- Email: [email protected]
Intragenic Domains of Strand-specific Repair inEscherichia coli
JMB—MS 327 Cust. Ref. No. GO 50/94
[SGML] J. Mol. Biol. (1995) 246, 264–272
Intragenic Domains of Strand-specific Repair in Escherichia coli Subrahmanyam Kunala and Douglas E. Brash* Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, CT 06510, U.S.A.
*Corresponding author
Heterogeneity of DNA repair has been observed at different levels of genomic organization, including chromatin domains, expressed genes and DNA strands. If heterogeneity also existed intragenically, it could reveal fine details of the excision repair mechanism in vivo. Here we measure the frequency of UV-induced cyclobutane pyrimidine dimers at individual nucleotides within defined portions of two Escherichia coli genes, lacl and lacZ, at various times after irradiation. Two domains of differential repair rates were apparent, with repair being slow at nucleotides adjacent to the transcription start sites. In lacZ, the domain of faster repair began 32 bases downstream of the transcription start site and required the mfd gene. Since mfd codes for a transcription-repair coupling factor, this transcriptioncoupled repair system evidently becomes operative downstream of the initiation complex region in vivo. Unexpectedly, however, (1) an mfd mutation reduced repair in the downstream domain even when transcription was at a very low level and (2) induction of lacZ transcription with isopropyl-b-D-thiogalactoside overcame this reduction. Evidently, the Mfd transcription-repair coupling factor is required for basal levels of strand-specific repair in this gene, but induced levels of repair are related to transcription through another mechanism. Keywords: E. coli; cyclobutane pyrimidine dimers; domain-specific repair; transcription-repair coupling factor; mfd
Introduction In both eukaryotes and prokaryotes, DNA damage and its repair are heterogeneous across the genome. This heterogeneity has been observed at different levels of genomic organization: chromatin domains, genes and DNA strands (Zolan et al., 1982; Bohr, 1991; Hanawalt, 1991; Smerdon, 1991). Initially, it was shown that the active DHFR gene in CHO cells was cleared of cyclobutane pyrimidine dimers more efficiently than was the overall genome. This phenomenon was referred to as ‘‘preferential repair’’ and has been observed in various mammalian cells, in yeast, and in Escherichia coli (Bohr et al., 1985; Mellon et al., 1987; Mellon & Hanawalt, 1989; Smerdon & Thoma, 1990; Leadon & Lawrence, 1992; Sweder & Hanawalt, 1992). Mellon et al. demonstrated, first in mammalian cells and then in E. coli, that preferential repair was primarily due to selective repair of the transcribed strand (Mellon et al., 1987; Mellon & Hanawalt, 1989). Abbreviations used: CHO, Chinese hamster ovary; TRCF, transcription-repair coupling factor; IPTG, isopropyl-b-D-thiogalactoside; Mfd, mutation frequency decline; PCR, polymerase chain reaction. 0022–2836/95/070264–09 $08.00/0
In those studies, DNA damage and repair were detected by Southern-blotting techniques, in which cyclobutane pyrimidine dimer frequencies were averaged over kilobase-length DNA fragments. The most frequent UV photoproduct, the TT cyclobutane pyrimidine dimer, will be most heavily represented in such an average; consequently, repair rates will reflect primarily the repair rate of this photoproduct. Thus, if strand-specific repair differs between TT, TC and CC photoproducts, this fact would remain undiscovered. Similarly, if repair rates differ over genome regions smaller than a kilobase, these differences would not have been observed. Such differences in repair rates at the nucleotide level could reveal fine details of the excision repair mechanism in vivo; they may also have biological consequences. Heterogeneity at a higher domain of structure, gene-specific and strand-specific repair, appears to influence mutagenesis and cell survival. Preferential repair of active genes has been proposed to underlie the relatively high survival of xeroderma pigmentosum group C cells compared to other complementation groups after UV irradiation (Kantor et al., 1990; Venema et al., 1991). In contrast, cells from Cockayne’s syndrome are defective in repairing 7 1995 Academic Press Limited
JMB—MS 327 265
Strand-specific Repair in Vivo
transcriptionally active genes and are more UVsensitive than normal cells (Venema et al., 1990; Troelstra et al., 1992). Strand-specific repair of the lacI gene in E. coli and the HPRT gene in hamster cells are correlated with a strand bias for UV-induced mutations (Vrieling et al., 1991; Chandrasekhar & Van Houten, 1994). Eliminating repair of UV photoproducts on the transcribed strand of the lacI gene leads to a shift in the source of mutations from pyrimidines on the non-transcribed strand to pyrimidines on the transcribed strand (Oller et al., 1992). The basis of this preferential repair of active genes was initially ascribed to a more open chromatin conformation (Bohr et al., 1985; Mellon et al., 1986). The discovery of strand-specific repair in E. coli ruled out this possibility (Mellon & Hanawalt, 1989). Mellon & Hanawalt proposed that RNA polymerase blocked at a lesion in the transcribed strand might be a high-affinity site for the UvrABC excision nuclease. However, Selby & Sancar (1990) found that, in vitro, a polymerase stalled at a lesion actually inhibited repair of the transcribed strand. They suggested that a coupling factor between the stalled polymerase and UvrABC is required for strand-specific repair. Such a factor, termed the ‘‘transcription-repair coupling factor’’ (TRCF), has been isolated and found to be the product of the E. coli mfd gene (Selby & Sancar, 1993). Mutating the mfd gene leads to deficient repair of UV photoproducts on the transcribed strand of the lacI gene in vivo (Kunala & Brash, 1992). In the present study of UV photoproduct repair at individual nucleotides in vivo, we find that: (1) domains of slow DNA repair exist near the transcription start site of the E. coli lacI and lacZ genes; (2) a domain of faster repair begins downstream of the initiation complex region and is specific for the transcribed strand; and (3) the domains are not due to DNA structure, since the fast-repair domain requires the mfd gene. These results suggest that the model for strand-specific repair described above, based on in vitro biochemical studies, applies in vivo. Moreover, the transcriptioncoupled repair system involving Mfd first becomes operative outside the initiation complex region. However, we also find that (4) the mfd gene is required even when transcription is at a very low level; and (5) induced transcription leads to strand-specific repair even with a repair-defective mfd allele. Thus, the transcription-coupled repair system involving Mfd appears to be required for basal levels of strand-specific repair, but not for induced levels.
