Intron-exon structure of the porcine IκBα-encoding gene

Gene, 152 (1995) 253 255 ©1995 Elsevier Science B.V. All rights reserved. 0378-1119/95/$9.50

253

GENE 08515

Intron-exon structure of the porcine b:B0t-encoding gene (ECI-6; NF-~:B inhibitor; genomic organization; ankyrin; transcription factor)

Rainer de Martin a, Harry HolzmOller a, Erhard Hofe# and Fritz H. Bach b aVienna International Research Cooperation Center, A-1235 Vienna, Austria; and bSandoz Center for Immunobiology, New England Deaconess Hospital, Boston, MA 02215, USA

Received by G. Bernardi: 20 July 1994; Accepted: 26 August 1994; Received at publishers: 13 October 1994

SUMMARY

Genomic clones of EC1-6 (endothelial cell inducible), the porcine lxBct gene that encodes a cytoplasmic inhibitor of the transcription factor NF-~:B, were isolated, spanning the entire transcribed region plus 2.1 and 0.35 kb of 5'- and 3'-flanking sequences, respectively. The gene contains five introns ranging in size from 0.6 to 0.1 kb. Four of the introns are located in the coding regions for four of the five ankyrin-like repeats in the central part of the I~Bct protein at similar positions. The fifth intron is located in the C-terminal region. Southern blot analysis indicates the presence of a single copy of ECI-6/I~cB~ in the porcine genome.

INTRODUCTION

Gene IKBe encodes a cytoplasmic inhibitor (I) of NF-~B, a transcripton factor that controls the transient expression of many different genes in response to a wide variety of physiological and pathological stimuli, such as cytokines, bacterial lipopolysaccharides, oxidative damage or viruses (Baeuerle, 1991; Liou and Baltimore, 1993). Regulation of NF-KB is achieved through complex formation with IKBct that, upon stimulation of the cells, dissociates from NF-•B to allow subsequent translocation of the transcription factor to the nucleus. Previous studies from our laboratory and others have demonstrated a direct transcriptional regulation of IKBe by NF-KB (de Martin et al., 1993; Le Bail et al., 1993; Cheng et al., 1994), leading to the model of a regulatory feedback Correspondence to: Dr. R. de Martin, Laboratory for Transplantation Immunology, Vienna International Research Cooperation Center, Brunnerstr. 59, A-1235 Vienna, Austria. Tel. (43-1) 866-34620; Fax (43-1) 866-34623; e-mail: [email protected]

Abbreviations: bp, base pair(s); ECI, endothelial cell inducible; ECI-6, gene encoding ECI-6; I~:Bet, inhibitor of NF-•B; l~Bct, gene encoding I~Ba; kb, kilobase(s) or 1000 bp; NF-KB, nuclear factor kappa B; nt, nucleotide(s). SSDI 0378-1119(94)00726-8

mechanism to ensure the transient nature of NF-~zBdependent gene expression (Brown et al., 1993; Scott et al., 1993; Sun et al., 1993; Chiao et al., 1994).

EXPERIMENTAL AND DISCUSSION

(a) Nucleotide sequence of porcine ECI..6/IKBa In an attempt to identify genes that are up-regulated in cytokine-stimulated endothelial cells, we have previously isolated by differential screening the cDNA for ECI-6, the porcine IKBa (de Martin et al., 1993). To determine the intron-exon structure, we have isolated genomic clones for ECI-6/I~B~. A full-length cDNA probe for EC1-6/lxBct was used to screen a porcine genomic library (Clontech, Palo Alto, CA, USA) in the vector XEMBL3. DNA from several positive clones was analyzed by Southern blotting using the same probe and a 5.5-kb EcoRI and a 4.0-kb HindIII fragment subcloned into pKSM13+. The two clones were found, by restriction analysis, to overlap to a significant extent, and were subsequently sequenced. Together, both clones span a region of 5.8 kb including 2.1 kb of 5'- and 0.35 kb of T-flanking sequences. The 5'-regulatory region has been analyzed

254 previously and demonstrated to contain multiple NF-~Bbinding sites that are functional in vitro and in vivo (Cheng et al., 1994).

