Leptin and cholecystokinin in Schizothorax prenanti: Molecular cloning, tissue expression, and mRNA expression responses to periprandial changes and fasting

General and Comparative Endocrinology 204 (2014) 13–24

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Leptin and cholecystokinin in Schizothorax prenanti: Molecular cloning, tissue expression, and mRNA expression responses to periprandial changes and fasting Dengyue Yuan, Tao Wang, Chaowei Zhou, Fangjun Lin, Hu Chen, Hongwei Wu, Rongbin Wei, Zhiming Xin, Zhiqiong Li ⇑ Department of Aquaculture, College of Animal Science and Technology, Sichuan Agricultural University, Ya’an, China

a r t i c l e

i n f o

Article history: Received 1 February 2014 Revised 6 May 2014 Accepted 8 May 2014 Available online 20 May 2014 Keywords: Schizothorax prenanti Leptin CCK Tissue distribution Appetite regulation

a b s t r a c t In the present study, full-length cDNA sequences of leptin and cholecystokinin (CCK) were cloned from Schizothorax prenanti (S. prenanti), and applied real-time quantitative PCR to characterize the tissue distribution, and appetite regulatory effects of leptin and CCK in S. prenanti. The S. prenanti leptin and CCK full-length cDNA sequences were 1121 bp and 776 bp in length, encoding the peptide of 171 and 123 amino acid residues, respectively. Tissue distribution analysis showed that leptin mRNA was mainly expressed in the liver of S. prenanti. CCK was widely expressed, with the highest levels of expression in the hypothalamus, myelencephalon, telencephalon and foregut of S. prenanti. The CCK mRNA expression was highly elevated after feeding, whereas the leptin mRNA expression was not affected by single meal. These results suggested that CCK is a postprandial satiety signal in S. prenanti, but leptin might not be. In present study, leptin and CCK gene expression were both decreased after fasting and increased after refeeding, which suggested leptin and CCK might be involved in regulation of appetite in S. prenanti. This study provides an essential groundwork to further elucidate the appetite regulatory systems of leptin and CCK in S. prenanti as well as in other teleosts. Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction Feeding behavior is one of the most essential activities in animals, which is tightly regulated by neuroendocrine factors (Valassi et al., 2008). Leptin and CCK are two hormones that have been recognized to have a major influence on energy balance (Hamann and Matthaei, 1996; Woods et al., 1998). Leptin was first cloned in ob/ob mice in 1994 (Zhang et al., 1994). It is a 167 amino acid peptide hormone belonging to the class-I-helical cytokine family (Zhang et al., 2005). In mammals, leptin is secreted predominantly by white adipose tissue (Friedman and Halaas, 1998), and the level of leptin in circulation is proportional to body fat content (Havel et al., 1996). Leptin has been reported to influence various biological mechanisms, including food intake, fat metabolism, reproduction, hematopoiesis, bone formation, angiogenesis, and immune function (Loffreda et al., 1998; Moran and Phillip, 2003; Sierra-Honigmann et al., 1998; Takeda et al.,

Abbreviations: CCK, cholecystokinin; S. prenanti, Schizothorax prenanti; OB-R, leptin receptor; RACE, rapid amplification of cDNA ends; 3D, three-dimensional. ⇑ Corresponding author. E-mail address: [email protected] (Z. Li). http://dx.doi.org/10.1016/j.ygcen.2014.05.013 0016-6480/Ó 2014 Elsevier Inc. All rights reserved.

2002). Leptin regulates a broad spectrum of homeostatic functions following its binding to the signaling form of its receptor (Yadav et al., 2009). The leptin receptor has at least six isoforms (OB-Ra-f), the main signaling isoform is OB-Rb (Coll et al., 2007). The leptin receptor is expressed in the central nervous system, as well as in a wide spectrum of peripheral tissues (Hoggard et al., 1997; Tartaglia et al., 1995). Circulating leptin acts on receptors in the hypothalamus, where it exerts negative feedback effects on energy intake in mammals (Elmquist et al., 1998). Cholecystokinin (CCK) is a 115 amino acid peptide that is secreted primarily by the GI tract but also synthesized in the brain (Simpson et al., 2012). CCK exerts a number of biological actions including inhibition of food intake and gastric emptying, and stimulation of pancreatic enzyme secretion and gall bladder contraction (Dockray, 2009). Two receptor subtypes mediate the actions of CCK, the CCK-1 receptor located primarily in the GI tract and the CCK-2 receptor predominant in the brain (Moran and Kinzig, 2004). In the mammals, CCK acts at receptors on peripheral vagal afferent terminals to suppress food intake and meal size (Raybould, 2007). The critical importance of leptin and CCK in the control of energy homeostasis has been clearly established in mammals.

14

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

However, in teleosts, studies have provided a less clear picture of the function and regulation mechanism of leptin and CCK. Furthermore, conflicting results existed in studies of leptin. Long-term fasting decreased the hepatic leptin expression in striped bass (Won et al., 2012). In contrast, the hepatic leptin I and II expression in carp did not affected by long-term nutritional regulation (Huising et al., 2006). Treatment with recombinant human leptin has suppressed appetite and body weight in goldfish (De Pedro et al., 2006). However, long-term peripheral treatment on Coho salmon with human leptin did not show such an effect (Baker et al., 2000). CCK also acts as a satiety signal in fish, as it does in mammals (Peterson et al., 2012; Peyon et al., 1999). Both central and peripheral injections of CCK inhibited food intake in goldfish (Himick and Peter, 1994), suggesting that CCK exerts an anorexic function in fish. But the role of CCK in food intake regulation has been studied within just a few fish species, such as goldfish (Himick and Peter, 1994), yellowtail (Murashita et al., 2006), winter flounder (MacDonald and Volkoff, 2009a) and cunner (Babichuk and Volkoff, 2013). The function of CCK in other species remains to be learned. Therefore, further investigation is required to clarify the functions of leptin and CCK in fish. The Schizothorax prenanti (S. prenanti) is an endemic cold-water fish distributed in Southwest China (Song et al., 2006), which displays remarkably low growth rates in nature. The growth rate of fish is closely related to food intake (Grayton and Beamish, 1977; Jobling, 1983). To accelerate the growth rate in aquaculture, it is important to understand the endocrine control of food intake in the S. prenanti. In this study, we have identified and characterized the leptin and CCK cDNA from S. prenanti, analyzed its expression pattern in various tissues of the fish. In addition, we examined the postprandial and feeding status change of leptin and CCK mRNA expression in the S. prenanti.

acclimated to the tanks (100  65  75 cm3) conditions and feeding time for 3 weeks before all experiments. Fish were anesthetized in 0.015% v/v MS-222 (SciYoung, China) before dissection of tissues for total RNA extraction. All animal experiments were performed with the approval of Sichuan Agricultural University Animal Care and Use Committee and in full compliance with ethics guidelines.

