- Email: [email protected]
Smad pathways
G Model YDLD-4165; No. of Pages 7
ARTICLE IN PRESS Digestive and Liver Disease xxx (2019) xxx–xxx
Contents lists available at ScienceDirect
Digestive and Liver Disease journal homepage: www.elsevier.com/locate/dld
Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways Cai Chen a , Xiankui Li b,∗ , Lei Wang c a b c
Teaching and Research Centre, Faculty of Medicine, Xinyang Vocational and Technical College, Xinyang, China Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Tianjin Medical University, Tianjin, China Department of Respiratory Medicine, First Affiliated Hospital of Zhengzhou University, Zhengzhou, China
a r t i c l e
i n f o
Article history: Received 19 April 2019 Accepted 5 August 2019 Available online xxx Keywords: Cholestatic liver fibrosis PDGFR TGF1 Thymosin4
a b s t r a c t Liver fibrosis is an important health problem without adequate and effective therapeutics. In this study, effects of thymosin4 (T4) on hepatic fibrogenesis and the underlying molecular mechanisms were explored in bile duct ligation (BDL)-induced mice cholestatic liver fibrosis model. Results showed exogenous T4 significantly reduced the mortality and liver/body weight ratio in BDL mice. Histological examinations and biochemical analyses demonstrated that BDL induced evident portal fibrosis and a significant increase in hepatic collagen contents. However, these changes were significantly attenuated by exogenous T4. Quantitative real-time PCR assays showed that T4 suppressed BDL-induced increases in many fibrotic genes expression including ␣-smooth muscle actin (␣-SMA), collagen I, III and fibronectin, TGF1, TGFR II, Smad2, Smad3, and PDGFR. Results from immunohistochemistry and Western blots also showed that T4 reduced TGF1 and PDGFR protein levels in the liver tissues of BDL mice. In vitro studies using LX-2 cells demonstrated that T4 could decrease PDGFR and TGFR II levels in hepatic stellate cells. Taken together, findings in our present studies suggested that exogenous T4 alleviated BDL-induced cholestatic liver fibrosis through downregulating PDGF/PDGFR and TGF/Smad pathways. © 2019 Published by Elsevier Ltd on behalf of Editrice Gastroenterologica Italiana S.r.l.
1. Introduction Liver fibrosis is the major consequence of many chronic liver injuries from a diversity of causes including chronic viral hepatitis, drugs, autoimmune response, alcoholism, parasitic diseases, metabolic disorders and cholestasis [1]. Due to the lack of effective therapies, liver fibrosis continues to be an important medical problem with significant morbidity and mortality worldwide [1,2]. If not treated, liver fibrosis can progress to cirrhosis and eventually liver failure or hepatocellular carcinoma (HCC) [1,3,4]. Liver transplantation is currently regarded as the only curative therapy but is still mostly unavailable [1]. At present, a lot of efforts are devoted to understanding the molecular mechanisms of liver fibrosis and developing new therapies [5–7]. Thymosin4 (T4) is a small acidic peptide with a molecular weight of 5 kD and exists widely in our body. It was originally identified as the main intracellular G-actin sequestering molecule [8]. Recent studies suggested that besides cytoskeleton regulation
∗ Corresponding author at: Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Tianjin Medical University, Tianjin 300070, China. E-mail address: [email protected] (X. Li).
[9], T4 harbored multiple functions including regulation of the physiological homeostasis of the liver [10–13]. In vitro cultured cell experiments [14,15] demonstrated that T4 treatment inhibited activation of hepatic stellate cells (HSCs), central players in liver fibrosis [7]. T4 treatment also inhibited HSCs activation in vivo in carbon tetrachloride-induced acute liver injuries [16,17]. In our previous work [17], we found that exogenous T4 could suppress carbon tetrachloride-induced liver fibrosis in rats. In the present study, the anti-fibrotic activities of T4 and the underlying molecular mechanisms were further investigated in mice cholestatic liver fibrosis models. Our results indicated that T4 could also alleviate cholestatic liver fibrosis through downregulating PDGFR and TGF/Smad pathways. 2. Materials and methods 2.1. Reagents Synthetic thymosin 4 (HPLC > 98%) was bought from GL Biochem. (Shanghai) Ltd. and dissolved in 0.9% saline. Trizol reagent was bought from Invitrogen (Shanghai, China). Reverse transcriptase was from Takara (Dalian, China). SYBR green qPCR master mix was bought from Transgen BioTech (Beijing, China). Primers
https://doi.org/10.1016/j.dld.2019.08.014 1590-8658/© 2019 Published by Elsevier Ltd on behalf of Editrice Gastroenterologica Italiana S.r.l.
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model
ARTICLE IN PRESS
YDLD-4165; No. of Pages 7
C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
2 Table 1 Primer sets. Gene name GAPDH ˛-SMA Col1a1 Col1a2 Col3a1 Fibronectin TGFˇ1 TGFˇRII Smad2 Smad3 PDGFRˇ
Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse:
Primer sequence
Product size
aaggtcatcccagagctgaa ctgcttcaccaccttcttga gaggcaccactgaaccctaa catctccagagtccagcaca acgccatcaaggtctactgc actcgaacgggaatccatcg ccaagggtgctactggactc gctcacccttgttaccggat ccagtggccataatggggaa atctcgacctggctgaccat cactgcagaaccagaggagg atggcgtaatgggaaaccgt gtgtggagcaacatgtggaactcta ttggttcagccactgccgta tacgagcccccatttggttc ccagcactcggtcaaagtct gtatggacacaggctctccg accagaatgcaggttccgag ctccaaacctctccccgaat gagttggaggggtcagtgaa gtggagattcgcaggaggtc accgtcagagctcacagact
138 bp 154 bp 159 bp
received an intraperitoneal injection of 100 g T4 (200 l) every other day. The survival status of the mice was checked and recorded every day. At day 16 after surgery mice were weighed and then sacrificed by cervical dissociation under 5% isoflurane anesthesia. The livers were promptly removed, weighted and processed for the following histological and biochemical examinations. 2.4. Hydroxyproline (Hyp) content determination
165 bp
143 bp
Hepatic hydroxyproline (Hyp) content was determined using a commercially available kit from Nanjing Jiancheng Institute of Biotechnology (Nanjing, China) according to the manufacturer’s instruction. The results were expressed as microgram of hydroxyproline per gram of wet liver tissue.
156 bp
2.5. Histology
122 bp 130 bp
105 bp 187 bp 185 bp
(Table 1) were synthesized by GENEWIZ (Suzhou, China). TGF-1 antibody (Cat: 21898-1-AP) and GAPDH antibody (Cat: 60004-1-Ig) were obtained from Proteintech (Wuhan, China). PDGFR antibody (Cat: ab69506) was obtained from Abcam (Shanghai, China). TGFR II antibody (Cat: sc-17791) was purchased from Santa Cruz Biotechnology (Shanghai, China). Secondary antibodies against rabbit (Cat: 111-035-003) and mouse (Cat: 115-035-003) were bought from Jackson ImmunoResearch (Baltimore, Maryland, USA). Immobilon enhanced chemiluminescence (ECL) reagent (Cat: WBKLS0500) was purchased from Millipore (Darmstadt, Germany). All other reagents were of analytic grade. 2.2. Mice and hepatic fibrosis model Male Balb/c mice (6 weeks old, weighing ∼20 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). The mice were maintained under a specificpathogen-free (SPF) environment with a 12 h light/dark cycle and offered ad libitum access to food and water. All mice were accustomed to the environment for a week before experiments were performed. All mice received humane care and all experiments were done according to the guidelines of the Animal Welfare Act and the Guide for Care and Use of Laboratory Animals from the National Institutes of Health. The experimental protocols were approved by the Institutional Animal Care and Use Committee of Tianjin Medical University and in accordance with the Helsinki Declaration and with implications for replacement, refinement or reduction (the 3Rs) principle. Hepatic fibrosis model was established in mice by bile duct ligation for 16 days. Surgery of bile duct ligation (BDL) was performed under anesthesia with 4% chloral hydrate (0.2 ml/20 g) according to the previously published protocol [18].