Results Domains of repair After UV photoproduct induction and excision had been allowed to take place for varying lengths of time in vivo, we measured photoproduct excision at
the sequence level in the specific restriction fragments of the lacI and lacZ genes chosen. On the transcribed strand, each gene displayed two regions that differed in their rate of removal of cyclobutane pyrimidine dimers: in the lacI gene, the promoter region was poorly repaired; repair was not complete even 30 minutes after UV-irradiation (Figure 1(a)). However, the region beginning ten base-pairs after the mRNA start site was repaired faster and was complete by 20 minutes post UV-irradiation (Figure 1(a); second TT dimer band and higher). In the lacZ gene, the entire region studied showed a slow repair rate compared with the lacI gene. Similarly to the lacI gene, however, cyclobutane dimers lying in the first 32 bases after the mRNA start site (referred to here as region A) were repaired less efficiently than those in the region >32 bases after the start site (region B: Figure 1(b)). Data for the sites shown on the gel, and for additional sites in flanking regions, are given in Figure 2. The exact boundary between the two domains is somewhat arbitrary, as the transition occurs over approximately 20 nucleotides (Figure 2). The difference in repair rates between regions A and B was particularly pronounced during the first 20 minutes post UV-irradiation. As will be described later, domains were not evident on the non-transcribed strand. Repair in the induced lacZ gene In order to test the effect of gene activity on the domain-specific repair, we induced the lac operon with IPTG. When the lacZ gene was induced to a level giving a 400 to 700-fold increase in b-galactosidase enzyme activity, 90% of cyclobutane pyrimidine dimers were removed from both regions A and B. Since region A was slowly repaired in the uninduced state, the increase in excision was greater in this region (Figures 1(c) and 2; see also Figure 5). Therefore, not only did excision repair in vivo occur in domains of differing repair efficiency, but increasing the transcription rate affected the two domains differently. It was possible that the difference in repair rate observed between domains, or between induced and uninduced genes, was actually due to differences in the domains’ accessibility to the T4 endonuclease used to assay cyclobutane dimers. To examine this possibility, we performed T4 endonuclease digestion with increasing amounts of enzyme. No significant alteration in incision pattern was found for either domain, in either the uninduced or induced lacZ gene (data not shown). Repair in the absence of the mfd transcription-repair coupling factor The domains of differing repair rates might have their origin either in DNA structural domains or in physiological domains due to protein binding. Because of the relationship of the domains to the transcription start site, we tested the effect of the
JMB—MS 327 266
Strand-specific Repair in Vivo
putative transcription-repair coupling factor (TRCF) on the repair domains. We transferred the mfd-1 mutation to a wild-type strain and carried out in vivo cyclobutane dimer repair experiments in the lacZ
gene similar to those above. Repair in the uninduced gene in the mfd-1 strain was then minimal at many sites in both region A and region B (Figures 3(a) and 4). This result is similar to our earlier results for
(a)
(b)
(c) Figure 1. Excision repair of cyclobutane pyrimidine dimers at the sequence level in the lacI and lacZ genes. Cells of E. coli strain AB1157 were irradiated with 20 J/m2 of 254 nm UV light and incubated for 0 to 60 min; the genomic DNA was then extracted and cyclobutane dimers were analyzed. G + A and C + T, Maxam-Gilbert sequencing reactions. With 3' end-labeled DNA, cyclobutane dimer bands migrate 1 or 2 bases slower than the 5' member of the dipyrimidine pair (Kunala & Brash, 1992). The bases underlined are those involved in cyclobutane dimers shown in the Figure. Base locations within each gene are according to the corresponding GenBank numbering system. (a) Transcribed strand of the lacI gene. The sequence of the region shown in the Figure is: 5'-TTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATA-3' and spans base-pairs 33 to 77; mRNA transcription starts at base-pair 51. (b) Transcribed strand of the uninduced lacZ gene. The sequence of the region shown in the Figure is: 5'-CCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATCCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATT-3' and spans base-pairs 1246 to 1345; mRNA transcription starts at base-pair 1246. Regions A and B are discussed in the text. (c) Transcribed strand of the induced lacZ gene.
JMB—MS 327 267
Strand-specific Repair in Vivo
Figure 2. Quantification of cyclobutane dimer removal from the transcribed strand of the lacZ gene of the wild-type strain. Percentage of dimers repaired refers to data 20 min after UV-irradiation. Region A spans base-pairs 1245 to 1278 and region B spans base-pairs 1286 to 1402, as discussed in the text. Open bars, with IPTG.
the structural gene of lacI (Kunala & Brash, 1992). Since region B was well repaired in the wild-type, the mfd mutation significantly reduced repair in this region. The distinction between domains A and B was thus primarily due to the Mfd transcriptionrepair coupling system. Moreover, this transcriptioncoupled repair system evidently becomes operative outside the initiation complex region (beyond base 32 from the transcription start site). The specific effect of TRCF on the elongation region was also observed in in vitro experiments (Selby & Sancar, 1993). Since in vitro studies had shown that a polymerase stalled at a lesion inhibits repair of the transcribed strand, and that the Mfd protein relieves this inhibition (Selby & Sancar, 1990), it was anticipated that IPTG-induction of lacZ in the mfd-1 strain would then lead to further inhibition of repair. Surprisingly, however, IPTG enhanced the removal of pyrimidine dimers at many sites in both region A and region B (Figures 3(b) and 4). At several sites, the extent of repair was as great as in the wild-type. (The difference in the final level of induction of the lactose operon between wild-type and mfd-1 strains was less than 5%). The large reduction in repair rate between the wild-type and mfd-1 strains was thus limited to: (1) region B, (2) in the uninduced state. Therefore, the largest effect of the mfd gene product was on the un-induced lacZ gene. Conversely, increased transcription was able to influence excision repair even without this particular transcription-repair coupling factor. Moreover, this in vivo effect of transcription was an increase rather than the decrease expected from in vitro studies. Time-course of repair By averaging together dimer frequencies at individually quantified dimer sites of the autoradio-
(a)
(b) Figure 3. Excision repair of cyclobutane dimers at the DNA sequence level in the lacZ gene of an E. coli mfd − strain. (a) Transcribed strand of the uninduced lacZ gene, in the region of base-pairs 1246 to 1345; mRNA starts at base-pair 1246. (b) Transcribed strand of the induced lacZ gene.
grams shown, and from flanking regions not shown, it is possible to examine how the time-course of repair in each domain overall is affected by the state of transcription or by the absence of the Mfd transcription-repair coupling factor (Figure 5(a) and (b)). It is important to note that this average counts each site equally, rather than counting each photoproduct equally, as Southern blot methods do. The latter technique emphasizes the most frequent photoproduct, the TT dimer, and may thus give repair rates different from those shown here. It can
JMB—MS 327 268
Strand-specific Repair in Vivo
(a) Figure 4. Quantification of cyclobutane dimer removal from the transcribed strand of the lacZ gene of the E. coli mfd − strain. Percentage of dimers repaired refers to data 20 min after UV-irradiation. Region A spans base-pairs 1245 to 1278 and region B spans base-pairs 1286 to 1402. Zero-length bars had no measurable repair. Open bars, with IPTG.
be seen that the largest effect of IPTG induction occurred in the first ten minutes. The largest effect of the mfd gene product occurred after ten minutes. Repair on the non-transcribed strand On the non-transcribed strand, no domain corresponding to region A or B was evident (Figure 6(a)). IPTG did not induce removal of dimers in either the wild-type or mfd-1 strain. An A-like domain is suggested by two sites at the promoterproximal end of the region examined, but cannot be investigated further due to a paucity of dipyrimidine sites. In the mfd-1 strain, IPTG actually caused a modest inhibition of repair at many sites on the non-transcribed strand (Figure 6(b)). Averaging together the dimer frequencies at individually quantified dimer sites, as above, also makes it possible to compare repair between strands (Table 1). In the absence of IPTG induction, cyclobutane pyrimidine dimers were removed at similar rates on both strands: the rate on the non-transcribed strand was approximately the average of that in regions A and B of the transcribed strand. However, when the lacZ gene was induced with IPTG there was a preferential removal of dimers from the transcribed strand. At ten minutes post-UV, this strand bias was two- to fourfold (ratio of each strand’s ratio of induced/uninduced), depending on the repair domain (Table 1). These results are expected, as they are comparable with those of Mellon & Hanawalt (1989); they are also consistent with in vitro studies. However, a surprising result was obtained for the mfd-1 strain. This strain also showed the two- to fourfold strand bias after gene induction (Table 1), despite its demonstrated deficiency in strand-specific repair in the uninduced state (Figure 3(a); and Kunala & Brash, 1992). IPTG induction therefore leads to strand-specific repair
(b) Figure 5. Time-course of cyclobutane dimer excision in the lacZ gene. Dimer frequencies at individually quantified bands were averaged over region A or region B of the transcribed strand. (a) Without IPTG; (b) with IPTG. Open symbols, wild-type; filled symbols, mfd − ; circles, region A; triangles, region B.
that is coupled to transcription but is distinct from the Mfd pathway.
Discussion Domains of repair In this study, we describe an additional level to the fine-structure of DNA repair: domain-specific repair within the transcribed strand. In the E. coli lacI gene, dimers were removed more efficiently from the region beginning 10 bp after the mRNA start site than in the promoter sequence. A similar pattern of domain-specific repair was also observed in the lacZ gene when it was expressed at a basal level. In the latter case, fast repair began 32 bases after the mRNA start site. Strand-specific repair without transcription has also been observed in the non-transcribed 5' flanking region of the murine c-myc gene (Beecham et al., 1991). Recently, it has been shown that preferential repair of the transcribed strand in the human PGK1 gene begins just downstream of the transcription start site. The promoter of the PGK1
JMB—MS 327 269
Strand-specific Repair in Vivo
strain; nor does it explain slow repair in the lacI promoter.
