- Email: [email protected]
Internal initiation of mRNA translation in insect cell mediated by an internal ribosome entry site (IRES) from shrimp white spot syndrome virus (WSSV)
BBRC Biochemical and Biophysical Research Communications 344 (2006) 893–899 www.elsevier.com/locate/ybbrc
Internal initiation of mRNA translation in insect cell mediated by an internal ribosome entry site (IRES) from shrimp white spot syndrome virus (WSSV) q Fang Han, Xiaobo Zhang
*
Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration Xiamen 361005, PR China Received 28 March 2006 Available online 19 April 2006
Abstract Internal initiation of mRNA translation can be mediated by internal ribosome entry site (IRES) elements which are located mainly in RNA viruses as well as certain mammalian and insect mRNA molecules. Thus far, only one DNA virus has been discovered to contain IRES element. In this investigation, an IRES element from white spot syndrome virus (WSSV), a DNA virus of marine shrimp, was demonstrated to direct the efficient translation of dicistronic mRNA in Trichoplusia ni insect cells. The IRES was inserted between glutathione S-transferase (GST) and green fluorescent protein (GFP) genes to construct a dicistronic cassette (GST-IRES-GFP). After transfection of this dicistronic cassette in insect cell, the Northern blot indicated that only one transcript corresponding to the mRNA of GST-IRES-GFP could be detected. However, the GST and GFP genes were simultaneously translated as revealed by Western blot and fluorescent microscopy, respectively. Based on sequence orientation and deletion analyses, the IRES element was 180 nucleotides (nt) in length and orientation-dependent. By comparison with that of cap-dependent initiation, the translation efficiency mediated by IRES was 98.77%. This finding promises that the WSSV IRES could be very useful to co-express two or more proteins due to its shorter length and higher translation efficiency. 2006 Elsevier Inc. All rights reserved. Keywords: WSSV; IRES; GST; GFP; Translation efficiency
For capped eukaryotic mRNA, translation initiation requires scanning by the ribosome from the 5 0 end to the initiator AUG codon of mRNA [1]. In contrast, studies on the translation of viral mRNAs bearing uncommon features in their 5 0 untranslated regions (UTRs) have shed light on an alternative mode of 40S recruitment to the mRNA. This cap-independent mechanism is directed by an internal ribosome entry site (IRES). The best-characterized IRES elements are those from the mammalian picornaviruses [2]. Picornavirus RNAs are uncapped and the initiation of translation on picornavirus RNA occurs up q The GenBank accession number of the sequence reported in this paper is AF227911. * Corresponding author. Fax: +86 592 2085376. E-mail address: [email protected] (X. Zhang).
0006-291X/$ - see front matter 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.03.229
to 1300 nucleotides (nt) away from the 5 0 terminus. Up to date, all picornavirus RNAs examined have been found to possess IRESs [3]. The picornavirus IRES elements are generally about 450 nt in length [2]. However, the IRES from Taura syndrome virus (TSV) of marine shrimp, an invertebrate picornavirus, is 230-nt [4]. Based on the predicted secondary structure and its activity in vitro, the picornavirus IRESs can be divided into one minor and two major groups: (i) hepatitis A virus (HAV) IRES elements; (ii) entero- and rhinovirus (e.g., poliovirus) IRES elements; and (iii) cardio-, aphtho-, and parechovirus IRES elements including the encephalomyocarditis virus and foot-and-mouth disease virus [4–7]. IRES elements have also been identified from hepaciviruses (HCV) [8] and pestiviruses, for example, classical swine fever virus (CSFV), which are members of the
Notes. IRESr represented the reversely oriented IRES from WSSV. IRESdel1, IRESdel2, IRESdel3, IRESdel4, IRESdel5, IRESdel6, IRESdel7, IRESdel8, IRESdel9 and IRESdel10 indicated various deletions of WSSV IRES (Fig. 1). The italic letters show the endonuclease sites.
SpeI HindIII XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI SpeI HindIII GACTAGTTTAACGCGGAACCAGATCCG CCAAGCTTTTACTTGTACAGCTCGTCCA GCTCTAGA GACGAGTTTTTTTCTTTATC GCTCTAGA TCACCATGTGCTTCTG GCTCTAGA ACCCTGGCTTACTGTA GCTCTAGA GAACGTTGCTTGGTTATT GCTCTAGA GATGTCGTTT TGTCGGCG GCTCTAGA GACAAAAAAAAAGGTTAC GCTCTAGA TTGGTGATGACAACCTCG GCTCTAGA AAACCACAGAGTACGTAA GCTCTAGA GACGAGTTTTTTTCTTTATC GCTCTAGA GACGAGTTTTTTTCTTTATC GCTCTAGA GACGAGTTTTTTTCTTTATC GCTCTAGA GACGAGTTTTTTTTCTTTATC GCTCTAGA GACGAGTTTTTTTCTTTATC GACTAGTTTATTGTTCATTTTTGAGAACTCGT CCAAGCTTTTACACGGCGATCTTTCCGCCCT GCGGATCC ATGTCCACCTTACTAGG GCTCTAGA ATGGTGAGCAAGGGCGAG GACTAGTTGAACCCTGGCTTACTGTA GACAGTTGAATGAGAAGAAGAAAGCCCAGT GACTAGTTGAGACGAGTTTTTTTCTTTATC GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAAAAAAAGAGTAAAAGGCG GACTAGTTGAGCTCGCTTGCCAATTGT GACTAGTTGATGTTACGTACTCTGTGGT GACTAGTTGACACGAGGTTGTCATCAC GACTAGTTGAAGGTAACCTTTTTTTTTG GCGGATCC ATGACTTCGAAAGTTTATGAT GCTCTAGA ATGGAAGACGCCAAAAACAT
BamHI XbaI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI BamHI XbaI
Reverse primers (5 0 –3 0 )2 Endonuclease
GST GFP IRES Shrimp interferon IRESr IRESdel 1 IRESdel 2 IRESdel 3 IRESdel 4 IRESdel 5 IRESdel 6 IRESdel 7 IRESdel 8 IRESdel 9 IRESdel 10 Rluc Fluc
Construction of dicistronic reporter bacmids. The cDNA analysis of vp28 gene from WSSV revealed the presence of an in-frame upstream minicistron, which was separated by a 180-nt fragment from the vp28 gene [23]. This putative IRES fragment was obtained by PCR with IRES-specific primers (Table 1) using WSSV genomic DNA [22]. The GST and GFP genes were amplified from pGEX-20T (Amersham Biosciences, America) and pEGFP (Clontech, America) with gene-specific primers (Table 1), respectively. After amplifications, they were cloned into pFASTBACHTb to construct the dicistronic reporter plasmid (GST-IRES-GFP), which contained a stop codon in GST and GFP genes, respectively. As a negative control, the IRES in GST-IRES-GFP was replaced by a 180-nt interferon gene fragment of shrimp. In addition, the GST gene and IRES were, respectively, amplified with specific primers (Table 1) and cloned into pFASTBACHTb to obtain the GST-IRES construct.