Liver tissues were fixed in 10% neutral buffered formalin, processed routinely, and embedded in paraffin. For histological examinations, 4 m-thick sections of liver tissues were subjected to hematoxylin-eosin (H.E.) and Sirius red stains according to standard procedures. Liver fibrosis was evaluated and scored according to the Ishak scoring system by an independent pathologist blinded to the experimental protocols [19,20]. Sirius red positive area was semi-quantitatively analyzed using Image J free software (http:// rsb.info.nih.gov/ij/). 2.6. Quantitative real-time RT-PCR assays About 100 mg of liver tissue was used to extract total RNA using Trizol reagent according to the manufacturer’s manual. Two micrograms of total RNA was used to synthesize cDNA in a 20 l reaction system. Then 1 l cDNA was used for the following quantitative real-time PCR assays using SYBR green master mix (Transgen BioTech, Beijing, China). Gene expression levels were analyzed in triplicate using the Ct method. GAPDH was used as an internal control. 2.7. Immunohistochemistry Immunohistochemistry was performed according to standard methods. Briefly, liver sections were deparaffinized, rehydrated and incubated in 3% H2 O2 for 10 min to block endogenous peroxidase activities. Antigen retrieval was performed in a microwave oven for 15 min. 5% BSA was used to block non-specific protein binding. Then liver slices were probed with specific primary antibodies against TGF-1 (1:200) and PDGFR (1:100) overnight in a humidified chamber at 4 ◦ C. After two washes with PBS, liver slices were incubated with biotinylated secondary antibody followed by incubation with streptavidin–peroxidase complex. Then liver slices were developed with diaminobenzidine (DAB) chromogen and lightly counter-stained with hematoxylin. After mounting with mounting medium liver slices were evaluated under a light microscope. Brown area against a blue hematoxylin background was positively stained.
2.3. Animal treatments and experimental groups
2.8. Western blot
Forty mice were used in this study and were divided into four groups including the control group (n = 4), sham BDL group (n = 6), BDL group (n = 18) and BDL + T4 group (n = 12). Mice in the control group received no operation. Mice in the sham BDL group received laparotomy to open the abdominal cavity but without BDL. Mice in the BDL group were subjected to BDL surgery and then received an intraperitoneal injection of 200 l 0.9% saline every other day. Mice in BDL + T4 group were subjected to BDL surgery and then
Cultured cells or mice liver tissues were lysed in RIPA lysis buffer (Pierce, Rockford, Illinois, USA) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, St. Louis, Missouri, USA), a protease inhibitor cocktail (Amresco, Solon, Ohio, USA) and phosphostop (Roche Diagnostics, Indianapolis, Indiana, USA). The lysates were centrifuged at 14,000 × g for 10 min at 4 ◦ C. The protein concentration in the supernatant was determined by BCA kits (Pierce, Rockford, Illinois, USA). The protein samples
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
3
Fig. 1. Exogenous T4 treatment in bile-duct ligated mice. (A) Kaplan–Meier survival analysis of the mice after bile duct ligation. T4 treatment significantly increased the survival of bile-duct ligated mice. (B) Liver/body weight ratio. T4 treatment significantly reduced the liver/body weight ratio of bile-duct ligated mice. *P < 0.05 vs. control group. # P < 0.05 vs. BDL group. (C) Hydroxyproline content in the liver tissues. T4 treatment significantly reduced the hepatic hydroxyproline content in bile-duct ligated mice. *P < 0.05 vs. control group. # P < 0.05 vs. BDL group.
were subjected to SDS-PAGE (10%) and transferred onto a 0.2-m PVDF membrane (Millipore, Darmstadt, Germany). After blocking with 5% skimmed milk the membranes were probed with specific primary antibodies against TGF-1 (1:1000), TGFR II (1:2000), PDGFR (1:1000) and GAPDH (1:10,000) overnight at 4 ◦ C. Then the membranes were incubated with horseradish peroxidase (HRP)conjugated goat anti-rabbit or goat anti-mouse secondary antibody (1:20,000) at room temperature for 1 h. Finally, the membranes were developed and visualized using Immobilon enhanced chemiluminescence (ECL). The pictures were captured using a GelDoc XR System (Bio-Rad, Shanghai, China). Image J free software (http:// rsb.info.nih.gov/ij/) was used to analyze the protein bands densities.
2.10. Statistical analyses
2.9. LX-2 cell culture and Tˇ4 treatment
In the control group, no mice died (n = 4). In sham BDL group, one mouse died (n = 6). In BDL group, 18 mice were subject to operation and at day 16 after operation 9 mice were left alive; the mortality in the BDL group was 50%. In BDL + T4 group, 12 mice were subjected to operation and at day 16 after operation 8 mice were left alive; the mortality in BDL + T4 group was about 33.33%. Kaplan–Meier survival analyses indicated that compared with the BDL group, the overall survival of the mice in BDL + T4 group was significantly increased by T4 treatment (Fig. 1A). At day 16 after surgery, the mice subject to BDL operation presented with jaundice in the visceral and parietal peritonea; the livers were also enlarged and the bile ducts above the obstruction point were dilated. The liver/body weight ratio was significantly increased in the BDL group compared to the control group; however, it was significantly lowered by
Human hepatic stellate cell line, LX-2, was bought from China Center for Type Culture Collection and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco-BRL, Gasthersburg, MD, USA) supplemented with 10% fetal bovine serum (FBS) (GibcoBRL, Gasthersburg, MD, USA), 100U/ml penicillin and 100 g/ml streptomycin. LX-2 cells were incubated in a humidified incubator containing 95% air and 5% CO2 at 37 ◦ C. The media were replenished every 3 days. Before experiments, LX-2 cells were starved in DMEM with 0.1% FBS for 24 h. Then the starved cells were treated with T4 for 24 h at the concentration of 0 ng/ml, 100 ng/ml and 300 ng/ml. Then the cells were lysed in RIPA lysis buffer and the cell lysates were used for Western blots assays.
SPSS 21.0 version for Windows (SPSS Inc., Chicago, Illinois, USA) was employed to do all the statistical analyses in this study. Kaplan–Meier method with the log-rank test was used to analyze the overall survival of mice. One-way ANOVA was used to test the difference between groups. Student’s t-test was used to compare the difference between the two groups. P < 0.05 was considered as statistically significant. 3. Results 3.1. Survival and macroscopic findings
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
4
Fig. 2. Histological examinations of the liver tissues. (A) Hematoxylin-eosin (H.E.) staining. (B) Sirius red staining. (C) Quantitative analysis of the H.E. stained liver sections according to the Ishak scoring system. *P < 0.05 vs. control group. # P < 0.05 vs. BDL group. (D) Quantitative analyses of Sirius red positive area. *P < 0.05 vs. Control group. # P < 0.05 vs. BDL group.
T4 treatment in the BDL + T4 group compared to the BDL group (Fig. 1B).
3.2. Hepatic collagen content and histological findings Hepatic collagen content was quantified by determining the hepatic hydroxyproline content. As indicated in Fig. 1C, hepatic hydroxyproline content was significantly increased in the BDL group compared to the control; however, it was significantly lowered by T4 treatment in the BDL + T4 group compared to the BDL group. Histological examinations through H.E. staining (Fig. 2A) and Sirius red staining (Fig. 2B) demonstrated that bile duct ligation induced evident portal fibrosis. Quantitative analyses showed that BDL-induced fibrosis was significantly reduced by T4 treatment (Fig. 2C and D).
3.3. Expression of fibrotic protein markers Quantitative real-time PCR assays were performed to determine the mRNA levels of the fibrotic proteins in the liver tissues. As shown in Fig. 3, compared with control group, expression levels of the fibrotic genes including ␣-smooth muscle actin (␣-SMA), collagen I (Col1a1, Col1a2), collagen III (Col3a1) and fibronectin (FN) in BDL group were significantly increased by bile duct ligation (BDL) operation; however, these increases were prominently suppressed by T4 in BDL + T4 group compared with the BDL group.
3.4. PDGFRˇ and TGFˇ/Smad pathway Quantitative real-time PCR assays, immunohistochemistry, and Western blots were employed to evaluate the expression of PDGFR and genes in the TGF/Smad pathway in the liver tissues. As shown in Fig. 3, the mRNA levels of PDGFR, TGF-1, TGFR II, and the downstream Smad2, Smad3 were apparently increased by bile duct ligation operation but were significantly suppressed by T4. Results from immunohistochemistry and Western blots also showed that the protein levels of PDGFR and TGF-1 in the liver tissues were elevated in BDL group as compared with the control group, but were greatly inhibited in BDL + T4 group compared with BDL group (Fig. 4A and B). During hepatic fibrosis PDGF and TGF can promote hepatic stellate cell (HSC) activation; what’s more, HSC activation plays a central role in liver fibrosis [7]. So, in the present study influences of T4 on PDGF/PDGFR and TGF/Smad pathways were also investigated in vitro using human HSC cell line LX-2. As indicated in Fig. 5, T4 treatment dose-dependently decrease PDGFR and TGFRII levels in LX-2 cells. These results suggested that T4 exerts inhibitory effects on PDGF/PDGFR and TGF/Smad pathways in HSC cells. 4. Discussion Results from our present study showed that T4 could reduce bile duct ligation induced cholestatic liver fibrosis in mice, which confirmed our previous conclusion that T4 harbored anti-fibrotic
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
5
Fig. 3. The mRNA levels revealed by quantitative real-time PCR assays (n = 3). Expression levels were expressed as folds change relative to the control group. Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as an internal control. *P < 0.05 vs. Control group. # P < 0.05 vs. BDL group.