Repair on the transcribed strand
(a)
(b) Figure 6. Quantification of cyclobutane dimer removal from the non-transcribed strand of the lacZ gene. Percentage of dimers repaired refers to data 20 min after UV-irradiation. (a) Wild-type strain; (b) mfd − strain. Open bars, with IPTG.
gene also contained slow repair regions (Gao et al., 1994). Slow repair of promoter sequences in part reflects the absence of the Mfd-dependent repair mechanism, which evidently becomes operative outside the initiation complex region. However, repair in the promoter is capable of proceeding faster, as revealed after gene induction. One possible reason for inherently slower repair of promoter sequences might be the abortive cycling of transcription, which delays the passage of RNA polymerase through the initiation complex (Carpousis & Gralla, 1985; Mikita & Beardsley, 1994). Such abortive cycling has been reported in vitro for the E. coli lac UV5 promoter (Straney & Crothers, 1986). It was also shown that the promoter DNA in the region −14 to +26 is protected from DNase I footprinting; this region may also be less accessible to DNA repair proteins. For example, the IPTG-induced repair of the lacZ gene promoter might be mediated directly by repressor removal, rather than indirectly via increased transcription. However, this model cannot explain the IPTG-induced repair of region B in the mfd −
The mechanism underlying the preference of repair for the transcribed strand is partially understood. In vitro experiments with E. coli cell-free extracts and purified proteins suggested that a protein factor, TRCF, is required to couple repair to transcription of the transcribed strand. In the absence of TRCF, repair was inhibited on the transcribed strand during transcription; adding TRCF to the transcription-repair reaction stimulated repair of the transcribed strand. In the absence of transcription, there was no effect of TRCF on strand-specific repair. However, in some experiments TRCF relieved the inhibition of repair of the transcribed strand but did not stimulate it (Selby & Sancar, 1993). This result suggests that factors other than or in addition to the Mfd TRCF may be required for strand-specific repair. In order to test the role of the Mfd repair system in vivo, we measured excision repair rates for particular fragments of the E. coli lacZ gene in an mfd − strain, in the absence and presence of induced transcription. From previous experiments it was anticipated that: (1) strand-specific repair would begin downstream of the transcription start site; (2) in the wild-type strain, inducing transcription would preferentially increase repair of the transcribed strand; (3) repair on the transcribed strand would be unaffected by an mfd − mutation if the level of transcription were low; and (4) in the mfd − strain, transcription would decrease repair of the transcribed strand. The first two expectations were met. Unexpectedly, however, the direct opposite of the last two expectations was found. Firstly, at a low basal level of transcription, repair of pyrimidine dimers from the transcribed strand was slower in the mfd − strain. The effect of Mfd was more pronounced in the elongation region (region B) than in the initiation region (region A; Figure 2 versus Figure 4). These results suggest that Mfd protein is required for repair of the transcribed strand in vivo even under conditions of low, basal, levels of transcription. One model for such a requirement would be that basal levels of polymerase translocation, in conjunction with Mfd protein, monitor the transcribed strand for DNA lesions. However, this model cannot explain the other unexpected result, that induction of strand-specific repair by IPTG proceeded almost normally in the mfd − strain. We therefore conclude that, in the lacZ gene in vivo, basal transcription is coupled to strand-specific repair through the Mfd protein, but induced transcription is coupled to strand-specific repair by a means not involving the Mfd protein. The two coupling mechanisms may use the UvrABC system at different times, since IPTG induction was most influential in the first ten minutes post-UV and the mfd gene product was most influential afterward.
JMB—MS 327 270
Strand-specific Repair in Vivo
Materials and Methods Strains The strains used were E. coli K-12 strain AB1157 [F − , thr-1, ara-14, leuB6, D(gpt-proA)62, lacY1, tsx33, supE44, galK2, hisG4, xyl-5, mtl-1, argE3, thi-1, str-31 ] (from R. Kolodner, Harvard) and its mfd-1 derivative. The mfd-1 derivative was constructed by P1 transduction of a Tn10 linked to mfd-1 (Miller, 1972; Kunala & Brash, 1992). The mfd-1 source was NR10130 [ara, thi, prolac, mfd-1, zcf::Tn10, F'prolac] (from R. W. Schaaper, NIEHS, Triangle Park). NR 10130 was constructed by transfering mfd-1 from WU 3610-45, which was originally isolated by George & Witkin (1974). Biochemical properties of the mutated protein are not known. UV irradiation, DNA isolation, and lac induction An overnight culture was diluted 1:50 in Luria broth and grown for 2.5 hours (absorbance approximately 0.3 at 550 nm). Cells were resuspended in medium 56 to an absorbance of 0.3. A portion (15 ml) of the suspension was spread in a 100 mm Petri dish and, while shaking, UV irradiated at dose of 20 J/m2 with a single 15 W General Electric germicidal lamp emitting principally 254 nm radiation. The dose rate was 1 J/m2 per second, measured with a UVX digital radiometer (Ultraviolet Products, San Gabriel, CA). The irradiated culture was supplemented with 0.25% (v/v) Casamino acids and 0.4% (w/v) glucose and incubated at 37°C for varying times. Portions of the culture were removed at regular intervals and the genomic DNA was rapidly isolated as described (Kunala & Brash, 1992). All the manipulations from UV irradiation to DNA isolation were carried out under dim yellow lights to avoid reversal of cyclobutane pyrimidine dimers by photoreactivation. To induce the lactose operon, 1 mM isopropyl-b-Dthiogalactoside (IPTG) was added to the medium 2.5 hours
before UV irradiation and after UV irradiation, and b-galactosidase activity was assayed as described (Miller, 1972). Induction at the time of UV irradiation was 400 to 700-fold above a basal level of two b-galactosidase units. Transcription of the lacZ gene is not detected in the absence of IPTG (Murakawa et al., 1991). Excision repair of cyclobutane pyrimidine dimers To measure excision repair at the DNA sequence level, we used the technique of oligonucleotide-directed end-labeling (Kunala & Brash, 1992). Briefly, an oligomer is designed to anneal the 3' portion of a specific genomic restriction fragment; the oligonucleotide also contains a 5' segment of six thymine residues. After annealing, this segment provides a template allowing the 3' OH of the genomic fragment to be extended with radiolabeled dATP. This approach circumvents the questions of site-to-site ligation efficiency and dependence of PCR efficiency on fragment length associated with other methods. For analyzing the lacI DNA region containing the lacI promoter sequence, genomic DNA was digested with restriction enzymes HincII and HaeIII. Of the fragments produced, the 150 base-pair fragment of the lacI gene containing the promoter was labeled using, for the non-transcribed strand, 5'-TTTTTTGACACCATCGAATGGCGCAAAACC-3' and, for the transcribed strand, 5'-TTTTTTCCTGGTTCACCACGCGGGAAACGG-3'. To analyze the lacZ gene, the genomic DNA was digested with MspI and HinPI. The resulting 110 base-pair DNA fragment containing the lacZ initiation region was selected for analysis. To label this fragment, the oligomers used were, for the non-transcibed strand, 5'-TTTTTTCAACTGTTGGGAAGGGCGATCGGTGCGGG-3', and for the transcribed strand, 5'-TTTTTTGCTCGTATGTTGTGTGGAATTGTGAGCGG-3'. End-labeling reactions were performed as described (Kunala & Brash, 1992). The cycling conditions were 94°C
Table 1 Strand-specific and domain-specific repair of cyclobutane pyrimidine dimers in the E. coli lacZ gene % Dimers repaired‡
Repair (+IPTG)
Strand bias§
Repair (−IPTG) Time (min)> Strain wt
mdf −
Time (min)
IPTG†
Strand
Region
10
20
30
− + − + − +
NT
B B A A B B
24 24 10 41 41 67
66 60 32 88 75 94
93 93 61 98 94 100
− + − + − +
NT
B B A A B B
15 29 9 43 8 67
44 31 12 54 31 76
77 76 27 71 41 84
TS
TS
Time (min)
10
20
30
1.0
0.9
1.0
4.1
2.8
1.6
1.6
1.2
1.1
1.9
0.7
1.0
4.8
4.5
2.6
8.4
2.5
2.0
10
20
30
1.7 4.1
1.1 3.1
1.0 1.6
0.5 4.2
0.7 6.4
0.5 2.6
Values represent the ratio of the percentage of molecules containing a dimer at a site to the corresponding percentage before repair incubation, averaged over the indicated region. † IPTG, isopropyl-b-D-thiogalactoside; NT, non-transcribed strand; TS, transcribed strand. ‡ Dimer frequencies at individually quantified dimer bands were averaged over region A, over region B, or over the entire region of the non-transcribed strand examined. § Strand bias of induced repair (ratio of inducibility of repair on TS strand to that on NT strand). > After UV-irradiation.
