- Email: [email protected]
Japanese flounder pol-miR-3p-2 suppresses Edwardsiella tarda infection by regulation of autophagy via p53
Journal Pre-proof Japanese flounder pol-miR-3p-2 suppresses Edwardsiella tarda infection by regulation of autophagy via p53
Xiao-lu Guan, Bao-cun Zhang, Li Sun PII:
S0145-305X(19)30358-1
DOI:
https://doi.org/10.1016/j.dci.2019.103531
Reference:
DCI 103531
To appear in:
Developmental and Comparative Immunology
Received Date:
01 August 2019
Accepted Date:
23 October 2019
Please cite this article as: Xiao-lu Guan, Bao-cun Zhang, Li Sun, Japanese flounder pol-miR-3p-2 suppresses Edwardsiella tarda infection by regulation of autophagy via p53, Developmental and Comparative Immunology (2019), https://doi.org/10.1016/j.dci.2019.103531
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.
Journal Pre-proof
Japanese flounder pol-miR-3p-2 suppresses Edwardsiella tarda infection by regulation of autophagy via p53 Xiao-lu Guan1,2, Bao-cun Zhang3, Li Sun1,2* 1CAS
Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao, China 2Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao, China 3Department of Biomedicine and Aarhus Research Center for Innate Immunity, Aarhus University, Aarhus, Denmark
*To whom correspondence should be addressed Corresponding author: Li Sun Institute of Oceanology Chinese Academy of Sciences 7 Nanhai Road Qingdao 266071, China Phone: 86-532-82898829 Email: [email protected]
1
Journal Pre-proof
Abstract
MicroRNAs (miRNAs) are post-transcriptional regulators that play vital roles in diverse physiological processes including immunity. In this study, we investigated the regulatory mechanism and function of a novel Japanese flounder (Paralichthys olivaceus) miRNA, pol-miR-3p-2. pol-miR-3p-2 was responsive in expression to the infection of the bacterial pathogen Edwardsiella tarda. pol-miR-3p-2 negatively regulated the expression of p53 through interaction with the 3’UTR of p53. Overexpression of pol-miR-3p-2 promoted autophagy, resulting in augmented production of LC3-II, while knockdown of p53 increased the level of beclin, a key factor of autophagy. In vivo and in vitro studies showed that E. tarda infection induced autophagy in flounder, and pol-miR-3p-2 inhibited the infectivity of E. tarda. Together these results indicate that pol-miR-3p-2 regulates autophagy through the target gene p53, thus revealing a regulatory link between p53 and autophagy in teleost, and that pol-miR-3p-2 plays an important role in the immune defense against E. tarda.
Keywords: miRNA; Paralichthys olivaceus; autophagy; bacterial infection; immune defense
2
Journal Pre-proof
1. Introduction
MicroRNAs (miRNAs) are small non-coding RNAs generally containing 18 – 25 nucleotides in length (Bartel, 2004; Pillai et al., 2007). MiRNAs are post-transcriptional regulators and negatively regulate the expression of target genes typically through interactions between the seed sequences of the miRNAs and the 3’ untranslated region (UTR) of the target genes (Hammond, 2005). In mammals, miRNAs are known to regulate many physiological processes including cell cycle, metabolism, and immune response (Chandra et al., 2017). In immune systems, miRNAs play essential roles by targeting various immune related genes, thus modulating diverse immune responses, in particular those associated with pathogen infection (Gantier, 2010; Zhou et al., 2014). In fish, miRNAs have been identified and studied in several species including Japanese flounder (Paralichthys olivaceus), grouper (Epinephelus coioides), miiuy croaker (Miichthys miiuy), and tongue sole (Cynoglossus semilaevis) (Andreassen and Hoyheim, 2017; Chen et al., 2017; Chu et al., 2017; Eslamloo et al., 2018; Guo et al., 2015; Hu et al., 2017; Liu et al., 2019; Ni et al., 2017; Xu et al., 2018; Zhang et al., 2016; Zhou et al., 2018). Some of the fish miRNAs have been reported to participate in immune regulation and microbial infection (Andreassen and Hoyheim, 2017; Chu et al., 2017; Eslamloo et al., 2018; Xu et al., 2018). Autophagy is a biological strategy for eukaryocytes to maintain homeostasis under stress conditions such as nutrient starvation and energy loss (He and Klionsky, 2009; Wang and Levine, 2010). Autophagy is evolutionarily highly conserved and exists in the majority of invertebrate and vertebrate species (Abounit et al., 2012). During autophagy, misfolded proteins and damaged organelles of the cell are degraded by lysosomes and recycled. The process of autophagy begins with the formation of autophagosome, which is a 3
Journal Pre-proof
double-membrane vehicle developed from phagophore and contains engulfed cellular components; autophagosomes subsequently fuse with lysosomes to form autophagolysosomes, which degrade their contents by lysosomal enzymes (Denisenko et al., 2018; Morishita and Mizushima, 2019; Rabinowitz and White, 2010). In addition to regulate homeostasis during nutrient stress, autophagy also functions as an intracellular immune mechanism of the host and plays a vital part in host defense against invading pathogens (Levine, 2005; Lin et al., 2010). Studies have shown that autophagy-mediated pathogen clearance can be achieved through targeting directly the intracellular bacteria located in the phagosome or in the cytoplasm, and finally eliminating the microbe through the autophagosome-lysosome pathway (Gutierrez et al., 2004; Nakagawa et al., 2004). In addition to direct bacterial interaction, autophagy can also influence some immune signaling molecules and pathways, which in turn affect pathogen infection (Saitoh and Akira, 2010). For example, in plasmacytoid dendritic cells, autophagy is involved in the transport of viral nucleic acids to endosomal toll-like receptors (TLRs), resulting in the activation of type I interferon response, which then promotes viral clearance (Lee et al., 2007). Japanese flounder is one of the major farmed fish in China due to its high economic value. Flounder is susceptible to the infection of a number of bacterial and viral pathogens, notably Edwardsiella tarda, a Gram-negative bacterium with a broad host range of infection (Han et al., 2006; Park et al., 2012), and megalocytivirus, a viral pathogen that can cause epidemic outbreaks in farmed fish (Li et al., 2011; Subramaniam et al., 2012). In previous studies, megalocytivirus infection was found to significantly alter the expression of 121 miRNAs in flounder (Zhang et al., 2014), some of which are important regulators of immunity that can determine the outcome of viral and bacterial infection (Guan et al., 2019; Zhang et al., 2016). However, the function and regulation of most of the megalocytivirus-induced miRNAs are unclear. In 4
Journal Pre-proof
the present study, we identified one of the above 121 miRNAs, pol-miR-3p-2, as a miRNA responsive to E. tarda infection as well. We examined the regulation mechanism of pol-miR-3p-2 as well as the effect of pol-miR-3p-2 on E. tarda invasion. Our results put forward a new miRNA-mediated autophagy activation mechanism in teleost that operates during bacterial infection and plays a significant role in anti-bacterial immunity.
2. Materials and methods
2.1. Fish
Clinically healthy Japanese flounder (average weight 15g) were purchased from a fish farm in Shandong Province, China. Fish were maintained for one week in the laboratory before experiment and confirmed to be clinically healthy as reported previously (Zhou and Sun, 2015). For tissue collection, fish were euthanized with an overdose of tricaine methanesulfonate (Sigma, St. Louis, USA).
2.2. Cell lines and culture
FG-9307, a gill epithelial cell line derived from Japanese flounder (Tong et al., 1997), was from Prof. Xiaohua Zhang’s laboratory in Ocean University of China. The cells were cultured in L-15 medium (Sigma, USA) plus 10% fetal bovine serum (Gibco, Invitrogen Corp., USA), 100 μg/ml penicillin, and 50 μg/ml streptomycin (Beyotime Biotechnology, China) at 24 ℃. The human embryonic kidney epithelial cell line 5
Journal Pre-proof
HEK293T was cultured at 37 ℃ in DMEM (Hyclone, USA) with 10% fetal bovine serum plus 100 μg/ml penicillin, 50 μg/ml streptomycin, and 5% CO2.
2.3. Quantitative real-time reverse transcription PCR (qRT-PCR)
Experimental bacterial infection of flounder was performed as reported previously (Guan et al., 2019). Briefly, E. tarda (Zhang et al., 2008) was cultured in LB medium at 28 ℃ to an OD600 of 0.8; the cells were washed with PBS and resuspended in PBS to 107 CFU/ml. Flounder (described above) were divided randomly into two groups (20 fish/group) and injected intraperitoneally with 50 μl E. tarda suspension or PBS. Spleen, liver, and gill were taken from the fish (nine at each time point) at 24 h and 48 h post-bacterial infection (hpi). miRNA was extracted from the tissues and reverse-transcribed using specific stem-loop primer miR-3p-2-RT (Table 1). pol-miR-3p-2 expression was determined by qRT-PCR as reported previously (Zhang et al., 2016) with primers miR-3p-2-F and miR-3p-2-R (Table 1) using comparative threshold cycle method (2−ΔΔCT). α-tubulin (TUBA) (for spleen and gill) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (for liver) were used as internal references (Zheng and Sun, 2011). The experiment was performed three times.
2.4. Plasmid construction
To construct the plasmid pmiR3p-2-Report, the 3’UTR of Japanese flounder p53 was amplified by PCR using primers pair of 3UTR-p53-F/3UTR-p53-R (Table 1). The PCR product was ligated into the luciferase reporter vector pMIR-REPORTER (AmBio, USA) at the SpeⅠ/HindⅢ enzyme sites. The plasmid 6
Journal Pre-proof
pmiR3p-2-Report-mut, which bears the p53 3’UTR with mutated sequence corresponding to the seed sequence of pol-miR-3p-2 was similarly constructed except that the sequence (5’-CTGTGTT-3’) that is complementary to the seed sequence of pol-miR-3p-2 was mutated to 5’-GACACAA-3’ by overlapping PCR with the primer pair p53-3UTR-mutF/p53-3UTR-mutR (Table 1). For heterologous expression of p53 and beclin, the plasmids pBeclin-flag and pp53-HA, which express Flag-tagged beclin and HA-tagged p53, respectively, were constructed as follows. The coding sequence of p53 and beclin were amplified by PCR using primer pairs p53-F/p53-R and belcin-F/beclin-R (Table 1), respectively, and the PCR products were ligated into the pCAGGS-FLAG and pCAGGS-HA vectors (Wuhan Miaoling Bioscience & Technology Co.,Ltd, China) at the EcoRⅠ/XhoⅠ enzyme sites, resulting in pBeclin-flag and pp53-HA, respectively. The plasmid pp53-3UTR was identical to pp53-HA except that the 3’UTR of p53 was linked right behind the coding sequence of p53. pp53-3UTR was created as follows. The coding sequence of p53 was amplified by PCR with the primers pair p53-F/p53-R1 (Table 1), and p53 3’UTR was amplified with the primer pair p53-F1/p53-R2 (Table 1). The PCR products were ligated into pCAGGS-HA as above, resulting in pp53-3UTR. The plasmid pp53-3UTR-mut, which bears the same mutated p53 3’UTR as that in pmiR3p-2-Report-mut described above, was constructed similarly as pp53-3UTR with the primer pairs p53-F/p53-R1 and p53-F1/p53-R2 (Table 1).
2.5. miRNA mimic and siRNA
The mimics of pol-miR-3p-2 and pol-miR-3p-2-mut (with the seed sequence of 5’-AACACAG-3’ mutated to 5’-UUGUGUC-3’) were synthesized by GenePharma (Shanghai, Chian). The negative control pol-miR-NC was designed and synthesized by the same company. siRNA-p53, which was designed to target the 132 to 150 7
Journal Pre-proof
nucleotide region of founder p53 (GenBank: EF564441.1), was synthesized by GenePharma. The negative control siRNA-NC was designed and synthesized by the same company.