Forward primers (5 0 –3 0 )2
Materials and methods
Genes or DNA fragments
flavivirus family [3,9]. So far, however, only one DNA virus, the Kaposi’s sarcoma-associated herpesvirus (KSHV), has been found to contain an IRES element [10,11]. Besides viruses, IRES elements have been documented in some cellular mRNAs of genes involved in cell proliferation and apoptosis, such as fibroblast growth factor-2 [12], vascular endothelial growth factor [13], X-linked inhibitor of apoptosis [14], the protooncogene c-myc [15], PITSLRE protein kinase [16] and ornithine decarboxylase [17]. Although reports on IRES are accumulated, no significant sequence similarity among IRES elements is found. Moreover, IRES elements usually share different lengths. Indeed, it has been demonstrated that different IRES elements function with different efficiencies in different cell types [18]. The cardio-/aphthovirus IRES elements function efficiently in the rabbit reticulocyte lysate (RRL) translation system. However, the poliovirus and rhinovirus IRES elements are inefficient in this system [19]. The activity of the hepatitis A virus IRES is stimulated by the addition of liver cell, but not HeLa cell extracts [20]. Viruses are extremely abundant in the sea [21]. To our surprise, however, no IRES is found from marine DNA viruses until now. In this study, an IRES element from white spot syndrome virus (WSSV) of marine shrimp, a DNA virus, was revealed. WSSV, a 305 kb doublestranded circular DNA virus [22], is the only member of a newly established Whispovirus genus, Nimaviridae (www.ncbi.nlm.nih.gov/ICTV). In our previous study, an in-frame minicistron separated by a 180 bp fragment was observed in the leading sequence of the cDNA of vp28 gene [23]. The expression of vp28 gene from a single mRNA led to the suggestion that the two cistrons might be under independent translation control. In an attempt to confirm the IRES element in WSSV, the 180-nt fragment was inserted between glutathione S-transferase (GST) and green fluorescent protein (GFP) genes to construct a bicistronic cassette GST-IRES-GFP. The results showed that the GST and GFP genes, transcribed in an mRNA, were simultaneously translated. By comparison with that of cap-dependent initiation, the translation efficiency of IRES was 98.77%.
Endonuclease
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899
Table 1 Primers used for PCR amplifications of genes or DNA fragments
894
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899 In order to evaluate the effects of sequence orientation and deletion on IRES, the IRES was reversely oriented and deleted at different length by PCR using the corresponding primers (Table 1). Then the IRES in GSTIRES-GFP was replaced by the oriented or deleted IRES, respectively. The Renilla luciferase (Rluc) and firefly luciferase (Fluc) genes were amplified from pRL-TK and pGL3 (Promega, America) with gene-specific primers (Table 1), respectively. Subsequently Rluc, Fluc, and IRES were ligated with pFASTBACHTb to construct another dicistronic reporter plasmid Rluc-IRES-Fluc which contained a stop codon in Rluc and Fluc genes, respectively. At the same time, the Rluc and Fluc genes were separately cloned into pFastBacHTb vector to form RLUC0 and FLUC0 reporter plasmids as controls. The above recombinant plasmids were confirmed by DNA sequencing. Then they were, respectively, transformed into DH10Bac competent E. coli. using the BAC-TO-BAC Baculovirus Expression System to obtain dicistronic or monocistronic bacmids according to the manufacturer’s instructions (Gibco-BRL, America). The bacmid DNAs were isolated for transfection of insect cells as recommended by the manufacturer’s protocol (Gibco-BRL, America). Insect cells, transfection, and infection. High Five (Hi5) insect cells developed from Trichoplusia ni (Invitrogen, America) were propagated at 27 C in Grace’s insect medium (Invitrogen, America) supplemented with 5% heat-inactivated fetal bovine serum (FBS) (PAA Laboratories, Linz, Austria). Transfections of high molecular weight bacmid DNAs were performed using Cellfectin transfection reagent (Invitrogen, America). Briefly, Hi5 cells were plated at 12-well plates and cultured for 24 h at confluence of about 70% before transfection. After removal of the medium (containing FBS), the cells were transfected by 4 lg of recombinant bacmid DNA mixed with 5 ll lipofectin in 500 ll medium per well. Four hours later, the mixture was removed and the cells were overlaid with 1 ml medium containing 5% FBS. Supernatants containing the recombinant baculovirus particles were collected at 72 h after transfection and filtered (0.45 lm pore size). For infection, the cells at confluence of about 70% were overlaid with 150–250 ll of recombinant baculovirus suspension. After incubation at 27 C for 2 h, 1 ml of medium containing 5% FBS was added. Two days later, the cells were harvested. Northern blot. Total RNAs were extracted from uninfected and infected (48 h post-infection) insect cells using 1 ml of Trizol reagent (Bio Basic Inc., Canada) according to the manufacturer’s instructions. After treatment with RNase-free DNase I (TakaRa, Japan) for 30 min at 37 C, RNAs were separated by electrophoresis on a 2% agarose gel in 1· TBE buffer (90 mM Tris–boric acid, 2 mM EDTA, pH 8.0) and transferred to a nitrocellulose membrane (Amersham, America). The blots were probed with DIG-labeled putative IRES fragment. The DIG labeling and detection were performed following the protocol of DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Germany). Western blot. The samples from whole insect cells were analyzed in a 12% SDS–PAGE gel. Then the proteins, visualized using Coomassie brilliant blue staining, were transferred onto a nitrocellulose membrane (Bio-Rad, America) in electroblotting buffer (25 mM Tris, 190 mM glycine, and 20% methanol) at 70 V for 2 h. The membrane was immersed in blocking buffer (3% BSA, 20 mM Tris, 0.9% NaCl, and 0.1% Tween 20, pH 7.2) at 4 C overnight, followed by incubation with anti-GST IgG for 2 h. The antibody was obtained in our previous study [23]. Subsequently, the membrane was incubated in HRP-conjugated goat anti-mouse IgG (Sigma, America) for 1 h and detected with substrate solution (4-chloro-1naphthol, Sigma). Dual luciferase assays. Firefly and Renilla luciferase activities from bacmid-transfected insect cells were measured at 48 h after transfection using Dual-Luciferase Reporter Assay System Kit (Promega, America). Briefly, transfected cells were washed twice with ice-cold 1· phosphatebuffered saline (PBS) and lysed in 100 ll of 1· luciferase lysis buffer per well (Promega, America). After rotation at room temperature for 15 min, the lysate was centrifuged at 12,000g for 2 min at 4 C. Subsequently 20 ll of the supernatant was incubated with 100 ll of Luciferase Assay Reagent II (Promega, America) for 2 s. The firefly luciferase activity was quickly measured in TD-20/20 luminometer (Turner Designs, America). After
895
that, the same supernatant was mixed with 100 ll of Stop & Glo Reagent (Promega) for 3 s, followed by immediate quantification of Renilla luciferase activity using TD-20/20 luminometer. All assays (bacmid transfection and luciferase assays) were performed twice. The data were analyzed by t-test using the Science Analysis Software (www.ats.ucla.edu/software).
Results Function of the IRES from the cDNA of vp28 gene In our previous study, a naturally occurring dicistron separated by a 180-nt fragment was found in the cDNA of WSSV vp28 gene [23]. The translation of vp28 gene from a single mRNA led to the suggestion that this 180-bp fragment functioned as an internal ribosome entry site (IRES). To identify the function of the putative IRES, it was inserted between GST and GFP genes to construct a dicistronic reporter plasmid (GST-IRES-GFP) (Fig. 1). The GST gene, as well as the GFP gene, contained a stop codon. After transfection into Hi5 cells with the dicistron, only a single transcript corresponding to the full length of GSTIRES-GFP could be observed as indicated by Northern blot using a DIG-labeled probe that was specific to the putative IRES (Fig. 2, lane 3), which was larger than that of the control GST-IRES (Fig. 2, lane 2). In addition, there
Fig. 1. Schematic constructs used for transfection of T. ni insect cells (Hi5 cells). (A) The dicistronic reporter constructs under the Polh promoter. The ORF 1 and ORF 2 were GST and GFP genes or Rluc and Fluc genes, respectively. The putative IRES region was located between the two cistrons. (B) Oriented or deleted IRESs. IRESr represented the reversely oriented IRES. IRESdel 1–10 indicated the different deletions (dots) of IRES. (C) Monocistronic constructs.
