Isolation and characterisation of two cDNAs encoding transglutaminase from Atlantic cod (Gadus morhua)

Fish & Shellfish Immunology 36 (2014) 276e283

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Isolation and characterisation of two cDNAs encoding transglutaminase from Atlantic cod (Gadus morhua) Clemens Furnes b, *, 3, Øyvind Kileng c,1, 3, Ingvill Jensen c, 2, Pralav Karki b, Lutz Eichacker b, Børre Robertsen a a b c

Norwegian College of Fishery Science, University of Tromsø, Breivika, N-9037 Tromsø, Norway Centre for Organelle Research, Faculty of Science and Technology, University of Stavanger, 4021 Stavanger, Norway Nofima, Box 6122, N-9291 Tromsø, Norway

a r t i c l e i n f o

a b s t r a c t

Article history: Received 9 October 2013 Received in revised form 19 November 2013 Accepted 22 November 2013 Available online 3 December 2013

Two cDNAs encoding transglutaminase (TG) were identified in a subtractive cDNA library prepared from the head kidney of poly I:C stimulated Atlantic cod (Gadus morhua). Full-length TG-1 and TG-2 cDNA were cloned from the head kidney by a reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The deduced amino acid (aa) sequence for TG-1 was 695 aa with an estimated molecular mass of 78.3 kDa, while TG-2 was a 698 aa protein with an estimated molecular mass of 78.8 kDa. The two proteins were named TG-1 and TG-2 and both possess transglutaminase/protease-like homologous domains (TGc) and full conservation of amino acids cysteine, histidine, and aspartate residues that form the catalytic triad. Sequence analysis showed high similarity (93.1%) with Alaska pollock TG, and the TGs were grouped together with TGs from chum salmon, Japanese flounder, Nile tilapia, and red sea bream in addition to Alaska pollock in phylogenetic analysis. Interestingly, they showed different tissue distribution with highest constitutive expression in reproductive and immunological organs, indicating important roles in these organs. Furthermore, the up-regulation of TG-1 and TG-2 in head kidney after stimulating Atlantic cod with poly I:C suggested a role of TGs in immune response in Atlantic cod. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Atlantic cod Transglutaminase Antiviral activity

1. Introduction Transglutaminases (TGs) are a family of enzymes that catalyse cross-linking of proteins through the formation of covalent bonds between lysine and glutamine residues of different polypeptides [1]. TGs also catalyse the conjugation of polyamines to proteins [2]. The isopeptide bonds created by TGs are highly resistant to proteolysis and cannot be broken [3]. Sequence alignments of the transglutaminase family members have shown they can be divided into three regions where the middle part is highly similar while the N- and C-terminal parts exhibit protein variations [1,4,5]. The middle region that possesses a * Corresponding author. Tel.: þ47 51831867; fax: þ47 51831750. E-mail addresses: [email protected] (C. Furnes), oyvind.kileng@ europharma.no (Ø. Kileng), [email protected] (I. Jensen), [email protected] (P. Karki), [email protected] (L. Eichacker), [email protected] (B. Robertsen). 1 Present address: Europharma AS, Lufthavnveien 11, N-8370 Leknes, Norway. 2 Present address: Norwegian College of Fishery Science, University of Tromsø, Breivika, N-9037 Tromsø, Norway. 3 These authors contributed equally to the work. 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.11.014

transglutaminase/protease-like domain (TGc) is well conserved, and motifs around the three amino acids cysteine, histidine, and aspartate that constitute the catalytic triad are especially well conserved [6]. Interestingly, transglutaminases and papain-like thiol proteases have the same structural core fold, which suggests that animal transglutaminases have evolved from ancestral proteases [5,7]. Most TGs are calcium dependent, with the exception of the bacterial-encoded TG. Enzyme activity is regulated by just the presence of calcium ions or by calcium ions binding directly to the enzyme [4,8]. The TG activity and subcellular localisation are also regulated by post-translational modifications such as proteolytic cleavage, phosphorylation, and fatty acid acylation [9]. The localisation of TGs can be extracellular and/or intracellular [5]. Distribution inside the cell can be cytoplasmic, nuclear, mitochondrial, or associated with membranes or cytoskeletal proteins [10]. TGs are involved in various biochemical processes and crosslinking reactions such as in blood clot formation, skin formation, angiogenesis, embryogenesis, and apoptosis [3,5,11,12]. They have clinical importance because they have been implicated in neurodegenerative diseases, tissue fibrosis, cancers, celiac diseases, etc. [5,11,13e16].