JMB—MS 327 Strand-specific Repair in Vivo
for one minute, 60°C for one minute, 72°C for one minute for MspI-HinPI-digested DNA and 94°C for one minute, 55°C for one minute, 72°C for one minute for HincII-HaeIII-digested DNA. The labeled DNA was purified on a denaturing 5% (w/v) polyacrylamide gel. After renaturation by phenol hybridization, the DNA was incised at cyclobutane dimer sites with saturating amounts of phage T4 endonuclease V as described (Brash, 1988). DNA fragments were resolved on an 8% sequencing gel and cyclobutane dimer locations were quantified as described (Kunala & Brash, 1992). Approximately 10,000 cts/min were loaded in each lane. The method of quantification (Brash, 1988) corrects for loading variations and yields an absolute quantity: the fraction of molecules in the sample that contained a cyclobutane dimer at a particular dinucleotide site. At 20 J/m2, the correction for multiple photoproducts in the same fragment was negligible (Brash, 1988; Kunala & Brash, 1992). Repeated measurements of incision frequency at the same sites using this technique were reproducible within 20%. In the post-irradiation interval studied, there was no detectable DNA replication in the lac operon (Kunala & Brash, 1992).
Acknowledgements We thank R. Schaaper for strains, S. Lloyd for T4 endonuclease, M. Ananthanarayanan for use of the laser densitometer, and P. C. Hanawalt, K. B. Low, I. Mellon and T. Mikita for helpful discussions. This research was supported by ACS grant CN-38 to D. E. B.
References Beecham, E. J., Mushinski, J. F., Shacter, E., Potter, M. & Bohr, V. A. (1991). DNA repair in the c-myc proto-oncogene locus: possible involvement in susceptibility or resistance to plasmacytoma induction in BALB/c mice. Mol. Cell Biol. 11, 3095–3104. Bohr, V. A. (1991). Gene specific DNA repair. Carcinogenesis, 12, 1983–1992. Bohr, V. A., Smith, C. A., Okumoto, D. S. & Hanawalt, P. C. (1985). DNA repair in an active gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more efficient than in the genome overall. Cell, 40, 359–369. Brash, D. E. (1988). Quantitating DNA lesions at the DNA sequence level. In DNA Repair: A Laboratory Manual of Research Procedures (Friedberg, E. C. & Hanawalt, P. C., eds), pp. 327–345, Marcel Dekker, New York. Carpousis, A. J. & Gralla, J. D. (1985). Interaction of RNA polymerase with lacUV5 promoter DNA during mRNA initiation and elongation. J. Mol. Biol. 183, 165–177. Chandrasekhar, D. & Van Houten, B. (1994). High resolution mapping of UV-induced photoproducts in the Escherichia coli lacI gene. Inefficient repair of the non-transcribed strand correlates with high mutation frequency. J. Mol. Biol. 238, 319–332. Gao, S., Drouin, R. & Holmquist, G. P. (1994). DNA repair rates mapped along the human PGK1 gene at nucleotide resolution. Science, 263, 1438–1440. George, D. L. & Witkin, E. M. (1974). Slow excision repair in an mfd mutant of Escherichia coli B/r. Mol. Gen. Genet. 133, 283–291. Hanawalt, P. C. (1991). Heterogeneity of DNA repair at the gene level. Mutat. Res. 247, 203–211.
271 Kantor, G. J., Barsalou, L. S. & Hanawalt, P. C. (1990). Selective repair of specific chromatin domains in UV-irradiated cells from xeroderma pigmentosum complementation group C. Mutat. Res. 235, 171–180. Kunala, S. & Brash, D. E. (1992). Excision repair at individual bases of the Escherichia coli lacI gene: relation to mutation hot spots and transcription coupling activity. Proc. Nat. Acad. Sci., U.S.A. 89, 11031–11035. Leadon, S. A. & Lawrence, D. A. (1992). Strand-selective repair of DNA damage in the yeast GAL7 gene requires RNA polymerase II. J. Biol. Chem. 267, 23175–23182. Mellon, I. & Hanawalt, P. C. (1989). Induction of the Escherichia coli lactose operon selectively increases repair of its transcribed DNA strand. Nature (London), 342, 95–98. Mellon, I., Bohr, V. A., Smith, C. A. & Hanawalt, P. C. (1986). Preferential DNA repair of an active gene in human cells. Proc. Nat. Acad. Sci., U.S.A. 83, 8878–8882. Mellon, I., Spivak, G. & Hanawalt, P. C. (1987). Selective removal of transcription-blocking DNA damage from the transcribed strand of the mammalian DHFR gene. Cell, 51, 241–249. Mikita, T. & Beardsley, G. P. (1994). Effects of arabinosylcytosine substituted DNA on DNA/RNA hybrid stability and transcription by T7 RNA polymerase. Biochemistry, 33, 9195–9208. Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Murakawa, G. J., Kwan, C., Yamashita, J. & Nierlich, D. P. (1991). Transcription and decay of the lac messenger: role of an intergenic terminator. J. Bacteriol. 173, 28–36. Oller, A. R., Fijalkowska, I. J., Dunn, R. L. & Schaaper, R. M. (1992). Transcription-repair coupling determines the strandedness of ultraviolet mutagenesis in Escherichia coli. Proc. Nat. Acad. Sci., U.S.A. 89, 11036–11040. Selby, C. P. & Sancar, A. (1990). Transcription preferentially inhibits nucleotide excision repair of the template DNA strand in vitro. J. Biol. Chem. 265, 21330–21336. Selby, C. P. & Sancar, A. (1993). Molecular mechanism of transcription-repair coupling. Science, 260, 53–58. Smerdon, M. J. (1991). DNA repair and the role of chromatin structure. Curr. Opin. Cell Biol. 3, 422–428. Smerdon, M. J. & Thoma, F. (1990). Site-specific DNA repair at the nucleosome level in a yeast minichromosome. Cell, 61, 675–684. Straney, D. C. & Crothers, D. M. (1986). A stressed intermediate in the formation of stably initiated RNA chains at the Escherichia coli lacUV5 promoter. J. Mol. Biol. 193, 267–278. Sweder, K. S. & Hanawalt, P. C. (1992). Preferential repair of cyclobutane pyrimidine dimers in the transcribed strand of a gene in yeast chromosomes and plasmids is dependent on transcription. Proc. Nat. Acad. Sci., U.S.A. 89, 10696–10700. Troelstra, C., van Gool, A., de Wit, J., Vermeulen, W., Bootsma, D. & Hoeijmakers, J. H. J. (1992). ERCC6, a member of a subfamily of putative helicases, is involved in Cockayne’s syndrome and preferential repair of active genes. Cell, 71, 939–953. Venema, J., Mullenders, L. H., Natarajan, A. T., van Zeeland, A. A. & Mayne, L. V. (1990). The genetic defect in Cockayne syndrome is associated with a defect in repair of UV-induced DNA damage in transcriptionally active DNA. Proc. Nat. Acad. Sci., U.S.A. 87, 4707–4711.
JMB—MS 327 272 Venema, J., van Hoffen, A., Karcagi, V., Natarajan, A. T., van Zeeland, A. A. & Mullenders, L. H. F. (1991). Xeroderma pigmentosum complementation group C cells remove pyrimidine dimers selectively from the transcribed strand of active genes. Mol. Cell. Biol. 11, 4128–4134. Vrieling, H., Venema, J., van Rooyen, M. L., van Hoffen, A., Menichini, P., Zdzienicka, M. Z., Simons, J. W.,
Strand-specific Repair in Vivo
Mullenders, L. H. & van Zeeland, A. A. (1991). Strand specificity for UV-induced DNA repair and mutations in the chinese hamster HPRT gene. Nucl. Acids Res. 19, 2411–2415. Zolan, M. E., Cortopassi, G. A., Smith, C. A. & Hanawalt, P. C. (1982). Deficient repair of chemical adducts in a DNA of monkey cells. Cell, 28, 613–619.