Fig. 4. Detection of TGF1 and PDGFR in liver tissues. (A) Immunohistochemistry. Four liver sections were randomly selected from each group and used for immunohistochemistry. Here showed the representative figures of immunohistochemistry. (Original magnification: 400×) (B) Western blots. Representative Western blot results from three repeats were shown here. Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as a loading control. (C) Quantitative analyses of Western blots results. Values represent the mean ± SD (n = 3). *P < 0.05 vs. control group. # P < 0.05 vs. BDL group.
activity in the livers [17]. Further investigation showed that it might be through downregulation of PDGFR, TGF-1, TGFR II, and Smad2, Smad3 expression T4 alleviated cholestatic liver fibrosis. T4 was originally isolated and identified from calf thymus in the 1980s and thought to be a thymic hormone [21]. The following studies found that T4 was widely expressed in our
body and acted as the main G-actin sequestering molecule in the cell to regulate cytoskeleton dynamics [8,21]. In 1999, Kleinman et al. first reported that T4 could accelerate skin wound healing [22]. And from then on, more and more investigations were performed to study the role of T4 in wound healing in many organs including skin [10,23], heart [11], cornea [12], lung [24], kid-
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7 6
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
Fig. 5. Effects of T4 on the expression of TGFR II and PDGFR in LX-2 cells. (A) Representative Western blots result from three repeat experiments. (B) Quantitative analyses of Western blots results. Values are means of triplicate experiments ±SD. *P < 0.05 vs. control group. # P < 0.05 vs. BDL group.
ney [25] and liver [13,26,27]. Local treatment with T4 promoted incisional skin wound repair with fewer myofibroblast and minimal scarring [28]. Intraperitoneal administration of T4 reduced bleomycin-induced lung damage and fibrosis through suppression of inflammation [24,29–32]. In the kidney, loss of endogenous T4 accelerates glomerular disease [33]; treatment with exogenous T4 reduced early diabetic nephropathy [34] and suppressed unilateral ureteral obstruction (UUO)-induced renal interstitial fibrosis [25]. Recently, several in vitro and in vivo studies suggested that exogenous T4 also harbored anti-fibrotic potential in the livers [13–15,27] although the pathophysiological role of endogenous T4 in the livers was unclear [13]. Our recent published works first gave the in vivo evidence that exogenous T4 treatment could suppress liver fibrosis induced by carbon tetrachloride [17]. However, the underlying molecular mechanisms of exogenous T4 against liver fibrosis remain elusive. In this study, the anti-fibrotic activity and the underneath mechanisms of T4 were further investigated in bile duct ligation induced cholestatic liver fibrosis model. BDL induced cholestatic liver fibrosis model (BDL model) is widely used to mimic human hepatic fibrosis and attracts many investigators to study the etiology and pathology, as well as the anti-fibrotic therapeutics [4,35,36]. BDL model is regarded as a representative chronic liver injury model which is mediated by biliary obstruction and subsequent cholestasis [37]. Double ligation of bile duct causes the abnormal flux of bile acids and bilirubin in the liver. Toxic hydrophobic bile salts subsequently accumulate within hepatocytes causing successive inflammatory reactions, hepatocyte death and peri-ductular fibrosis [38]. Liver fibrosis is featured by collagen and extracellular matrix proteins deposition in the liver tissues [39]. Activated hepatic stellate cells (HSCs) are the key cells responsible for collagen deposition and play a central role in hepatic fibrogenesis [7]. In this study, our results showed that in BDL mice exogenous T4 treatment reduced collagen deposition and suppressed ␣-SMA expression, a marker of HSCs activation, which suggested that exogenous T4 treatment inhibited HSCs activation. HSC activation is one of the most important steps during hepatic fibrosis. Many factors including TGF1 and PDGF can activate HSCs. TGF1 plays a master role in HSCs activation [40]. TGF1 initiates intracellular signaling by binding to TGF receptor type II (TGFR II) and then activates TGF receptor type I (TGFR I) kinase, resulting in activation of the downstream effector proteins Smad2 and Smad3 by phosphorylation. Subsequently, Smad2 and Smad3 form oligomeric complexes with Smad4 and translocate to the nucleus, where they promote many fibrotic genes expression including ␣1 and ␣2 type I collagen, tissue inhibitor metalloproteinase-1 and -2 (TIMP-1, TIMP-2) and plasminogen activator inhibitor (PAI)-1
[41,42]. Smad2 and Smad3 were both strongly activated in liver fibrosis [43]. Smad3 knock-out primary HSCs showed lower collagen expression [40]. Inhibiting TGF/Smad pathway is a promising strategy to treat liver fibrosis disorders [44]. Results from our present study showed that T4 reduced expression levels of TGF1, TGFR II, Smad2, and Smad3 in the liver tissues of mice with BDL operation. in vitro study also showed that T4 reduced TGFR II expression level in human hepatic stellate cells LX-2. These results indicated that T4 reduced cholestatic liver fibrosis via inhibiting TGF/Smad pathway. PDGF is the most potent mitogen for HSCs and stimulates HSCs proliferation and migration [45]. Overexpressing PDGF in transgenic mice induced hepatic fibrosis [46–48]. Antagonist against PDGF reduced experimental liver fibrosis [45]. HSCs express both ␣- and -receptor types for PDGF. PDGF stimulates HSCs proliferation through binding PDGFR␣ and PDGFR receptors and activating the downstream ERK/MAPK and Akt/PKB signaling pathways [45]. in vitro and in vivo evidence showed that during HSCs activation only PDGFR was upregulated [45]. PDGFR is an important player in liver fibrogenesis and inhibiting PDGFR signaling will attenuate liver fibrosis [49–51]. Nowadays, the PDGF/PDGFR pathway has been a drug target in treating liver fibrosis [52]. In the present study, our results showed that T4 significantly decreased PDGFR expression in vivo and in vitro, which indicated the inhibitory effects of T4 on PDGF/PDGFR signaling pathway during hepatic fibrosis.
5. Conclusions In summary, findings in this study suggested that exogenous T4 exerted inhibitory effects on cholestatic liver fibrosis induced by bile duct ligation through downregulating PDGF/PDGFR and TGF/Smad pathways.
Acknowledgments This work was supported by Tianjin Research Program of Application Foundation and Advanced Technology (No. 15JCQNJC12900), Henan Research Program of Medical Science and Technology (No. 201403057) and Natural Science Foundation of China (No. U1504801).
Conflict of interest None declared.