C. Furnes et al. / Fish & Shellfish Immunology 36 (2014) 276e283

In addition to the biochemical activity and physiological role of TGs, immunological activity has also been examined [17]. TGs play an essential role in the shrimp immune response to both bacterial and viral infection [17e20]. Furthermore, in crustaceans, TG is released from hemocytes by foreign particle stimuli, resulting in the formation of a blood clot [21]. A mechanism has been proposed where microbes are targeted by TG activity, leading to formation of small aggregates followed by phagocytic sequestration of the clot, which prevents bacterial proliferation [22]. TGs have been found in a diverse range of organisms such as bacteria, crustaceans, insects, fish, plants, and mammals [3,8,23]. In mammals, nine isozymes of TG have been characterised. TG genes from fish, such as red sea bream, chum salmon, common carp (AAL02240.1), Japanese medaka (NP_001098300.1), goldfish (AB198723.1), Nile tilapia (NP_001266408.1), Japanese flounder (E08624.1), Alaska pollock (E08616.1), and zebrafish (XP_694950.3), have been cloned [24,25]. No cloning of TG from Atlantic cod has been reported, but existence of a TG involved in egg hardening in Atlantic cod has been suggested [26]. In this report, we describe the cloning of two TG genes from Atlantic cod where the sequences appear to be significantly similar, suggesting that these TGs have evolved from a common ancestor gene. The cDNAs were initially cloned from a library from Atlantic cod treated with polyinosinic:polycytidylic acid (poly I:C). Poly I:C is a synthetic polymer, which resembles the RNA of infectious viruses that is used to stimulate the production of interferon by the immune system [27e29]. In fish, TGs have been studied in relation to egg maturation, optic nerve generation and gelation of actomyosin, and application to food processing, but their roles in immunity have not been addressed [12,24,25,30]. Our results, from SSH and real-time RT-PCR supports a possible role of TG in antiviral response in cod.

277

2.4. Bioinformatics Sequences were analysed using the Finch TV Chromatogram viewer program (Geospiza, Inc., Seattle, WA). Blast analysis of sequences was performed using software from the National Center for Biotechnology Information (NCBI) website of the National Library of Medicine (NLM) at the National Institutes of Health (NIH). Molecular mass was calculated by the ProtParam program (http:// au.expasy.org/tools/protparam.html). Sequence alignments were performed using CLUSTALW 1.8 program. Positions of domains were determined using the Simple Modular Architecture Tool (SMART) (http://smart.embl-heidelberg.de/). The percent amino acid identity between sequences was calculated using the SIM Alignment tool for protein sequences (http://ca.expasy.org/tools/ sim-prot.html). The phylogenetic tree was constructed from multiple sequence alignments using the Neighbour-Joining method in the MEGA4 software package [32] Full Text via CrossRefView Record in Scopus. The reliability of the tree topology was tested using bootstrap resampling (2000 replicates). The 3-dimensional models of TG-1 and TG-2 were predicted by I-TASSER server (http:// zhanglab.ccmb.med.umich.edu/I-TASSER/) [32]. 2.5. Stimulation of Atlantic cod with poly I:C

2. Materials and methods

Atlantic cod of 50 g were held at the Aquaculture Research station (Tromsø, Norway) and kept in a flat-bottomed circular tank supplied with fresh seawater at 18  C. Prior to treatment fish were anaesthetized with metacaine (75 mg/l, Norsk medisinaldepot) and 150 ml of poly I:C (2 mg/ml in PBS, Amersham Pharmacia Biotec, Uppsala, Sweden) was injected intramuscularly. Brain and head kidney from 6 fishes were harvested at twelve time points from 0 h to day 25 post stimulation and stored in RNA-later (Ambion, Austin, TX, USA) at 20  C. To study organ distribution of TG genes, organs from untreated cod were sampled and stored on RNA-later (Ambion).

2.1. Sample collection

2.6. Quantitative reverse transcriptase PCR analysis

Head kidney sample collection for cDNA library construction after injection of Atlantic cod with poly I:C was performed as previously described [31].

Quantitative reverse transcriptase PCR (RT-qPCR) was used to analyse the relative expression of the TG genes after poly I:C injection of cod as described. Total RNA from all organs including head kidney and brain samples from poly I:C stimulated cod was extracted using the E.Z.N.A Total RNA I kit (Omega Bio-tek) according to manufacturer’s instructions. The RNA samples were treated with DNase using TurboDNA-freeÔ (Ambion). For reverse transcription, the High Capacity RNA-to-cDNA Master Mix (Applied Biosystems, Foster City, CA, USA) were used according to the manufacturer’s instructions. The PCR primers used to assay gene expression by RT-qPCR are showed in Table 1. RT-qPCR was performed in 20 ml reactions using an ABI Prism 7500 sequence detector (Applied Biosystems) and SYBR Green PCR Master Mix (Applied Biosystems). All samples were analysed in duplicate and 18S rRNA was used as endogenous control for normalisation. Relative quantification of TG-1 and -2 gene expression was performed as described previously [33].