896
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899
Fig. 2. Northern blot analysis of total RNAs isolated from mock- and bacmid- transfected Hi5 cells at 48 h after transfection, using a DIGlabeled probe that was specific to the putative IRES. The migration of RNA molecular size standards (in kilobases) was shown at left. Lanes 1, mock; 2, cells transfected by the GST-IRES bacmid; 3, cells transfected by the GST-IRES-GFP bacmid.
was only a single transcript corresponding to the full length of GST-IRES-GFP using the GST or GFP as probe (data not shown). However, there was no band for the normal insect cells (Fig. 2, lane 1). This showed that the dicistron was transcribed as a single mRNA molecule. The non-transfected Hi5 cells and cells transfected by the dicistronic reporter bacmid (GST-IRES-GFP) were collected for the next analyses. As revealed by SDS–PAGE, the upstream GST gene of the dicistron was normally
expressed (Fig. 3A). This was further confirmed by Western blot analysis with the anti-GST antibody (Fig. 3A), indicating that the upstream cistron was separately translated from a dicistronic mRNA as GST protein, but not as a fusion protein. On the other hand, the fluorescent microscopy showed that the downstream GFP gene of the dicistron was simultaneously translated (Fig. 3B). However, the Hi5 cells could not fluoresce when transfected by the control bacmid (GST-interferon-GFP), in which a 180-nt DNA fragment of shrimp interferon gene was inserted between GST and GFP genes to replace the putative IRES of the dicistron (data not shown). The results revealed that the putative IRES functioned really as an internal ribosome entry site, which was able to mediate the translation initiation of gene in insect cells. Sequence orientation and length of the IRES from the WSSV IRES The IRES sequence was reversely oriented by PCR amplification. Then it was inserted between GST and GFP genes to construct a dicistron GST-IRESr-GFP (Fig. 1). Although the GST gene was translated as revealed by Western blot, no green fluorescence could be observed for the Hi5 cells transfected by GST-IRESr-GFP (data not shown), indicating that the IRES from WSSV was orientation-dependent. In an attempt to determine the minimal length of IRES, a series of deletions of the WSSV
Fig. 3. Gene translation analyses of the dicistron GST-IRES-GFP. Scale bar, 25 lm. (A) The proteins from mock- and bacmid-transfected Hi5 cells were separated by 12% SDS–PAGE (left), followed by Western blot analysis with GST-specific antibody (right). Lanes M, protein marker; 1, non-transfected cells as a negative control; 2, cells transfected by the dicistronic reporter bacmid GST-IRES-GFP; 3, the purified GST protein as a positive control. (B) Hi5 cells transfected by the dicistronic reporter bacmid GST-IRES-GFP were observed at 48 h after transfection under fluorescent microscope using 545 nm excitation (left) and light microscope (right) (40 · 10). The green fluorescence showed that the GFP gene was expressed in insect cells.
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899
897
IRES were prepared (Fig. 1). However, the fluorescent microscopy showed that the GFP gene was not expressed when the IRES in the dicistronic reporter GST-IRESGFP was replaced by truncated versions of IRES. At this moment, the GST gene was normally translated. The data showed that the minimum length of the WSSV IRES element was 180 nt.
struct Rluc-IRES-Fluc was significantly different from that of FLUC0 (t-test, P = 0.0248, 0.01 < P < 0.05) (Fig. 4). Compared with that of the cap-dependent translation initiation, however, the efficiency of translation mediated by IRES was 98.77% (Fig. 4), suggesting that the IRES element could very efficiently initiate the translation of the second cistron in a dicistronic construct.
Efficiency of translation initiation mediated by WSSV IRES element
Discussion
To address the concern with its translation efficiency, the IRES was inserted between the Renilla luciferase (Rluc) and the firefly luciferase (Fluc) genes to construct another dicistronic reporter plasmid Rluc-IRES-Fluc. As controls, the Rluc and Fluc genes were separately cloned into pFASTBACHTb to form RLUC0 and FLUC0 reporter plasmids, respectively. The t-test results indicated that the activities of Renilla luciferase had no significant difference between the dicistronic reporter construct Rluc-IRES-Fluc and the control RLUC0 (t-test, P = 0.1209, P > 0.05) (Fig. 4). On the other hand, the firefly luciferase activity of the con-
Fig. 4. Enzymatic quantitation of the IRES translational efficiencies. The activities of the Renilla luciferase (Rluc) (left) and the firefly luciferase (Fluc) (right) from the dicistronic construct Fluc-IRES-Rluc or the monocistronic constructs (RLUC0 or FLUC0) were measured as light units (A) and relative activities (B). The shadowed pillars presented the translation of the monocistronic constructs (RLUC0 or FLUC0), and the blank pillars indicated the translation of the dicistronic construct RlucIRES-Fluc. The mean values (A) and their corresponding percentages (B) from two independent experiments were shown above the pillars. Error bars indicated the standard deviations.
IRES elements, mediating internal initiation of mRNA translation, have been identified mainly in RNA viruses and only one DNA virus—Kaposi’s sarcoma-associated herpesvirus (KSHV) [10,11], as well as in some eukaryotic mRNA molecules. In this investigation, an IRES was first revealed from a marine DNA virus, WSSV of marine shrimp, which was also the second one discovered in DNA virus. Although the IRES elements from different origins are essentially the same in functions, no conserved domain or motif is found in the IRES sequences thus far. Moreover, the lengths of IRES elements vary among different origins (Table 2). The IRESs from mammalian picornaviruses are usually 450-nt [2], while the IRES elements from hepaciviruses (HCV) [8,24] and pestiviruses [9,25], members of the flavivirus family, are generally 300- to 350-nt in length. IRES elements of around 200-nt are present in insect RNA viruses [26,27] and in Taura syndrome virus (TSV) of penaeid shrimp [4]. The IRESs from DNA viruses seem shorter than those from RNA viruses. In Kaposi’s sarcoma-associated herpesvirus (DNA virus), a 233-nt IRES was capable of directing efficient translation of the downstream cistron of a dicistron in an orientation-dependent manner. Reducing the size of this IRES resulted in a complete loss of IRES activity [28]. The WSSV IRES revealed in this study was only 180-nt. Up to date, however, the shortest IRES comes from cellular mRNA molecule. A recent report described an IRES element within the 5 0 UTR of the mRNA encoding the homeodomain protein Gtx, which contained a 9-nt segment 100% complementary to 18S rRNA [29]. This 9-nt fragment still functioned as an IRES even when taken out of the context of the rest of the 5 0 UTR. Coexpression of two proteins, one being a selectable marker, and the other the gene of interest, is often a requirement in biotechnological applications. The ability of IRES to promote internal initiation of translation, instead of employing two or more promoters, has facilitated the expression of two or more proteins from a polycistronic translation unit in eukaryotic cells. In recent years, the dicistronic expression vectors, in which the first gene is translated in a cap-dependent manner and the second one in an IRES-dependent manner, have been applied to a variety of experimental settings, from cultured cells to transgenic animals. During these applications, one of the major concerns is the efficiency of translation initiation mediated by IRES. Many studies
898
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899
Table 2 Characteristics of IRESs from different origins Origins
Types
Length (nt)
Translation efficiency
References
Kaposi’s sarcoma- associated herpesvirus Mammalin picornavirus Taura syndrome virus of marine shrimp Hepacivirus and pestivirus Rhopalosiphum padi virus PITSLRE protein kinase Homeodomain protein Gtx White spot syndrome virus of marine shrimp
DNA virus RNA virus RNA virus RNA virus RNA virus Cellular mRNA Cellular mRNA DNA virus
233 450 230 300–350 579 1015 9 180
Unknown Unknown Unknown Unknown 3-fold weaker than that of cap-dependent translation Unknown Unknown 98.77% of cap-dependent translation
[10,11] [2] [4] [3,8,9,24] [30] [16] [29] This study
indicate that the translation efficiency in IRES-dependent manner is much lower than that in cap-dependent manner. Quantitation by fluorescence spectrophotometry of the fluorescent proteins produced in Sf21 cells revealed that the translation efficiency mediated by the Rhopalosiphum padi virus (RhPV) 5 0 UTR IRES was about 3-fold weaker than that of cap-dependent translation [30] (Table 2). In our study, the translation efficiency mediated by the WSSV IRES was 98.77%, compared with that of cap-dependent initiation (Table 2). In this context, this WSSV IRES promises to be very useful for coexpression of two or more proteins, which can serve as biotechnological tools, particularly for gene therapy.
