- Email: [email protected]
Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa
G Model TTBDIS-579; No. of Pages 6
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa Ali Halajian a , Ana M. Palomar b , Aránzazu Portillo b , Heloise Heyne c , Wilmien J. Luus-Powell a , José A. Oteo b,∗ a
Department of Biodiversity (Zoology), University of Limpopo, Sovenga 0727, South Africa Center of Rickettsiosis and Arthropod-Borne Diseases, Hospital San Pedro-CIBIR, Logro˜ no, La Rioja, Spain c Parasites, Vectors & Vector-borne Diseases, ARC-Onderstepoort Veterinary Institute, South Africa b
a r t i c l e
i n f o
Article history: Received 3 September 2015 Received in revised form 26 November 2015 Accepted 7 December 2015 Available online xxx Keywords: Vector-borne Rickettsia spp. Coxiella burnetii Bartonella spp. Ticks South Africa
a b s t r a c t Ticks are involved in the epidemiology of several human pathogens including spotted fever group (SFG) Rickettsia spp., Coxiella burnetii and Bartonella spp. Human diseases caused by these microorganisms have been reported from South Africa. The presence of SFG Rickettsia spp., C. burnetii and Bartonella spp. was investigated in 205 ticks collected from domestic and wild animals from Western Cape and Limpopo provinces (South Africa). Rickettsia massiliae was detected in 10 Amblyomma sylvaticum and 1 Rhipicephalus simus whereas Rickettsia africae was amplified in 7 Amblyomma hebraeum. Neither C. burnetii nor Bartonella spp. was found in the examined ticks. This study demonstrates the presence of the tick borne pathogen R. massiliae in South Africa (Western Cape and Limpopo provinces), and corroborates the presence of the African tick-bite fever agent (R. africae) in this country (Limpopo province). © 2015 Elsevier GmbH. All rights reserved.
Introduction Tick borne rickettsioses have a worldwide distribution, although detailed information concerning certain countries is lacking. Four tick borne spotted fever group (SFG) Rickettsia spp. have been associated with human diseases in South Africa: Rickettsia africae (African tick-bite fever, ATBF), Rickettsia conorii conorii (Mediterranean spotted fever, MSF), Rickettsia aeschlimannii (innominate rickettsioses) and Rickettsia sibirica mongolitimonae (lymphangitisassociated rickettsiosis, LAR) (Pretorius and Birtles, 2002, 2004; Parola et al., 2013). ATBF is considered the first possible cause of fever after returning from southern Africa (Mendelson et al., 2014). In addition to SFG Rickettsiae, ixodid ticks are involved in the epidemiology of other pathogens including Coxiella burnetii and Bartonella spp., although they are not recognized as the main source of these two microorganisms (Maurin and Raoult, 1999; Mediannikov and Fenollar, 2014). In South Africa the occurrence of Q fever cases has been linked to exposure to cattle
∗ Corresponding author at: Departamento de Enfermedades Infecciosas, Hos˜ (La Rioja), Spain. pital San Pedro-CIBIR, C/Piqueras 98-7a N.E., 26006 Logrono Tel.: +34 941298993; fax: +34 941298667. E-mail address: [email protected] (J.A. Oteo).
(Vanderburg et al., 2014). Besides, Bartonella spp. have been amplified in human and animal samples from South Africa, suggesting that this microorganism could be responsible for misdiagnosed diseases, particularly in immunocompromised patients (Trataris et al., 2012). Since epidemiological surveillance studies of Rickettsia spp., C. burnetii and Bartonella spp. conducted in ticks from South Africa are very scarce (Mtshali et al., 2015), the aim of this study was to investigate the presence of these bacteria in ticks collected from domestic and wild animals from different regions in South Africa.
Material and methods Tick collection From May 2012 to July 2013, 205 ticks were collected from domestic and wild animals (21 hosts belonging to 11 species) in 6 localities in Limpopo and Western Cape provinces, South Africa (Table 1, Fig. 1), two provinces with high touristic importance, mainly for game animals viewing and hunting. Most wild animals were checked for ticks in culling seasons (when the Government issues permit culling or hunting extra animals from farms or nature reserves). For the Southern African Hedgehog, Angulate Tortoise
http://dx.doi.org/10.1016/j.ttbdis.2015.12.008 1877-959X/© 2015 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
G Model
TTBDIS-579; No. of Pages 6
2
Host (number of specimens)
Total
Tick species Rh. appendiculatus
Rh. evertsi evertsi
Rhipicephalus spp.b
23◦ 58 32.1 S 29◦ 28 45.2 E 23◦ 58 32.1 S 29◦ 28 45.2 E
33 (33N)
21 (8N;13M)
8 (1N;3M;4F)
1 (1F)
17 (3M;14F)
23◦ 53 35.9 S 29◦ 44 17.0 E 24◦ 00 43.1 S 29◦ 45 18.6 E 23◦ 58 32.1 S 29◦ 28 45.2 E 32◦ 05 38.2 S 18◦ 22 59.3 E 23◦ 58 32.1 S 29◦ 28 45.2 E 23◦ 58 32.1 S 29◦ 28 45.2 E 23◦ 53 49.9 S 29◦ 07 56.6 E 24◦ 02 S 29◦ 09 E 23◦ 58 32.1 S 29◦ 28 45.2 E
Rh. decoloratus
Rh. simus
A. sylvaticum
A. hebraeum
H. spinulosa
5 (2M;3F) 5 (1M;4F)
6 (5M;1F) 15 (15M) 41 (37L;1N;3M)
5 (5N) 5 (5N) 10 (8M;2F)
3 (1M;2F) 1 (1N)
17 (3N;9M;5F)
9 (1M; 8F)
2 (1M;1F)
60 (46N; 9M;5F)
41 (8N; 22M; 11F)
30 (1N; 8M; 21F)
1 (1M) 5 (1M;4F)
1 (1N)
41 (37L;1N;3M)
Rh., Rhipicephalus; A., Amblyomma; H., Haemaphysalis; L, Larvae; N, Nymphs; M, Male adults; F, Female adults. a All the specimens but the Leopard Tortoise (captured in Western Cape province) were captured in Limpopo province. b The sequences of partial 16S rRNA and 12S rRNA genes were 95% and 94% identical to Rhipicephalus decoloratus (GenBank accession numbers EU918193 and AF150044).
22 (21M;1F)
5 (2M;3F)
ARTICLE IN PRESS
Aepyceros melampus (4) Impala Alcelaphus buselaphus caama (2) Red Hartebeest Atelerix frontalis (1) Southern African Hedgehog Bos taurus (2) Cow Ceratotherium simum (1) White Rhinoceros Chersina angulata (1) Leopard Tortoise Connochaetes taurinus (1) Blue Wildebeest Kobus ellipsiprymnus (1) Waterbuck Ovis aries (3) Sheep Gerbilliscus leucogaster (1) Bushveld Gerbil Tragelaphus strepsiceros (4) Greater Kudu
Locality coordinatesa
A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
Table 1 Ticks processed from different hosts from South Africa.
G Model TTBDIS-579; No. of Pages 6
ARTICLE IN PRESS A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
3
Fig. 1. Tick collection sites in Limpopo and Western Cape Provinces, South Africa. All but 41 tick specimens from a Leopard Tortoise were collected in Limpopo province (Table 1).
and Bushveld Gerbil, ticks could be removed since they were found shortly after being hustled on the road. Rhinoceros was checked for ticks before being transferred to a new nature reserve. Specimens were preserved in 70% ethanol and identified by morphological approaches through taxonomic keys (Theiler, 1945; Hoogstraal, 1964; Hussein and Mustafa, 1983; Walker et al., 2000, 2003), and molecular biology methods. Doubtful specimens were also compared to those deposited in the National Museum of South Africa (ARC-Onderstepoort Veterinary Institute). Each whole immature specimen and a half of each adult were individually processed. Arthropods were washed in ethanol 70% and rinsed twice in sterile water before being immersed in 100 L of 0.7 M ammonium hydroxide and boiled for 20 min at 100 ◦ C. A second boil of 20 min at 90 ◦ C was performed with the tube caps open to evaporate the ammonium. A single PCR targeting partial 16S mitochondrial genome of ticks (16S rRNA) was performed for all samples (Black and Piesman, 1994). In addition, at least one specimen from each tick species and from each host was analyzed by PCR for 12S mitochondrial fragment gene (12S rRNA) (Beati and Keirans, 2001).