2. Material and methods

The nucleotide and deduced protein sequences were analyzed using BLASTn and BLASTp (http://www.ncbi.nlm.nih.gov), and the ORF was predicted using Open Reading Frame Finder (http:// www.ncbi.nlm.nih.gov/gorf/gorf.html). Multiple sequence alignments were generated using clustalx1.83. The cleavage site of the signal peptide was estimated using SignalP Ver. 4.0 program (http://www.cbs.dtu.dk/services/SignalP/). A phylogenetic tree based on the amino acid sequences was constructed by the neighbor-joining method of the ClustalW (http://www.ddbj.nig.ac.jp/ search/clustalw-e.html) and MEGA 5.1 program (http://www.megasoftware.net/index.html). The analysis reliability was assessed

2.1. Animals Fish used in this study were were commercially obtained and reared at Sichuan Agricultural University Farm (Water temperature: 15 °C; Light condition: 12hL/12hD). Except for postprandial study, the fish were fed to satiety twice a day at 09:00 and 17:00 for 30 min, with commercial pellet diet (40% crude protein, 6% fat) (G68, China). During the postprandial experimentations, the fish were fed to satiety once a day at 11:00 for 30 min. Fish were

2.2. Molecular cloning of S. prenanti leptin and CCK Total RNA was isolated from whole brain and liver, using TrizolÒ reagent (TaKaRa, Japan) and treated with RNase free DNase I (TaKaRa, Japan) according to the manufacturer’s protocol. Final RNA concentrations were determined by a photometer (Bio-Rad) fixed at 260 nm and 280 nm wavelength. First-strand cDNA of whole brain and liver with 50 or 30 adaptors added was synthesized using SMART RACE cDNA Construction Kit (Clonetech, USA) for rapid amplification of cDNA ends (RACE) PCR. In order to obtain the full-length S. prenanti leptin and CCK sequences, 30 - and 50 -RACE PCR were performed. Primers for S. prenanti leptin and CCK were designed according to the partial obtained leptin and CCK fragment (50 RACE outer for leptin, leptin-R1; 50 RACE inner for leptin, leptinR2; 30 RACE outer for leptin, leptin-F1; 30 RACE inner for leptin, leptin-F2; 50 RACE outer for CCK, CCK-R1; 50 RACE inner for CCK, CCKR2; 30 RACE outer for CCK, CCK-F1; 30 RACE inner for CCK, CCK-F2; Table 1). The RACE products were purified from agarose gel using the Universal DNA Purification Kit (TIANGEN, China), and cloned into the pMD-19T vector (TaKaRa, Japan). The inserts were sequenced at BGI (Beijing, China). 2.3. Structural analysis

Table 1 Primers sequences and function used in this study. Primer name

Primer sequence (50 –30 )

Applications

Leptin-F Leptin-R Leptin-F1 Leptin-F2 Leptin-R1 Leptin-R2 Leptin-F3 Leptin-R3 CCK-F CCK-R CCK-F1 CCK-F2 CCK-R1 CCK-R2 CCK-F3 CCK-R3 b-Actin-F b-Actin-R 18S-F 18S-R

50 CCACTCAACACAGGAAGCAT30 50 CAATCATTTCAAATTAGCAGCT30 50 AGCCCATCCAAGGTCTCGGGTCTATCGT30 50 AGGGCACCGCCACCCACCACATTACT30 50 TGGCGGTGCCCTCCAAGAAAGCGT30 50 CACGATAGACCCGAGACCTTGGAT30 50 CTTTACCCTGTGGTTCCTGTTG30 50 CGCATAGAGTTCATTCTTTCCT30 50 TGGAATCTGTGTGTGCGT30 50 TCCATCCCAGGTAATCTCT30 50 GAATCTGTGTGTGCGTGCTGCTGGCT30 50 AGCAGAGGATGATGAAGAACCCCGCAGC30 50 GCTGCTGCGGGGTTCTTCATCATCCT30 50 GTGTGGGGAGAGAAAGGCAACTGCTGGT30 50 CACCAGCAGTTGCCTTTCTCT30 50 GCGGGGTTCTTCATCATCCT30 50 CGAGCTGTCTTCCCATCCA30 50 TCACCAACGTAGCTGTCTTTCTG30 50 ACCACCCACAGAATCGAGAAA30 50 GCCTGCGGCTTAATTTGACT30

Leptin cloning Leptin cloning Leptin 30 RACE outer Leptin 30 RACE inner Leptin 50 RACE outer Leptin 50 RACE inner Leptin qPCR Leptin qPCR CCK cloning CCK cloning CCK 30 RACE outer CCK 30 RACE inner CCK 50 RACE outer CCK 50 RACE inner CCK qPCR CCK qPCR b-Actin qPCR b-Actin qPCR 18S qPCR 18S qPCR

b-Actin and 18S were used as housekeeping genes.

