- Email: [email protected]
Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp., Rickettsia spp. and Coxiella burnetii
VPRSR-00013; No of Pages 6 Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Veterinary Parasitology: Regional Studies and Reports journal homepage: www.elsevier.com/locate/vprsr
Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp., Rickettsia spp. and Coxiella burnetii Joshua Kamani a, Gad Baneth b, Ricardo Gutiérrez b, Yaarit Nachum-Biala b, Harold Salant c, Kosta Y. Mumcuoglu c, Shimon Harrus b,⁎ a b c
Parasitology Division, National Veterinary Research Institute (NVRI), PMB 01 Vom Plateau State, Nigeria Koret School of Veterinary Medicine, The Hebrew University of Jerusalem, Rehovot, Israel Department of Microbiology and Molecular Genetics, The Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University-Hadassah Medical School, Jerusalem, Israel
a r t i c l e
i n f o
Article history: Received 16 December 2015 Received in revised form 28 March 2016 Accepted 8 April 2016 Available online xxxx Keywords: Ctenocephalides felis Bartonella Rickettsia Coxiella burnetii
a b s t r a c t Four hundred and sixty seven Ctenocephalides felis fleas removed from 185 feral cats living in residential areas of Jerusalem, Israel, were screened for bacterial infections of public health importance. The fleas were screened for bartonellae, rickettsiae and Coxiella burnetii by PCR and sequencing. Bartonella DNA was detected in 156 individual fleas collected from 91 of the 185 (49.2%) cats. DNA of Bartonella clarridgeiae, Bartonella henselae and Bartonella koehlerae was detected in 112/467 (24%), 29/467 (6.2%) and 15/467 (3.2%), respectively, indicating a significantly different distribution (P b 0.00001) of these Bartonella spp. among the fleas. However, no differences were observed between female and male fleas in their Bartonella-infection status (P N 0.05). Ninety one individual cats carried fleas infected with 1 to 3 Bartonella species. No differences were found between fleas collected from male and female, pregnant and non-pregnant or young, juvenile and adult cats. Interestingly, a significant association was observed between the clinical status of the cat hosts (apparently healthy versus sick) and the carriage of Bartonella-positive fleas. One of the 467 (0.2%) fleas was positive for Rickettsia felis DNA and no other Rickettsia spp. or C. burnetii DNA were detected. Our findings indicate a relatively high prevalence of Bartonella spp. known to be human pathogens, and low prevalence of R. felis in fleas from the Jerusalem district cats, highlighting the abundance and importance of bartonellae for public health in this urban region. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Fleas are important ectoparasites of mammals, including humans. They cause direct and indirect burden such as irritations, flea-allergy dermatoses, and transmission of pathogens to their hosts (Bitam et al., 2010). The cat flea, Ctenocephalides felis (Bouché 1835), has ubiquitous distribution and is one of the most important ectoparasites of cats and dogs worldwide (Rust and Dryden, 1997). Ct. felis serves as a vector for several emerging and re-emerging infectious disease-causing agents including Rickettsia and Bartonella species (Tsai et al., 2011). It is a competent vector of B. henselae and the probable vector of B. clarridgeiae and B. koehlerae (Chomel et al., 1996; Droz et al., 1999; Finkelstein et al., 2002). All three species have been detected in cats from Israel and the former two species have been incriminated as a cause of human illness in Israeli patients (Avidor et al., 2004). It has also been incriminated in the transmission of Rickettsia felis, the etiologic agent of the flea-borne spotted fever (Adams et al., 1990; Azad et al., 1992). There has been a growing number of reports implicating R. felis as a human pathogen, and human infections have been described in the USA (Schriefer et al., ⁎ Corresponding author. E-mail address: [email protected] (S. Harrus).
1994), Mexico (Zavala-Velázquez et al., 2000), Brazil (Raoult et al., 2001), Israel (Ilan et al., 2010) and North and sub-Saharan African countries (Mediannikov et al., 2013). In addition, many reports describe the worldwide detection of R. felis in several arthropod hosts, mainly the cat flea, Ct. felis. Q fever is a worldwide zoonosis caused by Coxiella burnetii, an obligate intracellular bacterial pathogen. This agent is transmitted to humans predominantly by aerogenic routes and can be spread by the wind. Other ways of transmission include ingestion of infected milk or fresh dairy products and contact with aborted fetuses or placentae, however they are either of minor importance or remain controversial (Kazár, 1999; Norlander, 2000; Doosti et al., 2014). Potential reservoirs are numerous and include mammals, birds and arthropods (mainly ticks). Cats and farm animals (cattle, sheep and goats) have been identified as a source for human infection (Baca and Paretsky, 1983; Lang, 1990; Pinskey et al., 1991). Although C. burnetii DNA was detected in Ct. felis from a weasel in Egypt (Loftis et al., 2006), the flea's role in the transmission of this pathogen was not determined. Israel is endemic for Q fever and human infections are frequently reported (Amitai et al., 2010). The only reported survey in cats from Israel has shown that feral cats from Central Israel had anti-C. burnetii antibodies, indicating that they were exposed to the pathogen (Amitai et al., 2010). However,
http://dx.doi.org/10.1016/j.vprsr.2016.04.001 2405-9390/© 2016 Elsevier B.V. All rights reserved.
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
2
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
data on the presence and/or prevalence of C. burnetii in fleas from Israel is lacking. Cats are known reservoirs of several bacterial pathogens of human importance (Fournier et al., 2001; Chomel, 2015). Stray cats are widespread in Jerusalem Israel, due to uncontrolled mating, their constant access to an abundance of leftover food in garbage bins, as well as food provided by cat fans. Fleas, like other hematophagous arthropods can acquire microbes from vertebrate animals during feeding and from the environment in their free-living stages. Therefore, they can serve as sentinels for infectious agents harbored by their hosts or the environment. The aim of this study was to investigate the presence of Bartonella spp., Rickettsia spp. and C. burnetii, agents of public health importance, in Ct. felis collected from cats in Jerusalem Israel. 2. Materials and methods 2.1. Fleas Between March 2011 and February 2012, fleas were collected from feral cats captured at residential areas of the Jerusalem district, Israel. Cats were captured using traps by professionals from the Municipal Veterinary Services of Jerusalem, as part of the routine sterilization and vaccination program. Other cats were brought directly to the municipal services by veterinary inspectors or citizens. Cats were defined as stray when no previous knowledge of ownership and no physical clues as to care, such as collars, castration or ovariohysterectomy scars were available. The age (estimated by dentation, level of calculus and size of the animal), health and reproductive status were recorded for every cat host. For the flea collection, a louse-comb (Prioderm, Rafa, USA) was used and the fur of the cat was combed for 3 min. Fleas from each individual cat were preserved in labeled microfuge tubes containing 70% ethanol and stored at -20 °C until used. All fleas used in this study were morphologically identified as Ct. felis using the taxonomic key of Lewis (1967). Up to a maximum of 5 fleas from each cat were included in the study. 2.2. DNA extraction Fleas were surface cleansed individually by two washes with sterile phosphate buffered saline (PBS) and then manually crushed with a sterile plastic pestle inside a microtube containing 50 μL of PBS. DNA was
extracted from individual fleas using the Illustra Tissue Mini Spin kit, (GE Healthcare, Little Chalfont, UK) according to the manufacturer's instructions. Phosphate buffered saline was used as a negative control for the extraction process, performed in parallel with the extraction of every set of 24 samples. The quality and quantity of DNA were assessed by the NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific).
2.3. Real-time PCR amplification of the 16S–23S internal transcribed spacer locus (ITS) and the citrate synthase gene (gltA) of Bartonella spp. Initial detection of Bartonella DNA was performed using a high resolution melt (HRM) real-time PCR analysis targeting the Bartonella 16S– 23S internal transcribed spacer (ITS) locus, as described elsewhere (Gutiérrez et al., 2013: Gutiérrez et al., 2015). The oligonucleotide primers used were listed in Table 1. Real-time PCR was carried out using the StepOnePlus (Applied Biosystems) real time system. The amplification protocol used was as follows: 4 min at 95 °C, followed by 50 cycles of 5 s at 95 °C, 30 s at 60 °C (data collection on HRM reporter), and 2 s at 72 °C. The HRM stage was performed at the end of the cycling stage as follows: 15 s at 95 °C, followed by a temperature increase from 70 to 95 °C (data collection set in 0.3%, HRM reporter). PCR was performed in 20 μL reaction volumes containing 4 μL of DNA, 0.6 μL of 50 μM solution of Syto9 (Invitrogen, CA, US), 0.5 μL of 10 mM of each primer, 10 μL Master Mix (Thermo Fisher Scientific, Van Allen Way, Carlsbad, California, US), and 4.4 μL ultrapure PCR water (Thermo Scientific, Surrey, UK). B. henselae DNA extracted from an isolated bacterial culture obtained from a naturally infected cat was used as a positive control, and DNA from a Ct. felis flea negative for Bartonella spp. collected from a cat that was PCR-negative for Bartonella spp. was used as a negative control. One sample, containing all the ingredients of the reaction except DNA, was used as a non-template control (NTC). All of the controls were included in duplicate in each PCR reaction to evaluate the presence of appropriate melting curves and possible contamination. Samples positive for the ITS locus of Bartonella spp. were characterized by their HRM patterns as described by Gutiérrez et al. (2013), and confirmed by sequencing of at least 20% of randomly selected amplicons from each HRM pattern. Further, the Bartonella spp. ITS-positive samples were subjected to citrate synthase gene (gltA) real time PCR under the same conditions outlined above using the primers listed in Table 1. Only fleas that were positive by both ITS and gltA PCR were considered positive.
Table 1 Oligonucleotide primer pairs used in polymerase chain reaction amplifications for the detection of Bartonella spp., Rickettsia spp. and Coxiella burnetii in cat fleas (Ctenocephalides felis) from Jerusalem, Israel. Pathogen
Primer pairs
5′-primer sequences-3’
Target locus
Amplicon (bp)
Reference
Bartonella spp.