Bacterium screening Screening of rickettsial DNA was performed using Rickettsia specific PCR assays for partial ompA and ompB genes, chosen according to the demonstrated sensitivity and usefulness for species iden˜ et al., 2013). Panbacterial (16S RNA) and tification (Santibánez Rickettsia specific PCR assays for gltA, sca4, htrA and 16S RNA genes were carried out for doubtful cases of Rickettsia identification. The presence of C. burnetii and Bartonella DNA was investigated by PCR assays targeting insertion sequence IS1111 and rpoB genes, respectively. PCR primer pairs and conditions are shown in Table 2. Two negative controls, one of them containing water instead of template DNA and the other with template DNA but without primers, as well as a positive control of an Ixodes ricinus tick extract (collected from vegetation in La Rioja, Spain), Rickettsia slovaca strain S14ab DNA (obtained from a culture of a Dermacentor marginatus tick in Vero cells), Bartonella henselae (obtained from a
cat blood sample) and C. burnetii (obtained from a human biopsy) were included in the PCR assays. Sequencing All PCR products were sequenced and nucleotide sequences were compared with those available in NCBI database using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Results Ticks identification PCR assays for 16S rRNA from ticks tested positive for all samples thus confirming the validation of the DNA extraction procedure. Seven species of ticks were identified: Rhipicephalus appendiculatus (29.3%), Rhipicephalus evertsi evertsi (20%), Rhipicephalus decoloratus (17.1%), Rhipicephalus simus (0.5%), Amblyomma sylvaticum (20%), Amblyomma hebraeum (10.7%) and Haemaphysalis spinulosa (2.4%) (Table 1). Sequencing of mitochondrial DNA markers confirmed the morphological classification of tick species whose sequences were available in GenBank (all but A. sylvaticum and H. spinulosa), except for 30 specimens initially classified as Rh. decoloratus. For these, the GenBank sequences EU918193 and AF150044 from Rh. decoloratus showed the highest identities with percentages of 95 and 94% for 16S and 12S rRNA genes, respectively. Sequences obtained herein were deposited in GenBank under accession no. KJ613643 and KJ613644, and designated as belonging to ‘Rhipicephalus spp.’. 16S and 12S mitochondrial sequences from H. spinulosa and A. sylvaticum and 16S mitochondrial sequences from Rh. simus and Rh. evertsi evertsi were deposited in GenBank under accession no. KJ613637–42. Bacterium screening Rickettsia spp. were detected in 19 out of 205 samples (9.3%) (Table 3). Nucleotide sequences found in 10 A. sylvaticum from an Angulate Tortoise (Chersina angulata) in Western Cape province
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
G Model
ARTICLE IN PRESS
TTBDIS-579; No. of Pages 6
A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
4 Table 2 PCR primer pairs and conditions used in this study.
Tick species
Gene target
Primer name
Primer sequence 5’→‘3’
Amplified fragment (bp)
Annealing temperature (◦ C)
Reference
16S rRNAa
16S+1 16S−1 T1B T2A
CTGCTCAATGATTTTTTAAATTGCTGTGG CCGGTCTGAACTCAGATCAAGT AAACTAGGATTAGATACCCT AATGAGAGCGACGGGCGATGT
456
48 54 51 53
Black and Piesman (1994) Beati and Keirans (2001)
Rr190.70p Rr190.701n Rr190.70p Rr190.602n rompB OF rompB OR rompB SFG IF rompB SFG/TG IR CS.279 CS.1298
ATGGCGAATATTTCTCCAAAA GTTCCGTTAATGGCAGCATCT ATGGCGAATATTTCTCCAAAA AGTGCAGCATTCGCTCCCCCT GTAACCGGAAGTAATCGTTTCGTAA GCTTTATAACCAGCTAAACCACC GTTTAATACGTGCTGCTAACCAA GGTTTGGCCCATATACCATAAG
631
46
Roux et al. (1996) Regnery et al. (1991)
532
48
511
54
420
56
1019
65
446
50
381
48
12S rRNAb Rickettsia spp.
ompA (semi-nested)a
ompB (nested)a
gltA (nested)b
gltA central region (nested)b
gltA 5 endb
sca4b b
htrA (17-kDa) 16S rRNA 5 endb
338
Choi et al. (2005)
CS.566 CS.1011 RpCS.877p RpCS1258n
GACGGTGATAAAGGAATCTTG CATTTCTTTCCATTGTGCCATC CTACGAACTTACCGCTATTAG GACCAAAACCCATTAACCTAAAC GGGGGCCTGCTCACGGCGG ATTGCAAAAAGTACAGTGAACA
Jado et al. (2007)
RpCS.896p RpCS.1233n CS-78 CS-323
GGCTAATGAAGCAGTGATAA GCGACGGTATACCCATAGC GCAAGTATCGGTGAGGATGTAAT GCTTCCTTAAAATTCAATAAATCAGGAT
337
54
401
48
Labruna et al. (2004)
D1f D928r 17 kDa-1 17 kDa-2 fD1: Rc16S.452n:
ATGAGTAAAGACGGTAACCT AAGCTATTGCGTCATCTCCG GCTCTTGCAACTTCTATGTT CATTGTTCGTCAGGTTGGCA AGAGTTTGATCCTGGCTCAG AACGTCATTATCTTCCTTGC
928
50
Sekeyova et al. (2001)
432
58
Oliveira et al. (2002)
426
59
Weisburg et al. (1991) Márquez et al. (1998)
1500
60
Weisburg et al. (1991)
Regnery et al. (1991) Choi et al. (2005)
Pan-bacterial
16S rRNAb
fD1 rP2
AGAGTTTGATCCTGGCTCAG ACGGCTACCTTGTTACGACTT
Coxiella burnetii
IS1111a
Trans1 Trans2
TATGTATCCACCGTAGCCAGTC CCCAACAACACCTCCTTATTC
685
48
Willems et al. (1994)
Bartonella spp.
rpoBa
1400 F 2300R
CGCATTGGCTTACTTCGTATG GTAGACTGATTAGAACGCTG
825
53
Renesto et al. (2001)
a b
PCRs performed to all the samples. PCRs performed to selected samples (explained in the main text).
Table 3 Microorganisms detected in individually examined ticks from different hosts. Microorganism (no.)
Host (no.)
R. massiliae (11)
Ch. angulata (1)
G. leucogaster (1) R. africae (7)
B. taurus (1) C. simum (1)
Unclassified microorganism (1)
At. frontalis (1)
Tick species (no. and stage)
ompA
A. sylvaticum (3M) A. sylvaticum (1L) A. sylvaticum (1L) A. sylvaticum (1N) A. sylvaticum (3L) A. sylvaticum (1L) Rh. simus (1N)
CP003319 CP003319 CP003319 CP003319 NR NR CP000683
100
A. hebraeum (1M) A. hebraeum (1M) A. hebraeum (4M) A. hebraeum (1M)
CP001612 CP001612 CP001612 CP001612
100 99.8 100 99.8
H. spinulosa (1F)
NH
GenBank ID
ompB % identity 99.2 99.4 99.4 99.4
Identical bp/Total bp
GenBank ID
585/5901 488/4913 488/4913 488/4913
590/590
CP000683 CP000683 CP000683 NR CP000683 CP000683 CP000683
491/491 589/5906 491/491 589/5906
CP001612 CP001612 CP001612 NR GQ223393a
% identity
Identical bp/Total bp
99.8 99.7 99.2
463/4642 381/3822 369/3714
99.5 99.8 100
380/3825 463/4642 382/382
100 100 100
382/382 382/382 382/382
88.6
No., Numbers; bp, Base pairs; R., Rickettsia; Ch., Chersina; A., Amblyomma; NR, Negative results; Rh., Rhipicephalus; G., Gerbilliscus; B., Bos; C., Ceratotherium; L, Larvae; M, Male adults; N, Nymphs; At., Atelerix; H., Haemaphysalis; F, Female; NH, No homology with any sequences available in GenBank. The nucleotide substitutions in the studied sequences were as follows (the number corresponds with the nucleotide position in the cited sequences): 1 1176263: C and 1175947: T and 1175937: G and 1175852: G and 1175809: T. 2 1099454: T. 3 1176263: C and 1175947: T and 1175937: G. 4 1099517: T and 1099454: T:A. 5 1099781: T or 1099740: T or 1099463: C and 1099454: T. 6 1190865: T. a ‘Candidatus Rickettsia tasmanensis’ sequence.