[9]
[10]
[11]
[12]
[13]
Acknowledgment [14]
This work was financially supported by National Natural Science Foundation of China (30525011 and 30330470). References [1] M. Kozak, The scanning model for translation: an update, J. Cell. Biol. 108 (1989) 229–241. [2] G.J. Belsham, R.J. Jackson, Translation initiation on picornavirus RNA, in: Translational Control of Gene Expression, 2nd ed., New York, 2000. [3] T.V. Pestova, I.N. Shatsky, S.P. Fletcher, R.J. Jackson, C.U.T. Hellen, A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNAs, Gene Dev. 12 (1998) 67–83. [4] R.C. Cevallos, P. Sarnow, Factor-independent assembly of elongationcompetent ribosomes by an internal ribosome entry site located in an RNA virus that infects Penaeid Shrimp, J. Virol. 79 (2005) 677–683. [5] E. Royall, K.E. Woolaway, J. Schacherl, S. Kubick, G.J. Belsham, L.O. Roberts, The Rhopalosiphum padi virus 5 0 internal ribosome entry site is functional in Spodoptera frugiperda 21cells and in their cell-free lysates: implications for the baculovirus expression system, J. Gen. Virol. 85 (2004) 1565–1569. [6] V.P. Pisarev, S.C. Louisa, K. Yoshihiro, L.J. Helen, N.S. Ivan, J.B. Graham, Functional and Structural Similarities between the Internal Ribosome Entry Sites of Hepatitis C Virus and Porcine Teschovirus, a Picornavirus, J. Virol. 5 (2004) 4487–4497. [7] I.K. Ali, L. McKendrick, S.J. Morley, R.J. Jackson, Activity of the hepatitis A virus IRES requires association between the cap-binding translation initiation factor (eIF4E) and eIF4G, J. Virol. 75 (2001) 7854–7863. [8] J.E. Reynolds, A. Kaminski, H.J. Kettinen, K. Grace, B.E. Clarke, A.R. Carroll, D.J. Rowlands, R.J. Jackson, Unique features of
[15]
[16]
[17] [18]
[19]
[20]
[21] [22]
[23]
[24]
[25]
internalinitiation of hepatitis-C virus-RNA translation, EMBO J. 14 (1995) 6010–6020. S.P. Fletcher, R.J. Jackson, Pestivirus internal ribosome entry site (IRES) structure and function: elements in the 5 0 untranslated region important for IRES function, J. Virol. 76 (2002) 5024–5033. L. Bieleski, S.J. Talbot, Kaposi’s sarcoma-associated herpesvirus vCyclin open reading frame contains an internal ribosome entry site, J. Virol. 7 (4) (2001) 1864–1869. A. Grundhoff, D. Ganem, Mechanisms governing expression of the vFLIP gene of Kaposi’s sarcoma-associated herpesvirus, J. Virol. 7 (4) (2001) 1857–1863. S. Vagner, M.C. Gensac, A. Maret, F. Bayard, F. Amalric, H. Prats, A.C. Prats, Alternative translation of human FGF-2 mRNA occurs by internal entry of ribosomes, Mol. Cell. Biol. 15 (1995) 35–44. I. Stein, A. Itin, P. Einat, R. Skaliter, Z. Grossman, E. Keshet, Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia, Mol. Cell. Biol. 18 (1998) 3112–3119. M. Holcik, R.G. Korneluk, Functional characterization of the Xlinked inhibitor of apoptosis (XIAP) internal ribosome entry site element: role of La autoantigen in XIAP translation, Mol. Cell. Biol. 20 (2000) 4648–4657. M. Stoneley, F.E.M. Paulin, J.P.C. Le Quesne, S.A. Chappell, A.E. Willis, C-Myc 5 0 untranslated region contains an internal ribosome entry segment, Oncogene 16 (1998) 423–428. S. Cornelis, Y. Bruynooghe, G. Denecker, S. Van Huffel, S. Tinton, R. Beyaert, Identification and characterization of a novel cell cycleregulated internal ribosome entry site, Mol. Cell 5 (2000) 597–605. S. Pyronnet, L. Pradayrol, N. Sonenberg, A cell cycle-dependent internal ribosome entry site, Mol. Cell 5 (2000) 607–616. L.O. Roberts, R.A. Seamons, G.J. Belsham, Recognition of picornavirus internal ribosome entry sites within cells; influence of cellular and viral proteins, RNA 4 (1998) 520–529. A.J. Dorner, B.L. Semler, R.J. Jackson, R. Hanecak, E. Duprey, E. Wimmer, In vitro translation of poliovirus RNA: utilization of internal initiation sites in reticulocyte lysate, J. Virol. 50 (1984) 507–514. M.J. Glass, D.F. Summers, Identification of a trans-acting activity from liver that stimulates hepatitis A virus translation in vitro, Virology 193 (1993) 1047–1050. C.A. Suttle, Viruses in the sea, Nature 437 (2005) 356–361. F. Yang, W. Wang, R.Z. Chen, X. Xu, A simple and efficient method for purification of prawn baculovirus DNA, J. Virol. Method. 67 (1997) 1–4. X. Zhang, C.H. Huang, X. Xu, C.L. Hew, Identification and localization of a prawn white spot syndrome virus gene that encodes an envelope protein, J. Gen. Virol. 83 (2002) 1069–1074. K. Tsukiyama-Kohara, N. Iizuka, M. Kohara, A. Nomoto, Internal ribosome entry site within hepatitis C virus RNA, J. Virol. 66 (1992) 1476–1483. J. Pelletier, N. Sonenberg, Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA, Nature 334 (1988) 320–325.
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899 [26] J. Sasaki, N. Nakashima, Translation initiation at the CUU codon is mediated by the internal ribosome entry site of an insect picorna-like virus in vitro, J. Virol. 73 (1999) 1219–1226. [27] J.E. Wilson, T.V. Pestova, C.U.T. Hellen, P. Sarnow, Initiation from the A site of the ribosome, Cell 102 (2000) 511–520. [28] L. Bieleski, C. Hindley, S.J. Talbot, A polypyrimidine tract facilitates the expression of Kaposi’s sarcoma-associated herpesvirus vFLIP through an internal ribosome entry site, J. Gen. Virol. 85 (2004) 615–620.
899
[29] S.A. Chappell, G.M. Edelman, V.P. Mauro, A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity, Proc. Natl. Acad. Sci. USA 97 (2000) 1536–1541. [30] Y.J. Chen, W.S. Chen, T.Y. Wu, Development of a bi-cistronic baculovirus expression vector by the Rhopalosiphum padi virus 5 0 internal ribosome entry site, Biochem. Biophys. Res. Commun. 33 (2) (2005) 616–623.