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

by 1000 bootstrap replicates. The three-dimensional (3D) structure figures were prepared using PyMOL. 2.4. Tissue distributions of leptin and CCK in S. prenanti All tissues were sampled from 10 fishes (1:1 male-to-female sex ratio), with average body weight of 254.32 ± 9.86 g (all tissues except for ovary and testis: n = 10; ovary and testis: n = 5). The samples were collected from telencephalon, hypothalamus, mesencephalon, cerebellum, myelencephalon, pituitary, eye, heart, liver, spleen, gill, head kidney, trunk kidney, foregut, midgut, hindgut, skin, red muscle, white muscle, ovary and testis. Tissues were flash-frozen in liquid nitrogen, and stored at 80 °C until RNA isolations were performed. The tissue distributions of the mRNA of S. prenanti leptin and CCK were analyzed by real-time quantitative RT-PCR (qPCR) using SYBR Green assays (TaKaRa, Japan) according to the manufacturer’s instructions. Primer set for the RT-PCR of leptin and CCK was designed in the obtained nucleotide sequence (primer set for leptin, leptin-F3 and leptin-R3; primer set for CCK, CCK-F3 and CCK-R3; Table 1). S. prenanti b-actin and 18S were amplified as an internal standard (primer set for b-actin, b-actin-F and b-actin-R; primer set for 18S, 18S-F and 18S-R; Table 1). The qPCR was performed in triplicate for each sample on a CFX96 Real Time PCR Detection System (Bio-Rad, USA) in 25 lL reactions

15

containing the following components: 100 ng of cDNA, 12.5 lL SYBR Premix EXTaq (TaKaRa, Japan), 0.5 lL of each primer (10 lmol/L) and 10.5 lL ddH2O. All samples for mRNA analysis were run once in a single assay. The PCR parameters were 40 cycles at 95 °C for 5 s, 60 °C for 30 s, followed by a dissociation curve analysis of 5 s per step from 65 to 95 °C. The primer amplification efficiency was 96.6% for leptin, 97.3% for CCK, 98.4% for b-actin and 99.2% for 18S, with R2 > 0.99 for all standards curves. The comparative CT method was used to analyze the expression of the target genes. The geometric mean of b-actin and 18S gene was validated as an accurate normalization factor of the relative expression values. All dates of leptin and CCK were normalized by the geometric mean of reference genes. In the figure, all gene expression data was normalized to the value of the highest expression. 2.5. Postprandial expression of leptin and CCK mRNA in S. prenanti The weight-matched fish (average body weight 39.42 ± 3.61 g) were randomly distributed among seven tanks and numbered group 1–7 (n = 15/group). Fish were sampled 3 h prior to feeding (3 h) at group 1, 1 h prior to feeding (1 h) at group 2, upon commencement of feeding (0 h) at group 3, 1 h after feeding (+1 h) and 3 h after feeding (+3 h) at group 4 and group 5, respectively. Two unfed groups (i.e. group 6 and group 7) were sampled at +1 h,

Fig. 1. Nucleotide and predicted amino acid sequences of S. prenanti leptin. The signal peptide region is underlined. The cysteine residues are indicated by double underline.

16

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

and +3 h and served as the control groups. The hypothalamus, foregut and liver samples of fish were collected at the end of experiment. For each group, six individuals were randomly sampled from 15 fishes. The tissues extraction and relative gene expression quantification were conducted as described above.

2.6. Fasting induced changes in leptin and CCK mRNA expression in S. prenanti The weight-matched fish (average body weight 36.75 ± 4.12 g) were randomly distributed among six tanks. Upon commencement

Fig. 2. Molecular characterization of S.prenanti leptin. (A) Alignment of the amino acid sequences of leptin. Residues that are conserved in more than half of the listed peptides are shadowed. Identical amino acids are indicated by an asterisk. Helices (A–D) are marked by solid bars. (B) The 3D structure models of leptin peptide.

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

17

Fig. 3. Phylogenetic analysis of leptin amino acid sequences. Scale bar indicates the substitution rate per residue. Numbers at nodes indicate the bootstrap value, as percentages, obtained for 1000 replicates. GenBank accession numbers: Human leptin (NP_000221); Cattle leptin (NP_776353); Mouse leptin (NP_032519); Chicken leptin (AAC60368); African clawed frog leptin (AAX77665); Tiger salamander leptin (AAY68417); Zebrafish leptin-a (CAP47064); Zebrafish leptin-b (CAP15930); Japanese medaka leptin-a (BAD94448); Japanese medaka leptin-b (BAH24202); Common carp leptin-a-I (CAI30828); Common carp leptin-a-II (CAI30827); Goldfish leptin-a-II (ACL68083); Goldfish leptin-a-II (ACO82076); Grass carp leptin (ACF23048); Arctic char leptin (BAH83535); Atlantic salmon leptin-A1 (ACZ02412); Atlantic salmon leptin-A2 (ADI77098); Rainbow trout leptin (BAG09232); Striped sea-bass leptin (AFD34357); Fugu rubripes leptin (BAD94444); Spotted green pufferfish leptin (BAD94451).

of the study, the six tanks (n = 20/tank) were randomly divided into fed group and fasted group (n = 60/group). The fed group was continued to be fed twice a day, and the fasted group was not. The fasted group was re-fed from day 9 to day 14. Each group was sampled for 6 fish at day 1, 3, 5, 7, 9, 11 and 14. The hypothalamus, foregut and liver were sampled after 2 h of feeding in the fed group, at the same time, same procedures were implemented in the unfed group. The tissues extraction and relative gene expression quantification were conducted as described previously.

one-way ANOVA followed by the Duncan’s multiple range tests was performed in order to identify changes caused by time alone within each treatment group, and an independent betweenvariable t-test was performed to determine significant differences between treatment group and control group at each time point. Significant differences were identified when their values were less than 0.05 (P < 0.05).