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
References [1] Zhang CY, Yuan WG, He P, et al. Liver fibrosis and hepatic stellate cells: etiology, pathological hallmarks and therapeutic targets. World J Gastroenterol 2016;22:10512–22. [2] Tsukada S, Parsons CJ, Rippe RA. Mechanisms of liver fibrosis. Clin Chim Acta 2006;364:33–60. [3] Pinzani M. Pathophysiology of liver fibrosis. Dig Dis 2015;33:492–7. [4] Tag CG, Weiskirchen S, Hittatiya K, Tacke F, Tolba RH, Weiskirchen R. Induction of experimental obstructive cholestasis in mice. Lab Anim 2015;49:70–80. [5] Koyama Y, Brenner DA. New therapies for hepatic fibrosis. Clin Res Hepatol Gastroenterol 2015;39(Suppl 1):S75–9. [6] Koyama Y, Xu J, Liu X, Brenner DA. New developments on the treatment of liver fibrosis. Dig Dis 2016;34:589–96. [7] Tsuchida T, Friedman SL. Mechanisms of hepatic stellate cell activation. Nat Rev Gastroenterol Hepatol 2017;14:397–411. [8] Crockford D, Turjman N, Allan C, Angel J. Thymosin beta4: structure, function, and biological properties supporting current and future clinical applications. Ann N Y Acad Sci 2010;1194:179–89. [9] Renault L. Intrinsic, functional, and structural properties of beta-thymosins and beta-thymosin/WH2 domains in the regulation and coordination of actin self-assembly dynamics and cytoskeleton remodeling. Vitam Horm 2016;102:25–54. [10] Kleinman HK, Sosne G. Thymosin beta4 promotes dermal healing. Vitam Horm 2016;102:251–75. [11] Pipes GT, Yang J. Cardioprotection by thymosin beta 4. Vitam Horm 2016;102:209–26. [12] Sosne G, Rimmer D, Kleinman HK, Ousler G. Thymosin beta 4: a potential novel therapy for neurotrophic keratopathy, dry eye, and ocular surface diseases. Vitam Horm 2016;102:277–306. [13] Kim J, Jung Y. Potential role of thymosin beta 4 in liver fibrosis. Int J Mol Sci 2015;16:10624–35. [14] Reyes-Gordillo K, Shah R, Popratiloff A, Fu S, Hindle A, Brody F, et al. Thymosinbeta4 (Tbeta4) blunts PDGF-dependent phosphorylation and binding of AKT to actin in hepatic stellate cells. Am J Pathol 2011;178:2100–8. [15] Barnaeva E, Nadezhda A, Hannappel E, Sjogren MH, Rojkind M. Thymosin beta4 upregulates the expression of hepatocyte growth factor and downregulates the expression of PDGF-beta receptor in human hepatic stellate cells. Ann N Y Acad Sci 2007;1112:154–60. [16] Reyes-Gordillo K, Shah R, Arellanes-Robledo J, Rojkind M, Lakshman MR. Protective effects of thymosin beta4 on carbon tetrachloride-induced acute hepatotoxicity in rats. Ann N Y Acad Sci 2012;1269:61–8. [17] Li X, Wang L, Chen C. Effects of exogenous thymosin beta4 on carbon tetrachloride-induced liver injury and fibrosis. Sci Rep 2017;7:5872. [18] Tag CG, Sauer-Lehnen S, Weiskirchen S, Borkham-Kamphorst E, Tolba RH, Tacke F, et al. Bile duct ligation in mice: induction of inflammatory liver injury and fibrosis by obstructive cholestasis. J Vis Exp 2015:52438. [19] Knodell RG, Ishak KG, Black WC, Chen TS, Craig R, Kaplowitz N, et al. Formulation and application of a numerical scoring system for assessing histological activity in asymptomatic chronic active hepatitis. Hepatology 1981;1:431–5. [20] Ishak K, Baptista A, Bianchi L, Callea F, De Groote J, Gudat F, et al. Histological grading and staging of chronic hepatitis. J Hepatol 1995;22:696–9. [21] Hannappel E. Beta-thymosins. Ann N Y Acad Sci 2007;1112:21–37. [22] Malinda KM, Sidhu GS, Mani H, Banaudha K, Maheshwari RK, Goldstein AL, et al. Thymosin beta4 accelerates wound healing. J Invest Dermatol 1999;113:364–8. [23] Li X, Zheng L, Peng F, Qi C, Zhang X, Zhou A, et al. Recombinant thymosin beta 4 can promote full-thickness cutaneous wound healing. Protein Expr Purif 2007;56:229–36. [24] Conte E, Genovese T, Gili E, Esposito E, Iemmolo M, Fruciano M, et al. Protective effects of thymosin beta4 in a mouse model of lung fibrosis. Ann N Y Acad Sci 2012;1269:69–73. [25] Zuo Y, Chun B, Potthoff SA, Kazi N, Brolin TJ, Orhan D, et al. Thymosin beta4 and its degradation product, Ac-SDKP, are novel reparative factors in renal fibrosis. Kidney Int 2013;84:1166–75. [26] Jiang Y, Han T, Zhang ZG, Li M, Qi FX, Zhang Y, et al. Potential role of thymosin beta 4 in the treatment of nonalcoholic fatty liver disease. Chronic Dis Transl Med 2017;3:165–8. [27] Lakshman MR, Reyes-Gordillo K, Varatharajalu R, Arellanes-Robledo J, Leckey LC, Garige M, et al. Novel modulators of hepatosteatosis, inflammation and fibrogenesis. Hepatol Int 2014;8(Suppl. 2):413–20.
7
[28] Ehrlich HP, Hazard 3rd SW. Thymosin beta4 enhances repair by organizing connective tissue and preventing the appearance of myofibroblasts. Ann N Y Acad Sci 2010;1194:118–24. [29] Conte E, Genovese T, Gili E, Esposito E, Iemmolo M, Fruciano M, et al. Thymosin beta4 protects C57BL/6 mice from bleomycin-induced damage in the lung. Eur J Clin Invest 2013;43:309–15. [30] Conte E, Iemmolo M, Fruciano M, Fagone E, Gili E, Genovese T, et al. Effects of thymosin 4 and its N-terminal fragment Ac-SDKP on TGF--treated human lung fibroblasts and in the mouse model of bleomycin-induced lung fibrosis. Expert Opin Biol Ther 2015;15:211–21. [31] Conte E, Iemmolo M, Fagone E, Gili E, Fruciano M, Genovese T, et al. Thymosin beta4 reduces IL-17-producing cells and IL-17 expression, and protects lungs from damage in bleomycin-treated mice. Immunobiology 2014;219:425–31. [32] Li XK, Chen C, Wang L, Li ZJ, Ren CZ. Thymosin 4 alleviates bleomycin-induced lung damage through inhibiting nitrative thioredoxin-1 inactivation. Int J Clin Exp Med 2016;9:6138–42. [33] Vasilopoulou E, Kolatsi-Joannou M, Lindenmeyer MT, White KE, Robson MG, Cohen CD, et al. Loss of endogenous thymosin beta4 accelerates glomerular disease. Kidney Int 2016;90:1056–70. [34] Zhu J, Su LP, Zhou Y, Ye L, Lee KO, Ma JH. Thymosin 4 attenuates early diabetic nephropathy in a mouse model of type 2 diabetes mellitus. Am J Ther 2015;22:141–6. [35] Liedtke C, Luedde T, Sauerbruch T, Scholten D, Streetz K, Tacke F, et al. Experimental liver fibrosis research: update on animal models, legal issues and translational aspects. Fibrogenesis Tissue Repair 2013;6:19. [36] Popov Y, Schuppan D. Targeting liver fibrosis: strategies for development and validation of antifibrotic therapies. Hepatology 2009;50:1294–306. [37] Heinrich S, Georgiev P, Weber A, Vergopoulos A, Graf R, Clavien PA. Partial bile duct ligation in mice: a novel model of acute cholestasis. Surgery 2011;149:445–51. [38] Han JM, Kim HG, Choi MK, Lee JS, Park HJ, Wang JH, et al. Aqueous extract of Artemisia iwayomogi Kitamura attenuates cholestatic liver fibrosis in a rat model of bile duct ligation. Food Chem Toxicol 2012;50:3505–13. [39] Hernandez-Gea V, Friedman SL. Pathogenesis of liver fibrosis. Annu Rev Pathol 2011;6:425–56. [40] Fabregat I, Caballero-Diaz D. Transforming growth factor-beta-induced cell plasticity in liver fibrosis and hepatocarcinogenesis. Front Oncol 2018;8:357. [41] Xu F, Liu C, Zhou D, Zhang L. TGF-beta/SMAD pathway and its regulation in hepatic fibrosis. J Histochem Cytochem 2016;64:157–67. [42] Dooley S, ten Dijke P. TGF-beta in progression of liver disease. Cell Tissue Res 2012;347:245–56. [43] Yao QY, Xu BL, Wang JY, Liu HC, Zhang SC, Tu CT. Inhibition by curcumin of multiple sites of the transforming growth factor-beta1 signalling pathway ameliorates the progression of liver fibrosis induced by carbon tetrachloride in rats. BMC Complement Altern Med 2012;12:156. [44] Giannelli G, Mikulits W, Dooley S, Fabregat I, Moustakas A, ten Dijke P, et al. The rationale for targeting TGF-beta in chronic liver diseases. Eur J Clin Invest 2016;46:349–61. [45] Borkham-Kamphorst E, Weiskirchen R. The PDGF system and its antagonists in liver fibrosis. Cytokine Growth Factor Rev 2016;28:53–61. [46] Czochra P, Klopcic B, Meyer E, Herkel J, Garcia-Lazaro JF, Thieringer F, et al. Liver fibrosis induced by hepatic overexpression of PDGF-B in transgenic mice. J Hepatol 2006;45:419–28. [47] Thieringer F, Maass T, Czochra P, Klopcic B, Conrad I, Friebe D, et al. Spontaneous hepatic fibrosis in transgenic mice overexpressing PDGF-A. Gene 2008;423:23–8. [48] Campbell JS, Hughes SD, Gilbertson DG, Palmer TE, Holdren MS, Haran AC, et al. Platelet-derived growth factor C induces liver fibrosis, steatosis, and hepatocellular carcinoma. Proc Natl Acad Sci U S A 2005;102:3389–94. [49] Borkham-Kamphorst E, Herrmann J, Stoll D, Treptau J, Gressner AM, Weiskirchen R. Dominant-negative soluble PDGF- receptor inhibits hepatic stellate cell activation and attenuates liver fibrosis. Lab Investig 2004;84:766. [50] Chen SW, Zhang XR, Wang CZ, Chen WZ, Xie WF, Chen YX. RNA interference targeting the platelet-derived growth factor receptor beta subunit ameliorates experimental hepatic fibrosis in rats. Liver Int 2008;28:1446–57. [51] Wang X, Wu X, Zhang A, Wang S, Hu C, Chen W, et al. Targeting the PDGFB/PDGFR- interface with destruxin A5 to selectively block PDGF-BB/PDGFR signaling and attenuate liver fibrosis. EBioMedicine 2016;7:146–56. [52] Papadopoulos N, Lennartsson J. The PDGF/PDGFR pathway as a drug target. Mol Aspects Med 2018;62:75–88.