Edited by M. Gottesman
(Received 16 August 1994; accepted 14 November 1994)
[SGML] J. Mol. Biol. (1995) 246, 264–272
Intragenic Domains of Strand-specific Repair in Escherichia coli Subrahmanyam Kunala and Douglas E. Brash* Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, CT 06510, U.S.A.
*Corresponding author
Heterogeneity of DNA repair has been observed at different levels of genomic organization, including chromatin domains, expressed genes and DNA strands. If heterogeneity also existed intragenically, it could reveal fine details of the excision repair mechanism in vivo. Here we measure the frequency of UV-induced cyclobutane pyrimidine dimers at individual nucleotides within defined portions of two Escherichia coli genes, lacl and lacZ, at various times after irradiation. Two domains of differential repair rates were apparent, with repair being slow at nucleotides adjacent to the transcription start sites. In lacZ, the domain of faster repair began 32 bases downstream of the transcription start site and required the mfd gene. Since mfd codes for a transcription-repair coupling factor, this transcriptioncoupled repair system evidently becomes operative downstream of the initiation complex region in vivo. Unexpectedly, however, (1) an mfd mutation reduced repair in the downstream domain even when transcription was at a very low level and (2) induction of lacZ transcription with isopropyl-b-D-thiogalactoside overcame this reduction. Evidently, the Mfd transcription-repair coupling factor is required for basal levels of strand-specific repair in this gene, but induced levels of repair are related to transcription through another mechanism. Keywords: E. coli; cyclobutane pyrimidine dimers; domain-specific repair; transcription-repair coupling factor; mfd
Introduction In both eukaryotes and prokaryotes, DNA damage and its repair are heterogeneous across the genome. This heterogeneity has been observed at different levels of genomic organization: chromatin domains, genes and DNA strands (Zolan et al., 1982; Bohr, 1991; Hanawalt, 1991; Smerdon, 1991). Initially, it was shown that the active DHFR gene in CHO cells was cleared of cyclobutane pyrimidine dimers more efficiently than was the overall genome. This phenomenon was referred to as ‘‘preferential repair’’ and has been observed in various mammalian cells, in yeast, and in Escherichia coli (Bohr et al., 1985; Mellon et al., 1987; Mellon & Hanawalt, 1989; Smerdon & Thoma, 1990; Leadon & Lawrence, 1992; Sweder & Hanawalt, 1992). Mellon et al. demonstrated, first in mammalian cells and then in E. coli, that preferential repair was primarily due to selective repair of the transcribed strand (Mellon et al., 1987; Mellon & Hanawalt, 1989). Abbreviations used: CHO, Chinese hamster ovary; TRCF, transcription-repair coupling factor; IPTG, isopropyl-b-D-thiogalactoside; Mfd, mutation frequency decline; PCR, polymerase chain reaction. 0022–2836/95/070264–09 $08.00/0
In those studies, DNA damage and repair were detected by Southern-blotting techniques, in which cyclobutane pyrimidine dimer frequencies were averaged over kilobase-length DNA fragments. The most frequent UV photoproduct, the TT cyclobutane pyrimidine dimer, will be most heavily represented in such an average; consequently, repair rates will reflect primarily the repair rate of this photoproduct. Thus, if strand-specific repair differs between TT, TC and CC photoproducts, this fact would remain undiscovered. Similarly, if repair rates differ over genome regions smaller than a kilobase, these differences would not have been observed. Such differences in repair rates at the nucleotide level could reveal fine details of the excision repair mechanism in vivo; they may also have biological consequences. Heterogeneity at a higher domain of structure, gene-specific and strand-specific repair, appears to influence mutagenesis and cell survival. Preferential repair of active genes has been proposed to underlie the relatively high survival of xeroderma pigmentosum group C cells compared to other complementation groups after UV irradiation (Kantor et al., 1990; Venema et al., 1991). In contrast, cells from Cockayne’s syndrome are defective in repairing 7 1995 Academic Press Limited
JMB—MS 327 265
Strand-specific Repair in Vivo
transcriptionally active genes and are more UVsensitive than normal cells (Venema et al., 1990; Troelstra et al., 1992). Strand-specific repair of the lacI gene in E. coli and the HPRT gene in hamster cells are correlated with a strand bias for UV-induced mutations (Vrieling et al., 1991; Chandrasekhar & Van Houten, 1994). Eliminating repair of UV photoproducts on the transcribed strand of the lacI gene leads to a shift in the source of mutations from pyrimidines on the non-transcribed strand to pyrimidines on the transcribed strand (Oller et al., 1992). The basis of this preferential repair of active genes was initially ascribed to a more open chromatin conformation (Bohr et al., 1985; Mellon et al., 1986). The discovery of strand-specific repair in E. coli ruled out this possibility (Mellon & Hanawalt, 1989). Mellon & Hanawalt proposed that RNA polymerase blocked at a lesion in the transcribed strand might be a high-affinity site for the UvrABC excision nuclease. However, Selby & Sancar (1990) found that, in vitro, a polymerase stalled at a lesion actually inhibited repair of the transcribed strand. They suggested that a coupling factor between the stalled polymerase and UvrABC is required for strand-specific repair. Such a factor, termed the ‘‘transcription-repair coupling factor’’ (TRCF), has been isolated and found to be the product of the E. coli mfd gene (Selby & Sancar, 1993). Mutating the mfd gene leads to deficient repair of UV photoproducts on the transcribed strand of the lacI gene in vivo (Kunala & Brash, 1992). In the present study of UV photoproduct repair at individual nucleotides in vivo, we find that: (1) domains of slow DNA repair exist near the transcription start site of the E. coli lacI and lacZ genes; (2) a domain of faster repair begins downstream of the initiation complex region and is specific for the transcribed strand; and (3) the domains are not due to DNA structure, since the fast-repair domain requires the mfd gene. These results suggest that the model for strand-specific repair described above, based on in vitro biochemical studies, applies in vivo. Moreover, the transcriptioncoupled repair system involving Mfd first becomes operative outside the initiation complex region. However, we also find that (4) the mfd gene is required even when transcription is at a very low level; and (5) induced transcription leads to strand-specific repair even with a repair-defective mfd allele. Thus, the transcription-coupled repair system involving Mfd appears to be required for basal levels of strand-specific repair, but not for induced levels.