Internal initiation of mRNA translation in insect cell mediated by an internal ribosome entry site (IRES) from shrimp white spot syndrome virus (WSSV) q Fang Han, Xiaobo Zhang
*
Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration Xiamen 361005, PR China Received 28 March 2006 Available online 19 April 2006
Abstract Internal initiation of mRNA translation can be mediated by internal ribosome entry site (IRES) elements which are located mainly in RNA viruses as well as certain mammalian and insect mRNA molecules. Thus far, only one DNA virus has been discovered to contain IRES element. In this investigation, an IRES element from white spot syndrome virus (WSSV), a DNA virus of marine shrimp, was demonstrated to direct the efficient translation of dicistronic mRNA in Trichoplusia ni insect cells. The IRES was inserted between glutathione S-transferase (GST) and green fluorescent protein (GFP) genes to construct a dicistronic cassette (GST-IRES-GFP). After transfection of this dicistronic cassette in insect cell, the Northern blot indicated that only one transcript corresponding to the mRNA of GST-IRES-GFP could be detected. However, the GST and GFP genes were simultaneously translated as revealed by Western blot and fluorescent microscopy, respectively. Based on sequence orientation and deletion analyses, the IRES element was 180 nucleotides (nt) in length and orientation-dependent. By comparison with that of cap-dependent initiation, the translation efficiency mediated by IRES was 98.77%. This finding promises that the WSSV IRES could be very useful to co-express two or more proteins due to its shorter length and higher translation efficiency. 2006 Elsevier Inc. All rights reserved. Keywords: WSSV; IRES; GST; GFP; Translation efficiency
For capped eukaryotic mRNA, translation initiation requires scanning by the ribosome from the 5 0 end to the initiator AUG codon of mRNA [1]. In contrast, studies on the translation of viral mRNAs bearing uncommon features in their 5 0 untranslated regions (UTRs) have shed light on an alternative mode of 40S recruitment to the mRNA. This cap-independent mechanism is directed by an internal ribosome entry site (IRES). The best-characterized IRES elements are those from the mammalian picornaviruses [2]. Picornavirus RNAs are uncapped and the initiation of translation on picornavirus RNA occurs up q The GenBank accession number of the sequence reported in this paper is AF227911. * Corresponding author. Fax: +86 592 2085376. E-mail address: [email protected] (X. Zhang).
0006-291X/$ - see front matter 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.03.229
to 1300 nucleotides (nt) away from the 5 0 terminus. Up to date, all picornavirus RNAs examined have been found to possess IRESs [3]. The picornavirus IRES elements are generally about 450 nt in length [2]. However, the IRES from Taura syndrome virus (TSV) of marine shrimp, an invertebrate picornavirus, is 230-nt [4]. Based on the predicted secondary structure and its activity in vitro, the picornavirus IRESs can be divided into one minor and two major groups: (i) hepatitis A virus (HAV) IRES elements; (ii) entero- and rhinovirus (e.g., poliovirus) IRES elements; and (iii) cardio-, aphtho-, and parechovirus IRES elements including the encephalomyocarditis virus and foot-and-mouth disease virus [4–7]. IRES elements have also been identified from hepaciviruses (HCV) [8] and pestiviruses, for example, classical swine fever virus (CSFV), which are members of the
Notes. IRESr represented the reversely oriented IRES from WSSV. IRESdel1, IRESdel2, IRESdel3, IRESdel4, IRESdel5, IRESdel6, IRESdel7, IRESdel8, IRESdel9 and IRESdel10 indicated various deletions of WSSV IRES (Fig. 1). The italic letters show the endonuclease sites.
SpeI HindIII XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI XbaI SpeI HindIII GACTAGTTTAACGCGGAACCAGATCCG CCAAGCTTTTACTTGTACAGCTCGTCCA GCTCTAGA GACGAGTTTTTTTCTTTATC GCTCTAGA TCACCATGTGCTTCTG GCTCTAGA ACCCTGGCTTACTGTA GCTCTAGA GAACGTTGCTTGGTTATT GCTCTAGA GATGTCGTTT TGTCGGCG GCTCTAGA GACAAAAAAAAAGGTTAC GCTCTAGA TTGGTGATGACAACCTCG GCTCTAGA AAACCACAGAGTACGTAA GCTCTAGA GACGAGTTTTTTTCTTTATC GCTCTAGA GACGAGTTTTTTTCTTTATC GCTCTAGA GACGAGTTTTTTTCTTTATC GCTCTAGA GACGAGTTTTTTTTCTTTATC GCTCTAGA GACGAGTTTTTTTCTTTATC GACTAGTTTATTGTTCATTTTTGAGAACTCGT CCAAGCTTTTACACGGCGATCTTTCCGCCCT GCGGATCC ATGTCCACCTTACTAGG GCTCTAGA ATGGTGAGCAAGGGCGAG GACTAGTTGAACCCTGGCTTACTGTA GACAGTTGAATGAGAAGAAGAAAGCCCAGT GACTAGTTGAGACGAGTTTTTTTCTTTATC GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAACCCTGGCTTACTGTA GACTAGTTGAAAAAAAGAGTAAAAGGCG GACTAGTTGAGCTCGCTTGCCAATTGT GACTAGTTGATGTTACGTACTCTGTGGT GACTAGTTGACACGAGGTTGTCATCAC GACTAGTTGAAGGTAACCTTTTTTTTTG GCGGATCC ATGACTTCGAAAGTTTATGAT GCTCTAGA ATGGAAGACGCCAAAAACAT
BamHI XbaI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI SpeI BamHI XbaI
Reverse primers (5 0 –3 0 )2 Endonuclease
GST GFP IRES Shrimp interferon IRESr IRESdel 1 IRESdel 2 IRESdel 3 IRESdel 4 IRESdel 5 IRESdel 6 IRESdel 7 IRESdel 8 IRESdel 9 IRESdel 10 Rluc Fluc
Construction of dicistronic reporter bacmids. The cDNA analysis of vp28 gene from WSSV revealed the presence of an in-frame upstream minicistron, which was separated by a 180-nt fragment from the vp28 gene [23]. This putative IRES fragment was obtained by PCR with IRES-specific primers (Table 1) using WSSV genomic DNA [22]. The GST and GFP genes were amplified from pGEX-20T (Amersham Biosciences, America) and pEGFP (Clontech, America) with gene-specific primers (Table 1), respectively. After amplifications, they were cloned into pFASTBACHTb to construct the dicistronic reporter plasmid (GST-IRES-GFP), which contained a stop codon in GST and GFP genes, respectively. As a negative control, the IRES in GST-IRES-GFP was replaced by a 180-nt interferon gene fragment of shrimp. In addition, the GST gene and IRES were, respectively, amplified with specific primers (Table 1) and cloned into pFASTBACHTb to obtain the GST-IRES construct.