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
ARTICLE IN PRESS Digestive and Liver Disease xxx (2019) xxx–xxx
Contents lists available at ScienceDirect
Digestive and Liver Disease journal homepage: www.elsevier.com/locate/dld
Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways Cai Chen a , Xiankui Li b,∗ , Lei Wang c a b c
Teaching and Research Centre, Faculty of Medicine, Xinyang Vocational and Technical College, Xinyang, China Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Tianjin Medical University, Tianjin, China Department of Respiratory Medicine, First Affiliated Hospital of Zhengzhou University, Zhengzhou, China
a r t i c l e
i n f o
Article history: Received 19 April 2019 Accepted 5 August 2019 Available online xxx Keywords: Cholestatic liver fibrosis PDGFR TGF1 Thymosin4
a b s t r a c t Liver fibrosis is an important health problem without adequate and effective therapeutics. In this study, effects of thymosin4 (T4) on hepatic fibrogenesis and the underlying molecular mechanisms were explored in bile duct ligation (BDL)-induced mice cholestatic liver fibrosis model. Results showed exogenous T4 significantly reduced the mortality and liver/body weight ratio in BDL mice. Histological examinations and biochemical analyses demonstrated that BDL induced evident portal fibrosis and a significant increase in hepatic collagen contents. However, these changes were significantly attenuated by exogenous T4. Quantitative real-time PCR assays showed that T4 suppressed BDL-induced increases in many fibrotic genes expression including ␣-smooth muscle actin (␣-SMA), collagen I, III and fibronectin, TGF1, TGFR II, Smad2, Smad3, and PDGFR. Results from immunohistochemistry and Western blots also showed that T4 reduced TGF1 and PDGFR protein levels in the liver tissues of BDL mice. In vitro studies using LX-2 cells demonstrated that T4 could decrease PDGFR and TGFR II levels in hepatic stellate cells. Taken together, findings in our present studies suggested that exogenous T4 alleviated BDL-induced cholestatic liver fibrosis through downregulating PDGF/PDGFR and TGF/Smad pathways. © 2019 Published by Elsevier Ltd on behalf of Editrice Gastroenterologica Italiana S.r.l.
1. Introduction Liver fibrosis is the major consequence of many chronic liver injuries from a diversity of causes including chronic viral hepatitis, drugs, autoimmune response, alcoholism, parasitic diseases, metabolic disorders and cholestasis [1]. Due to the lack of effective therapies, liver fibrosis continues to be an important medical problem with significant morbidity and mortality worldwide [1,2]. If not treated, liver fibrosis can progress to cirrhosis and eventually liver failure or hepatocellular carcinoma (HCC) [1,3,4]. Liver transplantation is currently regarded as the only curative therapy but is still mostly unavailable [1]. At present, a lot of efforts are devoted to understanding the molecular mechanisms of liver fibrosis and developing new therapies [5–7]. Thymosin4 (T4) is a small acidic peptide with a molecular weight of 5 kD and exists widely in our body. It was originally identified as the main intracellular G-actin sequestering molecule [8]. Recent studies suggested that besides cytoskeleton regulation
∗ Corresponding author at: Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Tianjin Medical University, Tianjin 300070, China. E-mail address: [email protected] (X. Li).
[9], T4 harbored multiple functions including regulation of the physiological homeostasis of the liver [10–13]. In vitro cultured cell experiments [14,15] demonstrated that T4 treatment inhibited activation of hepatic stellate cells (HSCs), central players in liver fibrosis [7]. T4 treatment also inhibited HSCs activation in vivo in carbon tetrachloride-induced acute liver injuries [16,17]. In our previous work [17], we found that exogenous T4 could suppress carbon tetrachloride-induced liver fibrosis in rats. In the present study, the anti-fibrotic activities of T4 and the underlying molecular mechanisms were further investigated in mice cholestatic liver fibrosis models. Our results indicated that T4 could also alleviate cholestatic liver fibrosis through downregulating PDGFR and TGF/Smad pathways. 2. Materials and methods 2.1. Reagents Synthetic thymosin 4 (HPLC > 98%) was bought from GL Biochem. (Shanghai) Ltd. and dissolved in 0.9% saline. Trizol reagent was bought from Invitrogen (Shanghai, China). Reverse transcriptase was from Takara (Dalian, China). SYBR green qPCR master mix was bought from Transgen BioTech (Beijing, China). Primers
https://doi.org/10.1016/j.dld.2019.08.014 1590-8658/© 2019 Published by Elsevier Ltd on behalf of Editrice Gastroenterologica Italiana S.r.l.
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model
ARTICLE IN PRESS
YDLD-4165; No. of Pages 7
C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
2 Table 1 Primer sets. Gene name GAPDH ˛-SMA Col1a1 Col1a2 Col3a1 Fibronectin TGFˇ1 TGFˇRII Smad2 Smad3 PDGFRˇ
Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse:
Primer sequence
Product size
aaggtcatcccagagctgaa ctgcttcaccaccttcttga gaggcaccactgaaccctaa catctccagagtccagcaca acgccatcaaggtctactgc actcgaacgggaatccatcg ccaagggtgctactggactc gctcacccttgttaccggat ccagtggccataatggggaa atctcgacctggctgaccat cactgcagaaccagaggagg atggcgtaatgggaaaccgt gtgtggagcaacatgtggaactcta ttggttcagccactgccgta tacgagcccccatttggttc ccagcactcggtcaaagtct gtatggacacaggctctccg accagaatgcaggttccgag ctccaaacctctccccgaat gagttggaggggtcagtgaa gtggagattcgcaggaggtc accgtcagagctcacagact
138 bp 154 bp 159 bp
received an intraperitoneal injection of 100 g T4 (200 l) every other day. The survival status of the mice was checked and recorded every day. At day 16 after surgery mice were weighed and then sacrificed by cervical dissociation under 5% isoflurane anesthesia. The livers were promptly removed, weighted and processed for the following histological and biochemical examinations. 2.4. Hydroxyproline (Hyp) content determination
165 bp
143 bp
Hepatic hydroxyproline (Hyp) content was determined using a commercially available kit from Nanjing Jiancheng Institute of Biotechnology (Nanjing, China) according to the manufacturer’s instruction. The results were expressed as microgram of hydroxyproline per gram of wet liver tissue.
156 bp
2.5. Histology
122 bp 130 bp
105 bp 187 bp 185 bp
(Table 1) were synthesized by GENEWIZ (Suzhou, China). TGF-1 antibody (Cat: 21898-1-AP) and GAPDH antibody (Cat: 60004-1-Ig) were obtained from Proteintech (Wuhan, China). PDGFR antibody (Cat: ab69506) was obtained from Abcam (Shanghai, China). TGFR II antibody (Cat: sc-17791) was purchased from Santa Cruz Biotechnology (Shanghai, China). Secondary antibodies against rabbit (Cat: 111-035-003) and mouse (Cat: 115-035-003) were bought from Jackson ImmunoResearch (Baltimore, Maryland, USA). Immobilon enhanced chemiluminescence (ECL) reagent (Cat: WBKLS0500) was purchased from Millipore (Darmstadt, Germany). All other reagents were of analytic grade. 2.2. Mice and hepatic fibrosis model Male Balb/c mice (6 weeks old, weighing ∼20 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). The mice were maintained under a specificpathogen-free (SPF) environment with a 12 h light/dark cycle and offered ad libitum access to food and water. All mice were accustomed to the environment for a week before experiments were performed. All mice received humane care and all experiments were done according to the guidelines of the Animal Welfare Act and the Guide for Care and Use of Laboratory Animals from the National Institutes of Health. The experimental protocols were approved by the Institutional Animal Care and Use Committee of Tianjin Medical University and in accordance with the Helsinki Declaration and with implications for replacement, refinement or reduction (the 3Rs) principle. Hepatic fibrosis model was established in mice by bile duct ligation for 16 days. Surgery of bile duct ligation (BDL) was performed under anesthesia with 4% chloral hydrate (0.2 ml/20 g) according to the previously published protocol [18].
Liver tissues were fixed in 10% neutral buffered formalin, processed routinely, and embedded in paraffin. For histological examinations, 4 m-thick sections of liver tissues were subjected to hematoxylin-eosin (H.E.) and Sirius red stains according to standard procedures. Liver fibrosis was evaluated and scored according to the Ishak scoring system by an independent pathologist blinded to the experimental protocols [19,20]. Sirius red positive area was semi-quantitatively analyzed using Image J free software (http:// rsb.info.nih.gov/ij/). 2.6. Quantitative real-time RT-PCR assays About 100 mg of liver tissue was used to extract total RNA using Trizol reagent according to the manufacturer’s manual. Two micrograms of total RNA was used to synthesize cDNA in a 20 l reaction system. Then 1 l cDNA was used for the following quantitative real-time PCR assays using SYBR green master mix (Transgen BioTech, Beijing, China). Gene expression levels were analyzed in triplicate using the Ct method. GAPDH was used as an internal control. 2.7. Immunohistochemistry Immunohistochemistry was performed according to standard methods. Briefly, liver sections were deparaffinized, rehydrated and incubated in 3% H2 O2 for 10 min to block endogenous peroxidase activities. Antigen retrieval was performed in a microwave oven for 15 min. 5% BSA was used to block non-specific protein binding. Then liver slices were probed with specific primary antibodies against TGF-1 (1:200) and PDGFR (1:100) overnight in a humidified chamber at 4 ◦ C. After two washes with PBS, liver slices were incubated with biotinylated secondary antibody followed by incubation with streptavidin–peroxidase complex. Then liver slices were developed with diaminobenzidine (DAB) chromogen and lightly counter-stained with hematoxylin. After mounting with mounting medium liver slices were evaluated under a light microscope. Brown area against a blue hematoxylin background was positively stained.