(Fracchiolla et al., 1993) that contains six ankyrin repeats and two half repeats in its C-terminal part, shows a partially similar distribution of the introns: each of the ankyrin repeats 1, 2 and 4 is interrupted by an intron at the corresponding position of l~:Bc~and neither gene contains an intron at the position of repeat 3. However, the location of the introns in the following repeats of LYT-IO is distinct, suggesting a separate evolution of hcBe and LYT-IO after an earlier duplication event.

(b) Intron-exon structure of ECI-6/IrBa Comparison with the cDNA sequence revealed that the ECI-6/I~B~ gene contains five introns of 573, 351, 289, 118 and 359 bp, respectively (Fig. 1). Introns 1 and 2 are located at the Y-ends of ankyrin repeats 1 and 2, introns 3 and 4 at the 5'-ends of repeats 4 and 5, respectively. The fifth intron is located in the C-terminal region; no intron was found in the position of ankyrin repeat 3. This is consistent with a model that during evolution the ankyrin repeats have either not been generated by duplication of exons, or that the intron sequence in repeat 3 was lost from the genome after duplication. In the case of I~BT, which encodes the C-terminal part of the p50 NF-~B precursor, the finding of alternatively spliced mRNAs suggests the presence of at least two introns in this gene. The positions of these introns, however, do not correspond to those in the I~B~ gene (Grumont and Gerondakis, 1994). Comparison with the intron-exon structure of LYT-IO, the p52 (NF-~B2) precursor

(c) l~Ba-related genes in the porcine genome To determine the number of ECI-6/I~Be-related sequences in the porcine genome, we have hybridized EcoRI-, SacI- and HindlII-digested porcine genomic DNA with an ECI-6/I~cB=-specific probe. As shown in Fig. 2, one single band is detected in each digest under conditions of high stringency, indicating the presence of a single gene for ECI-6/I~Be. The larger size of the EcoRI band in the genomic Southern blot (8 kb) as compared to the corresponding fragment isolated from the genomic k clone, is due to the EcoRI site in the polylinker and the use of Sau3A partial digestion for the construction of the genomic library.

ga~ttcct~at~agtgaaaatatcatt~aaaaataaagtaa~ag~a~ttg~t~c~cagg~aatc~c~Jaaaatc'att]~c~:t ~gao~aga~ccaaaatgtgtatta~aaggaagttcttcaggcaaaaatttagaactataact.~aao aaatgaggagtattggaaagatca[gaatggaggaaataat~ttttaattatcttgatgtttattagtcta< t c a a a a t g t tat ( c a a a a a c ~ a a t a t a t g g a g a t t t a a a g a a g g c t a a t c c t t a t g t c a g g a a a g a a g a c c t c a c t c a t a g g c t t g t c t c t c a t g a t a a c c c a a g a g a t a a c a t t t t t t g a a c a t t t c a a c a a t g c a a t t a g a g a a t t a t a g g g t t t a g c c c c a g a a t c a g ~ a a g a g g t a c t c & g ~ a a a a t c t a t t t t c a a g t t a c a c a a g % t t a a t tgt t g g c a t t C t g a a g a t g C C C a C C t a a t g g t act a g a g a a g t t t c a a g g c a a a c t t a c a a a a a t C t t a t a L g a t tat t t g a t a c t g c a a c a a c t tggc t a g t c c a c t c a g t c a a C a t C g t g c a t g a a a a c t t a c t a a a a c t g c t g a t gat at t t t t t t a ~

~catttatt~tgctaatttCggtaaaaa~tata~atttgagacttgga~aagatc~caaacct~acatttcCt~tgaata~ctacCca~ggtta~atgtaactaca~t~ctatgtgctggCcaatgttgtataat~a~agga~gaactg ~ a g c t t t t CCt tgct a a a g a g t t t t a g c c c t c c a a g a g t a a g t tat t c c a a t t t at ct Ct g c a g c a a c a g c a a c a t t aat t t t c a t t e a g e r c c c a t a a c a t a g c t t c t t a a ~ t a c t t g c c a t ttt t g a a a a g a t c c a a g t tgc t t t a t C a g g g c c t g g a c c a r t t Ct a g a a g t a g a t g a a t g o a t t cc t t teat t g g c t a g g a g g t g g g g a t g g g g c a g a g a g c a t acc t c t g t ttc t g c a g c t g a g a c c t g g a c a t g g t g a a c c t g g a g t a g c t ac c c a t a t g g c a t g g a c ~ g g t c c a a c t g c t g c c c c c t cct t tgt c c c c c a a g a a g c c a g c a g g g g c a g g a c g a a g g c c a c c t t g g g c t g c c c t g a g c c t cct g c a g t at gcc t g g c a a c t act t tct t a g c c a tct t t a a g g c c c a a t ct c g g g t a a a a t act a c t c a a c c c a t