Forward primers (5 0 –3 0 )2
Materials and methods
Genes or DNA fragments
flavivirus family [3,9]. So far, however, only one DNA virus, the Kaposi’s sarcoma-associated herpesvirus (KSHV), has been found to contain an IRES element [10,11]. Besides viruses, IRES elements have been documented in some cellular mRNAs of genes involved in cell proliferation and apoptosis, such as fibroblast growth factor-2 [12], vascular endothelial growth factor [13], X-linked inhibitor of apoptosis [14], the protooncogene c-myc [15], PITSLRE protein kinase [16] and ornithine decarboxylase [17]. Although reports on IRES are accumulated, no significant sequence similarity among IRES elements is found. Moreover, IRES elements usually share different lengths. Indeed, it has been demonstrated that different IRES elements function with different efficiencies in different cell types [18]. The cardio-/aphthovirus IRES elements function efficiently in the rabbit reticulocyte lysate (RRL) translation system. However, the poliovirus and rhinovirus IRES elements are inefficient in this system [19]. The activity of the hepatitis A virus IRES is stimulated by the addition of liver cell, but not HeLa cell extracts [20]. Viruses are extremely abundant in the sea [21]. To our surprise, however, no IRES is found from marine DNA viruses until now. In this study, an IRES element from white spot syndrome virus (WSSV) of marine shrimp, a DNA virus, was revealed. WSSV, a 305 kb doublestranded circular DNA virus [22], is the only member of a newly established Whispovirus genus, Nimaviridae (www.ncbi.nlm.nih.gov/ICTV). In our previous study, an in-frame minicistron separated by a 180 bp fragment was observed in the leading sequence of the cDNA of vp28 gene [23]. The expression of vp28 gene from a single mRNA led to the suggestion that the two cistrons might be under independent translation control. In an attempt to confirm the IRES element in WSSV, the 180-nt fragment was inserted between glutathione S-transferase (GST) and green fluorescent protein (GFP) genes to construct a bicistronic cassette GST-IRES-GFP. The results showed that the GST and GFP genes, transcribed in an mRNA, were simultaneously translated. By comparison with that of cap-dependent initiation, the translation efficiency of IRES was 98.77%.
Endonuclease
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899
Table 1 Primers used for PCR amplifications of genes or DNA fragments
894
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899 In order to evaluate the effects of sequence orientation and deletion on IRES, the IRES was reversely oriented and deleted at different length by PCR using the corresponding primers (Table 1). Then the IRES in GSTIRES-GFP was replaced by the oriented or deleted IRES, respectively. The Renilla luciferase (Rluc) and firefly luciferase (Fluc) genes were amplified from pRL-TK and pGL3 (Promega, America) with gene-specific primers (Table 1), respectively. Subsequently Rluc, Fluc, and IRES were ligated with pFASTBACHTb to construct another dicistronic reporter plasmid Rluc-IRES-Fluc which contained a stop codon in Rluc and Fluc genes, respectively. At the same time, the Rluc and Fluc genes were separately cloned into pFastBacHTb vector to form RLUC0 and FLUC0 reporter plasmids as controls. The above recombinant plasmids were confirmed by DNA sequencing. Then they were, respectively, transformed into DH10Bac competent E. coli. using the BAC-TO-BAC Baculovirus Expression System to obtain dicistronic or monocistronic bacmids according to the manufacturer’s instructions (Gibco-BRL, America). The bacmid DNAs were isolated for transfection of insect cells as recommended by the manufacturer’s protocol (Gibco-BRL, America). Insect cells, transfection, and infection. High Five (Hi5) insect cells developed from Trichoplusia ni (Invitrogen, America) were propagated at 27 C in Grace’s insect medium (Invitrogen, America) supplemented with 5% heat-inactivated fetal bovine serum (FBS) (PAA Laboratories, Linz, Austria). Transfections of high molecular weight bacmid DNAs were performed using Cellfectin transfection reagent (Invitrogen, America). Briefly, Hi5 cells were plated at 12-well plates and cultured for 24 h at confluence of about 70% before transfection. After removal of the medium (containing FBS), the cells were transfected by 4 lg of recombinant bacmid DNA mixed with 5 ll lipofectin in 500 ll medium per well. Four hours later, the mixture was removed and the cells were overlaid with 1 ml medium containing 5% FBS. Supernatants containing the recombinant baculovirus particles were collected at 72 h after transfection and filtered (0.45 lm pore size). For infection, the cells at confluence of about 70% were overlaid with 150–250 ll of recombinant baculovirus suspension. After incubation at 27 C for 2 h, 1 ml of medium containing 5% FBS was added. Two days later, the cells were harvested. Northern blot. Total RNAs were extracted from uninfected and infected (48 h post-infection) insect cells using 1 ml of Trizol reagent (Bio Basic Inc., Canada) according to the manufacturer’s instructions. After treatment with RNase-free DNase I (TakaRa, Japan) for 30 min at 37 C, RNAs were separated by electrophoresis on a 2% agarose gel in 1· TBE buffer (90 mM Tris–boric acid, 2 mM EDTA, pH 8.0) and transferred to a nitrocellulose membrane (Amersham, America). The blots were probed with DIG-labeled putative IRES fragment. The DIG labeling and detection were performed following the protocol of DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Germany). Western blot. The samples from whole insect cells were analyzed in a 12% SDS–PAGE gel. Then the proteins, visualized using Coomassie brilliant blue staining, were transferred onto a nitrocellulose membrane (Bio-Rad, America) in electroblotting buffer (25 mM Tris, 190 mM glycine, and 20% methanol) at 70 V for 2 h. The membrane was immersed in blocking buffer (3% BSA, 20 mM Tris, 0.9% NaCl, and 0.1% Tween 20, pH 7.2) at 4 C overnight, followed by incubation with anti-GST IgG for 2 h. The antibody was obtained in our previous study [23]. Subsequently, the membrane was incubated in HRP-conjugated goat anti-mouse IgG (Sigma, America) for 1 h and detected with substrate solution (4-chloro-1naphthol, Sigma). Dual luciferase assays. Firefly and Renilla luciferase activities from bacmid-transfected insect cells were measured at 48 h after transfection using Dual-Luciferase Reporter Assay System Kit (Promega, America). Briefly, transfected cells were washed twice with ice-cold 1· phosphatebuffered saline (PBS) and lysed in 100 ll of 1· luciferase lysis buffer per well (Promega, America). After rotation at room temperature for 15 min, the lysate was centrifuged at 12,000g for 2 min at 4 C. Subsequently 20 ll of the supernatant was incubated with 100 ll of Luciferase Assay Reagent II (Promega, America) for 2 s. The firefly luciferase activity was quickly measured in TD-20/20 luminometer (Turner Designs, America). After
895
that, the same supernatant was mixed with 100 ll of Stop & Glo Reagent (Promega) for 3 s, followed by immediate quantification of Renilla luciferase activity using TD-20/20 luminometer. All assays (bacmid transfection and luciferase assays) were performed twice. The data were analyzed by t-test using the Science Analysis Software (www.ats.ucla.edu/software).
Results Function of the IRES from the cDNA of vp28 gene In our previous study, a naturally occurring dicistron separated by a 180-nt fragment was found in the cDNA of WSSV vp28 gene [23]. The translation of vp28 gene from a single mRNA led to the suggestion that this 180-bp fragment functioned as an internal ribosome entry site (IRES). To identify the function of the putative IRES, it was inserted between GST and GFP genes to construct a dicistronic reporter plasmid (GST-IRES-GFP) (Fig. 1). The GST gene, as well as the GFP gene, contained a stop codon. After transfection into Hi5 cells with the dicistron, only a single transcript corresponding to the full length of GSTIRES-GFP could be observed as indicated by Northern blot using a DIG-labeled probe that was specific to the putative IRES (Fig. 2, lane 3), which was larger than that of the control GST-IRES (Fig. 2, lane 2). In addition, there
Fig. 1. Schematic constructs used for transfection of T. ni insect cells (Hi5 cells). (A) The dicistronic reporter constructs under the Polh promoter. The ORF 1 and ORF 2 were GST and GFP genes or Rluc and Fluc genes, respectively. The putative IRES region was located between the two cistrons. (B) Oriented or deleted IRESs. IRESr represented the reversely oriented IRES. IRESdel 1–10 indicated the different deletions (dots) of IRES. (C) Monocistronic constructs.