2.6. Luciferase reporter assays
The dual-luciferase reporter assay was performed as previously described (Guan et al., 2019). Briefly, HEK293T cells were co-transfected with pmiR3p-2-Report plus DEPC-treated water, pmiR3p-2-Report plus pol-miR-NC, pmiR3p-2-Report plus pol-miR-3p-2 mimic, pmiR3p-2-Report plus pol-miR-3p-2-mut mimic, pmiR3p-2-Report-mut
plus
DEPC-treated
water,
pmiR3p-2-Report-mut
plus
pol-miR-NC
or
pmiR3p-2-Report-mut plus pol-miR-3p-2 mimic using lipofectamineTM 3000 transfection reagent (Invitrogen, USA) for 24 h. Luciferase activity was determined using a firefly luciferase reporter gene assay kit (Beyotime Biotechnology, China) according to the instruction of the manufacturer. β-galactosidase was used as an internal control.
2.7. Effect of pol-miR-3p-2 on p53 expression and autophagy
To determine the effect of pol-miR-3p-2 on p53 expression, HEK293T cells were co-transfected with pp53-3UTR plus DEPC-treated water, pp53-3UTR plus pol-miR-NC, pp53-3UTR plus pol-miR-3p-2 mimic, pp53-3UTR plus pol-miR-3p-2-mut mimic, pp53-3UTR-mut plus DEPC-treated water, pp53-3UTR-mut plus pol-miR-NC or pp53-3UTR-mut plus pol-miR-3p-2 mimic using lipofectamineTM 3000 transfection reagent (Invitrogen, USA) for 24 h. p53 protein was detected by Western blot as reported previously (Guan et al., 8
Journal Pre-proof
2019), with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a loading control. Briefly, the HEK293T cells were lysed on ice for 30 minutes with RIPA lysis buffer (Beyotime Biotechnology, China) and then centrifuged to collect supernatant. The supernatant was mixed with 5× loading buffer (250 mM Tris-HCL, 10% sodium dodecylsulfate, 0.5% bromophenol blue, 50% glycerol, and 5% beta-mercaptoethanol) and boiled 10 min. The sample was then subjected to 15% SDS-PAGE, and the proteins were transferred to nitrocellulose filter (NC) membrane (Millipore, UK). The membrane was blocked with 5% skim milk and then incubated orderly with the mouse anti-HA tag antibody (ABclonal, China) and HRP-conjuncted anti-mouse IgG antibody (Abcam, UK). The membrane was finally incubated with ECL substrate (Beyotime Biotechnology, China) and visualized with GelDoc XR System (Bio-Rad, USA). To determine the effect of pol-miR-3p-2 on autophagy, FG-9307 cells were transfected with or without (control) pol-miR-3p-2 mimic or pol-miR-NC for 24 h as above. LC3-II protein was detected with Western blot as above, using the rabbit anti-LC3B antibody (Sigma, USA) as the first antibody and HRP-conjugated anti-rabbit IgG antibody (Abcam, UK) as the second antibody.
2.8. Effect of p53 knockdown on beclin expression
To determine the effect of p53 knockdown on beclin expression in HEK293T cells, HEK293T cells were co-transfected with the plasmids pBeclin-flag and pp53-HA together with or without (control) siRNA-p53 or siRNA-NC as above. At 24 h post transfection, p53 and beclin was detected by Western blot as above using the mouse anti-HA tag antibody (ABclonal, China) and mouse anti-DDDDK tag antibody (ABclonal, China). To determine the effect of p53 knockdown on beclin expression in FG-9307 cells, FG-9307 cells were transfected with or without (control) siRNA-p53 or siRNA-NC as above for 24 h. The endogenous beclin was 9
Journal Pre-proof
detected by Western blot as above using rabbit anti-beclin antibody (Proteintech, USA) and HRP-conjugated anti-rabbit IgG antibody (Abcam, UK) as the second antibody.
2.9. Effect of E. tarda infection on LC3 in vivo and in vitro
For in vivo study, flounder (described above) were infected with or without (control) E. tarda as above. At 12 h and 24 hpi, spleen was obtained and grounded in RIPA lysis buffer, and LC3-II was detected by Western blot as above. For in vitro study, cellular infection with E. tarda was performed as reported previously (Guan et al., 2019). Briefly, FG-9307 cells were infected with or without (control) E. tarda with a multiplicity (MOI) of 100, and the cells were incubated at 24 ℃ for 2 h. Gentamycin (200 μg/ml) was added to the cells, and the cells were incubated with at 24℃ for 1 h to kill extracellular bacteria. The cells were washed three times with PBS and cultured in L15 medium (Sigma, USA) containing 5% fetal bovine serum and 20 μg/ml gentamycin. At 4 h and 8 h post infection, LC3-II was detected by Western blot as described above. β-actin was used as a loading control.
2.10. Effect of pol-miR-3p-2 on E. tarda infection in FG-9307 cells
Cellular infection assay was performed as reported previously (Guan et al., 2019). Briefly, FG-9307 cells were seeded in 24-well plates (105 cells/well) and transfected with pol-miR-3p-2 mimic or pol-miR-NC at a concentration of 200 nM. E. tarda was added to the cells with a multiplicity (MOI) of 100, and the cells were incubated at 24 ℃ for 2 h. Gentamycin (200 μg/ml) was added to the cells, and the cells were incubated at 10
Journal Pre-proof
24℃ for 1 h to kill extracellular bacteria. The cells were washed three times with PBS and cultured in L15 medium (Sigma, USA) containing 5% fetal bovine serum and 20 μg/ml gentamycin. At 4 h and 8 h post infection, the cells were treated with 0.25% trypsin and lysed with 1 % Triton X-100, and intracellular bacterial number was determined by plate count as reported previously (Li et al., 2012). The assay was performed three times.
2.11. Statistical analysis
All experiments were performed at least three times, and statistics analysis was carried out with GraphPad Prism 5 (GraphPad Software, USA). Data were analyzed with analysis of Student's t-test, and p values < 0.05 were taken to be statistically significant.
3. Results
3.1 Expression of pol-miR-3p-2 is regulated by E. tarda
In a previous study, pol-miR-3p-2 was identified as a novel flounder miRNA regulated in expression by megalocytivirus (Zhang et al., 2014). In this study, we examined whether the expression of pol-miR-3p-2 was also affected by E. tarda, a severe bacterial pathogen to flounder. The results showed that in flounder infected with E. tarda for 24 h, the levels of pol-miR-3p-2 were significantly increased in spleen, liver, and gill, with a fold change of 2.7 to 4.6 (Fig. 1). At 48 hpi, the levels of pol-miR-3p-2 in the three tissues returned to normal. 11
Journal Pre-proof
3.2 pol-miR-3p-2 represses the expression of p53
By bioinformatic analysis, pol-miR-3p-2 was predicted to target the p53 gene. The potential interaction between pol-miR-3p-2 and the 3’UTR of p53 was examined by luciferase reporter assay. The results showed that in HEK293T cells co-transfected with pol-miR-3p-2 mimic and pmiR3p-2-Report, the latter bearing the 3’UTR of p53, the luciferase activity was significantly reduced compared to that in the cells transfected with pmiR3p-2-Report or pmiR3p-2-Report plus the non-specific miRNA, pol-miR-NC (Fig. 2A). In contrast, in HEK293T cells co-transfected with pmiR3p-2-Report and pol-miR-3p-2-mut mimic, which is a mimic of pol-miR-3p-2 with mutated seed sequence, the luciferase activity was in similar to that in the cells transfected with pmiR3p-2-Report (Fig. 2A). Similarly, in HEK293T cells co-transfected with pol-miR-3p-2 mimic and pmiR3p-2-Report-mut, which bears p53 3’UTR with mutated sequence corresponding to the seed sequence of pol-miR-3p-2,
the
luciferase
activity
was
comparable
to
that
in
the
cells
transfected
with
pmiR3p-2-Report-mut (Fig. 2A). Consistently, Western blot showed that in HEK293T cells co-transfected with pol-miR-3p-2 mimic and pp53-3UTR, the protein level of p53 was markedly decreased in comparison with that in the cells transfected with pp53-3UTR or in the cells co-transfected with pp53-3UTR and pol-miR-NC, whereas in HEK293T cells co-transfected with pol-miR-3p-2-mut mimic and pp53-3UTR, the level of p53 was similar to that in the cells transfected with pp53-3UTR (Fig. 2B). Similarly, in HEK293T cells co-transfected with pol-miR-3p-2 mimic and pp53-3UTR-mut, the level of p53 protein was comparable to that in the cells transfected with pp53-3UTR-mut (Fig. 2B). These results indicate that p53 was a target gene of pol-miR-3p-2 and negatively regulated by pol-miR-3p-2, and that the regulatory effect of pol-miR-3p-2 12
Journal Pre-proof
depended on the specific interaction between pol-miR-3p-2 and the 3’UTR of p53.
3.3 Overexpression of pol-miR-3p-2 promotes autophagy
In higher vertebrates, p53 is known to be a key regulator of autophagy; in fish, regulation of autophagy by p53 has not been documented. Given the above observation that p53 is a target of pol-miR-3p-2, we examined whether pol-miR-3p-2 had any impact on autophagy of flounder cells. For this purpose, flounder FG-9307 cells were transfected with pol-miR-3p-2 mimic, and production of the autophagy marker protein LC3 was monitored. The results showed that transfection with pol-miR-3p-2 mimic, but not with the control miRNA (pol-miR-NC), caused a marked increase in LC3-II protein (Fig. 3). These results suggest that overexpression of pol-miR-3p-2 can effectively induce the autophagy process of flounder.
3.4 Knockdown of p53 enhances the expression of beclin
In mammals, beclin plays a crucial role in autophagy. In this study, to examine whether flounder p53 had any effect on beclin, HEK293T cells were co-transfected with the plasmids expressing flounder beclin (pBeclin-flag) and p53 (pp53-HA) together with the p53-targeting siRNA (siRNA-p53). Subsequent immunoblot showed that the presence of siRNA-p53 dramatically reduced p53 level but increased beclin level, whereas the presence of the nonspecific siRNA (siRNA-NC) had no apparent effect on p53 or beclin (Fig. 4A). Similarly, in flounder FG-9307 cells transfected with siRNA-p53, but not with siRNA-NC, the expression level of beclin was much higher than that in the control cells (Fig. 4B). These results indicate a negative effect 13
Journal Pre-proof
of p53 on beclin protein homeostasis.
3.5 Autophagy is induced in Japanese flounder during E. tarda infection
Since, as shown above, pol-miR-3p-2 regulated autophagy and was responsive to E. tarda infection, we wondered whether autophagy in flounder was a cellular process inducible by E. tarda infection. To investigate this question, the LC3 level was monitored in flounder during E. tarda infection. We found that compared to the control fish, flounder infected with E. tarda for 12 h and 24 h exhibited apparently higher levels of LC3-II (Fig. 5A). Similarly, in cellular study, we found that when FG-9307 cells were infected with E. tarda for 4 h and 8 h, an apparent increase in LC3-II was observed (Fig. 5B). These results suggest that E. tarda can induce autophagy in Japanese flounder both in vivo and in vitro.