2.7. Statistical analysis

3.1. Cloning and sequence analysis of S. prenanti leptin and CCK

Quantitative data are shown as mean ± SEM. Statistical analysis was performed with SPSS version 21.0 (SPSS Inc., Chicago, IL, USA). For postprandial experiment, one-way ANOVA followed by the Duncan’s multiple range tests was performed in order to identify the gene expression changes between preprandial and postprandial, and an independent between-variable t-test was performed to determine significant differences between meal-fed group and control group at each time point. For fasting experiment,

From the RACE PCR, full-length cDNA sequence of leptin and CCK was obtained. The S. prenanti leptin (GenBank Accession No.KJ19 4184) full-length nucleotide sequence was 1121 bp in length, and contained an 109 bp of 50 -untranslated region (50 -UTR), a 496 bp of 30 -untranslated region (30 -UTR) and a 516 bp of open reading frame (ORF) (Fig. 1). The deduced leptin protein is composed of 171 amino acid residues, with a 20 amino acid signal region, a 151 amino acid mature peptide (Fig. 1). The S. prenanti leptin has

3. Results

18

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

Fig. 4. Nucleotide and predicted amino acid sequences of S. prenanti CCK. Putative signal peptides are underlined. The octapeptide of CCK is shaded in gray. The predicted Tyr sulfation site is indicated by double underline.

four a-helices typical of class-I cytokines similar to other species (Fig. 2A). The S. prenanti leptin displayed a high degree of homology (84.80%) with common carp (cyprinus carpio) leptin-a-II followed by goldfish (Carassius auratus auratus) leptin-a-I (82.46%), common carp (cyprinus carpio) leptin a-I (79.53%) and common carp (cyprinus carpio) leptin-a-II (78.70%). The 3D structure models showed strong conservation of tertiary structure between the S. prenanti leptin and other vertebrate leptins. Both of them had the characteristic four-helix bundle topology and disulfide bond (Fig. 2B). In the phylogenetic analysis, teleost leptin was divided from the non-teleost cluster. The teleost cluster comprised two leptin branches (leptin-a and leptin-b), and the S. prenanti leptin was grouped with the fish leptin-a subfamily (Fig. 3). For RACE PCR, a 776 bp full-length CCK (GenBank Accession No. KJ194185) was obtained, including an 86 bp of 50 -UTR, a 318 bp of 30 -UTR and a 372 bp of ORF for a 123 amino acid protein (Fig. 4). The prepro-CCK contained a 21 amino acid signal peptide and a 102 amino acid mature peptide that included the C-terminal octapeptide CCK-8. The S. prenanti CCK showed high identity with the other species (Fig. 5A), such as goldfish (Carassius auratus) CCK (95.12%), grass carp (Ctenopharyngodon idellus) CCK (91.06%) and zebrafish (Danio rerio) CCK (82.11%). The 3D structure models of CCK also showed high conservation of tertiary structure between the S. prenanti CCK and other vertebrate CCKs (Fig. 5B). A phylogenetic analysis of the inferred teleost CCK is differentiated from the CCK of other vertebrates. The teleost cluster comprised two CCK branches (CCK-1 and CCK-2), and the S. prenanti CCK was grouped with the fish CCK-2 subfamily (Fig. 6). 3.2. Tissue distribution of leptin and CCK in S. prenanti The S. prenanti leptin mRNA was mainly expressed in liver while a low expression was found in telencephalon, mesencephalon, cerebellum, myelencephalon, pituitary, heart, ovary and testis (Fig. 7).

For S. prenanti CCK, the high mRNA levels were observed in the hypothalamus, followed by myelencephalon, telencephalon and foregut. Expression levels of CCK appeared to be lower in the mesencephalon, cerebellum, heart, spleen, eye, gill, midgut, hindgut, head kidney, testis, pituitary, liver, skin, trunk kidney, red muscle, white muscle and ovary (Fig. 8). 3.3. Postprandial expression of leptin and CCK mRNA in S. prenanti The liver leptin mRNA expression of fed fish was slightly rose at the first and third hour after feeding compared to preprandial groups, but no significant changes between pre-prandial and post-prandial groups were detected. At the first and third hour after feeding, the leptin expression level of the unfed group was significantly lower compared to the fed group (P < 0.01). Among control fed group, no significant change in leptin mRNA expression was observed (Fig. 9). Quantitative analysis showed that CCK mRNA expression of fed fish was significantly elevated in the hypothalamus after a meal. At the first and third hour after feeding, the hypothalamus CCK expression level of fed fish had a 1.5 and 3.4-fold increase compared to preprandial groups, respectively (P < 0.01). At the third hour after feeding, the foregut CCK mRNA expression of fed fish was highly elevated by 5-fold compared to preprandial groups (P < 0.01). However, no significant changes of foregut CCK mRNA expression were observed at 1 h post-feeding compared to preprandial groups. At the first hour after feeding, the CCK expression level of fed fish in the hypothalamus had a 1.5-fold increase compared to unfed fish (P < 0.01). At the first hour after feeding, the CCK expression level of fed fish in the foregut had a 1.4-fold lower expression than unfed fish (P < 0.01). At the third hour after feeding, the CCK expression level of fed fish in the hypothalamus and foregut had a 3.4 and 2.3-fold increase compared to unfed fish, respectively, (P < 0.01) (Fig. 10).

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

19

Fig. 5. Molecular characterization of S. prenanti CCK. (A) Alignment of the amino acid sequences of CCK. Residues that are conserved in more than half of the listed peptides are shadowed. Identical amino acid is indicated by an asterisk. (B) The 3D structure models of CCK peptide.