tc~ttagccaccttctccaaatgc[tctagaaagcggcccccacaagtaggttctctgcagcagcacagtgcaaatggaggaacacgacctcagtaattattttgtcactgcaaagtatctacaacctttgctataaaaattaacacct~ g e t t t ccc t g a a a a a t a g c ¢ c a g [ c a r a t c e a g c a t t t t c c a g c a t C c a g g g c a g a g t g c u tgc t Cct c c c c c a g t C a a c a g g a c t gt t cat a c c g a g g a a a tgat t t g a g g g t tct C t a a g c a t t ~ a c g c t g t t a ~ t gc L a a a g c t t t c

acgacttctacctgaggggggcttgagggaggggggaggtttatgtccctgcactgccaggagcc~ggtctttggtaggaacg~agaggcagc'~ggcgaccttccac~ctcagtgtgtc~t~c~cc~ggagttLagggaagtgaatcc~t agatccagccaacattt~cactcccattttcaagagat~aaaaaaaa~aaaaaaaaaaaaaaaggaaagcatcggcaggtcagcaaaccagcagttctccatccttg~gatcttagcagccgacgaccccaaatca~atcgatcgtggga a ~ c c c c a g g g a a a a t a ~ g g t t c c a t g c a g a g g g c c a g g a t t ac tgac [ g c a g g c t g c a g g g a a g t ~ c c g g g g g a g g g g g c c g g g t c g g g a g g a c t

t [ c c a g c c a c t c a g c g t g c a t t a a a a a g t t c c c t g t a c a t g a c c c c a g t g g c t ca

tcgcagggagtttc~ctgatgaacccgggcgcggggtttaggcttctttttcccccagcagaggacgaggccagt[ctc[tttcLggtctgac~ggct~ggaaattccccgagcttgaccccgcccaggagaaatcccctgccagc~ttt ~g~gcgcCgCggCgGCGCTGCCGAGCCCACAACAGTCCGAGGCCATCGTC

?CGCCCGC~CGAGC~A~CGCGAG~AG~CACG~GCCGCGCAGCCTGT~GCCCGCGCA~cTAGGGAGCAGCG~CCAAGCCCTCAT~GCGCCATGTTCCAG M

CCCGCAGAGCCCGGCCAGGAGTGGGCCATGGAGGGGCCCCGGGACGCGCTCAAGAAG'ZaGC

L

E

P

Q

E

A

P

B

<7

A

E

P

W

K

Q

Q

L

T

E

F

Q

]GCYACTG,3AT 3 A C C G C C A C G % ? A G C G G C C T G G A C T C C A T G A A G G A C G A G G A G T A C G A G C A G A T G G T O A A G G A G C T G C G C G A G A T C O 3 C

R A E P G Q E W A M E G P R D A L K K E R L L E' CTCGAGC~GCAGGAGGCGCCCCGCGGCGCCGAGCC~TGGAAGCAGCAGCTCACCGAGGACGGAG~`CT~gtaagtg[ D

g

D

D

R H D S G L O S M K D E E Y E Q M V K E L R E i cg
R

c g g c c g g g g g c g g g g c g g c c a c g g g g a c g c g a a g t c c c c g c t tgcat a a g g g g g g g c g g g a g t t tc t g c c c c g c t g g c g g g c g g g a g g g g a a g t a c a g g g c g t C c c g g c c c g g c g g g a g g g c g g g g c g g t c ~ g g c c g g c g c c c g c c g c c t g g g g a g g g g g g g g g g g c g g a a a g ~ c c c t g g g t g c c t g c c a g g a a c a c t c a g c t cat a a t a a c c t c g c g g a a a a c a c c g c g g c c t c g g c c t c c a g a a a c c c c g g g c t t g c g c a a t c c c c t g c g g g c tgt g c c a c c c t g g g c c c c a c g c a g t g c a c t cac c a g c c c t g g g g g t t t t ccc t c t c t t c ccc t c a g G T T C C T G C A C T T G G C C A T C A T C C A T G A A G A G A A G G C A C T G A C C A T G G A A G T G G T C C G C C A A G T G A A G G G A G A T C T G G C T T T T C T T A A C T T C C A G A A C A A C C T G CAGCAG F L H L A i 1 H S E K A ~, ~ M E '/ V R Q %' /< G D L A F L N F Q N ,',~ L ~