3.6 pol-miR-3p-2 suppresses E. tarda infection
With the above observations, we further examined the effect of pol-miR-3p-2 on E. tarda infection. For this purpose, FG-9307 cells were experimented to overexpress pol-miR-3p-2 by transfection with pol-miR-3p-2 mimic and then infected with E. tarda. Bacterial invasion into and replication inside the host cells was then examined by determining the intracellular bacterial load. The results showed that at 4 hpi and 8 hpi, the number of intracellular E. tarda decreased significantly in pol-miR-3p-2-transfected cells compared to that in the control cells (Fig. 6). In contrast, the intracellular bacterial numbers in FG-9307 cells transfected with control miRNA (pol-miR-NC) were comparable to that in the control cells. 14
Journal Pre-proof
4. Discussion
In a previous study, pol-miR-3p-2 was identified as a novel miRNA that was upregulated in expression at the late stage of megalocytivirus infection (Zhang et al., 2014). In the present study, pol-miR-3p-2 expression was found to be upregulated in flounder tissues at 24 h after E. tarda infection and return to normal level at 48 hpi, indicating a relatively early response of pol-miR-3p-2 to the bacterial pathogen. Similar bacteria/virus-regulated expressions have been reported in other fish miRNAs, which exhibited significantly altered expression patterns after bacterial or viral challenge (Cui et al., 2016; Ni et al., 2017). The marked time-dependent responsiveness of pol-miR-3p-2 to both megalocytivirus and E. tarda invasion indicates an involvement, likely tightly regulated in time, of this miRNA in bacterial and viral infection. Luciferase reporter assay showed that the tumor suppressor p53 is a target gene of pol-miR-3p-2. In higher vertebrates, p53 is a transcription factor that, through regulating the expression of multiple target genes, plays a critical role in many cellular aspects, notably cell cycle, cell death, genome integrity, metabolism, and DNA repair (Vogelstein et al., 2000; Vogelstein and Kinzler, 1992). Recent studies revealed that p53 also participates in the regulation of autophagy and plays dual roles depending on its sub-cellular location (Tasdemir et al., 2008). In the nucleus, p53 acts as an inhibitor of autophagy by negatively regulating the mammalian target of rapamycin (mTOR), which is a key regulator of autophagy. This function of p53 is achieved through its target genes, such as PTEN, TSC2, and AMPK, that inhibit mTOR signaling (Feng et al., 2007). In the cytoplasm, p53 can promote autophagy with largely unknown mechanism, but there are evidences indicating that p53 can enhance the mTOR pathway by restraining the AMPK pathway, which leads 15
Journal Pre-proof
to blockage of autophagy induction (Tasdemir et al., 2008). In our study, we found that overexpression of pol-miR-3p-2 in flounder cells markedly affected the autophagy indicator protein LC3 and caused increased production of LC3-II, suggesting enhanced activation of autophagy by pol-miR-3p-2. These results are consistent with the observation that pol-miR-3p-2 represses p53 expression, and indicate that the downstream effect of pol-miR-3p-2 regulation is pro-autophagy. In mammals, beclin is a homologue of yeast ATG6 and essential to autophagy by initiating the formation of autophagosomes (Liang et al., 1999; Pattingre et al., 2008). During the occurrence of autophagy, beclin participates in the formation of the beclin-VPS34-VPS15 core complex, which further induces autophagy (Kang et al., 2011; Russell et al., 2013). Downregulation of p53 was reported to increase the beclin level in human embryonal carcinoma cells, as a result of attenuation of p53-regulated beclin ubiquitination and degradation (Tripathi et al., 2014). In fish, to our knowledge no regulatory relationship between p53 and beclin has been documented. In this study, we found that knockdown of p53 notably enhanced the expression of beclin in FG-9307 cells, indicating a regulatory connection between p53 and autophagy in flounder. Given the results of pol-miR-3p-2, p53, and beclin observed in our study, it is likely that pol-miR-3p-2 induces autophagy through downregulation of p53, which leads to beclin expression and subsequent initiation of the autophagy process. Autophagy is an important mechanism for eukaryocyte to survive under pressure and plays a crucial role in maintaining cell homeostasis (Mizushima, 2007). Autophagy functions in many processes, including innate immunity, infection, and disease. Several pathogenic bacteria have been reported to induce autophagy in mammalian models (Levine et al., 2011; Tumbarello et al., 2015; Verlhac et al., 2015; Virgin and Levine, 2009). In fish, two reports showed that snakehead fish vesiculovirus induced autophagy in striped snakehead 16
Journal Pre-proof
fish cell line, and Shigella flexneri induced autophagy in zebrafish (Mostowy et al., 2013; Wang et al., 2016). In our study, elevated production of LC3-II was observed both in E. tarda-infected Japanese flounder and in E. tarda-infected flounder cell line, indicating an autophagy inducing capacity of E. tarda under both in vivo and in vitro conditions. Previous studies with the intracellular pathogen Burkholderia pseudomallei, the causative agent of melioidosis, showed that B. pseudomallei activated autophagy in RAW 264.7 cells, and autophagy then targeted and killed the invading pathogen (Amano et al., 2006; Rich et al., 2003); in cells with activated autophagy, the intracellular viability of B. pseudomallei decreased, while in autophagy-deficient cells, the intracellular viability of B. pseudomallei was not affected (Cullinane et al., 2008). Similarly, Group A streptococcus (GAS) induced autophagy, which reduced the intracellular viability of GAS, whereas in autophagy-deficient cells, the viability of GAS was not impaired (Nakagawa et al., 2004). In line with these observations in mammalian models, we found in our study that overexpression of pol-miR-3p-2 significantly inhibited intracellular replication and survival of E. tarda in flounder cells, most likely due to the ability of pol-miR-3p-2 to activate autophagy, which subsequently killed or inactivated E. tarda. In summary, our study demonstrated that pol-miR-3p-2 promotes autophagy by negatively regulating the expression of its target gene p53, which in turn regulates the autophagy key factor beclin, thus indicating for the first time the existence of a regulatory link between p53 and autophagy component in fish. Our study also revealed induction of autophagy by the fish pathogen E. tarda and the significant effect of pol-miR-3p-2 on E. tarda infection.
17
Journal Pre-proof
Acknowledgements
This work was supported by the grants of the National Natural Science Foundation of China (31730100), the Shandong Major Science and Technology Innovation Project (2018SDKJ0302-2), and the Taishan Scholar Program of Shandong Province.
18
Journal Pre-proof
References
Abounit, K., Scarabelli, T.M., Mccauley, R.B., 2012. Autophagy in mammalian cells. World J Biol Chem. 3, 1-6. Amano, A., Nakagawa, I., Yoshimori, T., 2006. Autophagy in innate immunity against intracellular bacteria. J Biochem. 140, 161-166. Andreassen, R., Hoyheim, B., 2017. miRNAs associated with immune response in teleost fish. Dev Comp Immunol. 75, 77-85. Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116, 281-297. Chandra, S., Vimal, D., Sharma, D., Rai, V., Gupta, S.C., Chowdhuri, D.K., 2017. Role of miRNAs in development and disease: Lessons learnt from small organisms. Life Sci. 185, 8-14. Chen, W., Yi, L., Feng, S., Zhao, L., Li, J., Zhou, M., Liang, R., Gu, N., Wu, Z., Tu, J., Lin, L., 2017. Characterization of microRNAs in orange-spotted grouper (Epinephelus coioides) fin cells upon red-spotted grouper nervous necrosis virus infection. Fish Shellfish Immunol. 63, 228-236. Chu, Q., Sun, Y., Cui, J., Xu, T., 2017. MicroRNA-3570 Modulates the NF-kappaB Pathway in Teleost Fish by Targeting MyD88. J Immunol. 198, 3274-3282. Cui, J., Chu, Q., Xu, T., 2016. miR-122 involved in the regulation of toll-like receptor signaling pathway after Vibrio anguillarum infection by targeting TLR14 in miiuy croaker. Fish Shellfish Immunol. 58, 67-72. Cullinane, M., Gong, L., Li, X., Lazar-Adler, N., Tra, T., Wolvetang, E., Prescott, M., Boyce, J.D., Devenish, R.J., Adler, B., 2008. Stimulation of autophagy suppresses the intracellular survival of Burkholderia pseudomallei in mammalian cell lines. Autophagy. 4, 744-753. 19
Journal Pre-proof
Denisenko, T.V., Pivnyuk, A.D., Zhivotovsky, B., 2018. p53-Autophagy-Metastasis Link. Cancers (Basel). 10. Eslamloo, K., Inkpen, S.M., Rise, M.L., Andreassen, R., 2018. Discovery of microRNAs associated with the antiviral immune response of Atlantic cod macrophages. Mol Immunol. 93, 152-161. Eulalio, A., Schulte, L., Vogel, J., 2012. The mammalian microRNA response to bacterial infections. RNA Biol. 9, 742-750. Feng, Z., Hu, W., De Stanchina, E., Teresky, A.K., Jin, S., Lowe, S., Levine, A.J., 2007. The regulation of AMPK beta1, TSC2, and PTEN expression by p53: stress, cell and tissue specificity, and the role of these gene products in modulating the IGF-1-AKT-mTOR pathways. Cancer Res. 67, 3043-3053. Gantier, M.P., 2010. New perspectives in MicroRNA regulation of innate immunity. J Interferon Cytokine Res. 30, 283-289. Gracias, D.T., Katsikis, P.D., 2011. MicroRNAs: key components of immune regulation. Adv Exp Med Biol. 780, 15-26. Guan, X.L., Zhang, B.C., Sun, L., 2019. pol-miR-194a of Japanese flounder (Paralichthys olivaceus) suppresses type I interferon response and facilitates Edwardsiella tarda infection. Fish Shellfish Immunol. 87, 220-225. Guo, C., Cui, H., Ni, S., Yan, Y., Qin, Q., 2015. Comprehensive identification and profiling of host miRNAs in response to Singapore grouper iridovirus (SGIV) infection in grouper (Epinephelus coioides). Dev Comp Immunol. 52, 226-235. Gutierrez, M.G., Master, S.S., Singh, S.B., Taylor, G.A., Colombo, M.I., Deretic, V., 2004. Autophagy is a defense mechanism inhibiting BCG and Mycobacterium tuberculosis survival in infected macrophages. Cell. 119, 753-766. Hammond, S.M., 2005. Dicing and slicing: the core machinery of the RNA interference pathway. FEBS Lett. 579, 20
Journal Pre-proof
5822-5829. Han, H.J., Kim, D.H., Lee, D.C., Kim, S.M., Park, S.I., 2006. Pathogenicity of Edwardsiella tarda to olive flounder, Paralichthys olivaceus (Temminck & Schlegel). J Fish Dis. 29, 601-609. He, C., Klionsky, D.J., 2009. Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet. 43, 67-93. Hu, Y.H., Zhang, B.C., Zhou, H.Z., Guan, X.L., Sun, L., 2017. Edwardsiella tarda-induced miRNAs in a teleost host: Global profile and role in bacterial infection as revealed by integrative miRNA-mRNA analysis. Virulence. 8, 1457-1464. Kang, R., Zeh, H.J., Lotze, M.T., Tang, D., 2011. The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ. 18, 571-580. Lee, H.K., Lund, J.M., Ramanathan, B., Mizushima, N., Iwasaki, A., 2007. Autophagy-dependent viral recognition by plasmacytoid dendritic cells. Science. 315, 1398-1401. Levine, B., 2005. Eating oneself and uninvited guests: autophagy-related pathways in cellular defense. Cell. 120, 159-162. Levine, B., Mizushima, N., Virgin, H.W., 2011. Autophagy in immunity and inflammation. Nature. 469, 323-335. Li, H., Sun, Z.P., Li, Q., Jiang, Y.L., 2011. Characterization of an iridovirus detected in rock bream (Oplegnathus fasciatus; Temminck and Schlegel). Bing Du Xue Bao. 27, 158-164.