2.2. cDNA library construction A subtraction suppressive library (SSH) from head kidney was constructed using the PCR-Select cDNA subtraction kit (Clontech Laboratories, Inc., Mountain View, CA) as previously described [31]. Following hybridisation and subtraction, the cDNA was cloned directly into a pCRÒ 4-TOPOÒ vector in the TA cloning kit (Invitrogen, Carlsbad, CA), transformed into DH5alpha-competent Escherichia coli, and plated onto LB agar with 100 mg/mL ampicillin. Single bacterial colonies were grown overnight in LB with ampicillin. Plasmids were isolated using the plasmid miniprep kit (Omega Bio-tek, Norcross, GA). 2.3. Construction of 50 - and 30 -RACE cDNA libraries The 50 - and 30 -rapid amplification of cDNA ends (RACE) libraries were constructed using the SMARTÔ RACE amplification kit (Clontech) according to the manufacturer’s protocol. The bands for both the 50 - and 30 -RACE amplifications were excised, purified, and ligated into the pCRÒ 4-TOPOÒ vector (Invitrogen). At least 10 clones from both the 50 - and 30 -RACE libraries were sequenced using both M13 forward and M13 reverse primers (Invitrogen).

Table 1 The sequence of Real time primers used in this study. Name

Sequence (50 e30 )

Transglutaminase 1-F Transglutaminase 1-R

CTGCTGTCCGTCTCCCTCTG GACCCTGGCTTCCACATCAT GTAAAACGACGGCCAG CAGGAAACAGCTATGAC CAGTCAGTCAGTCAGTCAGT

Transglutaminase 2-F Transglutaminase 2-R

278

C. Furnes et al. / Fish & Shellfish Immunology 36 (2014) 276e283

Fig. 1. Sequence and domain structure of Atlantic cod TG-1. (A) Nucleotide sequence and deduced amino acid sequence of the TG-1 gene. Both nucleotides and amino acids are numbered on the right side of each line, respectively. The initiation ATG and termination TGA codons are underlined and in bold. The asterisk indicates the termination codon. The TGc domain (transglutaminase/protease-like homologous) is shown in red letters (position 264e355). Three catalytic sites (Cys-272, His-329, Glu-352) are shown in bold and underlined. Residues of potential Ca2þ-binding sites are marked in bold italics (Asn-393, Asp-395, Glu-441, and Glu-446). (B) The domain structure of TG-1. The different domains are represented by shapes with specific colours taken from SMART. Shown is the schematic diagram of Transglut_N (amino acids 3e118), TGc (amino acids 264e355), Transglut_C (amino acids 471e575), and Transglut_C (amino acids 583e681) of the TG-1 protein. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

C. Furnes et al. / Fish & Shellfish Immunology 36 (2014) 276e283

279

Fig. 1. (continued).

3. GenBank accession numbers

4.3. Sequence comparison of cod TGs with other TGs

The accession numbers for the Atlantic cod TG-1 and TG-2 cDNA identified herein are HQ540290 and HQ540291, respectively.

Sequence comparison and phylogenetic analysis revealed that cod TGs are separate from the mammalian and crustacean TGs but can be grouped together with some TG sequences from fish such as chum salmon, Japanese flounder, Nile tilapia, red sea bream, and Alaska pollock (Fig. 5). Sequence analysis and phylogenetic analysis showed high similarity (above 90% identity) of both TG-1 and TG-2 with TG from Alaska pollock and around 55% identity with the TGs from chum salmon, Japanese flounder, Nile tilapia, and red sea bream. Furthermore, phylogenetic analysis showed TG-2 is more similar than TG-1 to TG from Alaska pollock.