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
G Model TTBDIS-579; No. of Pages 6
ARTICLE IN PRESS A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
and 1 Rh. simus from a Bushveld Gerbil (Gerbilliscus leucogaster) in Limpopo province, showed the highest identity (99.2–100%) with R. massiliae. Further, nucleotide sequences found in 7 A. hebraeum DNA extracts from a cow (Bos taurus) and 1 White Rhinoceros (Ceratotherium simum) in two localities of Limpopo province showed highest identity (99.8–100%) with R. africae. In addition, the ompB nucleotide sequence obtained from 1 H. spinulosa DNA extract collected from a Southern African Hedgehog (Atelerix frontalis) in Limpopo province, showed 88.4% (327/370 bp) identity with Rickettsia conorii subsp. caspia (GenBank accession no. AY643093). For this specimen, ompA nucleotide sequence did not match any sequences deposited in GenBank, and PCRs yielded negative results for gltA, sca4, htrA and 16S RNA genes. Unfortunately, the identification of the microorganism as member of genus Rickettsia could not be confirmed according to the taxonomic classification of Rickettsia (Raoult et al., 2005) (Table 3). Coxiella burnetii or Bartonella spp. were not found in the ticks examined.
5
Transvaal province of South Africa (it included current Limpopo province) (Gummow et al., 1987). Ticks may become infected with C. burnetii during feeding on animals but are not recognized as vectors of the disease for humans (Maurin and Raoult, 1999). Very recently, the presence of C. burnetii was shown in ticks from domestic ruminants in Free State and KwaZulu-Natal provinces of South Africa by molecular methods (Mtshali et al., 2015) but conversely, we did not detect C. burnetii in the current samples. The role of ticks in the transmission of Bartonella infections to humans or animals is still debated (Telford and Wormser, 2010; Wormser and Pritt, 2015). In South Africa, Bartonella spp. have been amplified in human samples as well as in domestic and wild animals (Pretorius et al., 2004; Trataris et al., 2012) but studies in ticks had not been previously conducted. According to our data, Bartonella spp. have not been detected in the studied ticks. The lack of detection of DNA from C. burnetii and Bartonella could be due to the limited number of hosts and ticks analyzed herein. Further research should be carried out to assess the impact of these microorganisms in wildlife and the risk of transmission to domestic animals and humans.
Discussion Conclusions All tick species studied herein had been previously reported from South Africa and, all but A. sylvaticum and H. spinulosa, feeding on humans (Walker, 1991; Horak et al., 2002). In this study, according to the analysis of 16S and 12S rRNA sequences, two populations of specimens morphologically classified as Rh. decoloratus were present. Mitochondrial markers are, when available, useful to identify ticks although rarely distinguish phylogenetically close species (Mediannikov and Fenollar, 2014). Moreover, the molecular markers for ticks’ classification and the minimum phylogenetic distances among genetically closely related tick species have not been agreed by experts. Therefore, the current data could not clarify if our specimens morphologically classified as Rh. decoloratus belonged to more than one species. Rickettsia massiliae is distributed in North and South America, Africa, Europe and southwestern Asia (Parola et al., 2013) but, to our knowledge, it had not previously been detected in South Africa. To date, confirmed human cases of R. massiliae infection have not been reported outside Europe (Oteo and Portillo, 2012), although one patient acquired the infection in Argentina (García-García et al., 2010). The finding of R. massiliae in ticks from South Africa suggests that autochthonous human cases of R. massiliae infection can occur. This species has mainly been associated with the genus Rhipicephalus (Parola et al., 2013) and before this study it had not been reported either in Amblyomma spp. or in Rh. simus. Therefore, Amblyomma sylvaticum and Rh. simus should be considered in the epidemiology of R. massiliae, although more studies are needed to investigate their potential role as vectors and reservoirs of this pathogen. Rickettsia africae is widely distributed in Africa (Kelly et al., 1996; Parola et al., 2013). The identification of R. africae in A. hebraeum was not unexpected since this tick species is the major vector (Kelly et al., 1996; Parola et al., 2013). ATBF has emerged as the leading cause of febrile illness in travellers returning from southern Africa (Portillo and Oteo, 2012; Mendelson et al., 2014). Published reports on ATBF cases in indigenous African populations are scarce (Frean et al., 2008). Maybe in endemic areas such as South Africa, factors like the lack of clinical recognition and diagnostic tools and the possible acquisition of the infection at younger ages, when symptoms are usually mild, could explain this scarcity of reports (Frean et al., 2008). Infection by C. burnetii has been reported from all over the African continent in human and animal populations (Tissot-Dupont et al., 1995; Vanderburg et al., 2014). In our study area, positive antibody titers of C. burnetii have been detected in cattle in the former
This study demonstrates the presence of R. massiliae in South Africa, and corroborates the existence of R. africae in this country. Thus, SFG rickettsiosis should be considered in the differential diagnosis of patients with fever of unknown etiology in South Africa as well as in travellers returning from this country. Acknowledgments Partial results from this study have been presented at the ESCCAR International Congress on Rickettsia and Other Intracellular Bacteria, held in Lausanne (Switzerland) in June 2015. Thanks to Biodiversity Research Chair, University of Limpopo for funding AH for field surveys. We thank Malan Pretorius for providing one of the ticks, and Michael Rampedi and Mokgatla Jerry Molepo for assisting during two of the surveys. Special thanks to Prof. I.G. Horak (Prof. Emeritus, Faculty of Veterinary Science, University of Pretoria) for helping in the identification of problematic immature tick species. Thanks to Dr Sareh Tavakol for helping with the map. References Beati, L., Keirans, J.E., 2001. Analysis of the systematic relationships among ticks of the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on mitochondrial 12S ribosomal DNA gene sequences and morphological characters. J. Parasitol. 87, 32–48. Black, W.C., Piesman, J., 1994. Phylogeny of hard and soft tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc. Natl. Acad. Sci. U.S.A. 91, 10034–10038. Choi, Y.J., Lee, S.H., Park, K.H., Koh, Y.S., Lee, K.H., Baik, H.S., Choi, M.S., Kim, I.S., Jang, W.J., 2005. Evaluation of PCR-based assay for diagnosis of spotted fever group rickettsiosis in human serum samples. Clin. Diagn. Lab. Immunol. 12, 759–763. Frean, J., Blumberg, L., Ogunbanjo, G.A., 2008. Tick bite fever in South Africa. SA Fam. Pract. 50, 33–35. ˜ ˜ García-García, J.C., Portillo, A., Núnez, M.J., Santibánez, S., Castro, B., Oteo, J.A., 2010. A patient from Argentina infected with Rickettsia massiliae. Am. J. Trop. Med. Hyg. 82, 691–692. Gummow, B., Poerstamper, N., Herr, S., 1987. The incidence of Coxiella burnetii antibodies in cattle in the Transvaal. Onderstepoort J. Vet. Res. 54, 569–571. Hoogstraal, H., 1964. Notes on African Haemaphysalis ticks. VI. H. spinulosa Neumann, and its realtion to biological and nomenclatorial problems in the H. leachi group of Africa and Asia (Ixodoidea, Ixodidae). J. Parasitol. 50, 786–791. Horak, I.G., Fourie, L.J., Heyne, H., Walker, J.B., Needham, G.R., 2002. Ixodid ticks feeding on humans in South Africa: with notes on preferred hosts, geographic distribution, seasonal occurrence and transmission of pathogens. Exp. Appl. Acarol. 27, 113–136. Hussein, H.S., Mustafa, B.E., 1983. Haemaphysalis (Rhipistoma) spinulosa Neumann 1906, description of immature stages, adult structural variations, and notes on biology (Ixodoidea: Ixodidae). J. Parasitol., 405–412.