Results Domains of repair After UV photoproduct induction and excision had been allowed to take place for varying lengths of time in vivo, we measured photoproduct excision at
the sequence level in the specific restriction fragments of the lacI and lacZ genes chosen. On the transcribed strand, each gene displayed two regions that differed in their rate of removal of cyclobutane pyrimidine dimers: in the lacI gene, the promoter region was poorly repaired; repair was not complete even 30 minutes after UV-irradiation (Figure 1(a)). However, the region beginning ten base-pairs after the mRNA start site was repaired faster and was complete by 20 minutes post UV-irradiation (Figure 1(a); second TT dimer band and higher). In the lacZ gene, the entire region studied showed a slow repair rate compared with the lacI gene. Similarly to the lacI gene, however, cyclobutane dimers lying in the first 32 bases after the mRNA start site (referred to here as region A) were repaired less efficiently than those in the region >32 bases after the start site (region B: Figure 1(b)). Data for the sites shown on the gel, and for additional sites in flanking regions, are given in Figure 2. The exact boundary between the two domains is somewhat arbitrary, as the transition occurs over approximately 20 nucleotides (Figure 2). The difference in repair rates between regions A and B was particularly pronounced during the first 20 minutes post UV-irradiation. As will be described later, domains were not evident on the non-transcribed strand. Repair in the induced lacZ gene In order to test the effect of gene activity on the domain-specific repair, we induced the lac operon with IPTG. When the lacZ gene was induced to a level giving a 400 to 700-fold increase in b-galactosidase enzyme activity, 90% of cyclobutane pyrimidine dimers were removed from both regions A and B. Since region A was slowly repaired in the uninduced state, the increase in excision was greater in this region (Figures 1(c) and 2; see also Figure 5). Therefore, not only did excision repair in vivo occur in domains of differing repair efficiency, but increasing the transcription rate affected the two domains differently. It was possible that the difference in repair rate observed between domains, or between induced and uninduced genes, was actually due to differences in the domains’ accessibility to the T4 endonuclease used to assay cyclobutane dimers. To examine this possibility, we performed T4 endonuclease digestion with increasing amounts of enzyme. No significant alteration in incision pattern was found for either domain, in either the uninduced or induced lacZ gene (data not shown). Repair in the absence of the mfd transcription-repair coupling factor The domains of differing repair rates might have their origin either in DNA structural domains or in physiological domains due to protein binding. Because of the relationship of the domains to the transcription start site, we tested the effect of the
JMB—MS 327 266
Strand-specific Repair in Vivo
putative transcription-repair coupling factor (TRCF) on the repair domains. We transferred the mfd-1 mutation to a wild-type strain and carried out in vivo cyclobutane dimer repair experiments in the lacZ
gene similar to those above. Repair in the uninduced gene in the mfd-1 strain was then minimal at many sites in both region A and region B (Figures 3(a) and 4). This result is similar to our earlier results for
(a)
(b)
(c) Figure 1. Excision repair of cyclobutane pyrimidine dimers at the sequence level in the lacI and lacZ genes. Cells of E. coli strain AB1157 were irradiated with 20 J/m2 of 254 nm UV light and incubated for 0 to 60 min; the genomic DNA was then extracted and cyclobutane dimers were analyzed. G + A and C + T, Maxam-Gilbert sequencing reactions. With 3' end-labeled DNA, cyclobutane dimer bands migrate 1 or 2 bases slower than the 5' member of the dipyrimidine pair (Kunala & Brash, 1992). The bases underlined are those involved in cyclobutane dimers shown in the Figure. Base locations within each gene are according to the corresponding GenBank numbering system. (a) Transcribed strand of the lacI gene. The sequence of the region shown in the Figure is: 5'-TTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATA-3' and spans base-pairs 33 to 77; mRNA transcription starts at base-pair 51. (b) Transcribed strand of the uninduced lacZ gene. The sequence of the region shown in the Figure is: 5'-CCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATCCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATT-3' and spans base-pairs 1246 to 1345; mRNA transcription starts at base-pair 1246. Regions A and B are discussed in the text. (c) Transcribed strand of the induced lacZ gene.
JMB—MS 327 267
Strand-specific Repair in Vivo
Figure 2. Quantification of cyclobutane dimer removal from the transcribed strand of the lacZ gene of the wild-type strain. Percentage of dimers repaired refers to data 20 min after UV-irradiation. Region A spans base-pairs 1245 to 1278 and region B spans base-pairs 1286 to 1402, as discussed in the text. Open bars, with IPTG.
the structural gene of lacI (Kunala & Brash, 1992). Since region B was well repaired in the wild-type, the mfd mutation significantly reduced repair in this region. The distinction between domains A and B was thus primarily due to the Mfd transcriptionrepair coupling system. Moreover, this transcriptioncoupled repair system evidently becomes operative outside the initiation complex region (beyond base 32 from the transcription start site). The specific effect of TRCF on the elongation region was also observed in in vitro experiments (Selby & Sancar, 1993). Since in vitro studies had shown that a polymerase stalled at a lesion inhibits repair of the transcribed strand, and that the Mfd protein relieves this inhibition (Selby & Sancar, 1990), it was anticipated that IPTG-induction of lacZ in the mfd-1 strain would then lead to further inhibition of repair. Surprisingly, however, IPTG enhanced the removal of pyrimidine dimers at many sites in both region A and region B (Figures 3(b) and 4). At several sites, the extent of repair was as great as in the wild-type. (The difference in the final level of induction of the lactose operon between wild-type and mfd-1 strains was less than 5%). The large reduction in repair rate between the wild-type and mfd-1 strains was thus limited to: (1) region B, (2) in the uninduced state. Therefore, the largest effect of the mfd gene product was on the un-induced lacZ gene. Conversely, increased transcription was able to influence excision repair even without this particular transcription-repair coupling factor. Moreover, this in vivo effect of transcription was an increase rather than the decrease expected from in vitro studies. Time-course of repair By averaging together dimer frequencies at individually quantified dimer sites of the autoradio-
(a)
(b) Figure 3. Excision repair of cyclobutane dimers at the DNA sequence level in the lacZ gene of an E. coli mfd − strain. (a) Transcribed strand of the uninduced lacZ gene, in the region of base-pairs 1246 to 1345; mRNA starts at base-pair 1246. (b) Transcribed strand of the induced lacZ gene.
grams shown, and from flanking regions not shown, it is possible to examine how the time-course of repair in each domain overall is affected by the state of transcription or by the absence of the Mfd transcription-repair coupling factor (Figure 5(a) and (b)). It is important to note that this average counts each site equally, rather than counting each photoproduct equally, as Southern blot methods do. The latter technique emphasizes the most frequent photoproduct, the TT dimer, and may thus give repair rates different from those shown here. It can
JMB—MS 327 268
Strand-specific Repair in Vivo
(a) Figure 4. Quantification of cyclobutane dimer removal from the transcribed strand of the lacZ gene of the E. coli mfd − strain. Percentage of dimers repaired refers to data 20 min after UV-irradiation. Region A spans base-pairs 1245 to 1278 and region B spans base-pairs 1286 to 1402. Zero-length bars had no measurable repair. Open bars, with IPTG.
be seen that the largest effect of IPTG induction occurred in the first ten minutes. The largest effect of the mfd gene product occurred after ten minutes. Repair on the non-transcribed strand On the non-transcribed strand, no domain corresponding to region A or B was evident (Figure 6(a)). IPTG did not induce removal of dimers in either the wild-type or mfd-1 strain. An A-like domain is suggested by two sites at the promoterproximal end of the region examined, but cannot be investigated further due to a paucity of dipyrimidine sites. In the mfd-1 strain, IPTG actually caused a modest inhibition of repair at many sites on the non-transcribed strand (Figure 6(b)). Averaging together the dimer frequencies at individually quantified dimer sites, as above, also makes it possible to compare repair between strands (Table 1). In the absence of IPTG induction, cyclobutane pyrimidine dimers were removed at similar rates on both strands: the rate on the non-transcribed strand was approximately the average of that in regions A and B of the transcribed strand. However, when the lacZ gene was induced with IPTG there was a preferential removal of dimers from the transcribed strand. At ten minutes post-UV, this strand bias was two- to fourfold (ratio of each strand’s ratio of induced/uninduced), depending on the repair domain (Table 1). These results are expected, as they are comparable with those of Mellon & Hanawalt (1989); they are also consistent with in vitro studies. However, a surprising result was obtained for the mfd-1 strain. This strain also showed the two- to fourfold strand bias after gene induction (Table 1), despite its demonstrated deficiency in strand-specific repair in the uninduced state (Figure 3(a); and Kunala & Brash, 1992). IPTG induction therefore leads to strand-specific repair
(b) Figure 5. Time-course of cyclobutane dimer excision in the lacZ gene. Dimer frequencies at individually quantified bands were averaged over region A or region B of the transcribed strand. (a) Without IPTG; (b) with IPTG. Open symbols, wild-type; filled symbols, mfd − ; circles, region A; triangles, region B.
that is coupled to transcription but is distinct from the Mfd pathway.
Discussion Domains of repair In this study, we describe an additional level to the fine-structure of DNA repair: domain-specific repair within the transcribed strand. In the E. coli lacI gene, dimers were removed more efficiently from the region beginning 10 bp after the mRNA start site than in the promoter sequence. A similar pattern of domain-specific repair was also observed in the lacZ gene when it was expressed at a basal level. In the latter case, fast repair began 32 bases after the mRNA start site. Strand-specific repair without transcription has also been observed in the non-transcribed 5' flanking region of the murine c-myc gene (Beecham et al., 1991). Recently, it has been shown that preferential repair of the transcribed strand in the human PGK1 gene begins just downstream of the transcription start site. The promoter of the PGK1
JMB—MS 327 269
Strand-specific Repair in Vivo
strain; nor does it explain slow repair in the lacI promoter.
