol. 69 (9) (2017) 1125–1135. [47] T. Habash, A. Saleh, S.K. Roy Chowdhury, D.R. Smith, P. Fernyhough, The proinflammatory cytokine, interleukin-17A, augments mitochondrial function and neurite outgrowth of cultured adult sensory neurons derived from normal and diabetic rats, Exp. Neurol. 273 (2015) 177–189. [48] D.M. Cortez, M.D. Feldman, S. Mummidi, A.J. Valente, B. Steffensen, M. Vincenti, J.L. Barnes, B. Chandrasekar, IL-17 stimulates MMP-1 expression in primary human cardiac fibroblasts via p38 MAPK- and ERK1/2-dependent C/EBP-beta, NF-kappaB, and AP-1 activation, American journal of physiology, Heart Circul. Physiol. 293 (6) (2007) H3356–65. [49] W. Qin, A.C. Chung, X.R. Huang, X.M. Meng, D.S. Hui, C.M. Yu, J.J. Sung, H.Y. Lan, TGF-beta/Smad3 signaling promotes renal fibrosis by inhibiting miR-29, J. Am. Soc. Nephrol.: JASN 22 (8) (2011) 1462–1474. [50] Y.C. Tian, A.O. Phillips, Interaction between the transforming growth factor-beta type II receptor/Smad pathway and beta-catenin during transforming growth factor-beta1-mediated adherens junction disassembly, Am. J. Pathol. 160 (5) (2002) 1619–1628. [51] C.L. Yen, Y.J. Li, H.H. Wu, C.H. Weng, C.C. Lee, Y.C. Chen, M.Y. Chang, T.H. Yen, H.H. Hsu, C.C. Hung, C.W. Yang, Y.C. Tian, Stimulation of transforming growth factor-beta-1 and contact with type I collagen cooperatively facilitate irreversible transdifferentiation in proximal tubular cells, Biomed. J. 39 (1) (2016) 39–49. [52] Z. Tan, X. Qian, R. Jiang, Q. Liu, Y. Wang, C. Chen, X. Wang, B. Ryffel, B. Sun, IL17A plays a critical role in the pathogenesis of liver fibrosis through hepatic stellate cell activation, J. Immunol. 191 (4) (2013) 1835–1844.

and are independent predictors of worse graft outcome, Transpl. Int. 24 (10) (2011) 1008–1017. Z. Zhang, V.C. Kyttaris, G.C. Tsokos, The role of IL-23/IL-17 axis in lupus nephritis, J. Immunol. 183 (5) (2009) 3160–3169. J.C. Crispim, R. Grespan, G. Martelli-Palomino, D.M. Rassi, R.S. Costa, L.T. Saber, F.Q. Cunha, E.A. Donadi, Interleukin-17 and kidney allograft outcome, Transplant. Proc. 41 (5) (2009) 1562–1564. C. Van Kooten, J.G. Boonstra, M.E. Paape, F. Fossiez, J. Banchereau, S. Lebecque, J.A. Bruijn, J.W. De Fijter, L.A. Van Es, M.R. Daha, Interleukin-17 activates human renal epithelial cells in vitro and is expressed during renal allograft rejection, J. Am. Soc. Nephrol.: JASN 9 (8) (1998) 1526–1534. X. Dong, L.A. Bachman, M.N. Miller, K.A. Nath, M.D. Griffin, Dendritic cells facilitate accumulation of IL-17 T cells in the kidney following acute renal obstruction, Kidney Int. 74 (10) (2008) 1294–1309. C. Cortvrindt, R. Speeckaert, A. Moerman, J.R. Delanghe, M.M. Speeckaert, The role of interleukin-17A in the pathogenesis of kidney diseases, Pathology 49 (3) (2017) 247–258. P. Mehrotra, J.A. Collett, S.D. McKinney, J. Stevens, C.M. Ivancic, D.P. Basile, IL-17 mediates neutrophil infiltration and renal fibrosis following recovery from ischemia reperfusion: compensatory role of natural killer cells in athymic rats, American journal of physiology, Ren. Physiol. 312 (3) (2017) F385–F397. A.R. Kitching, S.R. Holdsworth, The emergence of TH17 cells as effectors of renal injury, J. Am. Soc. Nephrol.: JASN 22 (2) (2011) 235–238. H.J. Paust, J.E. Turner, O.M. Steinmetz, A. Peters, F. Heymann, C. Holscher, G. Wolf, C. Kurts, H.W. Mittrucker, R.A. Stahl, U. Panzer, The IL-23/Th17 axis contributes to renal injury in experimental glomerulonephritis, J. Am. Soc. Nephrol.: JASN 20 (5) (2009) 969–979. C.F. Krebs, S. Lange, G. Niemann, A. Rosendahl, A. Lehners, C. Meyer-Schwesinger, R.A. Stahl, R.A. Benndorf, J. Velden, H.J. Paust, U. Panzer, H. Ehmke, U.O. Wenzel, Deficiency of the interleukin 17/23 axis accelerates renal injury in mice with deoxycorticosterone acetate+angiotensin ii-induced hypertension, Hypertension 63 (3) (2014) 565–571. S.L. Gaffen, Structure and signalling in the IL-17 receptor family, Nature reviews, Immunology 9 (8) (2009) 556–567. S.H. Chang, C. Dong, Signaling of interleukin-17 family cytokines in immunity and inflammation, Cell. Signal. 