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
G Model TTBDIS-579; No. of Pages 6 6
ARTICLE IN PRESS A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Jado, I., Oteo, J.A., Aldámiz, M., Gil, H., Escudero, R., Ibarra, V., Portu, J., Portillo, A., Lezaun, M.J., García-Amil, C., Rodríguez-Moreno, I., Anda, P., 2007. Rickettsia monacensis and human disease, Spain. Emerg. Infect. Dis. 13, 1405–1407. Kelly, P.J., Beati, L., Mason, P.R., Matthewman, L.A., Roux, V., Raoult, D., 1996. Rickettsia africae sp. nov., the ethiological agent of African Tick Bite Fever. Int. J. Syst. Bacteriol. 46, 611–614. Labruna, M.B., Whitworth, T., Horta, M.C., Bouyer, D.H., McBride, J.W., Pinter, A., Popov, V., Gennari, S.M., Walker, D.H., 2004. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 42, 90–98. ˜ J., Márquez, F.J., Muniain, M.A., Soriguer, R.C., Izquierdo, G., Rodríguez-Bano, Borobio, M.V., 1998. Genotypic identification of an undescribed spotted fever group rickettsia in Ixodes ricinus from southwestern Spain. Am. J. Trop. Med. Hyg. 58, 570–577. Maurin, M., Raoult, D., 1999. Q fever. Clin. Microbiol. Rev. 12, 518–553. Mediannikov, O., Fenollar, F., 2014. Looking in ticks for human bacterial pathogens. Microb. Pathog. 77, 142–148. Mendelson, M., Han, P.V., Vincent, P., von Sonnenburg, F., Cramer, J.P., Loutan, L., Kain, K.C., Parola, P., Hagmann, S., Gkrania-Klotsas, E., Sotir, M., Schlagenhauf, P., 2014. GeoSentinel Surveillance Network, GeoSentinel Surveillance Network. Regional variation in travel-related illness acquired in Africa, March 1997–May 2011. Emerg. Infect. Dis. 20, 532–541. Mtshali, K., Khumalo, Z.T., Nakao, R., Grab, D.J., Sugimoto, C., Thekisoe, O.M., 2015. Molecular detection of zoonotic tick-borne pathogens from ticks collected from ruminants in four South African provinces. Vet. Med. Sci. (in press), http://doi.org/10.1292/jvms.15-0170. Oliveira, R.P., Galvão, M.A., Mafra, C.L., Chamone, C.B., Calic, S.B., Silva, S.U., Walker, D.H., 2002. Rickettsia felis in Ctenocephalides spp. Fleas, Brazil. Emerg. Infect. Dis. 8, 317–319. Oteo, J.A., Portillo, A., 2012. Tick-borne rickettsioses in Europe. Ticks Tick Borne Dis. 3, 271–278. Parola, P., Paddock, C.D., Socolovschi, C., Labruna, M.B., Mediannikov, O., Kernif, T., Abdad, M.Y., Stenos, J., Bitam, I., Fournier, P.E., Raoult, D., 2013. Update on tick-borne rickettsioses around the world: a geographic approach. Clin. Microbiol. Rev. 26, 657–702. Portillo, A., Oteo, J.A., 2012. Rickettsiosis as threat for the traveller. In: Rodriguez-Morales, A. (Ed.). Current Topics in Tropical Medicine InTech. http:// www.rickettsiosis-as-threat-for-the-traveller. Pretorius, A.M., Beati, L., Birtles, R.J., 2004. Diversity of bartonellae associated with small mammals inhabiting Free State province, South Africa. Int. J. Syst. Evol. Microbiol. 54, 1959–1967. Pretorius, A.M., Birtles, R.J., 2002. Rickettsia aeschlimannii: a new pathogenic spotted fever group Rickettsia, South Africa. Emerg. Infect. Dis. 8, 874. Pretorius, A., Birtles, R.J., 2004. Rickettsia mongolotimonae infection in South Africa. Emerg. Infect. Dis. 10, 125–126. Raoult, D., Fournier, P.E., Eremeeva, M., Graves, S., Kelly, P.J., Oteo, J.A., Sekeyova, Z., Tamura, A., Tarasevich, I., Zhang, L., 2005. Naming of Rickettsiae and rickettsial diseases. Ann. N.Y. Acad. Sci. 1063, 1–12.
Regnery, R.L., Spruill, C.L., Plikaytis, B.D., 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 173, 1576–1589. Renesto, P., Gouvernet, J., Drancourt, M., Roux, V., Raoult, D., 2001. Use of rpoB gene analysis for detection and identification of Bartonella species. J. Clin. Microbiol. 39, 430–437. Roux, V., Fournier, P.E., Raoult, D., 1996. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J. Clin. Microbiol. 34, 2058–2065. ˜ ˜ Santibánez, S., Portillo, A., Santibánez, P., Palomar, A.M., Oteo, J.A., 2013. Usefulness of rickettsial PCR assays for the molecular diagnosis of human rickettsioses. Enferm. Infecc. Microbiol. Clin. 31, 283–288. Sekeyova, Z., Roux, V., Raoult, D., 2001. Phylogeny of Rickettsia spp. inferred by comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Int. J. Syst. Evol. Microbiol. 51, 1353–1360. Telford, S.R., Wormser, G.P., 2010. Bartonella spp. transmission by ticks not established. Emerg. Infect. Dis. 16, 379–384. Theiler, G., 1945. Ticks in the South African Zoological Survey Collection, Part V. Three African Haemaphysalids parasitic on domestic Stock. Onderstepoort J. Vet. Sci. 20, 191–207. Tissot-Dupont, H., Brouqui, P., Faugere, B., Raoult, D., 1995. Prevalence of antibodies to Coxiella burnetii, Rickettsia conorii, and Rickettsia typhi in seven African countries. Clin. Infect. Dis. 21, 1126–1133. Trataris, A.N., Rossouw, J., Arntzen, L., Karstaedt, A., Frean, J., 2012. Bartonella spp. in human and animal populations in Gauteng, South Africa, from 2007 to 2009. Onderstepoort J. Vet. Res. 79, 452. Vanderburg, S., Rubach, M.P., Halliday, J.E., Cleaveland, S., Reddy, E.A., Crump, J.A., 2014. Epidemiology of Coxiella burnetii infection in Africa: a OneHealth systematic review. PLoS Negl. Trop. Dis. 8, e2787. ˜ A., Horak, I.G., Latif, A.A., Walker, A.R., Bouattour, A., Camicas, J.L., Estrada-Pena, Pegram, R.G., Preston, P.M., 2003. Ticks of domestic animals in Africa: a guide to identification of species. Biosci. Rep. Edinburgh (UK). Walker, J.B., 1991. A review of the ixodid ticks (Acari, Ixodidae) occurring in southern Africa. Onderstepoort J. Vet. Res. 58, 81–105. Walker, J.B., Keirans, J.E., Horak, I.G., 2000. The genus Rhipicephalus (Acari, Ixodidae). In: A Guide to the Brown Ticks of the World. Cambridge University Press, Cambridge, pp. 643. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703. Willems, H., Thiele, D., Frölich-Ritter, R., Krauss, H., 1994. Detection of Coxiella burnetii in cow’s milk using the polymerase chain reaction (PCR). Zentralbl Veterinarmed B 41, 580–587. Wormser, G.P., Pritt, B., 2015. Update and commentary on four emerging tick-borne infections: Ehrlichia muris-like Agent, Borrelia miyamotoi, Deer Tick Virus, Heartland Virus, and whether ticks play a role in transmission of Bartonella henselae. Infect. Dis. Clin. North Am. 29, 371–381.