Repair on the transcribed strand
(a)
(b) Figure 6. Quantification of cyclobutane dimer removal from the non-transcribed strand of the lacZ gene. Percentage of dimers repaired refers to data 20 min after UV-irradiation. (a) Wild-type strain; (b) mfd − strain. Open bars, with IPTG.
gene also contained slow repair regions (Gao et al., 1994). Slow repair of promoter sequences in part reflects the absence of the Mfd-dependent repair mechanism, which evidently becomes operative outside the initiation complex region. However, repair in the promoter is capable of proceeding faster, as revealed after gene induction. One possible reason for inherently slower repair of promoter sequences might be the abortive cycling of transcription, which delays the passage of RNA polymerase through the initiation complex (Carpousis & Gralla, 1985; Mikita & Beardsley, 1994). Such abortive cycling has been reported in vitro for the E. coli lac UV5 promoter (Straney & Crothers, 1986). It was also shown that the promoter DNA in the region −14 to +26 is protected from DNase I footprinting; this region may also be less accessible to DNA repair proteins. For example, the IPTG-induced repair of the lacZ gene promoter might be mediated directly by repressor removal, rather than indirectly via increased transcription. However, this model cannot explain the IPTG-induced repair of region B in the mfd −
The mechanism underlying the preference of repair for the transcribed strand is partially understood. In vitro experiments with E. coli cell-free extracts and purified proteins suggested that a protein factor, TRCF, is required to couple repair to transcription of the transcribed strand. In the absence of TRCF, repair was inhibited on the transcribed strand during transcription; adding TRCF to the transcription-repair reaction stimulated repair of the transcribed strand. In the absence of transcription, there was no effect of TRCF on strand-specific repair. However, in some experiments TRCF relieved the inhibition of repair of the transcribed strand but did not stimulate it (Selby & Sancar, 1993). This result suggests that factors other than or in addition to the Mfd TRCF may be required for strand-specific repair. In order to test the role of the Mfd repair system in vivo, we measured excision repair rates for particular fragments of the E. coli lacZ gene in an mfd − strain, in the absence and presence of induced transcription. From previous experiments it was anticipated that: (1) strand-specific repair would begin downstream of the transcription start site; (2) in the wild-type strain, inducing transcription would preferentially increase repair of the transcribed strand; (3) repair on the transcribed strand would be unaffected by an mfd − mutation if the level of transcription were low; and (4) in the mfd − strain, transcription would decrease repair of the transcribed strand. The first two expectations were met. Unexpectedly, however, the direct opposite of the last two expectations was found. Firstly, at a low basal level of transcription, repair of pyrimidine dimers from the transcribed strand was slower in the mfd − strain. The effect of Mfd was more pronounced in the elongation region (region B) than in the initiation region (region A; Figure 2 versus Figure 4). These results suggest that Mfd protein is required for repair of the transcribed strand in vivo even under conditions of low, basal, levels of transcription. One model for such a requirement would be that basal levels of polymerase translocation, in conjunction with Mfd protein, monitor the transcribed strand for DNA lesions. However, this model cannot explain the other unexpected result, that induction of strand-specific repair by IPTG proceeded almost normally in the mfd − strain. We therefore conclude that, in the lacZ gene in vivo, basal transcription is coupled to strand-specific repair through the Mfd protein, but induced transcription is coupled to strand-specific repair by a means not involving the Mfd protein. The two coupling mechanisms may use the UvrABC system at different times, since IPTG induction was most influential in the first ten minutes post-UV and the mfd gene product was most influential afterward.
JMB—MS 327 270
Strand-specific Repair in Vivo
Materials and Methods Strains The strains used were E. coli K-12 strain AB1157 [F − , thr-1, ara-14, leuB6, D(gpt-proA)62, lacY1, tsx33, supE44, galK2, hisG4, xyl-5, mtl-1, argE3, thi-1, str-31 ] (from R. Kolodner, Harvard) and its mfd-1 derivative. The mfd-1 derivative was constructed by P1 transduction of a Tn10 linked to mfd-1 (Miller, 1972; Kunala & Brash, 1992). The mfd-1 source was NR10130 [ara, thi, prolac, mfd-1, zcf::Tn10, F'prolac] (from R. W. Schaaper, NIEHS, Triangle Park). NR 10130 was constructed by transfering mfd-1 from WU 3610-45, which was originally isolated by George & Witkin (1974). Biochemical properties of the mutated protein are not known. UV irradiation, DNA isolation, and lac induction An overnight culture was diluted 1:50 in Luria broth and grown for 2.5 hours (absorbance approximately 0.3 at 550 nm). Cells were resuspended in medium 56 to an absorbance of 0.3. A portion (15 ml) of the suspension was spread in a 100 mm Petri dish and, while shaking, UV irradiated at dose of 20 J/m2 with a single 15 W General Electric germicidal lamp emitting principally 254 nm radiation. The dose rate was 1 J/m2 per second, measured with a UVX digital radiometer (Ultraviolet Products, San Gabriel, CA). The irradiated culture was supplemented with 0.25% (v/v) Casamino acids and 0.4% (w/v) glucose and incubated at 37°C for varying times. Portions of the culture were removed at regular intervals and the genomic DNA was rapidly isolated as described (Kunala & Brash, 1992). All the manipulations from UV irradiation to DNA isolation were carried out under dim yellow lights to avoid reversal of cyclobutane pyrimidine dimers by photoreactivation. To induce the lactose operon, 1 mM isopropyl-b-Dthiogalactoside (IPTG) was added to the medium 2.5 hours
before UV irradiation and after UV irradiation, and b-galactosidase activity was assayed as described (Miller, 1972). Induction at the time of UV irradiation was 400 to 700-fold above a basal level of two b-galactosidase units. Transcription of the lacZ gene is not detected in the absence of IPTG (Murakawa et al., 1991). Excision repair of cyclobutane pyrimidine dimers To measure excision repair at the DNA sequence level, we used the technique of oligonucleotide-directed end-labeling (Kunala & Brash, 1992). Briefly, an oligomer is designed to anneal the 3' portion of a specific genomic restriction fragment; the oligonucleotide also contains a 5' segment of six thymine residues. After annealing, this segment provides a template allowing the 3' OH of the genomic fragment to be extended with radiolabeled dATP. This approach circumvents the questions of site-to-site ligation efficiency and dependence of PCR efficiency on fragment length associated with other methods. For analyzing the lacI DNA region containing the lacI promoter sequence, genomic DNA was digested with restriction enzymes HincII and HaeIII. Of the fragments produced, the 150 base-pair fragment of the lacI gene containing the promoter was labeled using, for the non-transcribed strand, 5'-TTTTTTGACACCATCGAATGGCGCAAAACC-3' and, for the transcribed strand, 5'-TTTTTTCCTGGTTCACCACGCGGGAAACGG-3'. To analyze the lacZ gene, the genomic DNA was digested with MspI and HinPI. The resulting 110 base-pair DNA fragment containing the lacZ initiation region was selected for analysis. To label this fragment, the oligomers used were, for the non-transcibed strand, 5'-TTTTTTCAACTGTTGGGAAGGGCGATCGGTGCGGG-3', and for the transcribed strand, 5'-TTTTTTGCTCGTATGTTGTGTGGAATTGTGAGCGG-3'. End-labeling reactions were performed as described (Kunala & Brash, 1992). The cycling conditions were 94°C
Table 1 Strand-specific and domain-specific repair of cyclobutane pyrimidine dimers in the E. coli lacZ gene % Dimers repaired‡
Repair (+IPTG)
Strand bias§
Repair (−IPTG) Time (min)> Strain wt
mdf −
Time (min)
IPTG†
Strand
Region
10
20
30
− + − + − +
NT
B B A A B B
24 24 10 41 41 67
66 60 32 88 75 94
93 93 61 98 94 100
− + − + − +
NT
B B A A B B
15 29 9 43 8 67
44 31 12 54 31 76
77 76 27 71 41 84
TS
TS
Time (min)
10
20
30
1.0
0.9
1.0
4.1
2.8
1.6
1.6
1.2
1.1
1.9
0.7
1.0
4.8
4.5
2.6
8.4
2.5
2.0
10
20
30
1.7 4.1
1.1 3.1
1.0 1.6
0.5 4.2
0.7 6.4
0.5 2.6
Values represent the ratio of the percentage of molecules containing a dimer at a site to the corresponding percentage before repair incubation, averaged over the indicated region. † IPTG, isopropyl-b-D-thiogalactoside; NT, non-transcribed strand; TS, transcribed strand. ‡ Dimer frequencies at individually quantified dimer bands were averaged over region A, over region B, or over the entire region of the non-transcribed strand examined. § Strand bias of induced repair (ratio of inducibility of repair on TS strand to that on NT strand). > After UV-irradiation.