3.4. Fasting induced changes in leptin and CCK mRNA expression in S. prenanti The liver leptin mRNA expression of unfed fish had a 2.3, 1.4, 1.7, 1.9-fold decrease compared to 1-, 3–5- and 7-day fed animals, respectively (P < 0.05, P < 0.01). The leptin mRNA expression was

significantly increased after re-feeding. Particularly at 11-day, there was 1.3-fold increase in expression compared to control group (P < 0.01). Among control groups, no significant change in leptin mRNA expression was observed (Fig. 11). For CCK, there was significantly less expression in the hypothalamus than regularly fed controls with 2.9, 2.1, 2.5, 1.5-fold,

20

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

Fig. 6. Phylogenetic analysis of CCK amino acid sequences. Scale bar indicates the substitution rate per residue. Numbers at nodes indicate the bootstrap value, as percentages, obtained for 1000 replicates. GenBank accession numbers: Human CCK (AAA53094); Cattle CCK (AAI14185); Turtle CCK (CAA09334); Chicken CCK (CAB62203); African clawed frog CCK-1 (CAA87638); African clawed frog CCK-2 (CAA87639); White seabream CCK (AEU08492); Spotted green pufferfish CCK-1 (BAC44895); Spotted green pufferfish CCK-2 (BAC44894); Japanese flounder CCK-1 (BAA23734); Japanese flounder CCK-2 (BAC44892); Rainbow trout CCK-N (CAA09809); Rainbow trout CCK-T (CAA09906); Rainbow trout CCK-L (CAA09907); Japanese eel CCK (BAD01500); Zebrafish CCK (XP_001346140); Grass carp CCK (AEI59278); Goldfish CCK (O93464).

respectively (P < 0.01). When 9-day food-deprived fish were re-fed, CCK mRNA expression was significantly increased compared to 1-, 3–5-and 7-day fasted fish and 3.4-fold higher than control group (P < 0.01). Similar to the fasting fish in the hypothalamus, the CCK mRNA expression in the foregut of unfed fish had a 1.3, 1.5, 1.6, 1.4-fold decreased compared to control group, respectively (P < 0.05). After re-feeding, CCK mRNA expression was significantly increased compared to fasted group (P < 0.05). No significant changes in CCK mRNA levels were observed between fed groups (Fig. 12).

4. Discussion In this study, leptin and CCK were cloned, sequenced and their mRNA expression was quantified during different nutritional status for the first time in the S. prenanti. The amino acid sequences of S. prenanti leptin shared low sequence identity with other species and mammal. The amino acid sequences of S. prenanti CCK showed a relatively high degree of homology with other cyprinids compared to other families. Unlike mammals, teleosts have duplicate copies of leptin and CCK genes. Whether all teleost lineage had leptin gene duplications is not clear currently, but the duplications were identified from common carp (Huising et al., 2006), zebrafish (Gorissen et al., 2009), Japanese medaka (Kurokawa and Murashita, 2009) and Atlantic salmon (Rønnestad et al., 2010). So far, it has been reported that two isoforms of CCK were identified from

Japanese flounder, spotted green puffer fish (Kurokawa et al., 2003) and Atlantic salmon (Murashita et al., 2009). Moreover, three isoforms of CCK have been identified from rainbow trout (Jensen et al., 2001). However, we just identified one type of leptin and CCK in this study. It’s possible that S. prenanti has lost one of the copies. Thus, the leptin and CCK system appears to be more complex in teleosts than in tetrapods. The S. prenanti leptin was mainly expressed in the liver, which is consistent with the pattern in common carp (Huising et al., 2006), zebrafish (Gorissen et al., 2009), rainbow trout (Murashita et al., 2008), Japanese medaka (Kurokawa and Murashita, 2009), Atlantic salmon (Rønnestad et al., 2010). In mammals, white adipose tissue is the major site of leptin synthesis (Margetic et al., 2002). The adipose tissue is a major lipid storage organ in the mammals (Scherer, 2006). Like adipose tissue, the liver represents a major lipid storage site in fish (James Henderson and Tocher, 1987; McClelland et al., 1995). In addition to serving as a storage depot, the liver is the major site of lipid biosynthesis (Bell et al., 1978; Leveille et al., 1975). However, the liver is a major yet not the only site of leptin expression in S. prenanti. A high expression of leptin has been observed in S. prenanti ovary, testis and pituitary. It suggested that leptin might play a role in the regulation of reproductive function. Moreover, leptin was also expressed in the brain locations studied in S. prenanti. In our study, leptin was expressed at high levels in mesencephalon, cerebellum and telencephalon. The same result was found in goldfish (Tinoco et al., 2012) and orange-spotted grouper (Zhang et al., 2013).

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

21

Fig. 7. Tissue distribution of leptin mRNA in S. prenanti. The results were expressed as relative expression levels after standardization by b-actin and 18s gene. Error bars represent standard error of the mean (all tissues except for ovary and testis: n = 10; ovary and testis: n = 5). Tep, telencephalon; Hyp, hypothalamus; Mep, mesencephalon; Ceb, cerebellum; Myp, myelencephalon; Pi, pituitary; He, heart; Sp, spleen; Li, liver; Sk, skin; Ey, eye; Gi, gill; Fg, foregut; Mg, midgut; Hg, hindgut; Hk, head kidney; Tk, trunk kidney; Re, red muscle; Wh, white muscle; Te, testis and Ov, ovary.

Fig. 8. Tissue distribution of CCK mRNA in S. prenanti. The results were expressed as relative expression levels after standardization by b-actin and 18s gene. Error bars represent standard error of the mean (all tissues except for ovary and testis: n = 10; ovary and testis: n = 5). Tep, telencephalon; Hyp, hypothalamus; Mep, mesencephalon; Ceb, cerebellum; Myp, myelencephalon; Pi, pituitary; He, heart; Sp, spleen; Li, liver; Sk, skin; Ey, eye; Gi, gill; Fg, foregut; Mg, midgut; Hg, hindgut; Hk, head kidney; Tk, trunk kidney; Re, red muscle; Wh, white muscle; Te, testis and Ov, ovary.

In mammals, CCK is distributed widely throughout the gastrointestinal tract and the central nervous system (Beinfeld, 2001). CCK is highly abundant in cerebral cortex, hippocampus, thalamus and caudate-putamen of mammalian brain (Beinfeld, 2003). In fish, CCK

has also been detected in the central nervous system. Within the winter skate (Raja ocellata) brain, CCK mRNA was high expression in hypothalamus and telencephalon (MacDonald and Volkoff, 2009b). Grass carp CCK mRNA was mainly expressed in

22

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

Fig. 9. Postprandial changes leptin mRNA expression in the liver of S. prenanti. The mRNA expression of leptin was normalized to b-actin and 18s gene. Error bars represent standard error of the mean (n = 6). For each group, six individuals were sampled. The preprandial (3, 1 and 0 h) and postprandial groups (+3, +1 h) that differ significantly are indicated by different letters above bars. Asterisks represent significant differences between the fed and unfed groups at the same time point. ⁄ P < 0.05.