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa Ali Halajian a , Ana M. Palomar b , Aránzazu Portillo b , Heloise Heyne c , Wilmien J. Luus-Powell a , José A. Oteo b,∗ a
Department of Biodiversity (Zoology), University of Limpopo, Sovenga 0727, South Africa Center of Rickettsiosis and Arthropod-Borne Diseases, Hospital San Pedro-CIBIR, Logro˜ no, La Rioja, Spain c Parasites, Vectors & Vector-borne Diseases, ARC-Onderstepoort Veterinary Institute, South Africa b
a r t i c l e
i n f o
Article history: Received 3 September 2015 Received in revised form 26 November 2015 Accepted 7 December 2015 Available online xxx Keywords: Vector-borne Rickettsia spp. Coxiella burnetii Bartonella spp. Ticks South Africa
a b s t r a c t Ticks are involved in the epidemiology of several human pathogens including spotted fever group (SFG) Rickettsia spp., Coxiella burnetii and Bartonella spp. Human diseases caused by these microorganisms have been reported from South Africa. The presence of SFG Rickettsia spp., C. burnetii and Bartonella spp. was investigated in 205 ticks collected from domestic and wild animals from Western Cape and Limpopo provinces (South Africa). Rickettsia massiliae was detected in 10 Amblyomma sylvaticum and 1 Rhipicephalus simus whereas Rickettsia africae was amplified in 7 Amblyomma hebraeum. Neither C. burnetii nor Bartonella spp. was found in the examined ticks. This study demonstrates the presence of the tick borne pathogen R. massiliae in South Africa (Western Cape and Limpopo provinces), and corroborates the presence of the African tick-bite fever agent (R. africae) in this country (Limpopo province). © 2015 Elsevier GmbH. All rights reserved.
Introduction Tick borne rickettsioses have a worldwide distribution, although detailed information concerning certain countries is lacking. Four tick borne spotted fever group (SFG) Rickettsia spp. have been associated with human diseases in South Africa: Rickettsia africae (African tick-bite fever, ATBF), Rickettsia conorii conorii (Mediterranean spotted fever, MSF), Rickettsia aeschlimannii (innominate rickettsioses) and Rickettsia sibirica mongolitimonae (lymphangitisassociated rickettsiosis, LAR) (Pretorius and Birtles, 2002, 2004; Parola et al., 2013). ATBF is considered the first possible cause of fever after returning from southern Africa (Mendelson et al., 2014). In addition to SFG Rickettsiae, ixodid ticks are involved in the epidemiology of other pathogens including Coxiella burnetii and Bartonella spp., although they are not recognized as the main source of these two microorganisms (Maurin and Raoult, 1999; Mediannikov and Fenollar, 2014). In South Africa the occurrence of Q fever cases has been linked to exposure to cattle
∗ Corresponding author at: Departamento de Enfermedades Infecciosas, Hos˜ (La Rioja), Spain. pital San Pedro-CIBIR, C/Piqueras 98-7a N.E., 26006 Logrono Tel.: +34 941298993; fax: +34 941298667. E-mail address: [email protected] (J.A. Oteo).
(Vanderburg et al., 2014). Besides, Bartonella spp. have been amplified in human and animal samples from South Africa, suggesting that this microorganism could be responsible for misdiagnosed diseases, particularly in immunocompromised patients (Trataris et al., 2012). Since epidemiological surveillance studies of Rickettsia spp., C. burnetii and Bartonella spp. conducted in ticks from South Africa are very scarce (Mtshali et al., 2015), the aim of this study was to investigate the presence of these bacteria in ticks collected from domestic and wild animals from different regions in South Africa.
Material and methods Tick collection From May 2012 to July 2013, 205 ticks were collected from domestic and wild animals (21 hosts belonging to 11 species) in 6 localities in Limpopo and Western Cape provinces, South Africa (Table 1, Fig. 1), two provinces with high touristic importance, mainly for game animals viewing and hunting. Most wild animals were checked for ticks in culling seasons (when the Government issues permit culling or hunting extra animals from farms or nature reserves). For the Southern African Hedgehog, Angulate Tortoise
http://dx.doi.org/10.1016/j.ttbdis.2015.12.008 1877-959X/© 2015 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
G Model
TTBDIS-579; No. of Pages 6
2
Host (number of specimens)
Total
Tick species Rh. appendiculatus
Rh. evertsi evertsi
Rhipicephalus spp.b
23◦ 58 32.1 S 29◦ 28 45.2 E 23◦ 58 32.1 S 29◦ 28 45.2 E
33 (33N)
21 (8N;13M)
8 (1N;3M;4F)
1 (1F)
17 (3M;14F)
23◦ 53 35.9 S 29◦ 44 17.0 E 24◦ 00 43.1 S 29◦ 45 18.6 E 23◦ 58 32.1 S 29◦ 28 45.2 E 32◦ 05 38.2 S 18◦ 22 59.3 E 23◦ 58 32.1 S 29◦ 28 45.2 E 23◦ 58 32.1 S 29◦ 28 45.2 E 23◦ 53 49.9 S 29◦ 07 56.6 E 24◦ 02 S 29◦ 09 E 23◦ 58 32.1 S 29◦ 28 45.2 E
Rh. decoloratus
Rh. simus
A. sylvaticum
A. hebraeum
H. spinulosa
5 (2M;3F) 5 (1M;4F)
6 (5M;1F) 15 (15M) 41 (37L;1N;3M)
5 (5N) 5 (5N) 10 (8M;2F)
3 (1M;2F) 1 (1N)
17 (3N;9M;5F)
9 (1M; 8F)
2 (1M;1F)
60 (46N; 9M;5F)
41 (8N; 22M; 11F)
30 (1N; 8M; 21F)
1 (1M) 5 (1M;4F)
1 (1N)
41 (37L;1N;3M)
Rh., Rhipicephalus; A., Amblyomma; H., Haemaphysalis; L, Larvae; N, Nymphs; M, Male adults; F, Female adults. a All the specimens but the Leopard Tortoise (captured in Western Cape province) were captured in Limpopo province. b The sequences of partial 16S rRNA and 12S rRNA genes were 95% and 94% identical to Rhipicephalus decoloratus (GenBank accession numbers EU918193 and AF150044).
22 (21M;1F)
5 (2M;3F)
ARTICLE IN PRESS
Aepyceros melampus (4) Impala Alcelaphus buselaphus caama (2) Red Hartebeest Atelerix frontalis (1) Southern African Hedgehog Bos taurus (2) Cow Ceratotherium simum (1) White Rhinoceros Chersina angulata (1) Leopard Tortoise Connochaetes taurinus (1) Blue Wildebeest Kobus ellipsiprymnus (1) Waterbuck Ovis aries (3) Sheep Gerbilliscus leucogaster (1) Bushveld Gerbil Tragelaphus strepsiceros (4) Greater Kudu
Locality coordinatesa
A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
Table 1 Ticks processed from different hosts from South Africa.
G Model TTBDIS-579; No. of Pages 6
ARTICLE IN PRESS A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
3
Fig. 1. Tick collection sites in Limpopo and Western Cape Provinces, South Africa. All but 41 tick specimens from a Leopard Tortoise were collected in Limpopo province (Table 1).
and Bushveld Gerbil, ticks could be removed since they were found shortly after being hustled on the road. Rhinoceros was checked for ticks before being transferred to a new nature reserve. Specimens were preserved in 70% ethanol and identified by morphological approaches through taxonomic keys (Theiler, 1945; Hoogstraal, 1964; Hussein and Mustafa, 1983; Walker et al., 2000, 2003), and molecular biology methods. Doubtful specimens were also compared to those deposited in the National Museum of South Africa (ARC-Onderstepoort Veterinary Institute). Each whole immature specimen and a half of each adult were individually processed. Arthropods were washed in ethanol 70% and rinsed twice in sterile water before being immersed in 100 L of 0.7 M ammonium hydroxide and boiled for 20 min at 100 ◦ C. A second boil of 20 min at 90 ◦ C was performed with the tube caps open to evaporate the ammonium. A single PCR targeting partial 16S mitochondrial genome of ticks (16S rRNA) was performed for all samples (Black and Piesman, 1994). In addition, at least one specimen from each tick species and from each host was analyzed by PCR for 12S mitochondrial fragment gene (12S rRNA) (Beati and Keirans, 2001).