896
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899
Fig. 2. Northern blot analysis of total RNAs isolated from mock- and bacmid- transfected Hi5 cells at 48 h after transfection, using a DIGlabeled probe that was specific to the putative IRES. The migration of RNA molecular size standards (in kilobases) was shown at left. Lanes 1, mock; 2, cells transfected by the GST-IRES bacmid; 3, cells transfected by the GST-IRES-GFP bacmid.
was only a single transcript corresponding to the full length of GST-IRES-GFP using the GST or GFP as probe (data not shown). However, there was no band for the normal insect cells (Fig. 2, lane 1). This showed that the dicistron was transcribed as a single mRNA molecule. The non-transfected Hi5 cells and cells transfected by the dicistronic reporter bacmid (GST-IRES-GFP) were collected for the next analyses. As revealed by SDS–PAGE, the upstream GST gene of the dicistron was normally
expressed (Fig. 3A). This was further confirmed by Western blot analysis with the anti-GST antibody (Fig. 3A), indicating that the upstream cistron was separately translated from a dicistronic mRNA as GST protein, but not as a fusion protein. On the other hand, the fluorescent microscopy showed that the downstream GFP gene of the dicistron was simultaneously translated (Fig. 3B). However, the Hi5 cells could not fluoresce when transfected by the control bacmid (GST-interferon-GFP), in which a 180-nt DNA fragment of shrimp interferon gene was inserted between GST and GFP genes to replace the putative IRES of the dicistron (data not shown). The results revealed that the putative IRES functioned really as an internal ribosome entry site, which was able to mediate the translation initiation of gene in insect cells. Sequence orientation and length of the IRES from the WSSV IRES The IRES sequence was reversely oriented by PCR amplification. Then it was inserted between GST and GFP genes to construct a dicistron GST-IRESr-GFP (Fig. 1). Although the GST gene was translated as revealed by Western blot, no green fluorescence could be observed for the Hi5 cells transfected by GST-IRESr-GFP (data not shown), indicating that the IRES from WSSV was orientation-dependent. In an attempt to determine the minimal length of IRES, a series of deletions of the WSSV
Fig. 3. Gene translation analyses of the dicistron GST-IRES-GFP. Scale bar, 25 lm. (A) The proteins from mock- and bacmid-transfected Hi5 cells were separated by 12% SDS–PAGE (left), followed by Western blot analysis with GST-specific antibody (right). Lanes M, protein marker; 1, non-transfected cells as a negative control; 2, cells transfected by the dicistronic reporter bacmid GST-IRES-GFP; 3, the purified GST protein as a positive control. (B) Hi5 cells transfected by the dicistronic reporter bacmid GST-IRES-GFP were observed at 48 h after transfection under fluorescent microscope using 545 nm excitation (left) and light microscope (right) (40 · 10). The green fluorescence showed that the GFP gene was expressed in insect cells.
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899
897
IRES were prepared (Fig. 1). However, the fluorescent microscopy showed that the GFP gene was not expressed when the IRES in the dicistronic reporter GST-IRESGFP was replaced by truncated versions of IRES. At this moment, the GST gene was normally translated. The data showed that the minimum length of the WSSV IRES element was 180 nt.
struct Rluc-IRES-Fluc was significantly different from that of FLUC0 (t-test, P = 0.0248, 0.01 < P < 0.05) (Fig. 4). Compared with that of the cap-dependent translation initiation, however, the efficiency of translation mediated by IRES was 98.77% (Fig. 4), suggesting that the IRES element could very efficiently initiate the translation of the second cistron in a dicistronic construct.
Efficiency of translation initiation mediated by WSSV IRES element
Discussion
To address the concern with its translation efficiency, the IRES was inserted between the Renilla luciferase (Rluc) and the firefly luciferase (Fluc) genes to construct another dicistronic reporter plasmid Rluc-IRES-Fluc. As controls, the Rluc and Fluc genes were separately cloned into pFASTBACHTb to form RLUC0 and FLUC0 reporter plasmids, respectively. The t-test results indicated that the activities of Renilla luciferase had no significant difference between the dicistronic reporter construct Rluc-IRES-Fluc and the control RLUC0 (t-test, P = 0.1209, P > 0.05) (Fig. 4). On the other hand, the firefly luciferase activity of the con-
Fig. 4. Enzymatic quantitation of the IRES translational efficiencies. The activities of the Renilla luciferase (Rluc) (left) and the firefly luciferase (Fluc) (right) from the dicistronic construct Fluc-IRES-Rluc or the monocistronic constructs (RLUC0 or FLUC0) were measured as light units (A) and relative activities (B). The shadowed pillars presented the translation of the monocistronic constructs (RLUC0 or FLUC0), and the blank pillars indicated the translation of the dicistronic construct RlucIRES-Fluc. The mean values (A) and their corresponding percentages (B) from two independent experiments were shown above the pillars. Error bars indicated the standard deviations.
IRES elements, mediating internal initiation of mRNA translation, have been identified mainly in RNA viruses and only one DNA virus—Kaposi’s sarcoma-associated herpesvirus (KSHV) [10,11], as well as in some eukaryotic mRNA molecules. In this investigation, an IRES was first revealed from a marine DNA virus, WSSV of marine shrimp, which was also the second one discovered in DNA virus. Although the IRES elements from different origins are essentially the same in functions, no conserved domain or motif is found in the IRES sequences thus far. Moreover, the lengths of IRES elements vary among different origins (Table 2). The IRESs from mammalian picornaviruses are usually 450-nt [2], while the IRES elements from hepaciviruses (HCV) [8,24] and pestiviruses [9,25], members of the flavivirus family, are generally 300- to 350-nt in length. IRES elements of around 200-nt are present in insect RNA viruses [26,27] and in Taura syndrome virus (TSV) of penaeid shrimp [4]. The IRESs from DNA viruses seem shorter than those from RNA viruses. In Kaposi’s sarcoma-associated herpesvirus (DNA virus), a 233-nt IRES was capable of directing efficient translation of the downstream cistron of a dicistron in an orientation-dependent manner. Reducing the size of this IRES resulted in a complete loss of IRES activity [28]. The WSSV IRES revealed in this study was only 180-nt. Up to date, however, the shortest IRES comes from cellular mRNA molecule. A recent report described an IRES element within the 5 0 UTR of the mRNA encoding the homeodomain protein Gtx, which contained a 9-nt segment 100% complementary to 18S rRNA [29]. This 9-nt fragment still functioned as an IRES even when taken out of the context of the rest of the 5 0 UTR. Coexpression of two proteins, one being a selectable marker, and the other the gene of interest, is often a requirement in biotechnological applications. The ability of IRES to promote internal initiation of translation, instead of employing two or more promoters, has facilitated the expression of two or more proteins from a polycistronic translation unit in eukaryotic cells. In recent years, the dicistronic expression vectors, in which the first gene is translated in a cap-dependent manner and the second one in an IRES-dependent manner, have been applied to a variety of experimental settings, from cultured cells to transgenic animals. During these applications, one of the major concerns is the efficiency of translation initiation mediated by IRES. Many studies
898
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899
Table 2 Characteristics of IRESs from different origins Origins
Types
Length (nt)
Translation efficiency
References
Kaposi’s sarcoma- associated herpesvirus Mammalin picornavirus Taura syndrome virus of marine shrimp Hepacivirus and pestivirus Rhopalosiphum padi virus PITSLRE protein kinase Homeodomain protein Gtx White spot syndrome virus of marine shrimp
DNA virus RNA virus RNA virus RNA virus RNA virus Cellular mRNA Cellular mRNA DNA virus
233 450 230 300–350 579 1015 9 180
Unknown Unknown Unknown Unknown 3-fold weaker than that of cap-dependent translation Unknown Unknown 98.77% of cap-dependent translation
[10,11] [2] [4] [3,8,9,24] [30] [16] [29] This study
indicate that the translation efficiency in IRES-dependent manner is much lower than that in cap-dependent manner. Quantitation by fluorescence spectrophotometry of the fluorescent proteins produced in Sf21 cells revealed that the translation efficiency mediated by the Rhopalosiphum padi virus (RhPV) 5 0 UTR IRES was about 3-fold weaker than that of cap-dependent translation [30] (Table 2). In our study, the translation efficiency mediated by the WSSV IRES was 98.77%, compared with that of cap-dependent initiation (Table 2). In this context, this WSSV IRES promises to be very useful for coexpression of two or more proteins, which can serve as biotechnological tools, particularly for gene therapy.