321 s 493as 443f 781r RpCS 877p RpCS 1258n
AGATGATGATCCCAAGCCTTCTGG TGAACCTCCGACCTCACGCTTATC GCTATGTCTGCATTCTATCA CCACCATGAGCTGGTCCCC GGGGGCCTGCTCACGGCGG ATTGCAAAAAGTACAGTGAACA
16S–23S (ITS)
208
Maggi and Breitschwerdt, 2005
Citrate synthase (gltA)
340
Citrate synthase (gltA)
381
Birtles and Raoult, 1996 Sofer et al., 2015 Regnery et al., 1991
Rr190.70p Rr190.602n Rr190.701n rfompbf rfompbr 120–2788 120–3599 Single tube nested Trans 1 Trans 2
ATGGCGAATATTTCTCCAAAA AGTGCAGCATTCGCTCCCCCT GTTCCGTTAATGGCAGCATCT GACAATTAATATCGGTGACGG TGCATCAGCATTACCGCTTGC AAACAATAATCAAGGTACTGT TACTTCCGGTTACAGCAAAGT
OmpA
532
Regnery et al., 1991
120-kDa (ompB)
632 540
Fournier et al., 1998 Márquez et al., 2002
ompB
820
Roux and Raoult, 2000
261 F 463 R
GAGCGAACCATTGGTATCG CTTTAACAGCGCTTGAACGT
Rickettsia spp.
Coxiella burnetii
IS1111 gene TATGTATCCACC GTAGCCAGTC CCCAACAACACCTCCTTATTC
Parisi et al., 2006 678 203
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
2.4. Conventional PCR detection of Rickettsia spp A PCR targeting a fragment of the citrate synthase gene (gltA) was run as initial screening for rickettsiae (Regnery et al., 1991). Samples positive by the initial screening PCR were then subjected to further amplification, targeting the outer membrane protein A gene (ompA), and 120-kDa genus common antigen (ompB) to allow speciation of spotted fever group (SFG) Rickettsia spp. (Márquez et al., 1998). Primers and PCR conditions were sourced from the literature (Table 1). Conventional PCR was performed using Syntezza PCR-Ready High Specificity (Syntezza Bioscience, Israel) PCR kit using a programmable conventional thermocycler (Biometra, Goettingen, Germany) as described previously (Kamani et al., 2013). Rickettsia felis DNA was used as positive control, while DNA of Ct. felis negative for R. felis was used as negative control. A non-template control (NTC) consisting of all the reagents but DNA was also included in every set of PCR reaction. PCR products were electrophoresed on 1.5% agarose gel stained with ethidium bromide and checked under ultraviolet (UV) light for the size of amplified fragments by comparison to a 100-bp DNA molecular weight marker. 2.5. Nested PCR amplification of Coxiella burnetii A single-tube nested PCR was employed for the detection of C. burnetii DNA in flea DNA samples (Table 1). Two successive amplifications were performed in a single tube using a thermal profile which selectively extended first the DNA locus targeted by the external, then the internal primer pair as described by Parisi et al. (2006). DNA of C. burnetii was used as a positive control. DNA of Ct. felis negative for C. burnetii by PCR and NTC were used as negative controls. Conventional PCR and DNA gel electrophoresis were performed as described above (Section 2.4). 2.6. Sequencing Positive PCR products were purified using a PCR purification kit (Exo-SAP, NEB; New England Biolabs, Inc., Ipswich, MA). Sequencing was performed at the Center for Genomic Technologies, Hebrew University of Jerusalem, Israel. The quality of the DNA sequences was evaluated, all ambiguities were cleaned and a phylogenetic tree was done using the MEGA software version 6 (Tamura et al., 2013). The clean sequences were compared for similarity to sequences deposited in GenBank, using the BLAST program hosted by the National Center for Biotechnology Information (NCBI), National Institutes of Health, Bethesda, MD (www.ncbi.nlm.nih.gov/BLAST). 2.7. Statistical analyses Data generated in the study were analyzed by the χ2 test using the statistical software package R (R Development Core Team, 2009). P values b 0.05 were considered significant. 3. RESULTS 3.1. Fleas and their hosting cats A total of 685 Ct. felis fleas were recovered from 328 sampled cats. From the 328 cats, 56% (185/328) were infested with fleas at time of sampling, with 1–17 fleas per cat with a mean of 3.7 fleas per cat. However, a maximum of 5 fleas per cat were randomly chosen for this study, thus a total of 467 fleas were sexed [91 (19.5%) males, 376 (80.5%) females] and further processed for DNA extraction. Fleas were collected from cats of all ages and both sexes. Fifty two (28.1%) of the cats were between 0–6 months old (“kittens”), 47 (25.4%) were 7–12 months old (“juveniles”) and 86 (46.5%) were older than 12 months (“adults”). One hundred fifty five (47.3%) were males and 173 (52.7%) females. Of the female cats sampled, 36
3
(20.8%) were pregnant. Although infested with fleas, 162 (87.6%) of the cats seemed apparently healthy, while 23 (12.4%) were manifesting one or more signs of illness. 3.2. Bartonella DNA in cat fleas Bartonella DNA was detected and confirmed in 156 (33.4%) individual fleas collected from 91 (49.2%) cats. All confirmed positive samples were grouped according to their ITS-HRM curves into three groups, resulting in a total prevalence per Bartonella spp. of: 24.0% (112/467) B. clarridgeiae, 6.2% (29/467) B. henselae and 3.2% (15/467) B. koehlerae (Table 2). Twenty eight representative ITS amplicons for B. clarridgeiae group, 11 for B. henselae group and 6 for B. koehlerae group were randomly selected and sequenced. Sequences gave 100% identity to their respective species in the GenBank (accession numbers: B. henselae HG969191.1; B. clarridgeiae FN645454.1; B. koehlerae FJ832087.1) confirming the validity of the ITS-HRM grouping. To further validate the ITS-HRM grouping, 5 each of the gltA amplicons from B. clarridgeiae, and B. henselae and 2 from B. koehlerae groups were sequenced. The gltA sequences gave 100% identity to their respective species in the GenBank (accession numbers: B. henselae HG965802.1; B. clarridgeiae FN645454.1; B. koehlerae AF176091.1), thus, confirming the result of the ITS screening (Fig. 1). The gltA sequences obtained in the study were deposited under accession numbers KU947998-KU948000, KU948003-KU948005, KU948008 and KU948009. Thirty five % (133/376) of the female fleas and 25.3% (23/91) of the male fleas were Bartonella DNA positive (Table 2). Bartonella clarridgeiae was the most common Bartonella spp. in both flea sexes, followed by B. henselae and B. koehlerae (Table 2; all P b 0.0001). However, no significant association was determined between the flea sex and the Bartonella infection status of the flea (P N 0.05), nor differences were observed in the distribution of each Bartonella sp. between the flea sexes (all P N 0.05). Fleas collected from both cat sexes, all cats' age groups, both health status and reproductive status were positive for Bartonella DNA (Table 3 and Supplementary Table 1). Nevertheless, no significant associations were observed between cats' sex, age groups or the reproductive status and the hosting status of Bartonella-positive fleas (all p N 0.05). Conversely, there was a significant association between the health status of the infested cats and the presence of Bartonellapositive fleas (Table 3). Accordingly, a higher percentage of Bartonellapositive fleas (65.2%; 15/23) were removed from sick cats than the percentage obtained from apparently healthy cats (42.6%; 69/162). Cats hosting individual fleas infected with different Bartonella spp. were determined in 11 instances. Five cats hosted fleas containing B. clarridgeiae and B. henselae, 3 cats hosted fleas containing B. clarridgeiae and B. koehlerae and 2 cats hosted fleas containing B. henselae and B. koehlerae DNA. One cat hosted fleas containing the 3 species: B. clarridgeiae, B. henselae and B. koehlerae. The majority of the cats hosting fleas with several different Bartonella spp. DNA, were males (63.6%), apparently healthy (72.7%) and above 12 months old (54.5%). Nevertheless, the total proportion of apparently healthy cats (4.9%, 8/ 162) with multiple Bartonella spp.-positive fleas was not significantly different from the proportion of sick cats with multiple Bartonella spp.positive fleas (13.0%, 3/23) (P N 0.05). Similarly, there was no significant association between the cat's sex and the hosting of multiple Bartonella spp.-positive fleas (P N 0.05). 3.3. Prevalence of Rickettsia spp. DNA in cat fleas Only one of the 467 fleas (0.2%) was found positive for Rickettsia spp. DNA. The sample was positive for rickettsia gltA, ompA and ompB genes. Sequences from the amplicons for each of the different genes were 99% identical to R. felis (GenBank accession number gltA GQ329873; ompA KP318094; and ompB GQ385243).The positive sample #93D was from a flea collected from a 12 months old female cat that was apparently
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
4
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
Table 2 Prevalence of Bartonella spp. DNA in Ctenocephalides felis fleas collected from cats from the Jerusalem district, Israel. Flea's variables Flea sex Male Female Total
Number tested (%)
91 (19.5) 376 (80.5) 467
Number of Bartonella positive fleas (%)
23 (25.3) 133 (35.4) 156 (33.4)
healthy. It was negative for Bartonella spp. DNA. However, 3 other fleas (#93A, #93B and #93C) from the same cat were positive for B. clarridgeiae, B. koehlerae and B. henselae, respectively (Table 2). 3.4. Prevalence of Coxiella burnetii DNA in cat fleas All the 467 cat fleas were negative for C. burnetii targeting the IS1111 gene using the single tube nested PCR. 4. Discussion Fleas collected from all age and health-status categories of cats were positive for Bartonella DNA indicating a widespread prevalence of these bacteria in the study area. The prevalence of 33.41% (156 out of 467) Bartonella- DNA detected in cat fleas collected from stray cats in this study was lower than the prevalence of 50.4% in cat fleas from the nearby Palestinian territory found in another study (Nasereddin et al., 2014). However, the prevalence rates of B. clarridgeiae, B. henselae and B. koehlerae in cat fleas in this study and in the Palestinian study show a similar trend, in which B. clarridgeiae was the most prevalent (24.0% vs 46.7%) followed by B. henselae (6.2% vs 25%) and B. koehlerae (3.2% vs 3.1%). A potential explanation for the difference in the prevalence between the 2 studies could be the stringent criterion used for the determination of “Bartonella positive flea” in the present study (i.e. at least two positive loci). In a recent study conducted in a more confined stray cat population from Rishon Lezion in central Israel, a higher prevalence was detected with Bartonella DNA found in 75.6% of the Ct. felis fleas. Moreover, DNA of four different Bartonella species was identified in these fleas. B. clarridgeiae was detected in 38.9%, B. henselae in
Number of fleas positive (%) for B. clarridgeiae
B. henselae
B. koehlerae
18 (19.8) 94 (25.6) 112 (24.0)
3 (3.3) 26 (7.1) 29 (6.2)
2 (2.2) 13 (3.5) 15 (3.2)
χ2
P-value
22.9 96.8 119.0
b0.00001 b0.00001 b0.00001
26.7%, Bartonella elizabethae-like bacteria in 6.7%, and B. koehlerae in 1.1% of the fleas (Gutiérrez et al., 2015). These results, suggest that differences in the Bartonella spp. distribution can occur between different flea populations from nearby geographic regions. However, the dominance of B. clarridgeiae over the other Bartonella spp. is highlighted among all these flea populations. Similarly, other studies from other geographical regions have also reported B. clarridgeiae as the most prevalent spp. among Ct. felis fleas (Rolain et al., 2003; Kernif et al., 2011; Mokhtar and Tay, 2011). Since, B. henselae tend to be the dominant species circulating among cat populations globally (Boulouis et al., 2005), including Israel (Gutiérrez et al., 2013), the relationship between the Bartonella spp. (B. clarridgeiae, B. henselae), the cat flea (Ct. felis) and cats (Felis catus) needs to be further explored. In this study, we were able to demonstrate that individual fleas collected from the same hosting cat harbored different Bartonella spp. in 11 (3.6%) instances, with all possible combinations. This finding parallels the scenario of mixed infections in the cat population in Israel (Gutiérrez et al., 2013) or it may reflect the possibility that fleas fed previously on cats different from the ones on which they were found during the survey. It will be interesting to analyze the Bartonella community of individual fleas and the cat hosts using 454-pyrosequencing to determine if such co-infection occurs in an individual Ct. felis flea, as previously described in wild rodents and their associated fleas from Israel (Gutiérrez et al., 2014). In a previous study, a moderate correlation between feline Bartonella bacterial loads and their fleas was determined, when both were infected with the same Bartonella species (Gutiérrez et al., 2015). The same study also observed that Bartonella bacterial loads of fleas are positively affected by the presence of the bacteria in their feline host and attributed this to probable multiple
Fig. 1. Maximum-likelihood phylogenetic tree based on the partial gltA gene sequences (279 bp). Phylogenetic tree was constructed using the MEGA software version 5. Bootstrap replicates were performed to estimate the node reliability, and values were obtained from 1000 randomly selected samples of the aligned sequence data. The sequences obtained in this study are indicated with an asterisk (*). GenBank accession numbers are indicated in parentheses.