4. Results 4.1. Cloning of two Atlantic cod TG genes Suppression subtractive hybridisation (SSH) was used to identify poly I:C induced gene transcripts from cod head kidney. Sequence analysis of the poly I:C head kidney library revealed two clones with significant homology to the red sea bream TG (Pagrus major). Two full-length cDNAs were obtained by RACE, cloned from head kidney cDNA, and named TG-1 cDNA and TG-2 cDNA. The full-length sequence of TG-1 cDNA contains 2088 base pairs (bp) encoding a putative protein of 695 amino acids with an estimated molecular mass of 78.3 kDa. The TG-2 cDNA sequence contains 2097 bp encoding a putative 698 amino acid protein of 78.8 kDa. The TG-1 cDNA and TG-2 cDNA open reading frame and their associated annotations are shown in Figs. 1 and 2, respectively. 4.2. Annotation of Atlantic cod TGs The SMART program predicts domain organisation of TG-1 and TG-2 in the following order: Transglut_N domain, TGc domain, and two consecutive Transglut_C domains. The catalytic core domain (TGc domain) is known to have TG activity. Multiple alignment of the TGc domain is shown in Fig. 3. The three amino acids cysteine, histidine, and aspartate comprising the catalytic site were present in this domain, and the region surrounding the catalytic sites were highly conserved compared to other TGs. The amino acid sequence of TG-1 or TG-2 did not contain a signal sequence, a nuclear localisation signal, or a transmembrane coding region, but interestingly conservation of four amino acids (Asn-392, Asp-394, Glu441, and Glu-446 in TG-1 and Asn-391, Asp-393, Glu-440, and Glu445 in TG-2) probably involved in Ca2þ binding was detected. The overall structures of TG-1 and TG-2 predicted by I-Tasser are shown in Fig. 4. They are compared with solved three dimensional structure of transglutaminase from red sea bream and resemble each other and consist of the four distinct and sequential domains: the bsandwich, core, barrel 1, and barrel 2. The secondary structures of b-sandwich, barrel 1, and barrel 2 are predominately b-sheet, whereas core domain, in which the active site is located, consists of a mixture of a-helices and b-sheets.

4.4. Expression properties of TG-1 and TG-2 The organ distribution of TGs was analysed relative to the expression levels in heart tissue using RT-qPCR. Transcript levels were lowest for both genes in heart samples and for comparative purposes these were used as calibrators. TG-1 was detected in all organs studied and constitutive levels were most prominent in head kidney (186 fold compared to heart, Fig. 6). TG-1 mRNA levels were also moderately stronger in spleen and ovaries (8 and 14 fold, Fig. 6). In contrast, TG-2 mRNA was strongly expressed in spleen and liver (1000 and 2000 fold respectively), with moderate expression in head kidney and ovary (106 and 479 fold respectively, Fig. 6). To study transcription kinetics of the two TG genes, cod was injected intramuscularly with poly I:C and mRNA levels of TG-1 and -2 in brain and head kidney were measured at different time points for 25 days. Transcription of both genes was up-regulated rapidly in head kidney. TG-1 showed increased mRNA levels from 6 h post injection (hpi), peaked at day 1 (12 fold increase) and went back to constitutive levels at day 3 (Fig. 7(a)). Similar kinetics was observed in brain, but peak levels at day 1 were lower (3 fold induction). TG-2 peaked at 6 hpi (25 fold increase) in head kidney and transcript levels gradually decreased to constitutive levels at day 3 (Fig. 7(b)). In contrast, poly I:C did not induce any transcription of TG-2 in brain. Transcript levels remained at constitutive levels for both genes in head kidney and brain from day 9 to day 25 (results not shown). 5. Discussion The nucleotide sequence of cDNAs for Atlantic cod TG-1 and TG2 and the amino acid sequences were determined in the present

280

C. Furnes et al. / Fish & Shellfish Immunology 36 (2014) 276e283

Fig. 2. Sequence and domain structure of Atlantic cod TG-2. (A) Nucleotide sequence and deduced amino acid sequence of the TG-2 gene. Both nucleotides and amino acids are numbered on the right side of each line, respectively. The initiation ATG and termination TGA codons are underlined and in bold. The asterisk indicates the termination codon. The TGc domain (transglutaminase/protease-like homologous) is shown in red letters (position 263e354). Three catalytic sites (Cys-271, His-328, Glu-351) are shown in bold and underlined. Residues of potential Ca2þ-binding sites are marked in bold italics (Asn-391, Asp-393, Glu-440, and Glu-445). (B) The domain structure of TG-2. The different domains are represented by shapes with specific colours taken from SMART. Shown is the schematic diagram of Transglut_N (amino acids 3e118), TGc (amino acids 263e354), Transglut_C (amino acids 474e578), and Transglut_C (amino acids 586e684) of the TG-2 protein. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

C. Furnes et al. / Fish & Shellfish Immunology 36 (2014) 276e283

281

Fig. 2. (continued).