Fig. 10. Postprandial changes CCK mRNA expression in the hypothalamus and foregut of S. prenanti. The mRNA expression of CCK was normalized to b-actin and 18s gene. Error bars represent standard error of the mean (n = 6). For each group, six individuals were sampled. The preprandial (3, 1 and 0 h) and postprandial groups (+3, +1 h) that differ significantly are indicated by different letters above bars. Asterisks represent significant differences between the fed and unfed groups at the same time point. ⁄⁄P < 0.01.

hypohtalmus and pituitary (Feng et al., 2012). In the cunner (Tautogolabrus adspersus), a high level of CCK mRNA expression was found in hypothalamus, optic tectum and telencephalon

Fig. 11. Effects of fasting and refeeding on leptin mRNA expression in the liver of S. prenanti. The mRNA expression of leptin was normalized to b-actin and 18s gene. Error bars represent standard error of the mean (n = 6). Each group was sampled for 6 fish at day 1, 3, 5, 7, 9, 11 and 14. Bars with different letters represent significant differences between experimental groups. Asterisks represent significant differences between the groups at the same time point. No significant changes in leptin mRNA levels were observed between fed groups. ⁄P < 0.05, ⁄⁄P < 0.01.

(Babichuk and Volkoff, 2013). In the present study, S. prenanti CCK mRNA expression was found in all brain regions examined, specifically, a high expression in hypothalamus, telencephalon and myelencephalon has been observed. In the peripheral tissues, CCK gene was mainly concentrated in the proximal small intestine of mammals (Raybould, 2007). In this study, the foregut is a major site of CCK mRNA expression. Our results are similar to what has been observed in the yellowtail (Murashita et al., 2006), larval red drum (Webb et al., 2010) and grass carp (Feng et al., 2012). Leptin did not rise in response to individual meals in human (Kolaczynski et al., 1996). The same results also observed in cat, whose leptin concentrations are not related to diet but to fat mass (Coradini et al., 2013). Postprandial satiety is not thought to be primarily mediated by leptin (Murphy and Bloom, 2006; Pico et al., 2003). A recent study has shown that forebrain signaling by leptin limits food intake on a meal-to-meal basis by regulating the hindbrain response to short-acting satiety signals such as CCK (Morton et al., 2005). In the fish, the relationship between a single meal and leptin is limited and poorly defined. In the carp, the liver expression of leptin-a-I and leptin-a-II displays a marked and significant postprandial peak in expression at 3 and 6 h after feeding, respectively (Huising et al., 2006). In the orange-spotted grouper, hepatic expression of leptin-A mRNA increased significantly 9 h after a single meal (Zhang et al., 2013). However, in our study, the liver leptin mRNA expression was not affected by the postprandial changes. These results suggested that the response of leptin to postprandial change might be species-specific. The postprandial expression of leptin of S. prenanti in unfed group showed a significant lower level compared to the fed ones. It suggested short-term fasting decreased the leptin expression. In mammals, leptin plays a role in the long-term regulation of energy balance (Havel, 2001). Fasting decreases plasma leptin concentration, while refeeding reverses this decline in human (Boden et al., 1996; Kolaczynski et al., 1996). In teleosts, the results of studies about leptin on the long-term regulation of energy balance are inconsistent. In present study, the S. prenanti leptin mRNA expression in the liver was significant decreased during energy restriction, while re-feeding returns leptin to basal levels. The same result was also observed in the striped bass (Won et al., 2012). In the zebrafish, leptin-b expression levels in the liver declined after

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

23

increased within 3 h of feeding in the Atlantic salmon (Valen et al., 2011). In the channel catfish brain, CCK-a mRNA increased 1 h after feeding while CCK-b mRNA increased 4 h after feeding. And there was an increase in channel catfish intestinal CCK-a and CCK-b mRNA 4 h after feeding (Peterson et al., 2012). These studies have shown that the food intake enhances CCK production not only in the gastrointestinal tract but also in the brain. In order to get more information about S. prenanti CCK in the regulation of appetite, we also examined the CCK mRNA expression response to fasting. Following the fasting treatment, the CCK mRNA expression was significantly decreased both in hypothalamic and gut. In the grass carp and cunner, CCK mRNA expression levels in the brain and intestine was significantly decreased after fasting (Babichuk and Volkoff, 2013; Feng et al., 2012). In response to fasting, the CCK mRNA expression also decreased in Atlantic salmon brain (Murashita et al., 2009) and yellowtail anterior intestine (Murashita et al., 2006). Collectively, we speculated that hunger and satiety induce the change of CCK expression both in brain and gut, which in return regulate food intake. In summary, our results suggested that leptin and CCK are likely involved in regulating feeding in the S. prenanti. The findings of this study could be useful for future research to better understand the functions and mechanisms of actions of leptin and CCK in teleosts. 5. Disclosure summary The authors have nothing to disclose. Acknowledgments

Fig. 12. Effects of fasting and refeeding on CCK mRNA expression in the hypothalamus and foregut of S. prenanti. The mRNA expression of CCK was normalized to b-actin and 18s gene. Error bars represent standard error of the mean (n = 6). Each group was sampled for 6 fish at day 1, 3, 5, 7, 9, 11 and 14. Bars with different letters represent significant differences between experimental groups. Asterisks represent significant differences between the groups at the same time point. No significant changes in CCK mRNA levels were observed between fed groups. ⁄P < 0.05, ⁄⁄P < 0.01.