[9]
[10]
[11]
[12]
[13]
Acknowledgment [14]
This work was financially supported by National Natural Science Foundation of China (30525011 and 30330470). References [1] M. Kozak, The scanning model for translation: an update, J. Cell. Biol. 108 (1989) 229–241. [2] G.J. Belsham, R.J. Jackson, Translation initiation on picornavirus RNA, in: Translational Control of Gene Expression, 2nd ed., New York, 2000. [3] T.V. Pestova, I.N. Shatsky, S.P. Fletcher, R.J. Jackson, C.U.T. Hellen, A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNAs, Gene Dev. 12 (1998) 67–83. [4] R.C. Cevallos, P. Sarnow, Factor-independent assembly of elongationcompetent ribosomes by an internal ribosome entry site located in an RNA virus that infects Penaeid Shrimp, J. Virol. 79 (2005) 677–683. [5] E. Royall, K.E. Woolaway, J. Schacherl, S. Kubick, G.J. Belsham, L.O. Roberts, The Rhopalosiphum padi virus 5 0 internal ribosome entry site is functional in Spodoptera frugiperda 21cells and in their cell-free lysates: implications for the baculovirus expression system, J. Gen. Virol. 85 (2004) 1565–1569. [6] V.P. Pisarev, S.C. Louisa, K. Yoshihiro, L.J. Helen, N.S. Ivan, J.B. Graham, Functional and Structural Similarities between the Internal Ribosome Entry Sites of Hepatitis C Virus and Porcine Teschovirus, a Picornavirus, J. Virol. 5 (2004) 4487–4497. [7] I.K. Ali, L. McKendrick, S.J. Morley, R.J. Jackson, Activity of the hepatitis A virus IRES requires association between the cap-binding translation initiation factor (eIF4E) and eIF4G, J. Virol. 75 (2001) 7854–7863. [8] J.E. Reynolds, A. Kaminski, H.J. Kettinen, K. Grace, B.E. Clarke, A.R. Carroll, D.J. Rowlands, R.J. Jackson, Unique features of
[15]
[16]
[17] [18]
[19]
[20]
[21] [22]
[23]
[24]
[25]
internalinitiation of hepatitis-C virus-RNA translation, EMBO J. 14 (1995) 6010–6020. S.P. Fletcher, R.J. Jackson, Pestivirus internal ribosome entry site (IRES) structure and function: elements in the 5 0 untranslated region important for IRES function, J. Virol. 76 (2002) 5024–5033. L. Bieleski, S.J. Talbot, Kaposi’s sarcoma-associated herpesvirus vCyclin open reading frame contains an internal ribosome entry site, J. Virol. 7 (4) (2001) 1864–1869. A. Grundhoff, D. Ganem, Mechanisms governing expression of the vFLIP gene of Kaposi’s sarcoma-associated herpesvirus, J. Virol. 7 (4) (2001) 1857–1863. S. Vagner, M.C. Gensac, A. Maret, F. Bayard, F. Amalric, H. Prats, A.C. Prats, Alternative translation of human FGF-2 mRNA occurs by internal entry of ribosomes, Mol. Cell. Biol. 15 (1995) 35–44. I. Stein, A. Itin, P. Einat, R. Skaliter, Z. Grossman, E. Keshet, Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia, Mol. Cell. Biol. 18 (1998) 3112–3119. M. Holcik, R.G. Korneluk, Functional characterization of the Xlinked inhibitor of apoptosis (XIAP) internal ribosome entry site element: role of La autoantigen in XIAP translation, Mol. Cell. Biol. 20 (2000) 4648–4657. M. Stoneley, F.E.M. Paulin, J.P.C. Le Quesne, S.A. Chappell, A.E. Willis, C-Myc 5 0 untranslated region contains an internal ribosome entry segment, Oncogene 16 (1998) 423–428. S. Cornelis, Y. Bruynooghe, G. Denecker, S. Van Huffel, S. Tinton, R. Beyaert, Identification and characterization of a novel cell cycleregulated internal ribosome entry site, Mol. Cell 5 (2000) 597–605. S. Pyronnet, L. Pradayrol, N. Sonenberg, A cell cycle-dependent internal ribosome entry site, Mol. Cell 5 (2000) 607–616. L.O. Roberts, R.A. Seamons, G.J. Belsham, Recognition of picornavirus internal ribosome entry sites within cells; influence of cellular and viral proteins, RNA 4 (1998) 520–529. A.J. Dorner, B.L. Semler, R.J. Jackson, R. Hanecak, E. Duprey, E. Wimmer, In vitro translation of poliovirus RNA: utilization of internal initiation sites in reticulocyte lysate, J. Virol. 50 (1984) 507–514. M.J. Glass, D.F. Summers, Identification of a trans-acting activity from liver that stimulates hepatitis A virus translation in vitro, Virology 193 (1993) 1047–1050. C.A. Suttle, Viruses in the sea, Nature 437 (2005) 356–361. F. Yang, W. Wang, R.Z. Chen, X. Xu, A simple and efficient method for purification of prawn baculovirus DNA, J. Virol. Method. 67 (1997) 1–4. X. Zhang, C.H. Huang, X. Xu, C.L. Hew, Identification and localization of a prawn white spot syndrome virus gene that encodes an envelope protein, J. Gen. Virol. 83 (2002) 1069–1074. K. Tsukiyama-Kohara, N. Iizuka, M. Kohara, A. Nomoto, Internal ribosome entry site within hepatitis C virus RNA, J. Virol. 66 (1992) 1476–1483. J. Pelletier, N. Sonenberg, Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA, Nature 334 (1988) 320–325.
F. Han, X. Zhang / Biochemical and Biophysical Research Communications 344 (2006) 893–899 [26] J. Sasaki, N. Nakashima, Translation initiation at the CUU codon is mediated by the internal ribosome entry site of an insect picorna-like virus in vitro, J. Virol. 73 (1999) 1219–1226. [27] J.E. Wilson, T.V. Pestova, C.U.T. Hellen, P. Sarnow, Initiation from the A site of the ribosome, Cell 102 (2000) 511–520. [28] L. Bieleski, C. Hindley, S.J. Talbot, A polypyrimidine tract facilitates the expression of Kaposi’s sarcoma-associated herpesvirus vFLIP through an internal ribosome entry site, J. Gen. Virol. 85 (2004) 615–620.
899
[29] S.A. Chappell, G.M. Edelman, V.P. Mauro, A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity, Proc. Natl. Acad. Sci. USA 97 (2000) 1536–1541. [30] Y.J. Chen, W.S. Chen, T.Y. Wu, Development of a bi-cistronic baculovirus expression vector by the Rhopalosiphum padi virus 5 0 internal ribosome entry site, Biochem. Biophys. Res. Commun. 33 (2) (2005) 616–623.