23 (7) (2011) 1069–1075. M. Iyoda, T. Shibata, M. Kawaguchi, N. Hizawa, T. Yamaoka, F. Kokubu, T. Akizawa, IL-17A and IL-17F stimulate chemokines via MAPK pathways (ERK1/2 and p38 but not JNK) in mouse cultured mesangial cells: synergy with TNF-alpha and IL-1beta, American journal of physiology, Ren. Physiol. 298 (3) (2010) F779–87. G.J. Zijlstra, N.H. Ten Hacken, R.F. Hoffmann, A.J. van Oosterhout, I.H. Heijink, Interleukin-17A induces glucocorticoid insensitivity in human bronchial epithelial cells, Eur. Respir. J. 39 (2) (2012) 439–445. Y. Hirai, M. Iyoda, T. Shibata, Y. Kuno, M. Kawaguchi, N. Hizawa, K. Matsumoto, Y. Wada, F. Kokubu, T. Akizawa, IL-17A stimulates granulocyte colony-stimulating factor production via ERK1/2 but not p38 or JNK in human renal proximal tubular epithelial cells, Am. J. Physiol. Renal Physiol. 302 (2) (2012) F244–50. R. Vittal, L. Fan, D.S. Greenspan, E.A. Mickler, B. Gopalakrishnan, H. Gu, H.L. Benson, C. Zhang, W. Burlingham, O.W. Cummings, D.S. Wilkes, IL-17 induces type V collagen overexpression and EMT via TGF-beta-dependent pathways in obliterative bronchiolitis, Am. J. Physiol. Lung Cell. Mol. Physiol. 304 (6) (2013) L401–14. L. Xue, K. Xie, X. Han, Z. Yang, J. Qiu, Z. Zhao, T. Bao, Detrimental functions of IL17A in renal ischemia-reperfusion injury in mice, J. Surg. Res. 171 (1) (2011) 266–274. R. Derynck, X.H. Feng, TGF-beta receptor signaling, Biochim. Biophys. Acta 1333 (2) (1997) F105–50. W. Wang, V. Koka, H.Y. Lan, Transforming growth factor-beta and Smad signalling in kidney diseases, Nephrology 10 (1) (2005) 48–56. Y.C. Tian, C.C. Hung, Y.J. Li, Y.C. Chen, M.Y. Chang, T.H. Yen, H.H. Hsu, M.S. Wu, A. Phillips, C.W. Yang, Leptospira santorosai serovar shermani detergent extract induces an increase in fibronectin production through a toll-like receptor 2-mediated pathway, Infect. Immun. 79 (3) (2011) 1134–1142. Y.C. Tian, A.O. Phillips, TGF-beta1-mediated inhibition of HK-2 cell migration, J. Am. Soc. Nephrol.: JASN 14 (3) (2003) 631–640. P.D. de Menezes Neves, J.R. Machado, M.A. dos Reis, A.C. Faleiros, S.A. de Lima Pereira, D.B. Rodrigues, Distinct expression of interleukin 17, tumor necrosis factor alpha, transforming growth factor beta, and forkhead box P3 in acute rejection after kidney transplantation, Ann. Diagn. Pathol. 17 (1) (2013) 75–79. J. Velden, H.J. Paust, E. Hoxha, J.E. Turner, O.M. Steinmetz, G. Wolf, W.J. Jabs, F. Ozcan, J. Beige, P.J. Heering, S. Schroder, U. Kneissler, E. Disteldorf, H.W. Mittrucker, R.A. Stahl, U. Helmchen, U. Panzer, Renal IL-17 expression in human ANCA-associated glomerulonephritis, American journal of physiology, Ren. Physiol. 302 (12) (2012) F1663–73. Y.C. Tian, Y.C. Chen, C.T. Chang, C.C. Hung, M.S. Wu, A. Phillips, C.W. Yang, Epidermal growth factor and transforming growth factor-beta1 enhance HK-2 cell migration through a synergistic increase of matrix metalloproteinase and sustained activation of ERK signaling pathway, Exp. Cell Res. 313 (11) (2007) 2367–2377. Y.C. Tian, Y.C. Chen, C.C. Hung, C.T. Chang, M.S. Wu, A.O. Phillips, C.W. Yang, Leptospiral outer membrane protein induces extracellular matrix accumulation through a TGF-beta1/Smad-dependent pathway, J. Am. Soc. Nephrol.: JASN 17 (10) (2006) 2792–2798. Y.C. Tian, D. Fraser, L. Attisano, A.O. Phillips, TGF-beta1-mediated alterations of renal proximal tubular epithelial cell phenotype, Am. J. Physiol. Ren. Physiol. 285 (1) (2003) F130–42. J.M. Rodgers, A.P. Robinson, E.S. Rosler, K. Lariosa-Willingham, R.E. Persons, J.C. Dugas, S.D. Miller, IL-17A activates ERK1/2 and enhances differentiation of

13