Li, M., Hu, Y.H., Zheng, W.J., Sun, B.G., Wang, C., Sun, L., 2012. Inv1: an Edwardsiella tarda invasin and a protective immunogen that is required for host infection. Fish Shellfish Immunol. 32, 586–592. Liang, X.H., Jackson, S., Seaman, M., Brown, K., Kempkes, B., Hibshoosh, H., Levine, B., 1999. Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature. 402, 672-676. 21
Journal Pre-proof
Lin, L.T., Dawson, P.W., Richardson, C.D., 2010. Viral interactions with macroautophagy: a double-edged sword. Virology. 402, 1-10. Liu, Y., Liu, Y., Han, M., Du, X., Liu, X., Zhang, Q., Liu, J., 2019. Edwardsiella tarda-induced miR-7a functions as a suppressor in PI3K/AKT/GSK3beta signaling pathway by targeting insulin receptor substrate-2 (IRS2a and IRS2b) in Paralichthys olivaceus. Fish Shellfish Immunol. 89, 477-485. Mizushima, N., 2007. Autophagy: process and function. Genes Dev. 21, 2861-2873. Morishita, H., Mizushima, N., 2019. Diverse Cellular Roles of Autophagy. Annu Rev Cell Dev Biol. Mostowy, S., Boucontet, L., Mazon Moya, M.J., Sirianni, A., Boudinot, P., Hollinshead, M., Cossart, P., Herbomel, P., Levraud, J.P., Colucci-Guyon, E., 2013. The zebrafish as a new model for the in vivo study of Shigella flexneri interaction with phagocytes and bacterial autophagy. PLoS Pathog. 9, e1003588. Nakagawa, I., Amano, A., Mizushima, N., Yamamoto, A., Yamaguchi, H., Kamimoto, T., Nara, A., Funao, J., Nakata, M., Tsuda, K., Hamada, S., Yoshimori, T., 2004. Autophagy defends cells against invading group A Streptococcus. Science. 306, 1037-1040. Ni, S., Yan, Y., Cui, H., Yu, Y., Huang, Y., Qin, Q., 2017. Fish miR-146a promotes Singapore grouper iridovirus infection by regulating cell apoptosis and NF-kappaB activation. J Gen Virol. 98, 1489-1499. Park, S.B., Aoki, T., Jung, T.S., 2012. Pathogenesis of and strategies for preventing Edwardsiella tarda infection in fish. Vet Res. 43, 67. Pattingre, S., Espert, L., Biard-Piechaczyk, M., Codogno, P., 2008. Regulation of macroautophagy by mTOR and Beclin 1 complexes. Biochimie. 90, 313-323. Pillai, R.S., Bhattacharyya, S.N., Filipowicz, W., 2007. Repression of protein synthesis by miRNAs: how many mechanisms? Trends Cell Biol. 17, 118-126. 22
Journal Pre-proof
Rabinowitz, J.D., White, E., 2010. Autophagy and metabolism. Science. 330, 1344-1348. Rich, K.A., Burkett, C., Webster, P., 2003. Cytoplasmic bacteria can be targets for autophagy. Cell Microbiol. 5, 455-468. Russell, R.C., Tian, Y., Yuan, H., Park, H.W., Chang, Y.Y., Kim, J., Kim, H., Neufeld, T.P., Dillin, A., Guan, K.L., 2013. ULK1 induces autophagy by phosphorylating Beclin-1 and activating VPS34 lipid kinase. Nat Cell Biol. 15, 741-750. Saitoh, T., Akira, S., 2010. Regulation of innate immune responses by autophagy-related proteins. J Cell Biol. 189, 925-935. Schulte, L.N., Eulalio, A., Mollenkopf, H.J., Reinhardt, R., Vogel, J., 2011. Analysis of the host microRNA response to Salmonella uncovers the control of major cytokines by the let-7 family. Embo j. 30, 1977-1989. Subramaniam, K., Shariff, M., Omar, A.R., Hair-Bejo, M., 2012. Megalocytivirus infection in fish. Reviews in Aquaculture. 4, 221-233. Tasdemir, E., Maiuri, M.C., Galluzzi, L., Vitale, I., Djavaheri-Mergny, M., D'amelio, M., Criollo, A., Morselli, E., Zhu, C., Harper, F., Nannmark, U., Samara, C., Pinton, P., Vicencio, J.M., Carnuccio, R., Moll, U.M., Madeo, F., Paterlini-Brechot, P., Rizzuto, R., Szabadkai, G., Pierron, G., Blomgren, K., Tavernarakis, N., Codogno, P., Cecconi, F., Kroemer, G., 2008. Regulation of autophagy by cytoplasmic p53. Nat Cell Biol. 10, 676-687. Tong, S.L., Li, H., Miao, H.-Z., 1997. The establishment and partial characterization of a continuous fish cell line FG-9307 from the gill of flounder Paralichthys olivaceus. Aquaculture. 156, 327-333. Tripathi, R., Ash, D., Shaha, C., 2014. Beclin-1-p53 interaction is crucial for cell fate determination in embryonal carcinoma cells. J Cell Mol Med. 18, 2275-2286. Tumbarello, D.A., Manna, P.T., Allen, M., Bycroft, M., Arden, S.D., Kendrick-Jones, J., Buss, F., 2015. The 23
Journal Pre-proof
Autophagy Receptor TAX1BP1 and the Molecular Motor Myosin VI Are Required for Clearance of Salmonella Typhimurium by Autophagy. PLoS Pathog. 11, e1005174. Verlhac, P., Gregoire, I.P., Azocar, O., Petkova, D.S., Baguet, J., Viret, C., Faure, M., 2015. Autophagy receptor NDP52 regulates pathogen-containing autophagosome maturation. Cell Host Microbe. 17, 515-525. Virgin, H.W., Levine, B., 2009. Autophagy genes in immunity. Nat Immunol. 10, 461-470. Vogelstein, B., Kinzler, K.W., 1992. p53 function and dysfunction. Cell. 70, 523-526. Vogelstein, B., Lane, D., Levine, A.J., 2000. Surfing the p53 network. Nature. 408, 307-310. Wang, R.C., Levine, B., 2010. Autophagy in cellular growth control. FEBS Lett. 584, 1417-1426. Wang, Y., Chen, N., Hegazy, A.M., Liu, X., Wu, Z., Liu, X., Zhao, L., Qin, Q., Lan, J., Lin, L., 2016. Autophagy induced by snakehead fish vesiculovirus inhibited its replication in SSN-1 cell line. Fish Shellfish Immunol. 55, 415-422. Xu, T., Chu, Q., Cui, J., Zhao, X., 2018. The inducible microRNA-203 in fish represses the inflammatory responses to Gram-negative bacteria by targeting IL-1 receptor-associated kinase 4. J Biol Chem. 293, 1386-1396. Zhang, B.C., Zhang, J., Sun, L., 2014. In-depth profiling and analysis of host and viral microRNAs in Japanese flounder (Paralichthys olivaceus) infected with megalocytivirus reveal involvement of microRNAs in host-virus interaction in teleost fish. BMC Genomics. 15, 878. Zhang, B.C., Zhou, Z.J., Sun, L., 2016. pol-miR-731, a teleost miRNA upregulated by megalocytivirus, negatively regulates virus-induced type I interferon response, apoptosis, and cell cycle arrest. Sci Rep. 6, 28354. Zhang, M., Sun, K., Sun, L., 2008. Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain. Microbiology. 154, 2060-2069. Zheng, W.J., Sun, L., 2011. Evaluation of housekeeping genes as references for quantitative real time RT-PCR 24
Journal Pre-proof
analysis of gene expression in Japanese flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 30, 638-645. Zhou, X., Li, X., Ye, Y., Zhao, K., Zhuang, Y., Li, Y., Wei, Y., Wu, M., 2014. MicroRNA-302b augments host defense to bacteria by regulating inflammatory responses via feedback to TLR/IRAK4 circuits. Nat Commun. 5, 3619. Zhou, Z., Lin, Z., Pang, X., Shan, P., Wang, J., 2018. MicroRNA regulation of Toll-like receptor signaling pathways in teleost fish. Fish Shellfish Immunol. 75, 32-40. Zhou, Z.J., Sun, L., 2015. CsCTL1, a teleost C-type lectin that promotes antibacterial and antiviral immune defense in a manner that depends on the conserved EPN motif. Dev Comp Immunol. 50, 69-77.
25
Journal Pre-proof
Tables Table 1. Primers used in this study. Primers
Sequence (5’-3’)a
miR-3p-2-RT
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC GCTCAA
miR-3p-2-F
GCGGAACACAGCGATTGGT
miR-3p-2-R
AGTGCAGGGTCCGAGGTATT
3UTR-p53-F
TGATGAAAGCTGCGCACTAGTGAAGCTCGTTGCCTT (SpeⅠ)
3UTR-p53-R
AAAAGATCCTTTATTAAGCTTCCAATTAAAATCTGAT (HindⅢ)
p53-3UTR-mutF
AGCGCTGTACAGTGTTAAGA
p53-3UTR-mutR
ACACTGTACAGCGCTTTGTGTCTAATCAGCTCAAGTTTTC
p53-F
CATCATTTTGGCAAAGAATTCATGGAAGAGCAAGGT (EcoRⅠ)
p53-R
CCATAGATCTGCTAGCTCGAGTCAGTCACTGTCGCTCTG (XhoⅠ)
beclin-F
CATCATTTTGGCAAAGAATTCATGGAGGGCTCCAAG (EcoRⅠ)
beclin-R
CCATAGATCTGCTAGCTCGAGATCTGTTGTAGAACTG (XhoⅠ)
p53-R1
AGCGACAGTGACTGAGAAGCTCGTTGCCTT
p53-F1
TCAGTCACTGTCGCTCTG
p53-R2
CCATAGATCTGCTAGCTCGAGCCAATTAAAATCTGAT (XhoⅠ)
aUnderlined
nucleotides are restriction sites.
26
Journal Pre-proof
Figure legends
Figure 1. Expression of pol-miR-3p-2 in Japanese flounder infected by Edwardsiella tarda. Flounder were infected with or without (control) E. tarda, and pol-miR-3p-2 expression in spleen (A), liver (B) and gill (C) was determined by qRT-PCR at 24 h and 48 h post infection (hpi). Values are the means of triplicate experiments and shown as means ± SD. ** p < 0.01; *p < 0.05
Figure 2. Effect of pol-miR-3p-2 on p53 expression. (A) HEK293T cells were co-transfected with pmiR3p-2-Report plus DEPC-treated water, pmiR3p-2-Report plus pol-miR-NC, pmiR3p-2-Report plus pol-miR-3p-2 mimic, pmiR3p-2-Report plus pol-miR-3p-2-mut mimic, pmiR3p-2-Report-mut plus DEPC-treated water, pmiR3p-2-Report-mut plus pol-miR-NC or pmiR3p-2-Report-mut plus pol-miR-3p-2 mimic. At 24 h after transfection, and luciferase activity was measured. Values are the means of triplicate experiments and shown as means ± SD. **p﹤0.01. (B) HEK293T cells were co-transfected with pp53-3UTR plus DEPC-treated water, pp53-3UTR plus pol-miR-NC, pp53-3UTR plus pol-miR-3p-2 mimic, pp53-3UTR plus pol-miR-3p-2-mut mimic, pp53-3UTR-mut plus DEPC-treated water, pp53-3UTR-mut plus pol-miR-NC or pp53-3UTR-mut plus pol-miR-3p-2 mimic. At 24 h after transfection, p53 protein was detected by Western blot. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. The relative densities of p53/GAPDH are shown at the bottom of the figure.
Figure 3. Effect of pol-miR-3p-2 on autophagy. FG-9307 cells were transfected with or without (control) 27
Journal Pre-proof
pol-miR-3p-2 mimic or pol-miR-NC for 24 h, and LC3-II protein was detected by Western blot. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. The relative densities of LC3-II/GAPDH are shown at the bottom of the figure.
Figure 4. Effect of p53 knockdown on beclin expression. (A) HEK293T cells were co-transfected with the plasmids pBeclin-flag and pp53-HA together with or without siRNA-p53 or siRNA-NC. At 24 h after transfection, p53 and beclin were detected by Western blot. (B) FG-9307 cells were transfected with or without siRNA-p53 or siRNA-NC for 24 h, and beclin was detected by Western blot. In both panels, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control, and the relative densities of p53/GAPDH and beclin/GAPDH are shown at the bottom of the panels.
Figure 5. Expression of LC3-II in Japanese flounder and FG-9307 cells during Edwardsiella tarda infection. (A) Flounder were infected with or without (control) E. tarda, and LC3-II protein in spleen was determined at 12 and 24 h post-infection (hpi) by Western blot. (B) FG-9307 cells were infected with or without (control) E. tarda, and LC3-II was determined at 4 and 8 hpi as above. The relative densities of LC3-II/actin are shown at the bottom of the figure.
Figure 6. Effect of pol-miR-3p-2 on Edwardsiella tarda infection. FG-9307 cells were transfected with or without (control) pol-miR-3p-2 mimic or pol-miR-NC and then infected with E. tarda. At 4 and 8 hour post infection (hpi), intracellular bacterial numbers were determined and shown as colony forming unit (CFU). Values are triplicate experiments and shown as means ± SD. ** p﹤0.01; * p﹤0.05. 28
Journal Pre-proof
Figures
Figure 1
29
Journal Pre-proof
Figure 2
30
Journal Pre-proof
Figure 3
31
Journal Pre-proof
Figure 4
32
Journal Pre-proof
Figure 5
33
Journal Pre-proof
Figure 6
34
Journal Pre-proof
Research highlights ► pol-miR-3p-2 was regulated in expression by Edwardsiella tarda infection. ► pol-miR-3p-2 inhibited
p53 expression and promoted production of LC3-II. ►Knockdown of p53 enhanced the expression of beclin. ► Autophagy was induced in vivo flounder and in vitro during E. tarda infection. ► Overexpression of pol-miR-3p-2 suppressed E. tarda infection in flounder cells.