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
5
Table 3 Demographic factors of flea infested cats from the Jerusalem district, Israel and prevalence of Bartonella spp. DNA in their Ctenocephalides felis fleas. Cat's variables
Number infested (%)
Number of cats hosting Bartonella positive fleas (%)
χ2
P-value
1.93
Total number of fleas tested
Number of fleas out of the total fleas tested (and percentage) positive for B. clarridgeiae B. henselae B. koehlerae
0.16
262 205
37 (14.1) 33 (16.1)
12 (4.6) 8 (3.9)
7 (2.7) 6 (2.9)
19 (13.3) 12 (14.1) 39 (16.3)
8 (5.6) 3 (3.5) 9 (3.8)
3 (2.1) 3 (3.5) 7 (2.9)
Sex Male Female
89 (47.3) 96 (52.7)
49 (55.1) 42 (43.8)
Age group 0–6 months 7–12 months N12 months
52 (28.1) 47 (25.4) 86 (46.5)
26 (50) 18 (38.3) 47 (54.7)
3.27
0.195
143 85 239
Clinical status* Apparently healthy Sick
162 (87.6) 23 (12.4)
69 (42.6) 15 (65.2)
4.13
0.042
400 67
60 (15.0) 10 (14.9)
17 (4.3) 3 (4.5)
8 (2.0) 5 (7.5)
Reproductive status Pregnant Non-pregnant
21 (11.4) 75 (40.5)
7 (33.3) 34 (45.3)
0.54
0.464
32 173
6 (18.8) 21 (12.1)
1 (3.1) 7 (4.0)
1 (3.1) 5 (2.9)
*Excluding pregnancy.
acquisitions/accumulation by the fleas and/or multiplication events within the fleas. However, as in this study we did not test the fleas for blood meal feeding, neither the hosting cats for Bartonella, these associations could not be tested. The association of the clinical status of cats with the carriage of Bartonella-positive fleas is interesting (Table 3). Accordingly, a larger percentage of sick cats presented more positive fleas than the healthy cats. Most case controlled studies have shown that infection with Bartonella spp. usually does not cause disease in cats (Guptill, 2010). It is probable that concomitant diseases, other than bartonelloses, compromise the immune state of the cats and therefore increase their vulnerability to Bartonella infection and potentially their flea infection status. The prevalence of R. felis DNA in this study was 0.2% (1/467). In a previous study 7.6% (6/79) flea pools were found positive for R. felis DNA in fleas collected from central Israel (Bauer et al., 2006), indicating that the single flea prevalence in fleas from Israel is low. Higher prevalence was reported in fleas from France (8.1%), United Kingdom (6–12%) and Western Australia (33%) (Rolain et al., 2003; Kenny et al., 2003; Schloderer et al., 2006, respectively). The only R. felis-positive flea was negative for Bartonella DNA, despite the fact that other fleas collected from the same cat contained the DNA of three Bartonella spp. The lack of Bartonella DNA in this flea may be alluded to a similar observation of decreased species richness in R. felis-infected fleas made by Pornwiroon et al. (2007). The latter study suggested that this could be attributed to an enhanced survival strategy which competes against or blocks other potentially harmful infections in the flea. Human infections with C. burnetii have been reported in both rural and urban communities in Israel with varying clinical manifestations. In some of the human cases, epidemiological investigations failed to pinpoint the primary source of infection (Ergas et al., 2006; Ravid et al., 2008). Even though in two recent Israeli reports, cats were suggested as possible source of infection (Amitai et al., 2010; Rmeileh et al., 2015), which is in agreement with other reports (Marrie et al., 1988, Pinskey et al., 1991; Langley et al., 1998), albeit PCR analysis of feline samples were negative for C. burnetii (Amitai et al., 2010). The lack of detection of C. burnetii DNA in this study suggests that Ct. felis may not be actively involved in the epidemiology of this pathogen in the study area. Further surveillance studies targeting blood samples and parturient tissue/fluids of cats, dogs and their ecto-parasites for this organism are warranted. 5. Conclusions Three major zoonotic feline Bartonella species (B. clarridgeiae, B. henselae and B. koehlerae) were detected in a large percentage of cat
fleas from the Jerusalem district highlighting their potential public health hazard. The higher prevalence of B. clarridgeiae over the other Bartonella spp. contrasts the overall infection in the cat population from Israel. Thus, the relationships of the former species with the cat flea (Ct. felis) and the cat need to be further investigated. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.vprsr.2016.04.001.
References Adams, J.R., Schmidtmann, E.T., Azad, A.F., 1990. Infection of colonized cat fleas, Ctenocephalides felis (Bouché), with a Rickettsia-like microorganism. Am. J. Trop. Med. Hyg. 43, 400–409. Amitai, Z., Bromberg, M., Bernstein, M., Raveh, D., Keysary, A., David, D., Pitlik, S., Swerdlow, D., Massung, R., Rzotkiewicz, S., Halutz, O., Shohat, T., 2010. A large Q fever outbreak in an urban school in central Israel. Clin. Infect. Dis. 50, 1433–1438. Avidor, B., Graidy, M., Efrat, G., Leibowitz, C., Shapira, G., Schattner, A., Zimhony, O., Giladi, M., 2004. Bartonella koehlerae, a new cat-associated agent of culture-negative human endocarditis. J. Clin. Microbiol. 42, 3462–3468. Azad, A.F., Sacci Jr., J.B., Nelson, W.M., Dasch, G.A., Schmidtmann, E.T., Carl, M., 1992. Genetic characterization and transovarial transmission of a typhus-like Rickettsia found in cat fleas. Proc. Natl. Acad. Sci. U. S. A. 89, 43–46. Baca, O., Paretsky, D., 1983. Q fever and Coxiella burnetii: a model for host parasite interactions. Microbiol. Rev. 47, 127–149. Bauer, O., Baneth, G., Eshkol, T., Shaw, E.S., Harrus, S., 2006. Polygenic detection of Rickettsia felis in cat fleas (Ctenocephalides felis) from Israel. Am. J. Trop. Med. Hyg. 74, 444–448. Birtles, R., Raoult, D., 1996. Comparison of partial citrate synthase gene (gltA) sequences for phylogenetic analysis of Bartonella species. Int. J. Syst. Bacteriol. 46, 891–897. Bitam, I., Dittmar, K., Parola, P., Whiting, M.F., Raoult, D., 2010. Fleas and flea-borne diseases. Int. J. Infect. Dis. 14, e667–e676. Boulouis, H.J., Chang, C.C., Henn, J.B., Kasten, R.W., Chomel, B.B., 2005. Factors associated with the rapid emergence of zoonotic Bartonella infections. Vet. Res. 36, 383–410. Chomel, B., 2015. Role of cats as reservoirs of vector borne pathogens of humans. In: Beugnet, F., Halos, L. (Eds.), Parasitoses and vector borne diseases of cats. Merial, Lyon, pp. 339–350. Chomel, B.B., Kasten, R.W., Floyd-Hawkins, K., Chi, B., Yamamoto, K., Roberts-Wilson, J., Gurfield, A.N., Abbott, C., Pedersen, N.C., Koehler, J.E., 1996. Experimental transmission of Bartonella henselae by the cat flea. J. Clin. Microbiol. 34, 1952–1956. Development Core Team, R., 2009. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Doosti, A., Arshi, A., Sadeghi, M., 2014. Investigation of Coxiella burnetii in Iranian camels comparative clinical pathology. 23, 43–46. Droz, S., Chi, B., Horn, E., Steigerwalt, A.G., Whitney, A.M., Brenner, D.J., 1999. Bartonella koehlerae sp. nov., isolated from cats. J. Clin. Microbiol. 37, 1117–1122. Ergas, D., Keysari, A., Edelstein, V., Sthoeger, Z.M., 2006. Acute Q fever in Israel: clinical and laboratory study of 100 hospitalized patients. Isr. Med. Assoc. J. 8, 337–341. Finkelstein, J.L., Brown, T.P., O'Reilly, K.L., Wedincamp Jr., J., Foil, L.D., 2002. Studies on the growth of Bartonella henselae in the cat flea (Siphonaptera: Pulicidae). J. Med. Entomol. 39, 915–919. Fournier, P.E., Roux, V., Raoult, D., 1998. Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int. J. Syst. Bacteriol. 48, 839–849. Fournier, P.E., Lelievre, H., Eykyn, S., Mainardi, J., Marrie, T., Bruneel, F., et al., 2001. Epidemiologic and clinical characteristics of Bartonella quintana and Bartonella henselae endocarditis: a study of 48 patients. Medicine (Baltimore) 80, 245–251.