Fig. 3. Sequence alignment of Atlantic cod TG-1 and TG-2 protein TGc regions with TGs of selected mammals, fish, and crustaceans. Three amino acid residues, cysteine, histidine, and aspartate, comprising the catalytic triad are labelled in black, and the positions are indicated with solid triangles. The TG protein sequences were analysed by ClustalW. Identical (*) and similar ($ and ) residues identified by the ClustalW program are indicated. Abbreviations and GenBank accession numbers are as follows: Gadus morhua (Ac); human (Hs TG1), BAA34203.1; human (Hs TG-2), AAT79353.1; human (Hs TG-3), NP_003236.3; human (Hs TG-4), P49221; human (Hs TG-5), AAI22860.1; human (Hs TG-6), EAX10600.1; human (Hs XIII), NP_000120; rat (Rn XIII), CAA73104.1; mouse (Mm), AAH26422.1; dog (Cf), AAG13662.1; zebrafish (Dr), XP_694950.3; Alaska pollock (Tc), E08616.1; Japanese medaka (Ol), NP_001098300.1; red sea bream (Rs TG-2), P52181.1; common carp (Cc), AAL02240.1; Nile tilapia (On), NP_001266408.1; goldfish (Ca), AB198723.1; Japanese flounder (Po), E08624.1; chum salmon (Cs), BAA11633.1; starfish (Ap), BAB20439.1; common urchin (Cu), CAD28789.1; horshoe crab (Lp), 2012342A; black tiger shrimp (Pm TG-1), AAL78166.1; black tiger shrimp (Pm TG-2), AAV49005.1; signal crayfish (Pl), AAK69205.

study. The overall sequence homology was high when compared cod TG with other TGs. In particular, a catalytic core domain (TGc) comprising the putative active site of the enzymes was found to be highly similar among TGs that were compared. These TGc domains

are known to have transglutaminase activity in many proteins. Furthermore, both TGs showed the conservation of three amino acid residues, cysteine, histidine, and aspartate, comprising the catalytic triad. Interestingly, cod TGs lacks a signal sequence, a

Fig. 4. Predictions of the 3-dimensional structures of TG-1(left), TG-2 (middle) and red sea bream transglutaminase structure (right). The 3D-strucuture of the TG-1 and TG-2 proteins was predicted using the software program I-TASSER. A prediction with the highest C-score was chosen prior to editing and visualisation in swissPDBviewer 4.0. The structure is coloured according to the secondary structure motifs from the N-teminal (dark blue) to C-terminal (red) end of the sequence. From the aminoterminus, the four domains are the b-sandwich (blue), the core domain (pink), barrel 1 (green) and barrel 2 (yellow). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

C. Furnes et al. / Fish & Shellfish Immunology 36 (2014) 276e283 Tissue distribution

Rs TGase-2 On TGase-1

1

He ar t

Cc TGase-1

100

Ca TGase-1

100

Hs TGase-5

95

Hs TGase-3

100

Hs TGase-6

99

M

99

O va ry

Tc TGase-1

Hs TGase-2

Sp le en

100

AcTGase-2

10

Br ai n

Ac TGase-2

100

92

AcTGase-1

100

er

Ac TGase-1

1000

Li v

100

HK

Po TGase-1 Cs TGase-1

Relative expression

53

10000

G ill

91 100

us ce l

282

Fig. 6. Organ distribution of TG-1 and TG-2 by semi-quantitative RT-qPCR. Expression of each gene in different organs was analysed relative to transcript levels in heart muscle tissue normalised to housekeeping gene 18S, which were set to 1. Mean  SD (N ¼ 2).