Xiao-lu Guan, Bao-cun Zhang, Li Sun PII:
S0145-305X(19)30358-1
DOI:
https://doi.org/10.1016/j.dci.2019.103531
Reference:
DCI 103531
To appear in:
Developmental and Comparative Immunology
Received Date:
01 August 2019
Accepted Date:
23 October 2019
Please cite this article as: Xiao-lu Guan, Bao-cun Zhang, Li Sun, Japanese flounder pol-miR-3p-2 suppresses Edwardsiella tarda infection by regulation of autophagy via p53, Developmental and Comparative Immunology (2019), https://doi.org/10.1016/j.dci.2019.103531
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.
Journal Pre-proof
Japanese flounder pol-miR-3p-2 suppresses Edwardsiella tarda infection by regulation of autophagy via p53 Xiao-lu Guan1,2, Bao-cun Zhang3, Li Sun1,2* 1CAS
Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao, China 2Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao, China 3Department of Biomedicine and Aarhus Research Center for Innate Immunity, Aarhus University, Aarhus, Denmark
*To whom correspondence should be addressed Corresponding author: Li Sun Institute of Oceanology Chinese Academy of Sciences 7 Nanhai Road Qingdao 266071, China Phone: 86-532-82898829 Email: [email protected]
1
Journal Pre-proof
Abstract
MicroRNAs (miRNAs) are post-transcriptional regulators that play vital roles in diverse physiological processes including immunity. In this study, we investigated the regulatory mechanism and function of a novel Japanese flounder (Paralichthys olivaceus) miRNA, pol-miR-3p-2. pol-miR-3p-2 was responsive in expression to the infection of the bacterial pathogen Edwardsiella tarda. pol-miR-3p-2 negatively regulated the expression of p53 through interaction with the 3’UTR of p53. Overexpression of pol-miR-3p-2 promoted autophagy, resulting in augmented production of LC3-II, while knockdown of p53 increased the level of beclin, a key factor of autophagy. In vivo and in vitro studies showed that E. tarda infection induced autophagy in flounder, and pol-miR-3p-2 inhibited the infectivity of E. tarda. Together these results indicate that pol-miR-3p-2 regulates autophagy through the target gene p53, thus revealing a regulatory link between p53 and autophagy in teleost, and that pol-miR-3p-2 plays an important role in the immune defense against E. tarda.
Keywords: miRNA; Paralichthys olivaceus; autophagy; bacterial infection; immune defense
2
Journal Pre-proof
1. Introduction
MicroRNAs (miRNAs) are small non-coding RNAs generally containing 18 – 25 nucleotides in length (Bartel, 2004; Pillai et al., 2007). MiRNAs are post-transcriptional regulators and negatively regulate the expression of target genes typically through interactions between the seed sequences of the miRNAs and the 3’ untranslated region (UTR) of the target genes (Hammond, 2005). In mammals, miRNAs are known to regulate many physiological processes including cell cycle, metabolism, and immune response (Chandra et al., 2017). In immune systems, miRNAs play essential roles by targeting various immune related genes, thus modulating diverse immune responses, in particular those associated with pathogen infection (Gantier, 2010; Zhou et al., 2014). In fish, miRNAs have been identified and studied in several species including Japanese flounder (Paralichthys olivaceus), grouper (Epinephelus coioides), miiuy croaker (Miichthys miiuy), and tongue sole (Cynoglossus semilaevis) (Andreassen and Hoyheim, 2017; Chen et al., 2017; Chu et al., 2017; Eslamloo et al., 2018; Guo et al., 2015; Hu et al., 2017; Liu et al., 2019; Ni et al., 2017; Xu et al., 2018; Zhang et al., 2016; Zhou et al., 2018). Some of the fish miRNAs have been reported to participate in immune regulation and microbial infection (Andreassen and Hoyheim, 2017; Chu et al., 2017; Eslamloo et al., 2018; Xu et al., 2018). Autophagy is a biological strategy for eukaryocytes to maintain homeostasis under stress conditions such as nutrient starvation and energy loss (He and Klionsky, 2009; Wang and Levine, 2010). Autophagy is evolutionarily highly conserved and exists in the majority of invertebrate and vertebrate species (Abounit et al., 2012). During autophagy, misfolded proteins and damaged organelles of the cell are degraded by lysosomes and recycled. The process of autophagy begins with the formation of autophagosome, which is a 3
Journal Pre-proof
double-membrane vehicle developed from phagophore and contains engulfed cellular components; autophagosomes subsequently fuse with lysosomes to form autophagolysosomes, which degrade their contents by lysosomal enzymes (Denisenko et al., 2018; Morishita and Mizushima, 2019; Rabinowitz and White, 2010). In addition to regulate homeostasis during nutrient stress, autophagy also functions as an intracellular immune mechanism of the host and plays a vital part in host defense against invading pathogens (Levine, 2005; Lin et al., 2010). Studies have shown that autophagy-mediated pathogen clearance can be achieved through targeting directly the intracellular bacteria located in the phagosome or in the cytoplasm, and finally eliminating the microbe through the autophagosome-lysosome pathway (Gutierrez et al., 2004; Nakagawa et al., 2004). In addition to direct bacterial interaction, autophagy can also influence some immune signaling molecules and pathways, which in turn affect pathogen infection (Saitoh and Akira, 2010). For example, in plasmacytoid dendritic cells, autophagy is involved in the transport of viral nucleic acids to endosomal toll-like receptors (TLRs), resulting in the activation of type I interferon response, which then promotes viral clearance (Lee et al., 2007). Japanese flounder is one of the major farmed fish in China due to its high economic value. Flounder is susceptible to the infection of a number of bacterial and viral pathogens, notably Edwardsiella tarda, a Gram-negative bacterium with a broad host range of infection (Han et al., 2006; Park et al., 2012), and megalocytivirus, a viral pathogen that can cause epidemic outbreaks in farmed fish (Li et al., 2011; Subramaniam et al., 2012). In previous studies, megalocytivirus infection was found to significantly alter the expression of 121 miRNAs in flounder (Zhang et al., 2014), some of which are important regulators of immunity that can determine the outcome of viral and bacterial infection (Guan et al., 2019; Zhang et al., 2016). However, the function and regulation of most of the megalocytivirus-induced miRNAs are unclear. In 4
Journal Pre-proof
the present study, we identified one of the above 121 miRNAs, pol-miR-3p-2, as a miRNA responsive to E. tarda infection as well. We examined the regulation mechanism of pol-miR-3p-2 as well as the effect of pol-miR-3p-2 on E. tarda invasion. Our results put forward a new miRNA-mediated autophagy activation mechanism in teleost that operates during bacterial infection and plays a significant role in anti-bacterial immunity.
2. Materials and methods
2.1. Fish
Clinically healthy Japanese flounder (average weight 15g) were purchased from a fish farm in Shandong Province, China. Fish were maintained for one week in the laboratory before experiment and confirmed to be clinically healthy as reported previously (Zhou and Sun, 2015). For tissue collection, fish were euthanized with an overdose of tricaine methanesulfonate (Sigma, St. Louis, USA).
2.2. Cell lines and culture
FG-9307, a gill epithelial cell line derived from Japanese flounder (Tong et al., 1997), was from Prof. Xiaohua Zhang’s laboratory in Ocean University of China. The cells were cultured in L-15 medium (Sigma, USA) plus 10% fetal bovine serum (Gibco, Invitrogen Corp., USA), 100 μg/ml penicillin, and 50 μg/ml streptomycin (Beyotime Biotechnology, China) at 24 ℃. The human embryonic kidney epithelial cell line 5
Journal Pre-proof
HEK293T was cultured at 37 ℃ in DMEM (Hyclone, USA) with 10% fetal bovine serum plus 100 μg/ml penicillin, 50 μg/ml streptomycin, and 5% CO2.
2.3. Quantitative real-time reverse transcription PCR (qRT-PCR)
Experimental bacterial infection of flounder was performed as reported previously (Guan et al., 2019). Briefly, E. tarda (Zhang et al., 2008) was cultured in LB medium at 28 ℃ to an OD600 of 0.8; the cells were washed with PBS and resuspended in PBS to 107 CFU/ml. Flounder (described above) were divided randomly into two groups (20 fish/group) and injected intraperitoneally with 50 μl E. tarda suspension or PBS. Spleen, liver, and gill were taken from the fish (nine at each time point) at 24 h and 48 h post-bacterial infection (hpi). miRNA was extracted from the tissues and reverse-transcribed using specific stem-loop primer miR-3p-2-RT (Table 1). pol-miR-3p-2 expression was determined by qRT-PCR as reported previously (Zhang et al., 2016) with primers miR-3p-2-F and miR-3p-2-R (Table 1) using comparative threshold cycle method (2−ΔΔCT). α-tubulin (TUBA) (for spleen and gill) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (for liver) were used as internal references (Zheng and Sun, 2011). The experiment was performed three times.
2.4. Plasmid construction
To construct the plasmid pmiR3p-2-Report, the 3’UTR of Japanese flounder p53 was amplified by PCR using primers pair of 3UTR-p53-F/3UTR-p53-R (Table 1). The PCR product was ligated into the luciferase reporter vector pMIR-REPORTER (AmBio, USA) at the SpeⅠ/HindⅢ enzyme sites. The plasmid 6
Journal Pre-proof
pmiR3p-2-Report-mut, which bears the p53 3’UTR with mutated sequence corresponding to the seed sequence of pol-miR-3p-2 was similarly constructed except that the sequence (5’-CTGTGTT-3’) that is complementary to the seed sequence of pol-miR-3p-2 was mutated to 5’-GACACAA-3’ by overlapping PCR with the primer pair p53-3UTR-mutF/p53-3UTR-mutR (Table 1). For heterologous expression of p53 and beclin, the plasmids pBeclin-flag and pp53-HA, which express Flag-tagged beclin and HA-tagged p53, respectively, were constructed as follows. The coding sequence of p53 and beclin were amplified by PCR using primer pairs p53-F/p53-R and belcin-F/beclin-R (Table 1), respectively, and the PCR products were ligated into the pCAGGS-FLAG and pCAGGS-HA vectors (Wuhan Miaoling Bioscience & Technology Co.,Ltd, China) at the EcoRⅠ/XhoⅠ enzyme sites, resulting in pBeclin-flag and pp53-HA, respectively. The plasmid pp53-3UTR was identical to pp53-HA except that the 3’UTR of p53 was linked right behind the coding sequence of p53. pp53-3UTR was created as follows. The coding sequence of p53 was amplified by PCR with the primers pair p53-F/p53-R1 (Table 1), and p53 3’UTR was amplified with the primer pair p53-F1/p53-R2 (Table 1). The PCR products were ligated into pCAGGS-HA as above, resulting in pp53-3UTR. The plasmid pp53-3UTR-mut, which bears the same mutated p53 3’UTR as that in pmiR3p-2-Report-mut described above, was constructed similarly as pp53-3UTR with the primer pairs p53-F/p53-R1 and p53-F1/p53-R2 (Table 1).
2.5. miRNA mimic and siRNA
The mimics of pol-miR-3p-2 and pol-miR-3p-2-mut (with the seed sequence of 5’-AACACAG-3’ mutated to 5’-UUGUGUC-3’) were synthesized by GenePharma (Shanghai, Chian). The negative control pol-miR-NC was designed and synthesized by the same company. siRNA-p53, which was designed to target the 132 to 150 7
Journal Pre-proof
nucleotide region of founder p53 (GenBank: EF564441.1), was synthesized by GenePharma. The negative control siRNA-NC was designed and synthesized by the same company.
2.6. Luciferase reporter assays
The dual-luciferase reporter assay was performed as previously described (Guan et al., 2019). Briefly, HEK293T cells were co-transfected with pmiR3p-2-Report plus DEPC-treated water, pmiR3p-2-Report plus pol-miR-NC, pmiR3p-2-Report plus pol-miR-3p-2 mimic, pmiR3p-2-Report plus pol-miR-3p-2-mut mimic, pmiR3p-2-Report-mut
plus
DEPC-treated
water,
pmiR3p-2-Report-mut
plus
pol-miR-NC
or
pmiR3p-2-Report-mut plus pol-miR-3p-2 mimic using lipofectamineTM 3000 transfection reagent (Invitrogen, USA) for 24 h. Luciferase activity was determined using a firefly luciferase reporter gene assay kit (Beyotime Biotechnology, China) according to the instruction of the manufacturer. β-galactosidase was used as an internal control.