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
6
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
Guptill, L., 2010. Feline bartonellosis. Veterinary Clinics North American Small Animal Practice 40, 1073–1090. Gutiérrez, R., Morick, D., Gross, I., Winkler, R., Abdeen, Z., Harrus, S., 2013. Bartonellae in domestic and stray cats from Israel: comparison of bacterial cultures and highresolution melt real-time PCR as diagnostic methods. Vector Borne Zoonotic Dis. 13, 2–8. Gutiérrez, R., Morick, D., Cohen, C., Hawlena, H., Harrus, S., 2014. The effect of ecological and temporal factors on the composition of Bartonella infection in rodents and their fleas. Int. Soc. Microbial Ecol. J. 8, 1598–1608. Gutiérrez, R., Nachum-Biala, Y., Harrus, S., 2015. Relationship between the presence of Bartonella species and bacterial loads in cats and cat fleas (Ctenocephalides felis) under natural conditions. Appl. Environ. Microbiol. 81, 5613–5621. Ilan, B., Eyal, M., Mercedes, N.M., Ferran, S., Ilan, B., 2010. First detection of human infection with Rickettsia felis in Israel. Am. J. Med. Sci. 340, 343. Kamani, J., Baneth, G., Mumcuoglu, K.Y., Waziri, N.E., Eyal, O., Guthmann, Y., Harrus, S., 2013. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria. PLoS Negl. Trop. Dis. 7, e2108. Kazár, J., 1999. Q fever current concept. In: Raoult, D., Brouqui, P. (Eds.), Rickettsiae and Rrickettsial Diseases at the Turn of the Third Millennium. Elsevier, Paris, pp. 304–319. Kenny, M.J., Birtles, R.J., Day, M.J., Shaw, S.E., 2003. Rickettsia felis in the United Kingdom. Emerg. Infect. Dis. 9, 1023–1024. Kernif, T., Parola, P., Davoust, B., Plaire, L., Cabre, O., Raoult, D., Rolain, J.M., 2011. Bartonella clarridgeiae in fleas, Tahiti, French Polynesia. Emerg. Infect. Dis. 17, 1773–1775. Lang, G.H., 1990. Coxiellosis (Q fever) in animals. In: Marrie, T.J. (Ed.), Q Ffever: the Disease vol. 1. CRC press, Boca Raton. Langley, J.M., Marrie, T.J., Covert, A., Waag, D.M., Williams, J.C., 1998. Poker players' pneumonia: an urban outbreak of Q fever following exposure to a parturient cat. N. Engl. J. Med. 319, 354–356. Lewis, R.E., 1967. The fleas (Siphonaptera) of Egypt. An illustrated and annotated key. J. Parasitol. 3, 863–885. Loftis, A.D., Reeves, W.K., Szumlas, D.E., Abbassy, M.M., Helmy, I.M., Moriarity, J.R., Dasch, G.A., 2006. Rickettsial agents in Egyptian ticks collected from domestic animals. Exp. Appl. Acarol. 40, 67–81. Maggi, R.G., Breitschwerdt, E.B., 2005. Potential limitations of the 16S-23S rRNA intergenic region for molecular detection of Bartonella species. J. Clin. Microbiol. 43, 1171–1176. Márquez, F.J., Muniain, M., Soriguer, R., Izquierdo, G., Rodriguez-Bano, J., Borobio, M., 1998. Genotypic identification of an undescribed spotted fever group rickettsia in Ixodes ricinus from southwestern Spain. Am. J. Trop. Med. Hyg. 58, 570–577. Márquez, F.J., Muniain, M.A., Perez, J.M., Pachon, J., 2002. Presence of Rickettsia felis in the cat flea from southwestern Europe. Emerg. Infect. Dis. 8, 89–91. Marrie, T.J., MacDonald, A., Durant, H., Yates, L., McCormick, L., 1988. An outbreak of Q fever probably due to contact with a parturient cat. Chest 93, 98–103. Mediannikov, O., Socolovschi1, C., Edouard, S., Fenollar, F., Mouffok, N., Bassene, H., Diatta, G., Tall, A., Niangaly, H., Doumbo, O., Lekana-Douki, J.B., Znazen, A., Sarih, M., Ratmanov, P., Richet, H., Ndiath, M.O., Sokhna, C., Parola, P., Raoult., D., 2013. Common epidemiology of Rickettsia felis infection and malaria, Africa. Emerg. Infect. Dis. 19, 1775–1783.
Mokhtar, A.S., Tay, S.T., 2011. Molecular detection of Rickettsia felis, Bartonella henselae, and B. clarridgeiae in fleas from domestic dogs and cats in Malaysia. Am. J. Trop. Med. Hyg. 85, 931–933. Nasereddin, A., Risheq, A., Harrus, S., Azmi, K., Ereqat, S., Baneth, G., Salant, H., Mumcuoglu, K.Y., Abdeen, Z., 2014. Bartonella species in fleas from Palestinian territories: prevalence and genetic diversity. J. Vector Ecol. 39, 261–270. Norlander, L., 2000. Q fever epidemiology and pathogenesis. Microbes Infect. 2, 417–424. Parisi, A., Fraccalvieri, R., Cafiero, M., Miccolupo, A., Padalino, I., Montagna, C., Capuano, F., Sottili, R., 2006. Diagnosis of Coxiella burnetii related abortion in Italian domestic ruminants using single-tube nested PCR. Vet. Microbiol. 118, 101–106. Pinskey, R.L., Fishbein, D.B., Greene, C.R., Geinshemer, K.F., 1991. An outbreak of cat-associated Q fever in the United States. J. Infect. Dis. 164, 202–204. Pornwiroon, W., Kearney, M.T., Husseneder, C., Foil, L.D., Macaluso, K.R., 2007. Comparative microbiota of Rickettsia felis-uninfected and -infected colonized cat fleas, Ctenocephalides felis. ISME J. 1, 394–402. Raoult, D., La Scola, B., Enea, M., Fournier, P.E., Roux, V., Fenollar, F., et al., 2001. A fleaassociated Rickettsia pathogenic for humans. Emerg. Infect. Dis. 7, 73–81. Ravid, S., Shahar, E., Genizi, J., Schahor, Y., Kassis, I., 2008. Acute Q fever in children presenting with encephalitis. Pediatr. Neurol. 38, 44–46. Regnery, R.L., Spruill, C.L., Plikaytis, D., 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 73, 1576–1589. Rmeileh, A.A., Khoury, T., Meir, K., Drori, A., Shalit, M., Benenson, S., Elinav, H., 2015. Familial Q fever clustering with variable manifestations imitating infectious and autoimmune disease. Clin. Microbiol. Infect. 21, 459–463. Rolain, J.M., Franc, M., Davoust, B., Raoult, D., 2003. Molecular detection of Bartonella quintana, B. koehlerae, B. henselae, B. clarridgeiae, Rickettsia felis, and Wolbachia pipientis in cat fleas, France. Emerg. Infect. Dis. 9, 338–342. Roux, V., Raoult, D., 2000. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer membrane protein rompB (ompB). Int. J. Syst. Evol. Microbiol. 50, 1449–1455. Rust, M.K., Dryden, M.W., 1997. The biology, ecology, and management of the cat flea. Annu. Rev. Entomol. 42, 451–473. Schloderer, D., Owen, H., Clark, P., John Stenos, J., Fenwick, S.G., 2006. Rickettsia felis in fleas, Western Australia. Emerg. Infect. Dis. 12, 841–843. Schriefer, M.E., Sacci Jr., J.B., Dumler, J.S., Bullen, M.G., Azad, A.F., 1994. Identification of a novel rickettsial infection in a patient diagnosed with murine typhus. J. Clin. Microbiol. 32, 949–954. Sofer, S., Gutiérrez, R., Morick, D., Mumcuoglu, K.Y., Harrus, S., 2015. Molecular detection of zoonotic bartonellae (B. henselae, B. elizabethae and B. rochalimae) in fleas collected from dogs in Israel. Med. Vet. Entomol. 29, 344–348. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tsai, Y., Lin, C.C., Chomel, B.B., Chuang, S.T., Tsai, K.H., Wu, W.J., Huang, C.G., Yu, J.C., Sung, M.H., Kass, P.H., Chang, C.C., 2011. Bartonella infection in shelter cats and dogs and their ectoparasites. Vector Borne Zoonotic Dis. 11, 1023–1030. Zavala-Velázquez, J.E., Ruíz-Sosa, J.A., Sánchez-Elias, R.A., Becerra-Carmona, G., Walker, D.H., 2000. Rickettsia felis rickettsiosis in Yucatán. Lancet 356, 1079–1080.