2.3. Animal treatments and experimental groups
2.8. Western blot
Forty mice were used in this study and were divided into four groups including the control group (n = 4), sham BDL group (n = 6), BDL group (n = 18) and BDL + T4 group (n = 12). Mice in the control group received no operation. Mice in the sham BDL group received laparotomy to open the abdominal cavity but without BDL. Mice in the BDL group were subjected to BDL surgery and then received an intraperitoneal injection of 200 l 0.9% saline every other day. Mice in BDL + T4 group were subjected to BDL surgery and then
Cultured cells or mice liver tissues were lysed in RIPA lysis buffer (Pierce, Rockford, Illinois, USA) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, St. Louis, Missouri, USA), a protease inhibitor cocktail (Amresco, Solon, Ohio, USA) and phosphostop (Roche Diagnostics, Indianapolis, Indiana, USA). The lysates were centrifuged at 14,000 × g for 10 min at 4 ◦ C. The protein concentration in the supernatant was determined by BCA kits (Pierce, Rockford, Illinois, USA). The protein samples
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
3
Fig. 1. Exogenous T4 treatment in bile-duct ligated mice. (A) Kaplan–Meier survival analysis of the mice after bile duct ligation. T4 treatment significantly increased the survival of bile-duct ligated mice. (B) Liver/body weight ratio. T4 treatment significantly reduced the liver/body weight ratio of bile-duct ligated mice. *P < 0.05 vs. control group. # P < 0.05 vs. BDL group. (C) Hydroxyproline content in the liver tissues. T4 treatment significantly reduced the hepatic hydroxyproline content in bile-duct ligated mice. *P < 0.05 vs. control group. # P < 0.05 vs. BDL group.
were subjected to SDS-PAGE (10%) and transferred onto a 0.2-m PVDF membrane (Millipore, Darmstadt, Germany). After blocking with 5% skimmed milk the membranes were probed with specific primary antibodies against TGF-1 (1:1000), TGFR II (1:2000), PDGFR (1:1000) and GAPDH (1:10,000) overnight at 4 ◦ C. Then the membranes were incubated with horseradish peroxidase (HRP)conjugated goat anti-rabbit or goat anti-mouse secondary antibody (1:20,000) at room temperature for 1 h. Finally, the membranes were developed and visualized using Immobilon enhanced chemiluminescence (ECL). The pictures were captured using a GelDoc XR System (Bio-Rad, Shanghai, China). Image J free software (http:// rsb.info.nih.gov/ij/) was used to analyze the protein bands densities.
2.10. Statistical analyses
2.9. LX-2 cell culture and Tˇ4 treatment
In the control group, no mice died (n = 4). In sham BDL group, one mouse died (n = 6). In BDL group, 18 mice were subject to operation and at day 16 after operation 9 mice were left alive; the mortality in the BDL group was 50%. In BDL + T4 group, 12 mice were subjected to operation and at day 16 after operation 8 mice were left alive; the mortality in BDL + T4 group was about 33.33%. Kaplan–Meier survival analyses indicated that compared with the BDL group, the overall survival of the mice in BDL + T4 group was significantly increased by T4 treatment (Fig. 1A). At day 16 after surgery, the mice subject to BDL operation presented with jaundice in the visceral and parietal peritonea; the livers were also enlarged and the bile ducts above the obstruction point were dilated. The liver/body weight ratio was significantly increased in the BDL group compared to the control group; however, it was significantly lowered by
Human hepatic stellate cell line, LX-2, was bought from China Center for Type Culture Collection and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco-BRL, Gasthersburg, MD, USA) supplemented with 10% fetal bovine serum (FBS) (GibcoBRL, Gasthersburg, MD, USA), 100U/ml penicillin and 100 g/ml streptomycin. LX-2 cells were incubated in a humidified incubator containing 95% air and 5% CO2 at 37 ◦ C. The media were replenished every 3 days. Before experiments, LX-2 cells were starved in DMEM with 0.1% FBS for 24 h. Then the starved cells were treated with T4 for 24 h at the concentration of 0 ng/ml, 100 ng/ml and 300 ng/ml. Then the cells were lysed in RIPA lysis buffer and the cell lysates were used for Western blots assays.
SPSS 21.0 version for Windows (SPSS Inc., Chicago, Illinois, USA) was employed to do all the statistical analyses in this study. Kaplan–Meier method with the log-rank test was used to analyze the overall survival of mice. One-way ANOVA was used to test the difference between groups. Student’s t-test was used to compare the difference between the two groups. P < 0.05 was considered as statistically significant. 3. Results 3.1. Survival and macroscopic findings
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
4
Fig. 2. Histological examinations of the liver tissues. (A) Hematoxylin-eosin (H.E.) staining. (B) Sirius red staining. (C) Quantitative analysis of the H.E. stained liver sections according to the Ishak scoring system. *P < 0.05 vs. control group. # P < 0.05 vs. BDL group. (D) Quantitative analyses of Sirius red positive area. *P < 0.05 vs. Control group. # P < 0.05 vs. BDL group.
T4 treatment in the BDL + T4 group compared to the BDL group (Fig. 1B).
3.2. Hepatic collagen content and histological findings Hepatic collagen content was quantified by determining the hepatic hydroxyproline content. As indicated in Fig. 1C, hepatic hydroxyproline content was significantly increased in the BDL group compared to the control; however, it was significantly lowered by T4 treatment in the BDL + T4 group compared to the BDL group. Histological examinations through H.E. staining (Fig. 2A) and Sirius red staining (Fig. 2B) demonstrated that bile duct ligation induced evident portal fibrosis. Quantitative analyses showed that BDL-induced fibrosis was significantly reduced by T4 treatment (Fig. 2C and D).
3.3. Expression of fibrotic protein markers Quantitative real-time PCR assays were performed to determine the mRNA levels of the fibrotic proteins in the liver tissues. As shown in Fig. 3, compared with control group, expression levels of the fibrotic genes including ␣-smooth muscle actin (␣-SMA), collagen I (Col1a1, Col1a2), collagen III (Col3a1) and fibronectin (FN) in BDL group were significantly increased by bile duct ligation (BDL) operation; however, these increases were prominently suppressed by T4 in BDL + T4 group compared with the BDL group.
3.4. PDGFRˇ and TGFˇ/Smad pathway Quantitative real-time PCR assays, immunohistochemistry, and Western blots were employed to evaluate the expression of PDGFR and genes in the TGF/Smad pathway in the liver tissues. As shown in Fig. 3, the mRNA levels of PDGFR, TGF-1, TGFR II, and the downstream Smad2, Smad3 were apparently increased by bile duct ligation operation but were significantly suppressed by T4. Results from immunohistochemistry and Western blots also showed that the protein levels of PDGFR and TGF-1 in the liver tissues were elevated in BDL group as compared with the control group, but were greatly inhibited in BDL + T4 group compared with BDL group (Fig. 4A and B). During hepatic fibrosis PDGF and TGF can promote hepatic stellate cell (HSC) activation; what’s more, HSC activation plays a central role in liver fibrosis [7]. So, in the present study influences of T4 on PDGF/PDGFR and TGF/Smad pathways were also investigated in vitro using human HSC cell line LX-2. As indicated in Fig. 5, T4 treatment dose-dependently decrease PDGFR and TGFRII levels in LX-2 cells. These results suggested that T4 exerts inhibitory effects on PDGF/PDGFR and TGF/Smad pathways in HSC cells. 4. Discussion Results from our present study showed that T4 could reduce bile duct ligation induced cholestatic liver fibrosis in mice, which confirmed our previous conclusion that T4 harbored anti-fibrotic
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
5
Fig. 3. The mRNA levels revealed by quantitative real-time PCR assays (n = 3). Expression levels were expressed as folds change relative to the control group. Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as an internal control. *P < 0.05 vs. Control group. # P < 0.05 vs. BDL group.