Hs TGase-4

Pl TGase-1

100

Pm TGase-1 Lp TGase-1

80

Ap TGase-1 Cu TGase-1

100 100 100

Hs XIIIa Rn XIIIa Ol TGase-1

Dr TGase-1

99

Mm TGase-1

100 100 55

Hs TGase-1 Cf TGase-1

0.1

Fig. 5. Phylogenetic tree showing the relationships of TGs from Atlantic cod with the TG proteins of selected crustaceans, fish, and mammals. The tree was constructed from a ClustalW multiple alignment of the using the Neighbour-Joining method in the MEGA4 program. Bootstrap resampling (2000 replicates) was used to test the reliability of tree topology. Abbreviations and GenBank accession numbers are as follows: Gadus morhua (Ac); human (Hs TG-1), BAA34203.1; human (Hs TG-2), AAT79353.1; human (Hs TG-3), NP_003236.3; human (Hs TG-4), P49221; human (Hs TG-5), AAI22860.1; human (Hs TG-6), EAX10600.1; human (Hs XIII), NP_000120; rat (Rn XIII), CAA73104.1; mouse (Mm), AAH26422.1; dog (Cf), AAG13662.1; zebrafish (Dr), XP_694950.3; Alaska pollock (Tc), E08616.1; Japanese medaka (Ol), NP_001098300.1; red sea bream (Rs TG-2), P52181.1; common carp (Cc), AAL02240.1; Nile tilapia (On), NP_001266408.1; goldfish (Ca), AB198723.1; Japanese flounder (Po), E08624.1; chum salmon (Cs), BAA11633.1; starfish (Ap), BAB20439.1; common urchin (Cu), CAD28789.1; horshoe crab (Lp), 2012342A; black tiger shrimp (Pm TG-1), AAL78166.1; black tiger shrimp (Pm TG-2), AAV49005.1; signal crayfish (Pl), AAK69205.

transmembrane region, and a nuclear localisation signal, suggesting it may be a cytoplasmic protein. As suggested by a comparison of similar TG sequences from other species, several potential Ca2þ binding residues were identified, indicating it is a Ca2þ-binding protein and requires Ca2þ for activity. In general, the binding of calcium ions to the transglutaminase and exposure of the active site cysteine are essential for enzymatic activity [3]. The amino acids Asn-436, Asp-438, Glu485, and Glu-490 in humans are Ca2þ-binding sites in the enzyme and the corresponding amino acids in TG-1 are Asn-392, Asp-394, Glu-441, and Glu-446, and in TG-2 are Asn-391, Asp-393, Glu-440, and Glu-445. The four residues appear to be good candidates for Ca2þ-binding sites in the molecule. The evolutionary relationship between cod TGs compared to TGs form other species showed that cod TGs are separate from the mammalian TGs and can be grouped together with TG sequences from fish such as chum salmon, Japanese flounder, Nile tilapia, red sea bream, and Alaska pollock. Interestingly, TG-2 is grouped more

closely together with Alaska pollock TG than TG-1. These results support the existence of at least two isozymes in Atlantic cod, and that these TGs have evolved from a common ancestor gene. Both tissue distribution and expression kinetics revealed similarities and differences between the two TG genes. Both genes were expressed in all organs analysed and both had the highest expression in typical immune and reproductive organs. Transcript levels of TG-1 were most prominent in head kidney and moderate in spleen, indicative for an immunological role. The head kidney is an important immune organ in teleost fish with key regulatory functions like phagocytosis, antigen processing and immune memory [34]. Moderate increased levels in ovaries also indicate that this gene is involved in egg hardening as previously suggested [26]. TG-2 was expressed at similar levels in head kidney as TG-1, but transcript levels were significantly higher in liver, spleen and ovaries. The level of TG expression in head kidney and brain was examined after intramuscular injection of Atlantic cod with poly I:C. Both genes were transcriptional up-regulated in head kidney immediately after stimulation and mRNA levels returned to basic levels between day 2 and 3. The kinetics was somewhat different between the two genes. Most notably TG-2 responded stronger and peaked as soon as 6 h after stimulation, whereas TG-1 had lower peak levels and at a later time point (day 1). The latter gene was also induced in brain, but to a much lower extent than in head kidney.

A

AcTGase-1

16 14 Fold induction

100

Head kidney

12

Brain

10 8 6 4 2 0 0

6h

12h

D1

D2

D3

D5

D7

Timepoints

B

AcTGase-2

35 30 Fold induction

Pm TGase-2

98

Head kidney

25

Brain

20 15 10 5 0 0

6h

12h

D1

D2

D3

D5

D7

Timepoints

Fig. 7. Transcript levels of TG-1 (a) and TG-2 (b) in head kidney and brain of poly I:C injected Atlantic cod. Mean  SEM (N ¼ 6).