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
Contents lists available at ScienceDirect
Veterinary Parasitology: Regional Studies and Reports journal homepage: www.elsevier.com/locate/vprsr
Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp., Rickettsia spp. and Coxiella burnetii Joshua Kamani a, Gad Baneth b, Ricardo Gutiérrez b, Yaarit Nachum-Biala b, Harold Salant c, Kosta Y. Mumcuoglu c, Shimon Harrus b,⁎ a b c
Parasitology Division, National Veterinary Research Institute (NVRI), PMB 01 Vom Plateau State, Nigeria Koret School of Veterinary Medicine, The Hebrew University of Jerusalem, Rehovot, Israel Department of Microbiology and Molecular Genetics, The Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University-Hadassah Medical School, Jerusalem, Israel
a r t i c l e
i n f o
Article history: Received 16 December 2015 Received in revised form 28 March 2016 Accepted 8 April 2016 Available online xxxx Keywords: Ctenocephalides felis Bartonella Rickettsia Coxiella burnetii
a b s t r a c t Four hundred and sixty seven Ctenocephalides felis fleas removed from 185 feral cats living in residential areas of Jerusalem, Israel, were screened for bacterial infections of public health importance. The fleas were screened for bartonellae, rickettsiae and Coxiella burnetii by PCR and sequencing. Bartonella DNA was detected in 156 individual fleas collected from 91 of the 185 (49.2%) cats. DNA of Bartonella clarridgeiae, Bartonella henselae and Bartonella koehlerae was detected in 112/467 (24%), 29/467 (6.2%) and 15/467 (3.2%), respectively, indicating a significantly different distribution (P b 0.00001) of these Bartonella spp. among the fleas. However, no differences were observed between female and male fleas in their Bartonella-infection status (P N 0.05). Ninety one individual cats carried fleas infected with 1 to 3 Bartonella species. No differences were found between fleas collected from male and female, pregnant and non-pregnant or young, juvenile and adult cats. Interestingly, a significant association was observed between the clinical status of the cat hosts (apparently healthy versus sick) and the carriage of Bartonella-positive fleas. One of the 467 (0.2%) fleas was positive for Rickettsia felis DNA and no other Rickettsia spp. or C. burnetii DNA were detected. Our findings indicate a relatively high prevalence of Bartonella spp. known to be human pathogens, and low prevalence of R. felis in fleas from the Jerusalem district cats, highlighting the abundance and importance of bartonellae for public health in this urban region. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Fleas are important ectoparasites of mammals, including humans. They cause direct and indirect burden such as irritations, flea-allergy dermatoses, and transmission of pathogens to their hosts (Bitam et al., 2010). The cat flea, Ctenocephalides felis (Bouché 1835), has ubiquitous distribution and is one of the most important ectoparasites of cats and dogs worldwide (Rust and Dryden, 1997). Ct. felis serves as a vector for several emerging and re-emerging infectious disease-causing agents including Rickettsia and Bartonella species (Tsai et al., 2011). It is a competent vector of B. henselae and the probable vector of B. clarridgeiae and B. koehlerae (Chomel et al., 1996; Droz et al., 1999; Finkelstein et al., 2002). All three species have been detected in cats from Israel and the former two species have been incriminated as a cause of human illness in Israeli patients (Avidor et al., 2004). It has also been incriminated in the transmission of Rickettsia felis, the etiologic agent of the flea-borne spotted fever (Adams et al., 1990; Azad et al., 1992). There has been a growing number of reports implicating R. felis as a human pathogen, and human infections have been described in the USA (Schriefer et al., ⁎ Corresponding author. E-mail address: [email protected] (S. Harrus).
1994), Mexico (Zavala-Velázquez et al., 2000), Brazil (Raoult et al., 2001), Israel (Ilan et al., 2010) and North and sub-Saharan African countries (Mediannikov et al., 2013). In addition, many reports describe the worldwide detection of R. felis in several arthropod hosts, mainly the cat flea, Ct. felis. Q fever is a worldwide zoonosis caused by Coxiella burnetii, an obligate intracellular bacterial pathogen. This agent is transmitted to humans predominantly by aerogenic routes and can be spread by the wind. Other ways of transmission include ingestion of infected milk or fresh dairy products and contact with aborted fetuses or placentae, however they are either of minor importance or remain controversial (Kazár, 1999; Norlander, 2000; Doosti et al., 2014). Potential reservoirs are numerous and include mammals, birds and arthropods (mainly ticks). Cats and farm animals (cattle, sheep and goats) have been identified as a source for human infection (Baca and Paretsky, 1983; Lang, 1990; Pinskey et al., 1991). Although C. burnetii DNA was detected in Ct. felis from a weasel in Egypt (Loftis et al., 2006), the flea's role in the transmission of this pathogen was not determined. Israel is endemic for Q fever and human infections are frequently reported (Amitai et al., 2010). The only reported survey in cats from Israel has shown that feral cats from Central Israel had anti-C. burnetii antibodies, indicating that they were exposed to the pathogen (Amitai et al., 2010). However,
http://dx.doi.org/10.1016/j.vprsr.2016.04.001 2405-9390/© 2016 Elsevier B.V. All rights reserved.
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
2
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
data on the presence and/or prevalence of C. burnetii in fleas from Israel is lacking. Cats are known reservoirs of several bacterial pathogens of human importance (Fournier et al., 2001; Chomel, 2015). Stray cats are widespread in Jerusalem Israel, due to uncontrolled mating, their constant access to an abundance of leftover food in garbage bins, as well as food provided by cat fans. Fleas, like other hematophagous arthropods can acquire microbes from vertebrate animals during feeding and from the environment in their free-living stages. Therefore, they can serve as sentinels for infectious agents harbored by their hosts or the environment. The aim of this study was to investigate the presence of Bartonella spp., Rickettsia spp. and C. burnetii, agents of public health importance, in Ct. felis collected from cats in Jerusalem Israel. 2. Materials and methods 2.1. Fleas Between March 2011 and February 2012, fleas were collected from feral cats captured at residential areas of the Jerusalem district, Israel. Cats were captured using traps by professionals from the Municipal Veterinary Services of Jerusalem, as part of the routine sterilization and vaccination program. Other cats were brought directly to the municipal services by veterinary inspectors or citizens. Cats were defined as stray when no previous knowledge of ownership and no physical clues as to care, such as collars, castration or ovariohysterectomy scars were available. The age (estimated by dentation, level of calculus and size of the animal), health and reproductive status were recorded for every cat host. For the flea collection, a louse-comb (Prioderm, Rafa, USA) was used and the fur of the cat was combed for 3 min. Fleas from each individual cat were preserved in labeled microfuge tubes containing 70% ethanol and stored at -20 °C until used. All fleas used in this study were morphologically identified as Ct. felis using the taxonomic key of Lewis (1967). Up to a maximum of 5 fleas from each cat were included in the study. 2.2. DNA extraction Fleas were surface cleansed individually by two washes with sterile phosphate buffered saline (PBS) and then manually crushed with a sterile plastic pestle inside a microtube containing 50 μL of PBS. DNA was
extracted from individual fleas using the Illustra Tissue Mini Spin kit, (GE Healthcare, Little Chalfont, UK) according to the manufacturer's instructions. Phosphate buffered saline was used as a negative control for the extraction process, performed in parallel with the extraction of every set of 24 samples. The quality and quantity of DNA were assessed by the NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific).
2.3. Real-time PCR amplification of the 16S–23S internal transcribed spacer locus (ITS) and the citrate synthase gene (gltA) of Bartonella spp. Initial detection of Bartonella DNA was performed using a high resolution melt (HRM) real-time PCR analysis targeting the Bartonella 16S– 23S internal transcribed spacer (ITS) locus, as described elsewhere (Gutiérrez et al., 2013: Gutiérrez et al., 2015). The oligonucleotide primers used were listed in Table 1. Real-time PCR was carried out using the StepOnePlus (Applied Biosystems) real time system. The amplification protocol used was as follows: 4 min at 95 °C, followed by 50 cycles of 5 s at 95 °C, 30 s at 60 °C (data collection on HRM reporter), and 2 s at 72 °C. The HRM stage was performed at the end of the cycling stage as follows: 15 s at 95 °C, followed by a temperature increase from 70 to 95 °C (data collection set in 0.3%, HRM reporter). PCR was performed in 20 μL reaction volumes containing 4 μL of DNA, 0.6 μL of 50 μM solution of Syto9 (Invitrogen, CA, US), 0.5 μL of 10 mM of each primer, 10 μL Master Mix (Thermo Fisher Scientific, Van Allen Way, Carlsbad, California, US), and 4.4 μL ultrapure PCR water (Thermo Scientific, Surrey, UK). B. henselae DNA extracted from an isolated bacterial culture obtained from a naturally infected cat was used as a positive control, and DNA from a Ct. felis flea negative for Bartonella spp. collected from a cat that was PCR-negative for Bartonella spp. was used as a negative control. One sample, containing all the ingredients of the reaction except DNA, was used as a non-template control (NTC). All of the controls were included in duplicate in each PCR reaction to evaluate the presence of appropriate melting curves and possible contamination. Samples positive for the ITS locus of Bartonella spp. were characterized by their HRM patterns as described by Gutiérrez et al. (2013), and confirmed by sequencing of at least 20% of randomly selected amplicons from each HRM pattern. Further, the Bartonella spp. ITS-positive samples were subjected to citrate synthase gene (gltA) real time PCR under the same conditions outlined above using the primers listed in Table 1. Only fleas that were positive by both ITS and gltA PCR were considered positive.
Table 1 Oligonucleotide primer pairs used in polymerase chain reaction amplifications for the detection of Bartonella spp., Rickettsia spp. and Coxiella burnetii in cat fleas (Ctenocephalides felis) from Jerusalem, Israel. Pathogen
Primer pairs
5′-primer sequences-3’
Target locus
Amplicon (bp)
Reference
Bartonella spp.