Bacterium screening Screening of rickettsial DNA was performed using Rickettsia specific PCR assays for partial ompA and ompB genes, chosen according to the demonstrated sensitivity and usefulness for species iden˜ et al., 2013). Panbacterial (16S RNA) and tification (Santibánez Rickettsia specific PCR assays for gltA, sca4, htrA and 16S RNA genes were carried out for doubtful cases of Rickettsia identification. The presence of C. burnetii and Bartonella DNA was investigated by PCR assays targeting insertion sequence IS1111 and rpoB genes, respectively. PCR primer pairs and conditions are shown in Table 2. Two negative controls, one of them containing water instead of template DNA and the other with template DNA but without primers, as well as a positive control of an Ixodes ricinus tick extract (collected from vegetation in La Rioja, Spain), Rickettsia slovaca strain S14ab DNA (obtained from a culture of a Dermacentor marginatus tick in Vero cells), Bartonella henselae (obtained from a
cat blood sample) and C. burnetii (obtained from a human biopsy) were included in the PCR assays. Sequencing All PCR products were sequenced and nucleotide sequences were compared with those available in NCBI database using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Results Ticks identification PCR assays for 16S rRNA from ticks tested positive for all samples thus confirming the validation of the DNA extraction procedure. Seven species of ticks were identified: Rhipicephalus appendiculatus (29.3%), Rhipicephalus evertsi evertsi (20%), Rhipicephalus decoloratus (17.1%), Rhipicephalus simus (0.5%), Amblyomma sylvaticum (20%), Amblyomma hebraeum (10.7%) and Haemaphysalis spinulosa (2.4%) (Table 1). Sequencing of mitochondrial DNA markers confirmed the morphological classification of tick species whose sequences were available in GenBank (all but A. sylvaticum and H. spinulosa), except for 30 specimens initially classified as Rh. decoloratus. For these, the GenBank sequences EU918193 and AF150044 from Rh. decoloratus showed the highest identities with percentages of 95 and 94% for 16S and 12S rRNA genes, respectively. Sequences obtained herein were deposited in GenBank under accession no. KJ613643 and KJ613644, and designated as belonging to ‘Rhipicephalus spp.’. 16S and 12S mitochondrial sequences from H. spinulosa and A. sylvaticum and 16S mitochondrial sequences from Rh. simus and Rh. evertsi evertsi were deposited in GenBank under accession no. KJ613637–42. Bacterium screening Rickettsia spp. were detected in 19 out of 205 samples (9.3%) (Table 3). Nucleotide sequences found in 10 A. sylvaticum from an Angulate Tortoise (Chersina angulata) in Western Cape province
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
G Model
ARTICLE IN PRESS
TTBDIS-579; No. of Pages 6
A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
4 Table 2 PCR primer pairs and conditions used in this study.
Tick species
Gene target
Primer name
Primer sequence 5’→‘3’
Amplified fragment (bp)
Annealing temperature (◦ C)
Reference
16S rRNAa
16S+1 16S−1 T1B T2A
CTGCTCAATGATTTTTTAAATTGCTGTGG CCGGTCTGAACTCAGATCAAGT AAACTAGGATTAGATACCCT AATGAGAGCGACGGGCGATGT
456
48 54 51 53
Black and Piesman (1994) Beati and Keirans (2001)
Rr190.70p Rr190.701n Rr190.70p Rr190.602n rompB OF rompB OR rompB SFG IF rompB SFG/TG IR CS.279 CS.1298
ATGGCGAATATTTCTCCAAAA GTTCCGTTAATGGCAGCATCT ATGGCGAATATTTCTCCAAAA AGTGCAGCATTCGCTCCCCCT GTAACCGGAAGTAATCGTTTCGTAA GCTTTATAACCAGCTAAACCACC GTTTAATACGTGCTGCTAACCAA GGTTTGGCCCATATACCATAAG
631
46
Roux et al. (1996) Regnery et al. (1991)
532
48
511
54
420
56
1019
65
446
50
381
48
12S rRNAb Rickettsia spp.
ompA (semi-nested)a
ompB (nested)a
gltA (nested)b
gltA central region (nested)b
gltA 5 endb
sca4b b
htrA (17-kDa) 16S rRNA 5 endb
338
Choi et al. (2005)
CS.566 CS.1011 RpCS.877p RpCS1258n
GACGGTGATAAAGGAATCTTG CATTTCTTTCCATTGTGCCATC CTACGAACTTACCGCTATTAG GACCAAAACCCATTAACCTAAAC GGGGGCCTGCTCACGGCGG ATTGCAAAAAGTACAGTGAACA
Jado et al. (2007)
RpCS.896p RpCS.1233n CS-78 CS-323
GGCTAATGAAGCAGTGATAA GCGACGGTATACCCATAGC GCAAGTATCGGTGAGGATGTAAT GCTTCCTTAAAATTCAATAAATCAGGAT
337
54
401
48
Labruna et al. (2004)
D1f D928r 17 kDa-1 17 kDa-2 fD1: Rc16S.452n:
ATGAGTAAAGACGGTAACCT AAGCTATTGCGTCATCTCCG GCTCTTGCAACTTCTATGTT CATTGTTCGTCAGGTTGGCA AGAGTTTGATCCTGGCTCAG AACGTCATTATCTTCCTTGC
928
50
Sekeyova et al. (2001)
432
58
Oliveira et al. (2002)
426
59
Weisburg et al. (1991) Márquez et al. (1998)
1500
60
Weisburg et al. (1991)
Regnery et al. (1991) Choi et al. (2005)
Pan-bacterial
16S rRNAb
fD1 rP2
AGAGTTTGATCCTGGCTCAG ACGGCTACCTTGTTACGACTT
Coxiella burnetii
IS1111a
Trans1 Trans2
TATGTATCCACCGTAGCCAGTC CCCAACAACACCTCCTTATTC
685
48
Willems et al. (1994)
Bartonella spp.
rpoBa
1400 F 2300R
CGCATTGGCTTACTTCGTATG GTAGACTGATTAGAACGCTG
825
53
Renesto et al. (2001)
a b
PCRs performed to all the samples. PCRs performed to selected samples (explained in the main text).
Table 3 Microorganisms detected in individually examined ticks from different hosts. Microorganism (no.)
Host (no.)
R. massiliae (11)
Ch. angulata (1)
G. leucogaster (1) R. africae (7)
B. taurus (1) C. simum (1)
Unclassified microorganism (1)
At. frontalis (1)
Tick species (no. and stage)
ompA
A. sylvaticum (3M) A. sylvaticum (1L) A. sylvaticum (1L) A. sylvaticum (1N) A. sylvaticum (3L) A. sylvaticum (1L) Rh. simus (1N)
CP003319 CP003319 CP003319 CP003319 NR NR CP000683
100
A. hebraeum (1M) A. hebraeum (1M) A. hebraeum (4M) A. hebraeum (1M)
CP001612 CP001612 CP001612 CP001612
100 99.8 100 99.8
H. spinulosa (1F)
NH
GenBank ID
ompB % identity 99.2 99.4 99.4 99.4
Identical bp/Total bp
GenBank ID
585/5901 488/4913 488/4913 488/4913
590/590
CP000683 CP000683 CP000683 NR CP000683 CP000683 CP000683
491/491 589/5906 491/491 589/5906
CP001612 CP001612 CP001612 NR GQ223393a
% identity
Identical bp/Total bp
99.8 99.7 99.2
463/4642 381/3822 369/3714
99.5 99.8 100
380/3825 463/4642 382/382
100 100 100
382/382 382/382 382/382
88.6
No., Numbers; bp, Base pairs; R., Rickettsia; Ch., Chersina; A., Amblyomma; NR, Negative results; Rh., Rhipicephalus; G., Gerbilliscus; B., Bos; C., Ceratotherium; L, Larvae; M, Male adults; N, Nymphs; At., Atelerix; H., Haemaphysalis; F, Female; NH, No homology with any sequences available in GenBank. The nucleotide substitutions in the studied sequences were as follows (the number corresponds with the nucleotide position in the cited sequences): 1 1176263: C and 1175947: T and 1175937: G and 1175852: G and 1175809: T. 2 1099454: T. 3 1176263: C and 1175947: T and 1175937: G. 4 1099517: T and 1099454: T:A. 5 1099781: T or 1099740: T or 1099463: C and 1099454: T. 6 1190865: T. a ‘Candidatus Rickettsia tasmanensis’ sequence.