JMB—MS 327 Strand-specific Repair in Vivo
for one minute, 60°C for one minute, 72°C for one minute for MspI-HinPI-digested DNA and 94°C for one minute, 55°C for one minute, 72°C for one minute for HincII-HaeIII-digested DNA. The labeled DNA was purified on a denaturing 5% (w/v) polyacrylamide gel. After renaturation by phenol hybridization, the DNA was incised at cyclobutane dimer sites with saturating amounts of phage T4 endonuclease V as described (Brash, 1988). DNA fragments were resolved on an 8% sequencing gel and cyclobutane dimer locations were quantified as described (Kunala & Brash, 1992). Approximately 10,000 cts/min were loaded in each lane. The method of quantification (Brash, 1988) corrects for loading variations and yields an absolute quantity: the fraction of molecules in the sample that contained a cyclobutane dimer at a particular dinucleotide site. At 20 J/m2, the correction for multiple photoproducts in the same fragment was negligible (Brash, 1988; Kunala & Brash, 1992). Repeated measurements of incision frequency at the same sites using this technique were reproducible within 20%. In the post-irradiation interval studied, there was no detectable DNA replication in the lac operon (Kunala & Brash, 1992).
Acknowledgements We thank R. Schaaper for strains, S. Lloyd for T4 endonuclease, M. Ananthanarayanan for use of the laser densitometer, and P. C. Hanawalt, K. B. Low, I. Mellon and T. Mikita for helpful discussions. This research was supported by ACS grant CN-38 to D. E. B.
References Beecham, E. J., Mushinski, J. F., Shacter, E., Potter, M. & Bohr, V. A. (1991). DNA repair in the c-myc proto-oncogene locus: possible involvement in susceptibility or resistance to plasmacytoma induction in BALB/c mice. Mol. Cell Biol. 11, 3095–3104. Bohr, V. A. (1991). Gene specific DNA repair. Carcinogenesis, 12, 1983–1992. Bohr, V. A., Smith, C. A., Okumoto, D. S. & Hanawalt, P. C. (1985). DNA repair in an active gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more efficient than in the genome overall. Cell, 40, 359–369. Brash, D. E. (1988). Quantitating DNA lesions at the DNA sequence level. In DNA Repair: A Laboratory Manual of Research Procedures (Friedberg, E. C. & Hanawalt, P. C., eds), pp. 327–345, Marcel Dekker, New York. Carpousis, A. J. & Gralla, J. D. (1985). Interaction of RNA polymerase with lacUV5 promoter DNA during mRNA initiation and elongation. J. Mol. Biol. 183, 165–177. Chandrasekhar, D. & Van Houten, B. (1994). High resolution mapping of UV-induced photoproducts in the Escherichia coli lacI gene. Inefficient repair of the non-transcribed strand correlates with high mutation frequency. J. Mol. Biol. 238, 319–332. Gao, S., Drouin, R. & Holmquist, G. P. (1994). DNA repair rates mapped along the human PGK1 gene at nucleotide resolution. Science, 263, 1438–1440. George, D. L. & Witkin, E. M. (1974). Slow excision repair in an mfd mutant of Escherichia coli B/r. Mol. Gen. Genet. 133, 283–291. Hanawalt, P. C. (1991). Heterogeneity of DNA repair at the gene level. Mutat. Res. 247, 203–211.
271 Kantor, G. J., Barsalou, L. S. & Hanawalt, P. C. (1990). Selective repair of specific chromatin domains in UV-irradiated cells from xeroderma pigmentosum complementation group C. Mutat. Res. 235, 171–180. Kunala, S. & Brash, D. E. (1992). Excision repair at individual bases of the Escherichia coli lacI gene: relation to mutation hot spots and transcription coupling activity. Proc. Nat. Acad. Sci., U.S.A. 89, 11031–11035. Leadon, S. A. & Lawrence, D. A. (1992). Strand-selective repair of DNA damage in the yeast GAL7 gene requires RNA polymerase II. J. Biol. Chem. 267, 23175–23182. Mellon, I. & Hanawalt, P. C. (1989). Induction of the Escherichia coli lactose operon selectively increases repair of its transcribed DNA strand. Nature (London), 342, 95–98. Mellon, I., Bohr, V. A., Smith, C. A. & Hanawalt, P. C. (1986). Preferential DNA repair of an active gene in human cells. Proc. Nat. Acad. Sci., U.S.A. 83, 8878–8882. Mellon, I., Spivak, G. & Hanawalt, P. C. (1987). Selective removal of transcription-blocking DNA damage from the transcribed strand of the mammalian DHFR gene. Cell, 51, 241–249. Mikita, T. & Beardsley, G. P. (1994). Effects of arabinosylcytosine substituted DNA on DNA/RNA hybrid stability and transcription by T7 RNA polymerase. Biochemistry, 33, 9195–9208. Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Murakawa, G. J., Kwan, C., Yamashita, J. & Nierlich, D. P. (1991). Transcription and decay of the lac messenger: role of an intergenic terminator. J. Bacteriol. 173, 28–36. Oller, A. R., Fijalkowska, I. J., Dunn, R. L. & Schaaper, R. M. (1992). Transcription-repair coupling determines the strandedness of ultraviolet mutagenesis in Escherichia coli. Proc. Nat. Acad. Sci., U.S.A. 89, 11036–11040. Selby, C. P. & Sancar, A. (1990). Transcription preferentially inhibits nucleotide excision repair of the template DNA strand in vitro. J. Biol. Chem. 265, 21330–21336. Selby, C. P. & Sancar, A. (1993). Molecular mechanism of transcription-repair coupling. Science, 260, 53–58. Smerdon, M. J. (1991). DNA repair and the role of chromatin structure. Curr. Opin. Cell Biol. 3, 422–428. Smerdon, M. J. & Thoma, F. (1990). Site-specific DNA repair at the nucleosome level in a yeast minichromosome. Cell, 61, 675–684. Straney, D. C. & Crothers, D. M. (1986). A stressed intermediate in the formation of stably initiated RNA chains at the Escherichia coli lacUV5 promoter. J. Mol. Biol. 193, 267–278. Sweder, K. S. & Hanawalt, P. C. (1992). Preferential repair of cyclobutane pyrimidine dimers in the transcribed strand of a gene in yeast chromosomes and plasmids is dependent on transcription. Proc. Nat. Acad. Sci., U.S.A. 89, 10696–10700. Troelstra, C., van Gool, A., de Wit, J., Vermeulen, W., Bootsma, D. & Hoeijmakers, J. H. J. (1992). ERCC6, a member of a subfamily of putative helicases, is involved in Cockayne’s syndrome and preferential repair of active genes. Cell, 71, 939–953. Venema, J., Mullenders, L. H., Natarajan, A. T., van Zeeland, A. A. & Mayne, L. V. (1990). The genetic defect in Cockayne syndrome is associated with a defect in repair of UV-induced DNA damage in transcriptionally active DNA. Proc. Nat. Acad. Sci., U.S.A. 87, 4707–4711.
JMB—MS 327 272 Venema, J., van Hoffen, A., Karcagi, V., Natarajan, A. T., van Zeeland, A. A. & Mullenders, L. H. F. (1991). Xeroderma pigmentosum complementation group C cells remove pyrimidine dimers selectively from the transcribed strand of active genes. Mol. Cell. Biol. 11, 4128–4134. Vrieling, H., Venema, J., van Rooyen, M. L., van Hoffen, A., Menichini, P., Zdzienicka, M. Z., Simons, J. W.,
Strand-specific Repair in Vivo
Mullenders, L. H. & van Zeeland, A. A. (1991). Strand specificity for UV-induced DNA repair and mutations in the chinese hamster HPRT gene. Nucl. Acids Res. 19, 2411–2415. Zolan, M. E., Cortopassi, G. A., Smith, C. A. & Hanawalt, P. C. (1982). Deficient repair of chemical adducts in a DNA of monkey cells. Cell, 28, 613–619.
Edited by M. Gottesman
(Received 16 August 1994; accepted 14 November 1994)