321 s 493as 443f 781r RpCS 877p RpCS 1258n
AGATGATGATCCCAAGCCTTCTGG TGAACCTCCGACCTCACGCTTATC GCTATGTCTGCATTCTATCA CCACCATGAGCTGGTCCCC GGGGGCCTGCTCACGGCGG ATTGCAAAAAGTACAGTGAACA
16S–23S (ITS)
208
Maggi and Breitschwerdt, 2005
Citrate synthase (gltA)
340
Citrate synthase (gltA)
381
Birtles and Raoult, 1996 Sofer et al., 2015 Regnery et al., 1991
Rr190.70p Rr190.602n Rr190.701n rfompbf rfompbr 120–2788 120–3599 Single tube nested Trans 1 Trans 2
ATGGCGAATATTTCTCCAAAA AGTGCAGCATTCGCTCCCCCT GTTCCGTTAATGGCAGCATCT GACAATTAATATCGGTGACGG TGCATCAGCATTACCGCTTGC AAACAATAATCAAGGTACTGT TACTTCCGGTTACAGCAAAGT
OmpA
532
Regnery et al., 1991
120-kDa (ompB)
632 540
Fournier et al., 1998 Márquez et al., 2002
ompB
820
Roux and Raoult, 2000
261 F 463 R
GAGCGAACCATTGGTATCG CTTTAACAGCGCTTGAACGT
Rickettsia spp.
Coxiella burnetii
IS1111 gene TATGTATCCACC GTAGCCAGTC CCCAACAACACCTCCTTATTC
Parisi et al., 2006 678 203
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
2.4. Conventional PCR detection of Rickettsia spp A PCR targeting a fragment of the citrate synthase gene (gltA) was run as initial screening for rickettsiae (Regnery et al., 1991). Samples positive by the initial screening PCR were then subjected to further amplification, targeting the outer membrane protein A gene (ompA), and 120-kDa genus common antigen (ompB) to allow speciation of spotted fever group (SFG) Rickettsia spp. (Márquez et al., 1998). Primers and PCR conditions were sourced from the literature (Table 1). Conventional PCR was performed using Syntezza PCR-Ready High Specificity (Syntezza Bioscience, Israel) PCR kit using a programmable conventional thermocycler (Biometra, Goettingen, Germany) as described previously (Kamani et al., 2013). Rickettsia felis DNA was used as positive control, while DNA of Ct. felis negative for R. felis was used as negative control. A non-template control (NTC) consisting of all the reagents but DNA was also included in every set of PCR reaction. PCR products were electrophoresed on 1.5% agarose gel stained with ethidium bromide and checked under ultraviolet (UV) light for the size of amplified fragments by comparison to a 100-bp DNA molecular weight marker. 2.5. Nested PCR amplification of Coxiella burnetii A single-tube nested PCR was employed for the detection of C. burnetii DNA in flea DNA samples (Table 1). Two successive amplifications were performed in a single tube using a thermal profile which selectively extended first the DNA locus targeted by the external, then the internal primer pair as described by Parisi et al. (2006). DNA of C. burnetii was used as a positive control. DNA of Ct. felis negative for C. burnetii by PCR and NTC were used as negative controls. Conventional PCR and DNA gel electrophoresis were performed as described above (Section 2.4). 2.6. Sequencing Positive PCR products were purified using a PCR purification kit (Exo-SAP, NEB; New England Biolabs, Inc., Ipswich, MA). Sequencing was performed at the Center for Genomic Technologies, Hebrew University of Jerusalem, Israel. The quality of the DNA sequences was evaluated, all ambiguities were cleaned and a phylogenetic tree was done using the MEGA software version 6 (Tamura et al., 2013). The clean sequences were compared for similarity to sequences deposited in GenBank, using the BLAST program hosted by the National Center for Biotechnology Information (NCBI), National Institutes of Health, Bethesda, MD (www.ncbi.nlm.nih.gov/BLAST). 2.7. Statistical analyses Data generated in the study were analyzed by the χ2 test using the statistical software package R (R Development Core Team, 2009). P values b 0.05 were considered significant. 3. RESULTS 3.1. Fleas and their hosting cats A total of 685 Ct. felis fleas were recovered from 328 sampled cats. From the 328 cats, 56% (185/328) were infested with fleas at time of sampling, with 1–17 fleas per cat with a mean of 3.7 fleas per cat. However, a maximum of 5 fleas per cat were randomly chosen for this study, thus a total of 467 fleas were sexed [91 (19.5%) males, 376 (80.5%) females] and further processed for DNA extraction. Fleas were collected from cats of all ages and both sexes. Fifty two (28.1%) of the cats were between 0–6 months old (“kittens”), 47 (25.4%) were 7–12 months old (“juveniles”) and 86 (46.5%) were older than 12 months (“adults”). One hundred fifty five (47.3%) were males and 173 (52.7%) females. Of the female cats sampled, 36
3
(20.8%) were pregnant. Although infested with fleas, 162 (87.6%) of the cats seemed apparently healthy, while 23 (12.4%) were manifesting one or more signs of illness. 3.2. Bartonella DNA in cat fleas Bartonella DNA was detected and confirmed in 156 (33.4%) individual fleas collected from 91 (49.2%) cats. All confirmed positive samples were grouped according to their ITS-HRM curves into three groups, resulting in a total prevalence per Bartonella spp. of: 24.0% (112/467) B. clarridgeiae, 6.2% (29/467) B. henselae and 3.2% (15/467) B. koehlerae (Table 2). Twenty eight representative ITS amplicons for B. clarridgeiae group, 11 for B. henselae group and 6 for B. koehlerae group were randomly selected and sequenced. Sequences gave 100% identity to their respective species in the GenBank (accession numbers: B. henselae HG969191.1; B. clarridgeiae FN645454.1; B. koehlerae FJ832087.1) confirming the validity of the ITS-HRM grouping. To further validate the ITS-HRM grouping, 5 each of the gltA amplicons from B. clarridgeiae, and B. henselae and 2 from B. koehlerae groups were sequenced. The gltA sequences gave 100% identity to their respective species in the GenBank (accession numbers: B. henselae HG965802.1; B. clarridgeiae FN645454.1; B. koehlerae AF176091.1), thus, confirming the result of the ITS screening (Fig. 1). The gltA sequences obtained in the study were deposited under accession numbers KU947998-KU948000, KU948003-KU948005, KU948008 and KU948009. Thirty five % (133/376) of the female fleas and 25.3% (23/91) of the male fleas were Bartonella DNA positive (Table 2). Bartonella clarridgeiae was the most common Bartonella spp. in both flea sexes, followed by B. henselae and B. koehlerae (Table 2; all P b 0.0001). However, no significant association was determined between the flea sex and the Bartonella infection status of the flea (P N 0.05), nor differences were observed in the distribution of each Bartonella sp. between the flea sexes (all P N 0.05). Fleas collected from both cat sexes, all cats' age groups, both health status and reproductive status were positive for Bartonella DNA (Table 3 and Supplementary Table 1). Nevertheless, no significant associations were observed between cats' sex, age groups or the reproductive status and the hosting status of Bartonella-positive fleas (all p N 0.05). Conversely, there was a significant association between the health status of the infested cats and the presence of Bartonellapositive fleas (Table 3). Accordingly, a higher percentage of Bartonellapositive fleas (65.2%; 15/23) were removed from sick cats than the percentage obtained from apparently healthy cats (42.6%; 69/162). Cats hosting individual fleas infected with different Bartonella spp. were determined in 11 instances. Five cats hosted fleas containing B. clarridgeiae and B. henselae, 3 cats hosted fleas containing B. clarridgeiae and B. koehlerae and 2 cats hosted fleas containing B. henselae and B. koehlerae DNA. One cat hosted fleas containing the 3 species: B. clarridgeiae, B. henselae and B. koehlerae. The majority of the cats hosting fleas with several different Bartonella spp. DNA, were males (63.6%), apparently healthy (72.7%) and above 12 months old (54.5%). Nevertheless, the total proportion of apparently healthy cats (4.9%, 8/ 162) with multiple Bartonella spp.-positive fleas was not significantly different from the proportion of sick cats with multiple Bartonella spp.positive fleas (13.0%, 3/23) (P N 0.05). Similarly, there was no significant association between the cat's sex and the hosting of multiple Bartonella spp.-positive fleas (P N 0.05). 3.3. Prevalence of Rickettsia spp. DNA in cat fleas Only one of the 467 fleas (0.2%) was found positive for Rickettsia spp. DNA. The sample was positive for rickettsia gltA, ompA and ompB genes. Sequences from the amplicons for each of the different genes were 99% identical to R. felis (GenBank accession number gltA GQ329873; ompA KP318094; and ompB GQ385243).The positive sample #93D was from a flea collected from a 12 months old female cat that was apparently
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
4
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
Table 2 Prevalence of Bartonella spp. DNA in Ctenocephalides felis fleas collected from cats from the Jerusalem district, Israel. Flea's variables Flea sex Male Female Total
Number tested (%)
91 (19.5) 376 (80.5) 467
Number of Bartonella positive fleas (%)
23 (25.3) 133 (35.4) 156 (33.4)
healthy. It was negative for Bartonella spp. DNA. However, 3 other fleas (#93A, #93B and #93C) from the same cat were positive for B. clarridgeiae, B. koehlerae and B. henselae, respectively (Table 2). 3.4. Prevalence of Coxiella burnetii DNA in cat fleas All the 467 cat fleas were negative for C. burnetii targeting the IS1111 gene using the single tube nested PCR. 4. Discussion Fleas collected from all age and health-status categories of cats were positive for Bartonella DNA indicating a widespread prevalence of these bacteria in the study area. The prevalence of 33.41% (156 out of 467) Bartonella- DNA detected in cat fleas collected from stray cats in this study was lower than the prevalence of 50.4% in cat fleas from the nearby Palestinian territory found in another study (Nasereddin et al., 2014). However, the prevalence rates of B. clarridgeiae, B. henselae and B. koehlerae in cat fleas in this study and in the Palestinian study show a similar trend, in which B. clarridgeiae was the most prevalent (24.0% vs 46.7%) followed by B. henselae (6.2% vs 25%) and B. koehlerae (3.2% vs 3.1%). A potential explanation for the difference in the prevalence between the 2 studies could be the stringent criterion used for the determination of “Bartonella positive flea” in the present study (i.e. at least two positive loci). In a recent study conducted in a more confined stray cat population from Rishon Lezion in central Israel, a higher prevalence was detected with Bartonella DNA found in 75.6% of the Ct. felis fleas. Moreover, DNA of four different Bartonella species was identified in these fleas. B. clarridgeiae was detected in 38.9%, B. henselae in
Number of fleas positive (%) for B. clarridgeiae
B. henselae
B. koehlerae
18 (19.8) 94 (25.6) 112 (24.0)
3 (3.3) 26 (7.1) 29 (6.2)
2 (2.2) 13 (3.5) 15 (3.2)
χ2
P-value
22.9 96.8 119.0
b0.00001 b0.00001 b0.00001
26.7%, Bartonella elizabethae-like bacteria in 6.7%, and B. koehlerae in 1.1% of the fleas (Gutiérrez et al., 2015). These results, suggest that differences in the Bartonella spp. distribution can occur between different flea populations from nearby geographic regions. However, the dominance of B. clarridgeiae over the other Bartonella spp. is highlighted among all these flea populations. Similarly, other studies from other geographical regions have also reported B. clarridgeiae as the most prevalent spp. among Ct. felis fleas (Rolain et al., 2003; Kernif et al., 2011; Mokhtar and Tay, 2011). Since, B. henselae tend to be the dominant species circulating among cat populations globally (Boulouis et al., 2005), including Israel (Gutiérrez et al., 2013), the relationship between the Bartonella spp. (B. clarridgeiae, B. henselae), the cat flea (Ct. felis) and cats (Felis catus) needs to be further explored. In this study, we were able to demonstrate that individual fleas collected from the same hosting cat harbored different Bartonella spp. in 11 (3.6%) instances, with all possible combinations. This finding parallels the scenario of mixed infections in the cat population in Israel (Gutiérrez et al., 2013) or it may reflect the possibility that fleas fed previously on cats different from the ones on which they were found during the survey. It will be interesting to analyze the Bartonella community of individual fleas and the cat hosts using 454-pyrosequencing to determine if such co-infection occurs in an individual Ct. felis flea, as previously described in wild rodents and their associated fleas from Israel (Gutiérrez et al., 2014). In a previous study, a moderate correlation between feline Bartonella bacterial loads and their fleas was determined, when both were infected with the same Bartonella species (Gutiérrez et al., 2015). The same study also observed that Bartonella bacterial loads of fleas are positively affected by the presence of the bacteria in their feline host and attributed this to probable multiple
Fig. 1. Maximum-likelihood phylogenetic tree based on the partial gltA gene sequences (279 bp). Phylogenetic tree was constructed using the MEGA software version 5. Bootstrap replicates were performed to estimate the node reliability, and values were obtained from 1000 randomly selected samples of the aligned sequence data. The sequences obtained in this study are indicated with an asterisk (*). GenBank accession numbers are indicated in parentheses.