gtgcgctgcttgcccgcccc~t~cctct~ -r Ta~" a,qgt " a t a t g t t c t t g c t g c t a g c a g a a ~ c c t c a g a c t c a g c c a t a a g c a t c t c a a a t r 2ct% t t

L

v

S

L

2

A

D

V

N

A

Q

P

C

N

G

R

T

A

L

H

53

27,9'., 2850 3000 3150 112 3200 345,3 3606

145 3<[0 2 £~ 5}[,'2' 405< ~99 4205 222

ggt~tcagGAGCcCTG~AATG~C~G9-~.CCGC~cTGCATCTTG~GGTG'~A~CTG
3 240<) 2550 76

~

gaatcggggttcgtgcacggaccccgaggctg~gcaaaggtgcacggttgcgcgtgggagccggggatcgg~gattggggcc~tc~gtcc~cgcggctctaccttgcagccgtgcacacc~cccacccctcacccacctt~gcgg~ccc~

E

i5'.' 30{: 456, 600 7.<[) 900 1050 1200 1350 ISOC 1650 1800 1950 2100 2256,

L

A

V

D

L

O

27

P

D

L

V

S

L

L

2

K

?

3

.,%

L'

V

L'

R

V

T

Y

Q

G

Y

S

P

Y

2

i

?

W

4~[,, 7

95

GcCCAAGCACTCGG~TA~AGCAG~AGCTGGGC~AGCTGACCCTAGAAAA~CTCCAGATG~TTCC~GAGAG~GAGG~TGAG`5~G~'3C1~AT~`A~`~GAGTCAGAGTTCACAGAG`~ATG~gtg~g~c~caatgaCctt`~c~-gggt~<'~~ _

~ 45,0 © Q Q L G Q i T L E N i Q M L P E 2 E P 5 ~ J ? .0 ? E S E F ~" E D E 299 c a a a a a g c a a t g c t c t c g g a c c c c t a g a g c t c c ~ c c t t c t c c t g a g g q t c t c a a c a t dat g a g g a t c t c a a a t t aggga,~ <~~ L ~ a g c a g t gt cot a a g a g n a g g t t t a g g g g g a g g a t t a t g g t c t g g g g t L t tot t ~-t g c s t t t t [ let 4 6 5 ~ R

P

S

T

R

•

c ttt~gaaggaga@gatcCttaaaggaaaaCttcagcCcaggaagttaattCa~attcgggttagagggaac~gagtc~gaa~acttgcgttatttccagtagcagc~cttgccatcaccccagcacctttggcaaagt~ctggaa~ tttaacatgc~ttt~ttt~2ccc~tttagCTGCCCTATGACGACTGCGTGCTTGGAGGCCAGCGCCTGACGTTATGAGCTTTG~ %AGT3TCTAAAgGACCATGGACTTGTACATTTGTACAAAATCAAGAGTTTTATTTTT.CT%AAAAAZ L P Y D D C 5" L ,2 G Q R i T b " AAGAAAAAAAGAAAAAAAAAGA~A`~.GGGTATACTTATAACCACACCGCACACTGCCTGGCCTGAAACATTTTGCT 7TG ~ G G A ~ T A G C ~ C C G A T T T T G T T A T T C T T ~ T G A A C T T T G G A A A G G C G C C ~ ` G G A G G A T C A T C ~ G A A T G C A G

4~f)[ 495,[.