fasting for one week whereas leptin-a expression did not change significantly (Gorissen et al., 2009). After fasting for 10 months, the Atlantic salmon leptin-A2 was significant deceased in the liver and belly flap, but the leptin-A1 was significant increase in the visceral adipose tissue (Rønnestad et al., 2010). Plasma leptin concentration was reduced by 2 weeks fasting in the green sunfish (Johnson et al., 2000). In contrast, plasma leptin levels increase gradually during fasting and decline rapidly after refeeding in the fine flounder (Fuentes et al., 2012). However, leptin mRNA expression did not response to fasting in the common carp, goldfish and catfish (Huising et al., 2006; Kobayashi et al., 2011; Tinoco et al., 2012). This indicates potential differences of the leptin system in response to long-term changes of nutritional status, while the mechanism of which yet to be investigated. There appears to be both a short-term and a long-term system of CCK-controlled feeding behavior and energy balance. CCK is a brain-gut peptide that has long been established to act as a postprandial satiety signal (Chaudhri et al., 2006). The concentration of CCK in the circulation remains elevated for up to 5 h after a meal in human (Liddle et al., 1985). In our study, the CCK mRNA of hypothalamus and foregut increased 3 h after a meal. In the goldfish, the CCK mRNA levels of brain increased 2 h after a meal (Peyon et al., 1999). The CCK-L concentrations of brain significantly

We are very grateful to the company of Runzhao Fisheries (Sichuan, China) for supplying fish. This study was supported by grants from the Major Project of Education Department in Sichuan (12ZA120) and the double branch plan of Sichuan Agricultural University (01570702). Reference Babichuk, N.A., Volkoff, H., 2013. Changes in expression of appetite-regulating hormones in the cunner (Tautogolabrus adspersus) during short-term fasting and winter torpor. Physiol. Behav. 120, 54–63. Baker, D.M., Larsen, D.A., Swanson, P., Dickhoff, W.W., 2000. Long-term peripheral treatment of immature Coho salmon (Oncorhynchus kisutch) with human leptin has no clear physiologic effect. Gen. Comp. Endocrinol. 118, 134–138. Beinfeld, M.C., 2001. An introduction to neuronal cholecystokinin. Peptides 22, 1197–1200. Beinfeld, M.C., 2003. Biosynthesis and processing of pro CCK: recent progress and future challenges. Life Sci. 72, 747–757. Bell, F.P., Patt, C.S., Gillies, P.J., 1978. Effect of phthalate esters on serum cholesterol and lipid biosynthesis in liver, testes, and epididymal fat in the rat and rabbit. Lipids 13, 673–678. Boden, G., Chen, X., Mozzoli, M., Ryan, I., 1996. Effect of fasting on serum leptin in normal human subjects. J. Clin. Endocrinol. Metab. 81, 3419–3423. Chaudhri, O., Small, C., Bloom, S., 2006. Gastrointestinal hormones regulating appetite. Philos. Trans. R. Soc. B: Biol. Sci. 361, 1187–1209. Coll, A.P., Farooqi, I.S., O’Rahilly, S., 2007. The hormonal control of food intake. Cell 129, 251–262. Coradini, M., Rand, J., Morton, J., Arai, T., Ishioka, K., Rawlings, J., 2013. Fat mass, and not diet, has a large effect on postprandial leptin but not on adiponectin concentrations in cats. Domest. Anim. Endocrinol. 45, 79–88. De Pedro, N., Martinez-Alvarez, R., Delgado, M., 2006. Acute and chronic leptin reduces food intake and body weight in goldfish (Carassius auratus). J. Endocrinol. 188, 513–520. Dockray, G.J., 2009. Cholecystokinin and gut–brain signalling. Regul. Pept. 155, 6– 10. Elmquist, J.K., Bjoerbaek, C., Ahima, R.S., Flier, J.S., Saper, C.B., 1998. Distributions of leptin receptor mRNA isoforms in the rat brain. J. Comp. Neurol. 395, 535–547. Feng, K., Zhang, G.-R., Wei, K.-J., Xiong, B.-X., Liang, T., Ping, H.-C., 2012. Molecular characterization of cholecystokinin in grass carp (Ctenopharyngodon idellus): cloning, localization, developmental profile, and effect of fasting and refeeding on expression in the brain and intestine. Fish Physiol. Biochem. 38, 1825–1834. Friedman, J.M., Halaas, J.L., 1998. Leptin and the regulation of body weight in mammals. Nature 395, 763–770.