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
G Model TTBDIS-579; No. of Pages 6
ARTICLE IN PRESS A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
and 1 Rh. simus from a Bushveld Gerbil (Gerbilliscus leucogaster) in Limpopo province, showed the highest identity (99.2–100%) with R. massiliae. Further, nucleotide sequences found in 7 A. hebraeum DNA extracts from a cow (Bos taurus) and 1 White Rhinoceros (Ceratotherium simum) in two localities of Limpopo province showed highest identity (99.8–100%) with R. africae. In addition, the ompB nucleotide sequence obtained from 1 H. spinulosa DNA extract collected from a Southern African Hedgehog (Atelerix frontalis) in Limpopo province, showed 88.4% (327/370 bp) identity with Rickettsia conorii subsp. caspia (GenBank accession no. AY643093). For this specimen, ompA nucleotide sequence did not match any sequences deposited in GenBank, and PCRs yielded negative results for gltA, sca4, htrA and 16S RNA genes. Unfortunately, the identification of the microorganism as member of genus Rickettsia could not be confirmed according to the taxonomic classification of Rickettsia (Raoult et al., 2005) (Table 3). Coxiella burnetii or Bartonella spp. were not found in the ticks examined.
5
Transvaal province of South Africa (it included current Limpopo province) (Gummow et al., 1987). Ticks may become infected with C. burnetii during feeding on animals but are not recognized as vectors of the disease for humans (Maurin and Raoult, 1999). Very recently, the presence of C. burnetii was shown in ticks from domestic ruminants in Free State and KwaZulu-Natal provinces of South Africa by molecular methods (Mtshali et al., 2015) but conversely, we did not detect C. burnetii in the current samples. The role of ticks in the transmission of Bartonella infections to humans or animals is still debated (Telford and Wormser, 2010; Wormser and Pritt, 2015). In South Africa, Bartonella spp. have been amplified in human samples as well as in domestic and wild animals (Pretorius et al., 2004; Trataris et al., 2012) but studies in ticks had not been previously conducted. According to our data, Bartonella spp. have not been detected in the studied ticks. The lack of detection of DNA from C. burnetii and Bartonella could be due to the limited number of hosts and ticks analyzed herein. Further research should be carried out to assess the impact of these microorganisms in wildlife and the risk of transmission to domestic animals and humans.
Discussion Conclusions All tick species studied herein had been previously reported from South Africa and, all but A. sylvaticum and H. spinulosa, feeding on humans (Walker, 1991; Horak et al., 2002). In this study, according to the analysis of 16S and 12S rRNA sequences, two populations of specimens morphologically classified as Rh. decoloratus were present. Mitochondrial markers are, when available, useful to identify ticks although rarely distinguish phylogenetically close species (Mediannikov and Fenollar, 2014). Moreover, the molecular markers for ticks’ classification and the minimum phylogenetic distances among genetically closely related tick species have not been agreed by experts. Therefore, the current data could not clarify if our specimens morphologically classified as Rh. decoloratus belonged to more than one species. Rickettsia massiliae is distributed in North and South America, Africa, Europe and southwestern Asia (Parola et al., 2013) but, to our knowledge, it had not previously been detected in South Africa. To date, confirmed human cases of R. massiliae infection have not been reported outside Europe (Oteo and Portillo, 2012), although one patient acquired the infection in Argentina (García-García et al., 2010). The finding of R. massiliae in ticks from South Africa suggests that autochthonous human cases of R. massiliae infection can occur. This species has mainly been associated with the genus Rhipicephalus (Parola et al., 2013) and before this study it had not been reported either in Amblyomma spp. or in Rh. simus. Therefore, Amblyomma sylvaticum and Rh. simus should be considered in the epidemiology of R. massiliae, although more studies are needed to investigate their potential role as vectors and reservoirs of this pathogen. Rickettsia africae is widely distributed in Africa (Kelly et al., 1996; Parola et al., 2013). The identification of R. africae in A. hebraeum was not unexpected since this tick species is the major vector (Kelly et al., 1996; Parola et al., 2013). ATBF has emerged as the leading cause of febrile illness in travellers returning from southern Africa (Portillo and Oteo, 2012; Mendelson et al., 2014). Published reports on ATBF cases in indigenous African populations are scarce (Frean et al., 2008). Maybe in endemic areas such as South Africa, factors like the lack of clinical recognition and diagnostic tools and the possible acquisition of the infection at younger ages, when symptoms are usually mild, could explain this scarcity of reports (Frean et al., 2008). Infection by C. burnetii has been reported from all over the African continent in human and animal populations (Tissot-Dupont et al., 1995; Vanderburg et al., 2014). In our study area, positive antibody titers of C. burnetii have been detected in cattle in the former
This study demonstrates the presence of R. massiliae in South Africa, and corroborates the existence of R. africae in this country. Thus, SFG rickettsiosis should be considered in the differential diagnosis of patients with fever of unknown etiology in South Africa as well as in travellers returning from this country. Acknowledgments Partial results from this study have been presented at the ESCCAR International Congress on Rickettsia and Other Intracellular Bacteria, held in Lausanne (Switzerland) in June 2015. Thanks to Biodiversity Research Chair, University of Limpopo for funding AH for field surveys. We thank Malan Pretorius for providing one of the ticks, and Michael Rampedi and Mokgatla Jerry Molepo for assisting during two of the surveys. Special thanks to Prof. I.G. Horak (Prof. Emeritus, Faculty of Veterinary Science, University of Pretoria) for helping in the identification of problematic immature tick species. Thanks to Dr Sareh Tavakol for helping with the map. References Beati, L., Keirans, J.E., 2001. Analysis of the systematic relationships among ticks of the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on mitochondrial 12S ribosomal DNA gene sequences and morphological characters. J. Parasitol. 87, 32–48. Black, W.C., Piesman, J., 1994. Phylogeny of hard and soft tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc. Natl. Acad. Sci. U.S.A. 91, 10034–10038. Choi, Y.J., Lee, S.H., Park, K.H., Koh, Y.S., Lee, K.H., Baik, H.S., Choi, M.S., Kim, I.S., Jang, W.J., 2005. Evaluation of PCR-based assay for diagnosis of spotted fever group rickettsiosis in human serum samples. Clin. Diagn. Lab. Immunol. 12, 759–763. Frean, J., Blumberg, L., Ogunbanjo, G.A., 2008. Tick bite fever in South Africa. SA Fam. Pract. 50, 33–35. ˜ ˜ García-García, J.C., Portillo, A., Núnez, M.J., Santibánez, S., Castro, B., Oteo, J.A., 2010. A patient from Argentina infected with Rickettsia massiliae. Am. J. Trop. Med. Hyg. 82, 691–692. Gummow, B., Poerstamper, N., Herr, S., 1987. The incidence of Coxiella burnetii antibodies in cattle in the Transvaal. Onderstepoort J. Vet. Res. 54, 569–571. Hoogstraal, H., 1964. Notes on African Haemaphysalis ticks. VI. H. spinulosa Neumann, and its realtion to biological and nomenclatorial problems in the H. leachi group of Africa and Asia (Ixodoidea, Ixodidae). J. Parasitol. 50, 786–791. Horak, I.G., Fourie, L.J., Heyne, H., Walker, J.B., Needham, G.R., 2002. Ixodid ticks feeding on humans in South Africa: with notes on preferred hosts, geographic distribution, seasonal occurrence and transmission of pathogens. Exp. Appl. Acarol. 27, 113–136. Hussein, H.S., Mustafa, B.E., 1983. Haemaphysalis (Rhipistoma) spinulosa Neumann 1906, description of immature stages, adult structural variations, and notes on biology (Ixodoidea: Ixodidae). J. Parasitol., 405–412.