Fig. 4. Detection of TGF1 and PDGFR in liver tissues. (A) Immunohistochemistry. Four liver sections were randomly selected from each group and used for immunohistochemistry. Here showed the representative figures of immunohistochemistry. (Original magnification: 400×) (B) Western blots. Representative Western blot results from three repeats were shown here. Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as a loading control. (C) Quantitative analyses of Western blots results. Values represent the mean ± SD (n = 3). *P < 0.05 vs. control group. # P < 0.05 vs. BDL group.
activity in the livers [17]. Further investigation showed that it might be through downregulation of PDGFR, TGF-1, TGFR II, and Smad2, Smad3 expression T4 alleviated cholestatic liver fibrosis. T4 was originally isolated and identified from calf thymus in the 1980s and thought to be a thymic hormone [21]. The following studies found that T4 was widely expressed in our
body and acted as the main G-actin sequestering molecule in the cell to regulate cytoskeleton dynamics [8,21]. In 1999, Kleinman et al. first reported that T4 could accelerate skin wound healing [22]. And from then on, more and more investigations were performed to study the role of T4 in wound healing in many organs including skin [10,23], heart [11], cornea [12], lung [24], kid-
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7 6
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
Fig. 5. Effects of T4 on the expression of TGFR II and PDGFR in LX-2 cells. (A) Representative Western blots result from three repeat experiments. (B) Quantitative analyses of Western blots results. Values are means of triplicate experiments ±SD. *P < 0.05 vs. control group. # P < 0.05 vs. BDL group.
ney [25] and liver [13,26,27]. Local treatment with T4 promoted incisional skin wound repair with fewer myofibroblast and minimal scarring [28]. Intraperitoneal administration of T4 reduced bleomycin-induced lung damage and fibrosis through suppression of inflammation [24,29–32]. In the kidney, loss of endogenous T4 accelerates glomerular disease [33]; treatment with exogenous T4 reduced early diabetic nephropathy [34] and suppressed unilateral ureteral obstruction (UUO)-induced renal interstitial fibrosis [25]. Recently, several in vitro and in vivo studies suggested that exogenous T4 also harbored anti-fibrotic potential in the livers [13–15,27] although the pathophysiological role of endogenous T4 in the livers was unclear [13]. Our recent published works first gave the in vivo evidence that exogenous T4 treatment could suppress liver fibrosis induced by carbon tetrachloride [17]. However, the underlying molecular mechanisms of exogenous T4 against liver fibrosis remain elusive. In this study, the anti-fibrotic activity and the underneath mechanisms of T4 were further investigated in bile duct ligation induced cholestatic liver fibrosis model. BDL induced cholestatic liver fibrosis model (BDL model) is widely used to mimic human hepatic fibrosis and attracts many investigators to study the etiology and pathology, as well as the anti-fibrotic therapeutics [4,35,36]. BDL model is regarded as a representative chronic liver injury model which is mediated by biliary obstruction and subsequent cholestasis [37]. Double ligation of bile duct causes the abnormal flux of bile acids and bilirubin in the liver. Toxic hydrophobic bile salts subsequently accumulate within hepatocytes causing successive inflammatory reactions, hepatocyte death and peri-ductular fibrosis [38]. Liver fibrosis is featured by collagen and extracellular matrix proteins deposition in the liver tissues [39]. Activated hepatic stellate cells (HSCs) are the key cells responsible for collagen deposition and play a central role in hepatic fibrogenesis [7]. In this study, our results showed that in BDL mice exogenous T4 treatment reduced collagen deposition and suppressed ␣-SMA expression, a marker of HSCs activation, which suggested that exogenous T4 treatment inhibited HSCs activation. HSC activation is one of the most important steps during hepatic fibrosis. Many factors including TGF1 and PDGF can activate HSCs. TGF1 plays a master role in HSCs activation [40]. TGF1 initiates intracellular signaling by binding to TGF receptor type II (TGFR II) and then activates TGF receptor type I (TGFR I) kinase, resulting in activation of the downstream effector proteins Smad2 and Smad3 by phosphorylation. Subsequently, Smad2 and Smad3 form oligomeric complexes with Smad4 and translocate to the nucleus, where they promote many fibrotic genes expression including ␣1 and ␣2 type I collagen, tissue inhibitor metalloproteinase-1 and -2 (TIMP-1, TIMP-2) and plasminogen activator inhibitor (PAI)-1
[41,42]. Smad2 and Smad3 were both strongly activated in liver fibrosis [43]. Smad3 knock-out primary HSCs showed lower collagen expression [40]. Inhibiting TGF/Smad pathway is a promising strategy to treat liver fibrosis disorders [44]. Results from our present study showed that T4 reduced expression levels of TGF1, TGFR II, Smad2, and Smad3 in the liver tissues of mice with BDL operation. in vitro study also showed that T4 reduced TGFR II expression level in human hepatic stellate cells LX-2. These results indicated that T4 reduced cholestatic liver fibrosis via inhibiting TGF/Smad pathway. PDGF is the most potent mitogen for HSCs and stimulates HSCs proliferation and migration [45]. Overexpressing PDGF in transgenic mice induced hepatic fibrosis [46–48]. Antagonist against PDGF reduced experimental liver fibrosis [45]. HSCs express both ␣- and -receptor types for PDGF. PDGF stimulates HSCs proliferation through binding PDGFR␣ and PDGFR receptors and activating the downstream ERK/MAPK and Akt/PKB signaling pathways [45]. in vitro and in vivo evidence showed that during HSCs activation only PDGFR was upregulated [45]. PDGFR is an important player in liver fibrogenesis and inhibiting PDGFR signaling will attenuate liver fibrosis [49–51]. Nowadays, the PDGF/PDGFR pathway has been a drug target in treating liver fibrosis [52]. In the present study, our results showed that T4 significantly decreased PDGFR expression in vivo and in vitro, which indicated the inhibitory effects of T4 on PDGF/PDGFR signaling pathway during hepatic fibrosis.
5. Conclusions In summary, findings in this study suggested that exogenous T4 exerted inhibitory effects on cholestatic liver fibrosis induced by bile duct ligation through downregulating PDGF/PDGFR and TGF/Smad pathways.
Acknowledgments This work was supported by Tianjin Research Program of Application Foundation and Advanced Technology (No. 15JCQNJC12900), Henan Research Program of Medical Science and Technology (No. 201403057) and Natural Science Foundation of China (No. U1504801).
Conflict of interest None declared.
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014
G Model YDLD-4165; No. of Pages 7
ARTICLE IN PRESS C. Chen et al. / Digestive and Liver Disease xxx (2019) xxx–xxx