C. Furnes et al. / Fish & Shellfish Immunology 36 (2014) 276e283

Poly I:C was unable to induce any transcription of TG-2 in brain. These observations indicate that TG is involved in innate immune mechanisms, as poly I:C is known to mimic a viral infection both in vitro and in vivo, also in cod [31,35]. The constitutive levels of the genes were in addition significantly higher in immunological organs such as head kidney and spleen. The different constitutive levels and the transcription kinetics may also indicate that the proteins from the two genes have different properties, although they have very similar sequences. Except for TGs in crustaceans, no antiviral activity is so far reported for TGs [17,36]. However, TGs are present in genomes of most animals studied, and anti-bacterial activity is observed in distant species as humans and Drosophilia [22,37]. The antibacterial activity is related to clot-formation in human blood and insect hemolymph which results in sequestration of a variety of pathogens. TGs are thus one of the first effector proteins activated in the early innate immune response of an infection. Our data suggest that TGs can be added to the list of possible antiviral genes identified in cod. With the development of stable fish cell lines from cod, functional studies of the immune response and progress in disease control in Atlantic cod appear promising [38]. In summary, we isolated cDNA clones encoding TGs from an Atlantic cod (Gadus morhua) cDNA library prepared from the head kidney from poly I:C stimulated fish. There was an increased expression of TG-1 and TG-2, suggesting they are involved in the innate immune system. The specific role of TG-1 and TG-2 in the immune system will be examined in future studies. Acknowledgements This project was funded by the Research Council of Norway, project number 158952. References [1] Ichinose A, Bottenus RE, Davie EW. Structure of transglutaminases. J Biol Chem 1990;265(23):13411e4. [2] Lentini A, Abbruzzese A, Caraglia M, Marra M, Beninati S. Protein-polyamine conjugation by transglutaminase in cancer cell differentiation: review article. Amino Acids 2004;26(4):331e7. [3] Greenberg CS, Birckbichler PJ, Rice RH. Transglutaminases: multifunctional cross-linking enzymes that stabilize tissues. Faseb J 1991;5(15):3071e7. [4] Casadio R, Polverini E, Mariani P, Spinozzi F, Carsughi F, Fontana A, et al. The structural basis for the regulation of tissue transglutaminase by calcium ions. Eur J Biochem 1999;262(3):672e9. [5] Makarova KS, Aravind L, Koonin EV. A superfamily of archaeal, bacterial, and eukaryotic proteins homologous to animal transglutaminases. Protein Sci 1999;8(8):1714e9. [6] Yee VC, Pedersen LC, Le Trong I, Bishop PD, Stenkamp RE, Teller DC. Threedimensional structure of a transglutaminase: human blood coagulation factor XIII. Proc Natl Acad Sci U S A 1994;91(15):7296e300. [7] Pedersen LC, Yee VC, Bishop PD, Le Trong I, Teller DC, Stenkamp RE. Transglutaminase factor XIII uses proteinase-like catalytic triad to crosslink macromolecules. Protein Sci 1994;3(7):1131e5. [8] Serafini-Fracassini D, Del Duca S, Beninati S. Plant transglutaminases. Phytochemistry 1995;40(2):355e65. [9] Wang DS, Dickson DW, Malter JS. Tissue transglutaminase, protein crosslinking and Alzheimer’s disease: review and views. Int J Clin Exp Pathol 2008;1(1):5e18. [10] Park D, Choi SS, Ha KS. Transglutaminase 2: a multi-functional protein in multiple subcellular compartments. Amino Acids 2010;39(3):619e31. [11] Fesus L. Transglutaminase-catalyzed protein cross-linking in the molecular program of apoptosis and its relationship to neuronal processes. Cell Mol Neurobiol 1998;18(6):683e94. [12] Chang YS, Wang YW, Huang FL. Cross-linking of ZP2 and ZP3 by transglutaminase is required for the formation of the outer layer of fertilization envelope of carp egg. Mol Reprod Dev 2002;63(2):237e44.