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
5
Table 3 Demographic factors of flea infested cats from the Jerusalem district, Israel and prevalence of Bartonella spp. DNA in their Ctenocephalides felis fleas. Cat's variables
Number infested (%)
Number of cats hosting Bartonella positive fleas (%)
χ2
P-value
1.93
Total number of fleas tested
Number of fleas out of the total fleas tested (and percentage) positive for B. clarridgeiae B. henselae B. koehlerae
0.16
262 205
37 (14.1) 33 (16.1)
12 (4.6) 8 (3.9)
7 (2.7) 6 (2.9)
19 (13.3) 12 (14.1) 39 (16.3)
8 (5.6) 3 (3.5) 9 (3.8)
3 (2.1) 3 (3.5) 7 (2.9)
Sex Male Female
89 (47.3) 96 (52.7)
49 (55.1) 42 (43.8)
Age group 0–6 months 7–12 months N12 months
52 (28.1) 47 (25.4) 86 (46.5)
26 (50) 18 (38.3) 47 (54.7)
3.27
0.195
143 85 239
Clinical status* Apparently healthy Sick
162 (87.6) 23 (12.4)
69 (42.6) 15 (65.2)
4.13
0.042
400 67
60 (15.0) 10 (14.9)
17 (4.3) 3 (4.5)
8 (2.0) 5 (7.5)
Reproductive status Pregnant Non-pregnant
21 (11.4) 75 (40.5)
7 (33.3) 34 (45.3)
0.54
0.464
32 173
6 (18.8) 21 (12.1)
1 (3.1) 7 (4.0)
1 (3.1) 5 (2.9)
*Excluding pregnancy.
acquisitions/accumulation by the fleas and/or multiplication events within the fleas. However, as in this study we did not test the fleas for blood meal feeding, neither the hosting cats for Bartonella, these associations could not be tested. The association of the clinical status of cats with the carriage of Bartonella-positive fleas is interesting (Table 3). Accordingly, a larger percentage of sick cats presented more positive fleas than the healthy cats. Most case controlled studies have shown that infection with Bartonella spp. usually does not cause disease in cats (Guptill, 2010). It is probable that concomitant diseases, other than bartonelloses, compromise the immune state of the cats and therefore increase their vulnerability to Bartonella infection and potentially their flea infection status. The prevalence of R. felis DNA in this study was 0.2% (1/467). In a previous study 7.6% (6/79) flea pools were found positive for R. felis DNA in fleas collected from central Israel (Bauer et al., 2006), indicating that the single flea prevalence in fleas from Israel is low. Higher prevalence was reported in fleas from France (8.1%), United Kingdom (6–12%) and Western Australia (33%) (Rolain et al., 2003; Kenny et al., 2003; Schloderer et al., 2006, respectively). The only R. felis-positive flea was negative for Bartonella DNA, despite the fact that other fleas collected from the same cat contained the DNA of three Bartonella spp. The lack of Bartonella DNA in this flea may be alluded to a similar observation of decreased species richness in R. felis-infected fleas made by Pornwiroon et al. (2007). The latter study suggested that this could be attributed to an enhanced survival strategy which competes against or blocks other potentially harmful infections in the flea. Human infections with C. burnetii have been reported in both rural and urban communities in Israel with varying clinical manifestations. In some of the human cases, epidemiological investigations failed to pinpoint the primary source of infection (Ergas et al., 2006; Ravid et al., 2008). Even though in two recent Israeli reports, cats were suggested as possible source of infection (Amitai et al., 2010; Rmeileh et al., 2015), which is in agreement with other reports (Marrie et al., 1988, Pinskey et al., 1991; Langley et al., 1998), albeit PCR analysis of feline samples were negative for C. burnetii (Amitai et al., 2010). The lack of detection of C. burnetii DNA in this study suggests that Ct. felis may not be actively involved in the epidemiology of this pathogen in the study area. Further surveillance studies targeting blood samples and parturient tissue/fluids of cats, dogs and their ecto-parasites for this organism are warranted. 5. Conclusions Three major zoonotic feline Bartonella species (B. clarridgeiae, B. henselae and B. koehlerae) were detected in a large percentage of cat
fleas from the Jerusalem district highlighting their potential public health hazard. The higher prevalence of B. clarridgeiae over the other Bartonella spp. contrasts the overall infection in the cat population from Israel. Thus, the relationships of the former species with the cat flea (Ct. felis) and the cat need to be further investigated. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.vprsr.2016.04.001.
References Adams, J.R., Schmidtmann, E.T., Azad, A.F., 1990. Infection of colonized cat fleas, Ctenocephalides felis (Bouché), with a Rickettsia-like microorganism. Am. J. Trop. Med. Hyg. 43, 400–409. Amitai, Z., Bromberg, M., Bernstein, M., Raveh, D., Keysary, A., David, D., Pitlik, S., Swerdlow, D., Massung, R., Rzotkiewicz, S., Halutz, O., Shohat, T., 2010. A large Q fever outbreak in an urban school in central Israel. Clin. Infect. Dis. 50, 1433–1438. Avidor, B., Graidy, M., Efrat, G., Leibowitz, C., Shapira, G., Schattner, A., Zimhony, O., Giladi, M., 2004. Bartonella koehlerae, a new cat-associated agent of culture-negative human endocarditis. J. Clin. Microbiol. 42, 3462–3468. Azad, A.F., Sacci Jr., J.B., Nelson, W.M., Dasch, G.A., Schmidtmann, E.T., Carl, M., 1992. Genetic characterization and transovarial transmission of a typhus-like Rickettsia found in cat fleas. Proc. Natl. Acad. Sci. U. S. A. 89, 43–46. Baca, O., Paretsky, D., 1983. Q fever and Coxiella burnetii: a model for host parasite interactions. Microbiol. Rev. 47, 127–149. Bauer, O., Baneth, G., Eshkol, T., Shaw, E.S., Harrus, S., 2006. Polygenic detection of Rickettsia felis in cat fleas (Ctenocephalides felis) from Israel. Am. J. Trop. Med. Hyg. 74, 444–448. Birtles, R., Raoult, D., 1996. Comparison of partial citrate synthase gene (gltA) sequences for phylogenetic analysis of Bartonella species. Int. J. Syst. Bacteriol. 46, 891–897. Bitam, I., Dittmar, K., Parola, P., Whiting, M.F., Raoult, D., 2010. Fleas and flea-borne diseases. Int. J. Infect. Dis. 14, e667–e676. Boulouis, H.J., Chang, C.C., Henn, J.B., Kasten, R.W., Chomel, B.B., 2005. Factors associated with the rapid emergence of zoonotic Bartonella infections. Vet. Res. 36, 383–410. Chomel, B., 2015. Role of cats as reservoirs of vector borne pathogens of humans. In: Beugnet, F., Halos, L. (Eds.), Parasitoses and vector borne diseases of cats. Merial, Lyon, pp. 339–350. Chomel, B.B., Kasten, R.W., Floyd-Hawkins, K., Chi, B., Yamamoto, K., Roberts-Wilson, J., Gurfield, A.N., Abbott, C., Pedersen, N.C., Koehler, J.E., 1996. Experimental transmission of Bartonella henselae by the cat flea. J. Clin. Microbiol. 34, 1952–1956. Development Core Team, R., 2009. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Doosti, A., Arshi, A., Sadeghi, M., 2014. Investigation of Coxiella burnetii in Iranian camels comparative clinical pathology. 23, 43–46. Droz, S., Chi, B., Horn, E., Steigerwalt, A.G., Whitney, A.M., Brenner, D.J., 1999. Bartonella koehlerae sp. nov., isolated from cats. J. Clin. Microbiol. 37, 1117–1122. Ergas, D., Keysari, A., Edelstein, V., Sthoeger, Z.M., 2006. Acute Q fever in Israel: clinical and laboratory study of 100 hospitalized patients. Isr. Med. Assoc. J. 8, 337–341. Finkelstein, J.L., Brown, T.P., O'Reilly, K.L., Wedincamp Jr., J., Foil, L.D., 2002. Studies on the growth of Bartonella henselae in the cat flea (Siphonaptera: Pulicidae). J. Med. Entomol. 39, 915–919. Fournier, P.E., Roux, V., Raoult, D., 1998. Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int. J. Syst. Bacteriol. 48, 839–849. Fournier, P.E., Lelievre, H., Eykyn, S., Mainardi, J., Marrie, T., Bruneel, F., et al., 2001. Epidemiologic and clinical characteristics of Bartonella quintana and Bartonella henselae endocarditis: a study of 48 patients. Medicine (Baltimore) 80, 245–251.