314

51.0 A G A G A A C C T C T T T T ~ A A C G G C A C C T T G G T G G G G C C T G G G G G A A A G G T T A T C C C T A A T T T G A T G G G A C T C TT T T A T T T A T T S C G C T T C T T G G T T G . < ~ . C C A C C A T G G A G T C A G T G G T G G A G C C C A G G T G T A T C T G G G A . % A T G T T A G ~ . T C A G 5 2 5 0 GTGTGTTGTTAAACCTGTCAGTGGGGTGGGGTTAAAAGTCACGACCTGTCAAGGTTTGTGTTACCCTGCTGTAAATACTGTACATAATGT~PTTTGTTGGTAATTATTTTGGTACTTCTAAGATGTATATTTATTA~ATGGATTTTTACa 5400 aacagaatt~gatCact~tcttcttcgggcagctgtgggactc~tacactgagagtcattcgaa~ccaag~ggaggtggaggt~gag~at~gtgtgggag~atttaccaca~cCaac~acggaactctttcagagaacagcttcCcac [550 accgt~tacaccag~ctcccgg~caggctttgcaggcagccccaggcccagtgcgtgggaggggaggctgttgCaaggtgatag~aa`~ca~cagttt~gg~ttg~ggtggca~caag~tggttggcctacagctggaaggc~cttCa~ t [700 gtcgcttgct£tcatcttcctggtttaaattcagccaggaccttacttctgctttaggaagc~t [764

Fig. 1. Sequence of the porcine ECI-6/I~cBo~gene derived from overlapping EcoRl and Hindlll clones. Exon sequences are in uppercase, the deduced protein sequence and the corresponding numbering is italicized. The TATA-box (upstream from the transcription start point at nt 2117), the AATAAAlike polyadenylation signal, as well as the ankyrin repeats in the protein sequence are underlined. The EcoRI site at nt 1-6 is from the vector sequence. The sequence has been submitted to the EMBL/GenBank data-bases under accession No. Z35483.

255

l

N

precursor, but differs in the region of the following ankyrin repeat(s). (3) Southern blot analysis indicates the presence of a single copy of IKB~ in the porcine genome.

kb REFERENCES

108654m

m

Fig. 2. Southern blot analysis of porcine genomic DNA. 10 ktg DNA were digested with HindlII, XbaI or EcoRI, separated on a 0.7% agarose gel and after transfer to a nylon membrane hybridized with a full-length ECI-6/IxBct probe under high-stringency conditions.

(d) Conclusions (1) The porcine DcBct-encoding gene contains five introns ranging in size from 0.6 to 0.1 kb. Introns 1, 2, 3 and 4 are located at similar positions at the 5' end of the corresponding ankyrin repeats 1, 2, 4 and 5, respectively. (2) The intron-exon structure of IxBct in the region of the first four ankyrin repeats is very similar to the one in the C-terminal part of gene LYT-1 O, encoding the NF-~:B2

Baeuerle, P.A.: The inducible transcription activator NF-nB: regulation by distinct protein subunits. Biochim. Biophys. Acta 1072 (1991) 63-80. Brown, K., Park, S., Kanno, T., Franzoso, G. and Siebenlist, U.: Mutual regulation of the transcriptional activator NF-KB and its inhibitor, IKB~t. Proc. Natl. Acad. Sci. USA 90 (1993) 2532-2536. Cheng, Q., Cant, C.A., Moll, T., Hofer-Warbinek, R., Wagner, E., Birnstiel, M.L., Bach, F.H. and de Martin, R.: NF-KB subunitspecific regulation of the I~:BQtpromoter. J. Biol. Chem. 269 (1994), 13551-13557. Chiao, P.J., Miyamoto, S. and Verma, I.: Auotoregulation of InBa activity. Proc. Natl. Acad. Sci. USA 91 (1994) 28-32. de Martin, R., Vanhove, B., Cheng, Q., Hofer, E., Csizmadia, V., Winkler, H. and Bach, F.H.: Cytokine-inducible expression in endothelial cells of an IKBct-like gene is regulated by NF-KB. EMBO J. 12 (1993) 2773-2779. Fracchiolla, N.S., Lombardi, L., Salina, M., Migliazza, A., Baldini, L., Berti, E., Cro, L., Polli, E., Maiolo, A.T. and Neri, A.: Structural alterations of the NF-KB transcription factor LYT-IO in lymphoid malignancies. Oncogene 8 (1993) 2839-2845. Grumont, R.J. and Gerondakis, S.: Alternative splicing of RNA transcripts encoded by the murine p105 NF-~B gene generates IKB? isoforms with different inhibitory activities. Proc. Natl. Acad. Sci. USA 91 (1994) 4367-4371. Le Bail, O., Schmidt-Ullrich, R. and Israel, A.: Promoter analysis of the gene encoding the IrB