2.7. Effect of pol-miR-3p-2 on p53 expression and autophagy
To determine the effect of pol-miR-3p-2 on p53 expression, HEK293T cells were co-transfected with pp53-3UTR plus DEPC-treated water, pp53-3UTR plus pol-miR-NC, pp53-3UTR plus pol-miR-3p-2 mimic, pp53-3UTR plus pol-miR-3p-2-mut mimic, pp53-3UTR-mut plus DEPC-treated water, pp53-3UTR-mut plus pol-miR-NC or pp53-3UTR-mut plus pol-miR-3p-2 mimic using lipofectamineTM 3000 transfection reagent (Invitrogen, USA) for 24 h. p53 protein was detected by Western blot as reported previously (Guan et al., 8
Journal Pre-proof
2019), with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a loading control. Briefly, the HEK293T cells were lysed on ice for 30 minutes with RIPA lysis buffer (Beyotime Biotechnology, China) and then centrifuged to collect supernatant. The supernatant was mixed with 5× loading buffer (250 mM Tris-HCL, 10% sodium dodecylsulfate, 0.5% bromophenol blue, 50% glycerol, and 5% beta-mercaptoethanol) and boiled 10 min. The sample was then subjected to 15% SDS-PAGE, and the proteins were transferred to nitrocellulose filter (NC) membrane (Millipore, UK). The membrane was blocked with 5% skim milk and then incubated orderly with the mouse anti-HA tag antibody (ABclonal, China) and HRP-conjuncted anti-mouse IgG antibody (Abcam, UK). The membrane was finally incubated with ECL substrate (Beyotime Biotechnology, China) and visualized with GelDoc XR System (Bio-Rad, USA). To determine the effect of pol-miR-3p-2 on autophagy, FG-9307 cells were transfected with or without (control) pol-miR-3p-2 mimic or pol-miR-NC for 24 h as above. LC3-II protein was detected with Western blot as above, using the rabbit anti-LC3B antibody (Sigma, USA) as the first antibody and HRP-conjugated anti-rabbit IgG antibody (Abcam, UK) as the second antibody.
2.8. Effect of p53 knockdown on beclin expression
To determine the effect of p53 knockdown on beclin expression in HEK293T cells, HEK293T cells were co-transfected with the plasmids pBeclin-flag and pp53-HA together with or without (control) siRNA-p53 or siRNA-NC as above. At 24 h post transfection, p53 and beclin was detected by Western blot as above using the mouse anti-HA tag antibody (ABclonal, China) and mouse anti-DDDDK tag antibody (ABclonal, China). To determine the effect of p53 knockdown on beclin expression in FG-9307 cells, FG-9307 cells were transfected with or without (control) siRNA-p53 or siRNA-NC as above for 24 h. The endogenous beclin was 9
Journal Pre-proof
detected by Western blot as above using rabbit anti-beclin antibody (Proteintech, USA) and HRP-conjugated anti-rabbit IgG antibody (Abcam, UK) as the second antibody.
2.9. Effect of E. tarda infection on LC3 in vivo and in vitro
For in vivo study, flounder (described above) were infected with or without (control) E. tarda as above. At 12 h and 24 hpi, spleen was obtained and grounded in RIPA lysis buffer, and LC3-II was detected by Western blot as above. For in vitro study, cellular infection with E. tarda was performed as reported previously (Guan et al., 2019). Briefly, FG-9307 cells were infected with or without (control) E. tarda with a multiplicity (MOI) of 100, and the cells were incubated at 24 ℃ for 2 h. Gentamycin (200 μg/ml) was added to the cells, and the cells were incubated with at 24℃ for 1 h to kill extracellular bacteria. The cells were washed three times with PBS and cultured in L15 medium (Sigma, USA) containing 5% fetal bovine serum and 20 μg/ml gentamycin. At 4 h and 8 h post infection, LC3-II was detected by Western blot as described above. β-actin was used as a loading control.
2.10. Effect of pol-miR-3p-2 on E. tarda infection in FG-9307 cells
Cellular infection assay was performed as reported previously (Guan et al., 2019). Briefly, FG-9307 cells were seeded in 24-well plates (105 cells/well) and transfected with pol-miR-3p-2 mimic or pol-miR-NC at a concentration of 200 nM. E. tarda was added to the cells with a multiplicity (MOI) of 100, and the cells were incubated at 24 ℃ for 2 h. Gentamycin (200 μg/ml) was added to the cells, and the cells were incubated at 10
Journal Pre-proof
24℃ for 1 h to kill extracellular bacteria. The cells were washed three times with PBS and cultured in L15 medium (Sigma, USA) containing 5% fetal bovine serum and 20 μg/ml gentamycin. At 4 h and 8 h post infection, the cells were treated with 0.25% trypsin and lysed with 1 % Triton X-100, and intracellular bacterial number was determined by plate count as reported previously (Li et al., 2012). The assay was performed three times.
2.11. Statistical analysis
All experiments were performed at least three times, and statistics analysis was carried out with GraphPad Prism 5 (GraphPad Software, USA). Data were analyzed with analysis of Student's t-test, and p values < 0.05 were taken to be statistically significant.
3. Results
3.1 Expression of pol-miR-3p-2 is regulated by E. tarda
In a previous study, pol-miR-3p-2 was identified as a novel flounder miRNA regulated in expression by megalocytivirus (Zhang et al., 2014). In this study, we examined whether the expression of pol-miR-3p-2 was also affected by E. tarda, a severe bacterial pathogen to flounder. The results showed that in flounder infected with E. tarda for 24 h, the levels of pol-miR-3p-2 were significantly increased in spleen, liver, and gill, with a fold change of 2.7 to 4.6 (Fig. 1). At 48 hpi, the levels of pol-miR-3p-2 in the three tissues returned to normal. 11
Journal Pre-proof
3.2 pol-miR-3p-2 represses the expression of p53
By bioinformatic analysis, pol-miR-3p-2 was predicted to target the p53 gene. The potential interaction between pol-miR-3p-2 and the 3’UTR of p53 was examined by luciferase reporter assay. The results showed that in HEK293T cells co-transfected with pol-miR-3p-2 mimic and pmiR3p-2-Report, the latter bearing the 3’UTR of p53, the luciferase activity was significantly reduced compared to that in the cells transfected with pmiR3p-2-Report or pmiR3p-2-Report plus the non-specific miRNA, pol-miR-NC (Fig. 2A). In contrast, in HEK293T cells co-transfected with pmiR3p-2-Report and pol-miR-3p-2-mut mimic, which is a mimic of pol-miR-3p-2 with mutated seed sequence, the luciferase activity was in similar to that in the cells transfected with pmiR3p-2-Report (Fig. 2A). Similarly, in HEK293T cells co-transfected with pol-miR-3p-2 mimic and pmiR3p-2-Report-mut, which bears p53 3’UTR with mutated sequence corresponding to the seed sequence of pol-miR-3p-2,
the
luciferase
activity
was
comparable
to
that
in
the
cells
transfected
with
pmiR3p-2-Report-mut (Fig. 2A). Consistently, Western blot showed that in HEK293T cells co-transfected with pol-miR-3p-2 mimic and pp53-3UTR, the protein level of p53 was markedly decreased in comparison with that in the cells transfected with pp53-3UTR or in the cells co-transfected with pp53-3UTR and pol-miR-NC, whereas in HEK293T cells co-transfected with pol-miR-3p-2-mut mimic and pp53-3UTR, the level of p53 was similar to that in the cells transfected with pp53-3UTR (Fig. 2B). Similarly, in HEK293T cells co-transfected with pol-miR-3p-2 mimic and pp53-3UTR-mut, the level of p53 protein was comparable to that in the cells transfected with pp53-3UTR-mut (Fig. 2B). These results indicate that p53 was a target gene of pol-miR-3p-2 and negatively regulated by pol-miR-3p-2, and that the regulatory effect of pol-miR-3p-2 12
Journal Pre-proof
depended on the specific interaction between pol-miR-3p-2 and the 3’UTR of p53.
3.3 Overexpression of pol-miR-3p-2 promotes autophagy
In higher vertebrates, p53 is known to be a key regulator of autophagy; in fish, regulation of autophagy by p53 has not been documented. Given the above observation that p53 is a target of pol-miR-3p-2, we examined whether pol-miR-3p-2 had any impact on autophagy of flounder cells. For this purpose, flounder FG-9307 cells were transfected with pol-miR-3p-2 mimic, and production of the autophagy marker protein LC3 was monitored. The results showed that transfection with pol-miR-3p-2 mimic, but not with the control miRNA (pol-miR-NC), caused a marked increase in LC3-II protein (Fig. 3). These results suggest that overexpression of pol-miR-3p-2 can effectively induce the autophagy process of flounder.
3.4 Knockdown of p53 enhances the expression of beclin
In mammals, beclin plays a crucial role in autophagy. In this study, to examine whether flounder p53 had any effect on beclin, HEK293T cells were co-transfected with the plasmids expressing flounder beclin (pBeclin-flag) and p53 (pp53-HA) together with the p53-targeting siRNA (siRNA-p53). Subsequent immunoblot showed that the presence of siRNA-p53 dramatically reduced p53 level but increased beclin level, whereas the presence of the nonspecific siRNA (siRNA-NC) had no apparent effect on p53 or beclin (Fig. 4A). Similarly, in flounder FG-9307 cells transfected with siRNA-p53, but not with siRNA-NC, the expression level of beclin was much higher than that in the control cells (Fig. 4B). These results indicate a negative effect 13
Journal Pre-proof
of p53 on beclin protein homeostasis.
3.5 Autophagy is induced in Japanese flounder during E. tarda infection
Since, as shown above, pol-miR-3p-2 regulated autophagy and was responsive to E. tarda infection, we wondered whether autophagy in flounder was a cellular process inducible by E. tarda infection. To investigate this question, the LC3 level was monitored in flounder during E. tarda infection. We found that compared to the control fish, flounder infected with E. tarda for 12 h and 24 h exhibited apparently higher levels of LC3-II (Fig. 5A). Similarly, in cellular study, we found that when FG-9307 cells were infected with E. tarda for 4 h and 8 h, an apparent increase in LC3-II was observed (Fig. 5B). These results suggest that E. tarda can induce autophagy in Japanese flounder both in vivo and in vitro.