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008
G Model TTBDIS-579; No. of Pages 6 6
ARTICLE IN PRESS A. Halajian et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx
Jado, I., Oteo, J.A., Aldámiz, M., Gil, H., Escudero, R., Ibarra, V., Portu, J., Portillo, A., Lezaun, M.J., García-Amil, C., Rodríguez-Moreno, I., Anda, P., 2007. Rickettsia monacensis and human disease, Spain. Emerg. Infect. Dis. 13, 1405–1407. Kelly, P.J., Beati, L., Mason, P.R., Matthewman, L.A., Roux, V., Raoult, D., 1996. Rickettsia africae sp. nov., the ethiological agent of African Tick Bite Fever. Int. J. Syst. Bacteriol. 46, 611–614. Labruna, M.B., Whitworth, T., Horta, M.C., Bouyer, D.H., McBride, J.W., Pinter, A., Popov, V., Gennari, S.M., Walker, D.H., 2004. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 42, 90–98. ˜ J., Márquez, F.J., Muniain, M.A., Soriguer, R.C., Izquierdo, G., Rodríguez-Bano, Borobio, M.V., 1998. Genotypic identification of an undescribed spotted fever group rickettsia in Ixodes ricinus from southwestern Spain. Am. J. Trop. Med. Hyg. 58, 570–577. Maurin, M., Raoult, D., 1999. Q fever. Clin. Microbiol. Rev. 12, 518–553. Mediannikov, O., Fenollar, F., 2014. Looking in ticks for human bacterial pathogens. Microb. Pathog. 77, 142–148. Mendelson, M., Han, P.V., Vincent, P., von Sonnenburg, F., Cramer, J.P., Loutan, L., Kain, K.C., Parola, P., Hagmann, S., Gkrania-Klotsas, E., Sotir, M., Schlagenhauf, P., 2014. GeoSentinel Surveillance Network, GeoSentinel Surveillance Network. Regional variation in travel-related illness acquired in Africa, March 1997–May 2011. Emerg. Infect. Dis. 20, 532–541. Mtshali, K., Khumalo, Z.T., Nakao, R., Grab, D.J., Sugimoto, C., Thekisoe, O.M., 2015. Molecular detection of zoonotic tick-borne pathogens from ticks collected from ruminants in four South African provinces. Vet. Med. Sci. (in press), http://doi.org/10.1292/jvms.15-0170. Oliveira, R.P., Galvão, M.A., Mafra, C.L., Chamone, C.B., Calic, S.B., Silva, S.U., Walker, D.H., 2002. Rickettsia felis in Ctenocephalides spp. Fleas, Brazil. Emerg. Infect. Dis. 8, 317–319. Oteo, J.A., Portillo, A., 2012. Tick-borne rickettsioses in Europe. Ticks Tick Borne Dis. 3, 271–278. Parola, P., Paddock, C.D., Socolovschi, C., Labruna, M.B., Mediannikov, O., Kernif, T., Abdad, M.Y., Stenos, J., Bitam, I., Fournier, P.E., Raoult, D., 2013. Update on tick-borne rickettsioses around the world: a geographic approach. Clin. Microbiol. Rev. 26, 657–702. Portillo, A., Oteo, J.A., 2012. Rickettsiosis as threat for the traveller. In: Rodriguez-Morales, A. (Ed.). Current Topics in Tropical Medicine InTech. http:// www.rickettsiosis-as-threat-for-the-traveller. Pretorius, A.M., Beati, L., Birtles, R.J., 2004. Diversity of bartonellae associated with small mammals inhabiting Free State province, South Africa. Int. J. Syst. Evol. Microbiol. 54, 1959–1967. Pretorius, A.M., Birtles, R.J., 2002. Rickettsia aeschlimannii: a new pathogenic spotted fever group Rickettsia, South Africa. Emerg. Infect. Dis. 8, 874. Pretorius, A., Birtles, R.J., 2004. Rickettsia mongolotimonae infection in South Africa. Emerg. Infect. Dis. 10, 125–126. Raoult, D., Fournier, P.E., Eremeeva, M., Graves, S., Kelly, P.J., Oteo, J.A., Sekeyova, Z., Tamura, A., Tarasevich, I., Zhang, L., 2005. Naming of Rickettsiae and rickettsial diseases. Ann. N.Y. Acad. Sci. 1063, 1–12.
Regnery, R.L., Spruill, C.L., Plikaytis, B.D., 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 173, 1576–1589. Renesto, P., Gouvernet, J., Drancourt, M., Roux, V., Raoult, D., 2001. Use of rpoB gene analysis for detection and identification of Bartonella species. J. Clin. Microbiol. 39, 430–437. Roux, V., Fournier, P.E., Raoult, D., 1996. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J. Clin. Microbiol. 34, 2058–2065. ˜ ˜ Santibánez, S., Portillo, A., Santibánez, P., Palomar, A.M., Oteo, J.A., 2013. Usefulness of rickettsial PCR assays for the molecular diagnosis of human rickettsioses. Enferm. Infecc. Microbiol. Clin. 31, 283–288. Sekeyova, Z., Roux, V., Raoult, D., 2001. Phylogeny of Rickettsia spp. inferred by comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Int. J. Syst. Evol. Microbiol. 51, 1353–1360. Telford, S.R., Wormser, G.P., 2010. Bartonella spp. transmission by ticks not established. Emerg. Infect. Dis. 16, 379–384. Theiler, G., 1945. Ticks in the South African Zoological Survey Collection, Part V. Three African Haemaphysalids parasitic on domestic Stock. Onderstepoort J. Vet. Sci. 20, 191–207. Tissot-Dupont, H., Brouqui, P., Faugere, B., Raoult, D., 1995. Prevalence of antibodies to Coxiella burnetii, Rickettsia conorii, and Rickettsia typhi in seven African countries. Clin. Infect. Dis. 21, 1126–1133. Trataris, A.N., Rossouw, J., Arntzen, L., Karstaedt, A., Frean, J., 2012. Bartonella spp. in human and animal populations in Gauteng, South Africa, from 2007 to 2009. Onderstepoort J. Vet. Res. 79, 452. Vanderburg, S., Rubach, M.P., Halliday, J.E., Cleaveland, S., Reddy, E.A., Crump, J.A., 2014. Epidemiology of Coxiella burnetii infection in Africa: a OneHealth systematic review. PLoS Negl. Trop. Dis. 8, e2787. ˜ A., Horak, I.G., Latif, A.A., Walker, A.R., Bouattour, A., Camicas, J.L., Estrada-Pena, Pegram, R.G., Preston, P.M., 2003. Ticks of domestic animals in Africa: a guide to identification of species. Biosci. Rep. Edinburgh (UK). Walker, J.B., 1991. A review of the ixodid ticks (Acari, Ixodidae) occurring in southern Africa. Onderstepoort J. Vet. Res. 58, 81–105. Walker, J.B., Keirans, J.E., Horak, I.G., 2000. The genus Rhipicephalus (Acari, Ixodidae). In: A Guide to the Brown Ticks of the World. Cambridge University Press, Cambridge, pp. 643. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703. Willems, H., Thiele, D., Frölich-Ritter, R., Krauss, H., 1994. Detection of Coxiella burnetii in cow’s milk using the polymerase chain reaction (PCR). Zentralbl Veterinarmed B 41, 580–587. Wormser, G.P., Pritt, B., 2015. Update and commentary on four emerging tick-borne infections: Ehrlichia muris-like Agent, Borrelia miyamotoi, Deer Tick Virus, Heartland Virus, and whether ticks play a role in transmission of Bartonella henselae. Infect. Dis. Clin. North Am. 29, 371–381.
Please cite this article in press as: Halajian, A., et al., Investigation of Rickettsia, Coxiella burnetii and Bartonella in ticks from animals in South Africa. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.12.008