References [1] Zhang CY, Yuan WG, He P, et al. Liver fibrosis and hepatic stellate cells: etiology, pathological hallmarks and therapeutic targets. World J Gastroenterol 2016;22:10512–22. [2] Tsukada S, Parsons CJ, Rippe RA. Mechanisms of liver fibrosis. Clin Chim Acta 2006;364:33–60. [3] Pinzani M. Pathophysiology of liver fibrosis. Dig Dis 2015;33:492–7. [4] Tag CG, Weiskirchen S, Hittatiya K, Tacke F, Tolba RH, Weiskirchen R. Induction of experimental obstructive cholestasis in mice. Lab Anim 2015;49:70–80. [5] Koyama Y, Brenner DA. New therapies for hepatic fibrosis. Clin Res Hepatol Gastroenterol 2015;39(Suppl 1):S75–9. [6] Koyama Y, Xu J, Liu X, Brenner DA. New developments on the treatment of liver fibrosis. Dig Dis 2016;34:589–96. [7] Tsuchida T, Friedman SL. Mechanisms of hepatic stellate cell activation. Nat Rev Gastroenterol Hepatol 2017;14:397–411. [8] Crockford D, Turjman N, Allan C, Angel J. Thymosin beta4: structure, function, and biological properties supporting current and future clinical applications. Ann N Y Acad Sci 2010;1194:179–89. [9] Renault L. Intrinsic, functional, and structural properties of beta-thymosins and beta-thymosin/WH2 domains in the regulation and coordination of actin self-assembly dynamics and cytoskeleton remodeling. Vitam Horm 2016;102:25–54. [10] Kleinman HK, Sosne G. Thymosin beta4 promotes dermal healing. Vitam Horm 2016;102:251–75. [11] Pipes GT, Yang J. Cardioprotection by thymosin beta 4. Vitam Horm 2016;102:209–26. [12] Sosne G, Rimmer D, Kleinman HK, Ousler G. Thymosin beta 4: a potential novel therapy for neurotrophic keratopathy, dry eye, and ocular surface diseases. Vitam Horm 2016;102:277–306. [13] Kim J, Jung Y. Potential role of thymosin beta 4 in liver fibrosis. Int J Mol Sci 2015;16:10624–35. [14] Reyes-Gordillo K, Shah R, Popratiloff A, Fu S, Hindle A, Brody F, et al. Thymosinbeta4 (Tbeta4) blunts PDGF-dependent phosphorylation and binding of AKT to actin in hepatic stellate cells. Am J Pathol 2011;178:2100–8. [15] Barnaeva E, Nadezhda A, Hannappel E, Sjogren MH, Rojkind M. Thymosin beta4 upregulates the expression of hepatocyte growth factor and downregulates the expression of PDGF-beta receptor in human hepatic stellate cells. Ann N Y Acad Sci 2007;1112:154–60. [16] Reyes-Gordillo K, Shah R, Arellanes-Robledo J, Rojkind M, Lakshman MR. Protective effects of thymosin beta4 on carbon tetrachloride-induced acute hepatotoxicity in rats. Ann N Y Acad Sci 2012;1269:61–8. [17] Li X, Wang L, Chen C. Effects of exogenous thymosin beta4 on carbon tetrachloride-induced liver injury and fibrosis. Sci Rep 2017;7:5872. [18] Tag CG, Sauer-Lehnen S, Weiskirchen S, Borkham-Kamphorst E, Tolba RH, Tacke F, et al. Bile duct ligation in mice: induction of inflammatory liver injury and fibrosis by obstructive cholestasis. J Vis Exp 2015:52438. [19] Knodell RG, Ishak KG, Black WC, Chen TS, Craig R, Kaplowitz N, et al. Formulation and application of a numerical scoring system for assessing histological activity in asymptomatic chronic active hepatitis. Hepatology 1981;1:431–5. [20] Ishak K, Baptista A, Bianchi L, Callea F, De Groote J, Gudat F, et al. Histological grading and staging of chronic hepatitis. J Hepatol 1995;22:696–9. [21] Hannappel E. Beta-thymosins. Ann N Y Acad Sci 2007;1112:21–37. [22] Malinda KM, Sidhu GS, Mani H, Banaudha K, Maheshwari RK, Goldstein AL, et al. Thymosin beta4 accelerates wound healing. J Invest Dermatol 1999;113:364–8. [23] Li X, Zheng L, Peng F, Qi C, Zhang X, Zhou A, et al. Recombinant thymosin beta 4 can promote full-thickness cutaneous wound healing. Protein Expr Purif 2007;56:229–36. [24] Conte E, Genovese T, Gili E, Esposito E, Iemmolo M, Fruciano M, et al. Protective effects of thymosin beta4 in a mouse model of lung fibrosis. Ann N Y Acad Sci 2012;1269:69–73. [25] Zuo Y, Chun B, Potthoff SA, Kazi N, Brolin TJ, Orhan D, et al. Thymosin beta4 and its degradation product, Ac-SDKP, are novel reparative factors in renal fibrosis. Kidney Int 2013;84:1166–75. [26] Jiang Y, Han T, Zhang ZG, Li M, Qi FX, Zhang Y, et al. Potential role of thymosin beta 4 in the treatment of nonalcoholic fatty liver disease. Chronic Dis Transl Med 2017;3:165–8. [27] Lakshman MR, Reyes-Gordillo K, Varatharajalu R, Arellanes-Robledo J, Leckey LC, Garige M, et al. Novel modulators of hepatosteatosis, inflammation and fibrogenesis. Hepatol Int 2014;8(Suppl. 2):413–20.
7
[28] Ehrlich HP, Hazard 3rd SW. Thymosin beta4 enhances repair by organizing connective tissue and preventing the appearance of myofibroblasts. Ann N Y Acad Sci 2010;1194:118–24. [29] Conte E, Genovese T, Gili E, Esposito E, Iemmolo M, Fruciano M, et al. Thymosin beta4 protects C57BL/6 mice from bleomycin-induced damage in the lung. Eur J Clin Invest 2013;43:309–15. [30] Conte E, Iemmolo M, Fruciano M, Fagone E, Gili E, Genovese T, et al. Effects of thymosin 4 and its N-terminal fragment Ac-SDKP on TGF--treated human lung fibroblasts and in the mouse model of bleomycin-induced lung fibrosis. Expert Opin Biol Ther 2015;15:211–21. [31] Conte E, Iemmolo M, Fagone E, Gili E, Fruciano M, Genovese T, et al. Thymosin beta4 reduces IL-17-producing cells and IL-17 expression, and protects lungs from damage in bleomycin-treated mice. Immunobiology 2014;219:425–31. [32] Li XK, Chen C, Wang L, Li ZJ, Ren CZ. Thymosin 4 alleviates bleomycin-induced lung damage through inhibiting nitrative thioredoxin-1 inactivation. Int J Clin Exp Med 2016;9:6138–42. [33] Vasilopoulou E, Kolatsi-Joannou M, Lindenmeyer MT, White KE, Robson MG, Cohen CD, et al. Loss of endogenous thymosin beta4 accelerates glomerular disease. Kidney Int 2016;90:1056–70. [34] Zhu J, Su LP, Zhou Y, Ye L, Lee KO, Ma JH. Thymosin 4 attenuates early diabetic nephropathy in a mouse model of type 2 diabetes mellitus. Am J Ther 2015;22:141–6. [35] Liedtke C, Luedde T, Sauerbruch T, Scholten D, Streetz K, Tacke F, et al. Experimental liver fibrosis research: update on animal models, legal issues and translational aspects. Fibrogenesis Tissue Repair 2013;6:19. [36] Popov Y, Schuppan D. Targeting liver fibrosis: strategies for development and validation of antifibrotic therapies. Hepatology 2009;50:1294–306. [37] Heinrich S, Georgiev P, Weber A, Vergopoulos A, Graf R, Clavien PA. Partial bile duct ligation in mice: a novel model of acute cholestasis. Surgery 2011;149:445–51. [38] Han JM, Kim HG, Choi MK, Lee JS, Park HJ, Wang JH, et al. Aqueous extract of Artemisia iwayomogi Kitamura attenuates cholestatic liver fibrosis in a rat model of bile duct ligation. Food Chem Toxicol 2012;50:3505–13. [39] Hernandez-Gea V, Friedman SL. Pathogenesis of liver fibrosis. Annu Rev Pathol 2011;6:425–56. [40] Fabregat I, Caballero-Diaz D. Transforming growth factor-beta-induced cell plasticity in liver fibrosis and hepatocarcinogenesis. Front Oncol 2018;8:357. [41] Xu F, Liu C, Zhou D, Zhang L. TGF-beta/SMAD pathway and its regulation in hepatic fibrosis. J Histochem Cytochem 2016;64:157–67. [42] Dooley S, ten Dijke P. TGF-beta in progression of liver disease. Cell Tissue Res 2012;347:245–56. [43] Yao QY, Xu BL, Wang JY, Liu HC, Zhang SC, Tu CT. Inhibition by curcumin of multiple sites of the transforming growth factor-beta1 signalling pathway ameliorates the progression of liver fibrosis induced by carbon tetrachloride in rats. BMC Complement Altern Med 2012;12:156. [44] Giannelli G, Mikulits W, Dooley S, Fabregat I, Moustakas A, ten Dijke P, et al. The rationale for targeting TGF-beta in chronic liver diseases. Eur J Clin Invest 2016;46:349–61. [45] Borkham-Kamphorst E, Weiskirchen R. The PDGF system and its antagonists in liver fibrosis. Cytokine Growth Factor Rev 2016;28:53–61. [46] Czochra P, Klopcic B, Meyer E, Herkel J, Garcia-Lazaro JF, Thieringer F, et al. Liver fibrosis induced by hepatic overexpression of PDGF-B in transgenic mice. J Hepatol 2006;45:419–28. [47] Thieringer F, Maass T, Czochra P, Klopcic B, Conrad I, Friebe D, et al. Spontaneous hepatic fibrosis in transgenic mice overexpressing PDGF-A. Gene 2008;423:23–8. [48] Campbell JS, Hughes SD, Gilbertson DG, Palmer TE, Holdren MS, Haran AC, et al. Platelet-derived growth factor C induces liver fibrosis, steatosis, and hepatocellular carcinoma. Proc Natl Acad Sci U S A 2005;102:3389–94. [49] Borkham-Kamphorst E, Herrmann J, Stoll D, Treptau J, Gressner AM, Weiskirchen R. Dominant-negative soluble PDGF- receptor inhibits hepatic stellate cell activation and attenuates liver fibrosis. Lab Investig 2004;84:766. [50] Chen SW, Zhang XR, Wang CZ, Chen WZ, Xie WF, Chen YX. RNA interference targeting the platelet-derived growth factor receptor beta subunit ameliorates experimental hepatic fibrosis in rats. Liver Int 2008;28:1446–57. [51] Wang X, Wu X, Zhang A, Wang S, Hu C, Chen W, et al. Targeting the PDGFB/PDGFR- interface with destruxin A5 to selectively block PDGF-BB/PDGFR signaling and attenuate liver fibrosis. EBioMedicine 2016;7:146–56. [52] Papadopoulos N, Lennartsson J. The PDGF/PDGFR pathway as a drug target. Mol Aspects Med 2018;62:75–88.
Please cite this article in press as: Chen C, et al. Thymosin4 alleviates cholestatic liver fibrosis in mice through downregulating PDGF/PDGFR and TGF/Smad pathways. Dig Liver Dis (2019), https://doi.org/10.1016/j.dld.2019.08.014