3.6 pol-miR-3p-2 suppresses E. tarda infection
With the above observations, we further examined the effect of pol-miR-3p-2 on E. tarda infection. For this purpose, FG-9307 cells were experimented to overexpress pol-miR-3p-2 by transfection with pol-miR-3p-2 mimic and then infected with E. tarda. Bacterial invasion into and replication inside the host cells was then examined by determining the intracellular bacterial load. The results showed that at 4 hpi and 8 hpi, the number of intracellular E. tarda decreased significantly in pol-miR-3p-2-transfected cells compared to that in the control cells (Fig. 6). In contrast, the intracellular bacterial numbers in FG-9307 cells transfected with control miRNA (pol-miR-NC) were comparable to that in the control cells. 14
Journal Pre-proof
4. Discussion
In a previous study, pol-miR-3p-2 was identified as a novel miRNA that was upregulated in expression at the late stage of megalocytivirus infection (Zhang et al., 2014). In the present study, pol-miR-3p-2 expression was found to be upregulated in flounder tissues at 24 h after E. tarda infection and return to normal level at 48 hpi, indicating a relatively early response of pol-miR-3p-2 to the bacterial pathogen. Similar bacteria/virus-regulated expressions have been reported in other fish miRNAs, which exhibited significantly altered expression patterns after bacterial or viral challenge (Cui et al., 2016; Ni et al., 2017). The marked time-dependent responsiveness of pol-miR-3p-2 to both megalocytivirus and E. tarda invasion indicates an involvement, likely tightly regulated in time, of this miRNA in bacterial and viral infection. Luciferase reporter assay showed that the tumor suppressor p53 is a target gene of pol-miR-3p-2. In higher vertebrates, p53 is a transcription factor that, through regulating the expression of multiple target genes, plays a critical role in many cellular aspects, notably cell cycle, cell death, genome integrity, metabolism, and DNA repair (Vogelstein et al., 2000; Vogelstein and Kinzler, 1992). Recent studies revealed that p53 also participates in the regulation of autophagy and plays dual roles depending on its sub-cellular location (Tasdemir et al., 2008). In the nucleus, p53 acts as an inhibitor of autophagy by negatively regulating the mammalian target of rapamycin (mTOR), which is a key regulator of autophagy. This function of p53 is achieved through its target genes, such as PTEN, TSC2, and AMPK, that inhibit mTOR signaling (Feng et al., 2007). In the cytoplasm, p53 can promote autophagy with largely unknown mechanism, but there are evidences indicating that p53 can enhance the mTOR pathway by restraining the AMPK pathway, which leads 15
Journal Pre-proof
to blockage of autophagy induction (Tasdemir et al., 2008). In our study, we found that overexpression of pol-miR-3p-2 in flounder cells markedly affected the autophagy indicator protein LC3 and caused increased production of LC3-II, suggesting enhanced activation of autophagy by pol-miR-3p-2. These results are consistent with the observation that pol-miR-3p-2 represses p53 expression, and indicate that the downstream effect of pol-miR-3p-2 regulation is pro-autophagy. In mammals, beclin is a homologue of yeast ATG6 and essential to autophagy by initiating the formation of autophagosomes (Liang et al., 1999; Pattingre et al., 2008). During the occurrence of autophagy, beclin participates in the formation of the beclin-VPS34-VPS15 core complex, which further induces autophagy (Kang et al., 2011; Russell et al., 2013). Downregulation of p53 was reported to increase the beclin level in human embryonal carcinoma cells, as a result of attenuation of p53-regulated beclin ubiquitination and degradation (Tripathi et al., 2014). In fish, to our knowledge no regulatory relationship between p53 and beclin has been documented. In this study, we found that knockdown of p53 notably enhanced the expression of beclin in FG-9307 cells, indicating a regulatory connection between p53 and autophagy in flounder. Given the results of pol-miR-3p-2, p53, and beclin observed in our study, it is likely that pol-miR-3p-2 induces autophagy through downregulation of p53, which leads to beclin expression and subsequent initiation of the autophagy process. Autophagy is an important mechanism for eukaryocyte to survive under pressure and plays a crucial role in maintaining cell homeostasis (Mizushima, 2007). Autophagy functions in many processes, including innate immunity, infection, and disease. Several pathogenic bacteria have been reported to induce autophagy in mammalian models (Levine et al., 2011; Tumbarello et al., 2015; Verlhac et al., 2015; Virgin and Levine, 2009). In fish, two reports showed that snakehead fish vesiculovirus induced autophagy in striped snakehead 16
Journal Pre-proof
fish cell line, and Shigella flexneri induced autophagy in zebrafish (Mostowy et al., 2013; Wang et al., 2016). In our study, elevated production of LC3-II was observed both in E. tarda-infected Japanese flounder and in E. tarda-infected flounder cell line, indicating an autophagy inducing capacity of E. tarda under both in vivo and in vitro conditions. Previous studies with the intracellular pathogen Burkholderia pseudomallei, the causative agent of melioidosis, showed that B. pseudomallei activated autophagy in RAW 264.7 cells, and autophagy then targeted and killed the invading pathogen (Amano et al., 2006; Rich et al., 2003); in cells with activated autophagy, the intracellular viability of B. pseudomallei decreased, while in autophagy-deficient cells, the intracellular viability of B. pseudomallei was not affected (Cullinane et al., 2008). Similarly, Group A streptococcus (GAS) induced autophagy, which reduced the intracellular viability of GAS, whereas in autophagy-deficient cells, the viability of GAS was not impaired (Nakagawa et al., 2004). In line with these observations in mammalian models, we found in our study that overexpression of pol-miR-3p-2 significantly inhibited intracellular replication and survival of E. tarda in flounder cells, most likely due to the ability of pol-miR-3p-2 to activate autophagy, which subsequently killed or inactivated E. tarda. In summary, our study demonstrated that pol-miR-3p-2 promotes autophagy by negatively regulating the expression of its target gene p53, which in turn regulates the autophagy key factor beclin, thus indicating for the first time the existence of a regulatory link between p53 and autophagy component in fish. Our study also revealed induction of autophagy by the fish pathogen E. tarda and the significant effect of pol-miR-3p-2 on E. tarda infection.
17
Journal Pre-proof
Acknowledgements
This work was supported by the grants of the National Natural Science Foundation of China (31730100), the Shandong Major Science and Technology Innovation Project (2018SDKJ0302-2), and the Taishan Scholar Program of Shandong Province.
18
Journal Pre-proof
References
Abounit, K., Scarabelli, T.M., Mccauley, R.B., 2012. Autophagy in mammalian cells. World J Biol Chem. 3, 1-6. Amano, A., Nakagawa, I., Yoshimori, T., 2006. Autophagy in innate immunity against intracellular bacteria. J Biochem. 140, 161-166. Andreassen, R., Hoyheim, B., 2017. miRNAs associated with immune response in teleost fish. Dev Comp Immunol. 75, 77-85. Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116, 281-297. Chandra, S., Vimal, D., Sharma, D., Rai, V., Gupta, S.C., Chowdhuri, D.K., 2017. Role of miRNAs in development and disease: Lessons learnt from small organisms. Life Sci. 185, 8-14. Chen, W., Yi, L., Feng, S., Zhao, L., Li, J., Zhou, M., Liang, R., Gu, N., Wu, Z., Tu, J., Lin, L., 2017. Characterization of microRNAs in orange-spotted grouper (Epinephelus coioides) fin cells upon red-spotted grouper nervous necrosis virus infection. Fish Shellfish Immunol. 63, 228-236. Chu, Q., Sun, Y., Cui, J., Xu, T., 2017. MicroRNA-3570 Modulates the NF-kappaB Pathway in Teleost Fish by Targeting MyD88. J Immunol. 198, 3274-3282. Cui, J., Chu, Q., Xu, T., 2016. miR-122 involved in the regulation of toll-like receptor signaling pathway after Vibrio anguillarum infection by targeting TLR14 in miiuy croaker. Fish Shellfish Immunol. 58, 67-72. Cullinane, M., Gong, L., Li, X., Lazar-Adler, N., Tra, T., Wolvetang, E., Prescott, M., Boyce, J.D., Devenish, R.J., Adler, B., 2008. Stimulation of autophagy suppresses the intracellular survival of Burkholderia pseudomallei in mammalian cell lines. Autophagy. 4, 744-753. 19
Journal Pre-proof
Denisenko, T.V., Pivnyuk, A.D., Zhivotovsky, B., 2018. p53-Autophagy-Metastasis Link. Cancers (Basel). 10. Eslamloo, K., Inkpen, S.M., Rise, M.L., Andreassen, R., 2018. Discovery of microRNAs associated with the antiviral immune response of Atlantic cod macrophages. Mol Immunol. 93, 152-161. Eulalio, A., Schulte, L., Vogel, J., 2012. The mammalian microRNA response to bacterial infections. RNA Biol. 9, 742-750. Feng, Z., Hu, W., De Stanchina, E., Teresky, A.K., Jin, S., Lowe, S., Levine, A.J., 2007. The regulation of AMPK beta1, TSC2, and PTEN expression by p53: stress, cell and tissue specificity, and the role of these gene products in modulating the IGF-1-AKT-mTOR pathways. Cancer Res. 67, 3043-3053. Gantier, M.P., 2010. New perspectives in MicroRNA regulation of innate immunity. J Interferon Cytokine Res. 30, 283-289. Gracias, D.T., Katsikis, P.D., 2011. MicroRNAs: key components of immune regulation. Adv Exp Med Biol. 780, 15-26. Guan, X.L., Zhang, B.C., Sun, L., 2019. pol-miR-194a of Japanese flounder (Paralichthys olivaceus) suppresses type I interferon response and facilitates Edwardsiella tarda infection. Fish Shellfish Immunol. 87, 220-225. Guo, C., Cui, H., Ni, S., Yan, Y., Qin, Q., 2015. Comprehensive identification and profiling of host miRNAs in response to Singapore grouper iridovirus (SGIV) infection in grouper (Epinephelus coioides). Dev Comp Immunol. 52, 226-235. Gutierrez, M.G., Master, S.S., Singh, S.B., Taylor, G.A., Colombo, M.I., Deretic, V., 2004. Autophagy is a defense mechanism inhibiting BCG and Mycobacterium tuberculosis survival in infected macrophages. Cell. 119, 753-766. Hammond, S.M., 2005. Dicing and slicing: the core machinery of the RNA interference pathway. FEBS Lett. 579, 20
Journal Pre-proof
5822-5829. Han, H.J., Kim, D.H., Lee, D.C., Kim, S.M., Park, S.I., 2006. Pathogenicity of Edwardsiella tarda to olive flounder, Paralichthys olivaceus (Temminck & Schlegel). J Fish Dis. 29, 601-609. He, C., Klionsky, D.J., 2009. Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet. 43, 67-93. Hu, Y.H., Zhang, B.C., Zhou, H.Z., Guan, X.L., Sun, L., 2017. Edwardsiella tarda-induced miRNAs in a teleost host: Global profile and role in bacterial infection as revealed by integrative miRNA-mRNA analysis. Virulence. 8, 1457-1464. Kang, R., Zeh, H.J., Lotze, M.T., Tang, D., 2011. The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ. 18, 571-580. Lee, H.K., Lund, J.M., Ramanathan, B., Mizushima, N., Iwasaki, A., 2007. Autophagy-dependent viral recognition by plasmacytoid dendritic cells. Science. 315, 1398-1401. Levine, B., 2005. Eating oneself and uninvited guests: autophagy-related pathways in cellular defense. Cell. 120, 159-162. Levine, B., Mizushima, N., Virgin, H.W., 2011. Autophagy in immunity and inflammation. Nature. 469, 323-335. Li, H., Sun, Z.P., Li, Q., Jiang, Y.L., 2011. Characterization of an iridovirus detected in rock bream (Oplegnathus fasciatus; Temminck and Schlegel). Bing Du Xue Bao. 27, 158-164.