283

[13] Dieterich W, Ehnis T, Bauer M, Donner P, Volta U, Riecken EO, et al. Identification of tissue transglutaminase as the autoantigen of celiac disease. Nat Med 1997;3(7):797e801. [14] Lesort M, Tucholski J, Miller ML, Johnson GV. Tissue transglutaminase: a possible role in neurodegenerative diseases. Prog Neurobiol 2000;61(5):439e 63. [15] Jeitner TM, Muma NA, Battaile KP, Cooper AJ. Transglutaminase activation in neurodegenerative diseases. Future Neurol 2009;4(4):449e67. [16] Birckbichler PJ, Orr GR, Conway E, Patterson Jr MK. Transglutaminase activity in normal and transformed cells. Cancer Res 1977;37(5):1340e4. [17] Maningas MB, Kondo H, Hirono I, Saito-Taki T, Aoki T. Essential function of transglutaminase and clotting protein in shrimp immunity. Mol Immunol 2008;45(5):1269e75. [18] Yeh MS, Liu CH, Hung CW, Cheng W. cDNA cloning, identification, tissue localisation, and transcription profile of a transglutaminase from white shrimp, Litopenaeus vannamei, after infection by Vibrio alginolyticus. Fish Shellfish Immunol 2009;27(6):748e56. [19] Prapavorarat, A., S. Pongsomboon, and A. Tassanakajon, Identification of genes expressed in response to yellow head virus infection in the black tiger shrimp, Penaeus monodon, by suppression subtractive hybridization. Dev Comp Immunol. 34(6): p. 611e617. [20] Liu YC, Li FH, Wang B, Dong B, Zhang QL, Luan W, et al. A transglutaminase from Chinese shrimp (Fenneropenaeus chinensis), full-length cDNA cloning, tissue localization and expression profile after challenge. Fish Shellfish Immunol 2007;22(5):576e88. [21] Hall M, Wang R, van Antwerpen R, Sottrup-Jensen L, Söderhäll K. The crayfish plasma clotting protein: a vitellogenin-related protein responsible for clot formation in crustacean blood. Proc Natl Acad Sci U S A 1999;96(5):1965e70. [22] Wang Z, Wilhelmsson C, Hyrsl P, Loof TG, Dobes P, Klupp M, et al. Pathogen entrapment by transglutaminaseea conserved early innate immune mechanism. PLoS Pathog 2010;6(2):e1000763. [23] Griffin M, Casadio R, Bergamini CM. Transglutaminases: nature’s biological glues. Biochem J 2002;368(Pt 2):377e96. [24] Sano K, Nakanishi K, Nakamura N, Motoki M, Yasueda H. Cloning and sequence analysis of a cDNA encoding salmon (Onchorhynchus keta) liver transglutaminase. Biosci Biotechnol Biochem 1996;60(11):1790e4. [25] Yasueda H, Nakanishi K, Kumazawa Y, Nagase K, Motoki M, Matsui H. Tissuetype transglutaminase from red sea bream (Pagrus major). Sequence analysis of the cDNA and functional expression in Escherichia coli. Eur J Biochem 1995;232(2):411e9. [26] Oppen-Berntsen DO, Helvik JV, Walther BT. The major structural proteins of cod (Gadus morhua) eggshells and protein crosslinking during teleost egg hardening. Dev Biol 1990;137(2):258e65. [27] Jacobs BL, Langland JO. When two strands are better than one: the mediators and modulators of the cellular responses to double-stranded RNA. Virology 1996;219(2):339e49. [28] Robertsen B. The interferon system of teleost fish. Fish Shellfish Immunol 2006;20(2):172e91. [29] Alonso M, Leong JA. Suppressive subtraction libraries to identify interferoninducible genes in fish. Mar Biotechnol (NY) 2002;4(1):74e80. [30] Macouzet M, Simpson BK, Lee BH. Cloning of fish enzymes and other fish protein genes. Crit Rev Biotechnol 1999;19(3):179e96. [31] Seppola M, Stenvik J, Steiro K, Solstad T, Robertsen B, Jensen I. Sequence and expression analysis of an interferon stimulated gene (ISG15) from Atlantic cod (Gadus morhua L.). Dev Comp Immunol 2007;31(2):156e71. [32] Roy A, Kucukural A, Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc 2010;5(4):725e38. [33] Kileng O, Brundtland MI, Robertsen B. Infectious salmon anemia virus is a powerful inducer of key genes of the type I interferon system of Atlantic salmon, but is not inhibited by interferon. Fish Shellfish Immunol 2007;23(2): 378e89. [34] Chen J, Li C, Huang R, Du F, Liao L, Zhu Z, et al. Transcriptome analysis of head kidney in grass carp and discovery of immune-related genes. BMC Vet Res 2012;8:108. [35] Furnes C, Kileng Ø, Rinaldo CH, Seppola M, Jensen I, Robertsen B. Atlantic cod (Gadus morhua L.) possesses three homologues of ISG15 with different expression kinetics and conjugation properties. Dev Comp Immunol 2009;33(12):1239e46. [36] Fagutao FF, Maningas MB, Kondo H, Aoki T, Hirono I. Transglutaminase regulates immune-related genes in shrimp. Fish Shellfish Immunol 2012;32(5): 711e5. [37] Loof TG, Mörgelin M, Johansson L, Oehmcke S, Olin AI, Dickneite G, et al. Coagulation, an ancestral serine protease cascade, exerts a novel function in early immune defense. Blood 2011;118(9):2589e98. [38] Jensen I, Steiro K, Sommer AI, Mennen S, Johansen A, Sandaker EK, et al. Establishing a cell line from Atlantic cod as a novel tool for in vitro studies. Fish Shellfish Immunol 2013;34(1):199e208.