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001
6
J. Kamani et al. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx
Guptill, L., 2010. Feline bartonellosis. Veterinary Clinics North American Small Animal Practice 40, 1073–1090. Gutiérrez, R., Morick, D., Gross, I., Winkler, R., Abdeen, Z., Harrus, S., 2013. Bartonellae in domestic and stray cats from Israel: comparison of bacterial cultures and highresolution melt real-time PCR as diagnostic methods. Vector Borne Zoonotic Dis. 13, 2–8. Gutiérrez, R., Morick, D., Cohen, C., Hawlena, H., Harrus, S., 2014. The effect of ecological and temporal factors on the composition of Bartonella infection in rodents and their fleas. Int. Soc. Microbial Ecol. J. 8, 1598–1608. Gutiérrez, R., Nachum-Biala, Y., Harrus, S., 2015. Relationship between the presence of Bartonella species and bacterial loads in cats and cat fleas (Ctenocephalides felis) under natural conditions. Appl. Environ. Microbiol. 81, 5613–5621. Ilan, B., Eyal, M., Mercedes, N.M., Ferran, S., Ilan, B., 2010. First detection of human infection with Rickettsia felis in Israel. Am. J. Med. Sci. 340, 343. Kamani, J., Baneth, G., Mumcuoglu, K.Y., Waziri, N.E., Eyal, O., Guthmann, Y., Harrus, S., 2013. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria. PLoS Negl. Trop. Dis. 7, e2108. Kazár, J., 1999. Q fever current concept. In: Raoult, D., Brouqui, P. (Eds.), Rickettsiae and Rrickettsial Diseases at the Turn of the Third Millennium. Elsevier, Paris, pp. 304–319. Kenny, M.J., Birtles, R.J., Day, M.J., Shaw, S.E., 2003. Rickettsia felis in the United Kingdom. Emerg. Infect. Dis. 9, 1023–1024. Kernif, T., Parola, P., Davoust, B., Plaire, L., Cabre, O., Raoult, D., Rolain, J.M., 2011. Bartonella clarridgeiae in fleas, Tahiti, French Polynesia. Emerg. Infect. Dis. 17, 1773–1775. Lang, G.H., 1990. Coxiellosis (Q fever) in animals. In: Marrie, T.J. (Ed.), Q Ffever: the Disease vol. 1. CRC press, Boca Raton. Langley, J.M., Marrie, T.J., Covert, A., Waag, D.M., Williams, J.C., 1998. Poker players' pneumonia: an urban outbreak of Q fever following exposure to a parturient cat. N. Engl. J. Med. 319, 354–356. Lewis, R.E., 1967. The fleas (Siphonaptera) of Egypt. An illustrated and annotated key. J. Parasitol. 3, 863–885. Loftis, A.D., Reeves, W.K., Szumlas, D.E., Abbassy, M.M., Helmy, I.M., Moriarity, J.R., Dasch, G.A., 2006. Rickettsial agents in Egyptian ticks collected from domestic animals. Exp. Appl. Acarol. 40, 67–81. Maggi, R.G., Breitschwerdt, E.B., 2005. Potential limitations of the 16S-23S rRNA intergenic region for molecular detection of Bartonella species. J. Clin. Microbiol. 43, 1171–1176. Márquez, F.J., Muniain, M., Soriguer, R., Izquierdo, G., Rodriguez-Bano, J., Borobio, M., 1998. Genotypic identification of an undescribed spotted fever group rickettsia in Ixodes ricinus from southwestern Spain. Am. J. Trop. Med. Hyg. 58, 570–577. Márquez, F.J., Muniain, M.A., Perez, J.M., Pachon, J., 2002. Presence of Rickettsia felis in the cat flea from southwestern Europe. Emerg. Infect. Dis. 8, 89–91. Marrie, T.J., MacDonald, A., Durant, H., Yates, L., McCormick, L., 1988. An outbreak of Q fever probably due to contact with a parturient cat. Chest 93, 98–103. Mediannikov, O., Socolovschi1, C., Edouard, S., Fenollar, F., Mouffok, N., Bassene, H., Diatta, G., Tall, A., Niangaly, H., Doumbo, O., Lekana-Douki, J.B., Znazen, A., Sarih, M., Ratmanov, P., Richet, H., Ndiath, M.O., Sokhna, C., Parola, P., Raoult., D., 2013. Common epidemiology of Rickettsia felis infection and malaria, Africa. Emerg. Infect. Dis. 19, 1775–1783.
Mokhtar, A.S., Tay, S.T., 2011. Molecular detection of Rickettsia felis, Bartonella henselae, and B. clarridgeiae in fleas from domestic dogs and cats in Malaysia. Am. J. Trop. Med. Hyg. 85, 931–933. Nasereddin, A., Risheq, A., Harrus, S., Azmi, K., Ereqat, S., Baneth, G., Salant, H., Mumcuoglu, K.Y., Abdeen, Z., 2014. Bartonella species in fleas from Palestinian territories: prevalence and genetic diversity. J. Vector Ecol. 39, 261–270. Norlander, L., 2000. Q fever epidemiology and pathogenesis. Microbes Infect. 2, 417–424. Parisi, A., Fraccalvieri, R., Cafiero, M., Miccolupo, A., Padalino, I., Montagna, C., Capuano, F., Sottili, R., 2006. Diagnosis of Coxiella burnetii related abortion in Italian domestic ruminants using single-tube nested PCR. Vet. Microbiol. 118, 101–106. Pinskey, R.L., Fishbein, D.B., Greene, C.R., Geinshemer, K.F., 1991. An outbreak of cat-associated Q fever in the United States. J. Infect. Dis. 164, 202–204. Pornwiroon, W., Kearney, M.T., Husseneder, C., Foil, L.D., Macaluso, K.R., 2007. Comparative microbiota of Rickettsia felis-uninfected and -infected colonized cat fleas, Ctenocephalides felis. ISME J. 1, 394–402. Raoult, D., La Scola, B., Enea, M., Fournier, P.E., Roux, V., Fenollar, F., et al., 2001. A fleaassociated Rickettsia pathogenic for humans. Emerg. Infect. Dis. 7, 73–81. Ravid, S., Shahar, E., Genizi, J., Schahor, Y., Kassis, I., 2008. Acute Q fever in children presenting with encephalitis. Pediatr. Neurol. 38, 44–46. Regnery, R.L., Spruill, C.L., Plikaytis, D., 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 73, 1576–1589. Rmeileh, A.A., Khoury, T., Meir, K., Drori, A., Shalit, M., Benenson, S., Elinav, H., 2015. Familial Q fever clustering with variable manifestations imitating infectious and autoimmune disease. Clin. Microbiol. Infect. 21, 459–463. Rolain, J.M., Franc, M., Davoust, B., Raoult, D., 2003. Molecular detection of Bartonella quintana, B. koehlerae, B. henselae, B. clarridgeiae, Rickettsia felis, and Wolbachia pipientis in cat fleas, France. Emerg. Infect. Dis. 9, 338–342. Roux, V., Raoult, D., 2000. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer membrane protein rompB (ompB). Int. J. Syst. Evol. Microbiol. 50, 1449–1455. Rust, M.K., Dryden, M.W., 1997. The biology, ecology, and management of the cat flea. Annu. Rev. Entomol. 42, 451–473. Schloderer, D., Owen, H., Clark, P., John Stenos, J., Fenwick, S.G., 2006. Rickettsia felis in fleas, Western Australia. Emerg. Infect. Dis. 12, 841–843. Schriefer, M.E., Sacci Jr., J.B., Dumler, J.S., Bullen, M.G., Azad, A.F., 1994. Identification of a novel rickettsial infection in a patient diagnosed with murine typhus. J. Clin. Microbiol. 32, 949–954. Sofer, S., Gutiérrez, R., Morick, D., Mumcuoglu, K.Y., Harrus, S., 2015. Molecular detection of zoonotic bartonellae (B. henselae, B. elizabethae and B. rochalimae) in fleas collected from dogs in Israel. Med. Vet. Entomol. 29, 344–348. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tsai, Y., Lin, C.C., Chomel, B.B., Chuang, S.T., Tsai, K.H., Wu, W.J., Huang, C.G., Yu, J.C., Sung, M.H., Kass, P.H., Chang, C.C., 2011. Bartonella infection in shelter cats and dogs and their ectoparasites. Vector Borne Zoonotic Dis. 11, 1023–1030. Zavala-Velázquez, J.E., Ruíz-Sosa, J.A., Sánchez-Elias, R.A., Becerra-Carmona, G., Walker, D.H., 2000. Rickettsia felis rickettsiosis in Yucatán. Lancet 356, 1079–1080.
Please cite this article as: Kamani, J., et al., Molecular screening of Ctenocephalides felis fleas collected from stray cats in the Jerusalem District, Israel, for Bartonella spp..., Veterinary Parasitology: Regional Studies and Reports (2016), http://dx.doi.org/10.1016/j.vprsr.2016.04.001