Li, M., Hu, Y.H., Zheng, W.J., Sun, B.G., Wang, C., Sun, L., 2012. Inv1: an Edwardsiella tarda invasin and a protective immunogen that is required for host infection. Fish Shellfish Immunol. 32, 586–592. Liang, X.H., Jackson, S., Seaman, M., Brown, K., Kempkes, B., Hibshoosh, H., Levine, B., 1999. Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature. 402, 672-676. 21
Journal Pre-proof
Lin, L.T., Dawson, P.W., Richardson, C.D., 2010. Viral interactions with macroautophagy: a double-edged sword. Virology. 402, 1-10. Liu, Y., Liu, Y., Han, M., Du, X., Liu, X., Zhang, Q., Liu, J., 2019. Edwardsiella tarda-induced miR-7a functions as a suppressor in PI3K/AKT/GSK3beta signaling pathway by targeting insulin receptor substrate-2 (IRS2a and IRS2b) in Paralichthys olivaceus. Fish Shellfish Immunol. 89, 477-485. Mizushima, N., 2007. Autophagy: process and function. Genes Dev. 21, 2861-2873. Morishita, H., Mizushima, N., 2019. Diverse Cellular Roles of Autophagy. Annu Rev Cell Dev Biol. Mostowy, S., Boucontet, L., Mazon Moya, M.J., Sirianni, A., Boudinot, P., Hollinshead, M., Cossart, P., Herbomel, P., Levraud, J.P., Colucci-Guyon, E., 2013. The zebrafish as a new model for the in vivo study of Shigella flexneri interaction with phagocytes and bacterial autophagy. PLoS Pathog. 9, e1003588. Nakagawa, I., Amano, A., Mizushima, N., Yamamoto, A., Yamaguchi, H., Kamimoto, T., Nara, A., Funao, J., Nakata, M., Tsuda, K., Hamada, S., Yoshimori, T., 2004. Autophagy defends cells against invading group A Streptococcus. Science. 306, 1037-1040. Ni, S., Yan, Y., Cui, H., Yu, Y., Huang, Y., Qin, Q., 2017. Fish miR-146a promotes Singapore grouper iridovirus infection by regulating cell apoptosis and NF-kappaB activation. J Gen Virol. 98, 1489-1499. Park, S.B., Aoki, T., Jung, T.S., 2012. Pathogenesis of and strategies for preventing Edwardsiella tarda infection in fish. Vet Res. 43, 67. Pattingre, S., Espert, L., Biard-Piechaczyk, M., Codogno, P., 2008. Regulation of macroautophagy by mTOR and Beclin 1 complexes. Biochimie. 90, 313-323. Pillai, R.S., Bhattacharyya, S.N., Filipowicz, W., 2007. Repression of protein synthesis by miRNAs: how many mechanisms? Trends Cell Biol. 17, 118-126. 22
Journal Pre-proof
Rabinowitz, J.D., White, E., 2010. Autophagy and metabolism. Science. 330, 1344-1348. Rich, K.A., Burkett, C., Webster, P., 2003. Cytoplasmic bacteria can be targets for autophagy. Cell Microbiol. 5, 455-468. Russell, R.C., Tian, Y., Yuan, H., Park, H.W., Chang, Y.Y., Kim, J., Kim, H., Neufeld, T.P., Dillin, A., Guan, K.L., 2013. ULK1 induces autophagy by phosphorylating Beclin-1 and activating VPS34 lipid kinase. Nat Cell Biol. 15, 741-750. Saitoh, T., Akira, S., 2010. Regulation of innate immune responses by autophagy-related proteins. J Cell Biol. 189, 925-935. Schulte, L.N., Eulalio, A., Mollenkopf, H.J., Reinhardt, R., Vogel, J., 2011. Analysis of the host microRNA response to Salmonella uncovers the control of major cytokines by the let-7 family. Embo j. 30, 1977-1989. Subramaniam, K., Shariff, M., Omar, A.R., Hair-Bejo, M., 2012. Megalocytivirus infection in fish. Reviews in Aquaculture. 4, 221-233. Tasdemir, E., Maiuri, M.C., Galluzzi, L., Vitale, I., Djavaheri-Mergny, M., D'amelio, M., Criollo, A., Morselli, E., Zhu, C., Harper, F., Nannmark, U., Samara, C., Pinton, P., Vicencio, J.M., Carnuccio, R., Moll, U.M., Madeo, F., Paterlini-Brechot, P., Rizzuto, R., Szabadkai, G., Pierron, G., Blomgren, K., Tavernarakis, N., Codogno, P., Cecconi, F., Kroemer, G., 2008. Regulation of autophagy by cytoplasmic p53. Nat Cell Biol. 10, 676-687. Tong, S.L., Li, H., Miao, H.-Z., 1997. The establishment and partial characterization of a continuous fish cell line FG-9307 from the gill of flounder Paralichthys olivaceus. Aquaculture. 156, 327-333. Tripathi, R., Ash, D., Shaha, C., 2014. Beclin-1-p53 interaction is crucial for cell fate determination in embryonal carcinoma cells. J Cell Mol Med. 18, 2275-2286. Tumbarello, D.A., Manna, P.T., Allen, M., Bycroft, M., Arden, S.D., Kendrick-Jones, J., Buss, F., 2015. The 23
Journal Pre-proof
Autophagy Receptor TAX1BP1 and the Molecular Motor Myosin VI Are Required for Clearance of Salmonella Typhimurium by Autophagy. PLoS Pathog. 11, e1005174. Verlhac, P., Gregoire, I.P., Azocar, O., Petkova, D.S., Baguet, J., Viret, C., Faure, M., 2015. Autophagy receptor NDP52 regulates pathogen-containing autophagosome maturation. Cell Host Microbe. 17, 515-525. Virgin, H.W., Levine, B., 2009. Autophagy genes in immunity. Nat Immunol. 10, 461-470. Vogelstein, B., Kinzler, K.W., 1992. p53 function and dysfunction. Cell. 70, 523-526. Vogelstein, B., Lane, D., Levine, A.J., 2000. Surfing the p53 network. Nature. 408, 307-310. Wang, R.C., Levine, B., 2010. Autophagy in cellular growth control. FEBS Lett. 584, 1417-1426. Wang, Y., Chen, N., Hegazy, A.M., Liu, X., Wu, Z., Liu, X., Zhao, L., Qin, Q., Lan, J., Lin, L., 2016. Autophagy induced by snakehead fish vesiculovirus inhibited its replication in SSN-1 cell line. Fish Shellfish Immunol. 55, 415-422. Xu, T., Chu, Q., Cui, J., Zhao, X., 2018. The inducible microRNA-203 in fish represses the inflammatory responses to Gram-negative bacteria by targeting IL-1 receptor-associated kinase 4. J Biol Chem. 293, 1386-1396. Zhang, B.C., Zhang, J., Sun, L., 2014. In-depth profiling and analysis of host and viral microRNAs in Japanese flounder (Paralichthys olivaceus) infected with megalocytivirus reveal involvement of microRNAs in host-virus interaction in teleost fish. BMC Genomics. 15, 878. Zhang, B.C., Zhou, Z.J., Sun, L., 2016. pol-miR-731, a teleost miRNA upregulated by megalocytivirus, negatively regulates virus-induced type I interferon response, apoptosis, and cell cycle arrest. Sci Rep. 6, 28354. Zhang, M., Sun, K., Sun, L., 2008. Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain. Microbiology. 154, 2060-2069. Zheng, W.J., Sun, L., 2011. Evaluation of housekeeping genes as references for quantitative real time RT-PCR 24
Journal Pre-proof
analysis of gene expression in Japanese flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 30, 638-645. Zhou, X., Li, X., Ye, Y., Zhao, K., Zhuang, Y., Li, Y., Wei, Y., Wu, M., 2014. MicroRNA-302b augments host defense to bacteria by regulating inflammatory responses via feedback to TLR/IRAK4 circuits. Nat Commun. 5, 3619. Zhou, Z., Lin, Z., Pang, X., Shan, P., Wang, J., 2018. MicroRNA regulation of Toll-like receptor signaling pathways in teleost fish. Fish Shellfish Immunol. 75, 32-40. Zhou, Z.J., Sun, L., 2015. CsCTL1, a teleost C-type lectin that promotes antibacterial and antiviral immune defense in a manner that depends on the conserved EPN motif. Dev Comp Immunol. 50, 69-77.
25
Journal Pre-proof
Tables Table 1. Primers used in this study. Primers
Sequence (5’-3’)a
miR-3p-2-RT
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC GCTCAA
miR-3p-2-F
GCGGAACACAGCGATTGGT
miR-3p-2-R
AGTGCAGGGTCCGAGGTATT
3UTR-p53-F
TGATGAAAGCTGCGCACTAGTGAAGCTCGTTGCCTT (SpeⅠ)
3UTR-p53-R
AAAAGATCCTTTATTAAGCTTCCAATTAAAATCTGAT (HindⅢ)
p53-3UTR-mutF
AGCGCTGTACAGTGTTAAGA
p53-3UTR-mutR
ACACTGTACAGCGCTTTGTGTCTAATCAGCTCAAGTTTTC
p53-F
CATCATTTTGGCAAAGAATTCATGGAAGAGCAAGGT (EcoRⅠ)
p53-R
CCATAGATCTGCTAGCTCGAGTCAGTCACTGTCGCTCTG (XhoⅠ)
beclin-F
CATCATTTTGGCAAAGAATTCATGGAGGGCTCCAAG (EcoRⅠ)
beclin-R
CCATAGATCTGCTAGCTCGAGATCTGTTGTAGAACTG (XhoⅠ)
p53-R1
AGCGACAGTGACTGAGAAGCTCGTTGCCTT
p53-F1
TCAGTCACTGTCGCTCTG
p53-R2
CCATAGATCTGCTAGCTCGAGCCAATTAAAATCTGAT (XhoⅠ)
aUnderlined
nucleotides are restriction sites.
26
Journal Pre-proof
Figure legends
Figure 1. Expression of pol-miR-3p-2 in Japanese flounder infected by Edwardsiella tarda. Flounder were infected with or without (control) E. tarda, and pol-miR-3p-2 expression in spleen (A), liver (B) and gill (C) was determined by qRT-PCR at 24 h and 48 h post infection (hpi). Values are the means of triplicate experiments and shown as means ± SD. ** p < 0.01; *p < 0.05
Figure 2. Effect of pol-miR-3p-2 on p53 expression. (A) HEK293T cells were co-transfected with pmiR3p-2-Report plus DEPC-treated water, pmiR3p-2-Report plus pol-miR-NC, pmiR3p-2-Report plus pol-miR-3p-2 mimic, pmiR3p-2-Report plus pol-miR-3p-2-mut mimic, pmiR3p-2-Report-mut plus DEPC-treated water, pmiR3p-2-Report-mut plus pol-miR-NC or pmiR3p-2-Report-mut plus pol-miR-3p-2 mimic. At 24 h after transfection, and luciferase activity was measured. Values are the means of triplicate experiments and shown as means ± SD. **p﹤0.01. (B) HEK293T cells were co-transfected with pp53-3UTR plus DEPC-treated water, pp53-3UTR plus pol-miR-NC, pp53-3UTR plus pol-miR-3p-2 mimic, pp53-3UTR plus pol-miR-3p-2-mut mimic, pp53-3UTR-mut plus DEPC-treated water, pp53-3UTR-mut plus pol-miR-NC or pp53-3UTR-mut plus pol-miR-3p-2 mimic. At 24 h after transfection, p53 protein was detected by Western blot. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. The relative densities of p53/GAPDH are shown at the bottom of the figure.
Figure 3. Effect of pol-miR-3p-2 on autophagy. FG-9307 cells were transfected with or without (control) 27
Journal Pre-proof
pol-miR-3p-2 mimic or pol-miR-NC for 24 h, and LC3-II protein was detected by Western blot. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. The relative densities of LC3-II/GAPDH are shown at the bottom of the figure.
Figure 4. Effect of p53 knockdown on beclin expression. (A) HEK293T cells were co-transfected with the plasmids pBeclin-flag and pp53-HA together with or without siRNA-p53 or siRNA-NC. At 24 h after transfection, p53 and beclin were detected by Western blot. (B) FG-9307 cells were transfected with or without siRNA-p53 or siRNA-NC for 24 h, and beclin was detected by Western blot. In both panels, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control, and the relative densities of p53/GAPDH and beclin/GAPDH are shown at the bottom of the panels.
Figure 5. Expression of LC3-II in Japanese flounder and FG-9307 cells during Edwardsiella tarda infection. (A) Flounder were infected with or without (control) E. tarda, and LC3-II protein in spleen was determined at 12 and 24 h post-infection (hpi) by Western blot. (B) FG-9307 cells were infected with or without (control) E. tarda, and LC3-II was determined at 4 and 8 hpi as above. The relative densities of LC3-II/actin are shown at the bottom of the figure.
Figure 6. Effect of pol-miR-3p-2 on Edwardsiella tarda infection. FG-9307 cells were transfected with or without (control) pol-miR-3p-2 mimic or pol-miR-NC and then infected with E. tarda. At 4 and 8 hour post infection (hpi), intracellular bacterial numbers were determined and shown as colony forming unit (CFU). Values are triplicate experiments and shown as means ± SD. ** p﹤0.01; * p﹤0.05. 28
Journal Pre-proof
Figures
Figure 1
29
Journal Pre-proof
Figure 2
30
Journal Pre-proof
Figure 3
31
Journal Pre-proof
Figure 4
32
Journal Pre-proof
Figure 5
33
Journal Pre-proof
Figure 6
34
Journal Pre-proof
Research highlights ► pol-miR-3p-2 was regulated in expression by Edwardsiella tarda infection. ► pol-miR-3p-2 inhibited
p53 expression and promoted production of LC3-II. ►Knockdown of p53 enhanced the expression of beclin. ► Autophagy was induced in vivo flounder and in vitro during E. tarda infection. ► Overexpression of pol-miR-3p-2 suppressed E. tarda infection in flounder cells.