24

D. Yuan et al. / General and Comparative Endocrinology 204 (2014) 13–24

Fuentes, E.N., Kling, P., Einarsdottir, I.E., Alvarez, M., Valdés, J.A., Molina, A., Björnsson, B.T., 2012. Plasma leptin and growth hormone levels in the fine flounder (Paralichthys adspersus) increase gradually during fasting and decline rapidly after refeeding. Gen. Comp. Endocrinol. 177, 120–127. Gorissen, M., Bernier, N.J., Nabuurs, S.B., Flik, G., Huising, M.O., 2009. Two divergent leptin paralogues in zebrafish (Danio rerio) that originate early in teleostean evolution. J. Endocrinol. 201, 329–339. Grayton, B., Beamish, F., 1977. Effects of feeding frequency on food intake, growth and body composition of rainbow trout (Salmo gairdneri). Aquaculture 11, 159– 172. Hamann, A., Matthaei, S., 1996. Regulation of energy balance by leptin. Exp. Clin. Endocrinol. Diabetes 104, 293–300. Havel, P.J., 2001. Peripheral signals conveying metabolic information to the brain: short-term and long-term regulation of food intake and energy homeostasis. Exp. Biol. Med. 226, 963–977. Havel, P.J., Kasim-Karakas, S., Mueller, W., Johnson, P., Gingerich, R., Stern, J., 1996. Relationship of plasma leptin to plasma insulin and adiposity in normal weight and overweight women: effects of dietary fat content and sustained weight loss. J. Clin. Endocrinol. Metab. 81, 4406–4413. Himick, B.A., Peter, R.E., 1994. CCK/gastrin-like immunoreactivity in brain and gut, and CCK suppression of feeding in goldfish. Am. J. Physiol. Regul. Integr. Comp. Physiol. 267, R841–R851. Hoggard, N., Mercer, J.G., Rayner, D.V., Moar, K., Trayhurn, P., Williams, L.M., 1997. Localization of leptin receptor mRNA splice variants in murine peripheral tissues by RT-PCR and in situ hybridization. Biochem. Biophys. Res. Commun. 232, 383–387. Huising, M.O., Geven, E.J., Kruiswijk, C.P., Nabuurs, S.B., Stolte, E.H., Spanings, F.T., Verburg-van Kemenade, B.L., Flik, G., 2006. Increased leptin expression in common carp (Cyprinus carpio) after food intake but not after fasting or feeding to satiation. Endocrinology 147, 5786–5797. James Henderson, R., Tocher, D.R., 1987. The lipid composition and biochemistry of freshwater fish. Prog. Lipid Res. 26, 281–347. Jensen, H., Rourke, I.J., Moller, M., Jonson, L., Johnsen, A.H., 2001. Identification and distribution of CCK-related peptides and mRNAs in the rainbow trout, Oncorhynchus mykiss. Biochim. Biophys. Acta 1517, 190–201. Jobling, M., 1983. Effect of feeding frequency on food intake and growth of Arctic charr, Salvelinus alpinus L. J. Fish Biol. 23, 177–185. Johnson, R.M., Johnson, T.M., Londraville, R.L., 2000. Evidence for leptin expression in fishes. J. Exp. Zool. 286, 718. Kobayashi, Y., Quiniou, S., Booth, N.J., Peterson, B.C., 2011. Expression of leptin-like peptide (LLP) mRNA in channel catfish (Ictalurus punctatus) is induced by exposure to Edwardsiella ictaluri but is independent of energy status. Gen. Comp. Endocrinol. 173, 411–418. Kolaczynski, J.W., Considine, R.V., Ohannesian, J., Marco, C., Opentanova, I., Nyce, M.R., Myint, M., Caro, J.F., 1996. Responses of leptin to short-term fasting and refeeding in humans: a link with ketogenesis but not ketones themselves. Diabetes 45, 1511–1515. Kurokawa, T., Murashita, K., 2009. Genomic characterization of multiple leptin genes and a leptin receptor gene in the Japanese medaka, Oryzias latipes. Gen. Comp. Endocrinol. 161, 229–237. Kurokawa, T., Suzuki, T., Hashimoto, H., 2003. Identification of gastrin and multiple cholecystokinin genes in teleost. Peptides 24, 227–235. Leveille, G.A., Romsos, D.R., Yeh, Y.-Y., O’Hea, E.K., 1975. Lipid biosynthesis in the chick. A consideration of site of synthesis, influence of diet and possible regulatory mechanisms. Poult. Sci. 54, 1075–1093. Liddle, R.A., Goldfine, I.D., Rosen, M.S., Taplitz, R., Williams, J., 1985. Cholecystokinin bioactivity in human plasma. Molecular forms, responses to feeding, and relationship to gallbladder contraction. J. Clin. Investig. 75, 1144. Loffreda, S., Yang, S., Lin, H., Karp, C., Brengman, M., Wang, D., Klein, A., Bulkley, G., Bao, C., Noble, P., 1998. Leptin regulates proinflammatory immune responses. FASEB J. 12, 57–65. MacDonald, E., Volkoff, H., 2009a. Cloning, distribution and effects of season and nutritional status on the expression of neuropeptide Y (NPY), cocaine and amphetamine regulated transcript (CART) and cholecystokinin (CCK) in winter flounder (Pseudopleuronectes americanus). Horm. Behav. 56, 58–65. MacDonald, E., Volkoff, H., 2009b. Neuropeptide Y (NPY), cocaine- and amphetamine-regulated transcript (CART) and cholecystokinin (CCK) in winter skate (Raja ocellata): cDNA cloning, tissue distribution and mRNA expression responses to fasting. Gen. Comp. Endocrinol. 161, 252–261. Margetic, S., Gazzola, C., Pegg, G., Hill, R., 2002. Leptin: a review of its peripheral actions and interactions. Int. J. Obes. 26, 1407–1433. McClelland, G., Weber, J.-M., Zwingelstein, G., Brichon, G., 1995. Lipid composition off tissue and plasma in two mediterranean fishes, the gilt-head sea bream (Chrysophyrys auratus) and the European seabass (Dicentratchus labrx). Can. J. Fish. Aquat. Sci. 52, 161–170. Moran, T.H., Kinzig, K.P., 2004. Gastrointestinal satiety signals II. Cholecystokinin.. Am. J. Physiol. Gastrointest. Liver Physiol. 286, G183–G188. Moran, O., Phillip, M., 2003. Leptin: obesity, diabetes and other peripheral effects–a review. Pediatr. Diabetes 4, 101–109.

Morton, G.J., Blevins, J.E., Williams, D.L., Niswender, K.D., Gelling, R.W., Rhodes, C.J., Baskin, D.G., Schwartz, M.W., 2005. Leptin action in the forebrain regulates the hindbrain response to satiety signals. J. Clin. Investig. 115, 703–710. Murashita, K., Fukada, H., Hosokawa, H., Masumoto, T., 2006. Cholecystokinin and peptide Y in yellowtail (Seriola quinqueradiata): molecular cloning, real-time quantitative RT-PCR, and response to feeding and fasting. Gen. Comp. Endocrinol. 145, 287–297. Murashita, K., Uji, S., Yamamoto, T., Rønnestad, I., Kurokawa, T., 2008. Production of recombinant leptin and its effects on food intake in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 150, 377–384. Murashita, K., Kurokawa, T., Nilsen, T.O., Rønnestad, I., 2009. Ghrelin, cholecystokinin, and peptide YY in Atlantic salmon (Salmo salar): molecular cloning and tissue expression. Gen. Comp. Endocrinol. 160, 223–235. Murphy, K.G., Bloom, S.R., 2006. Gut hormones and the regulation of energy homeostasis. Nature 444, 854–859. Peterson, B.C., Waldbieser, G.C., Riley Jr, L.G., Upton, K.R., Kobayashi, Y., Small, B.C., 2012. Pre-and postprandial changes in orexigenic and anorexigenic factors in channel catfish (Ictalurus punctatus). Gen. Comp. Endocrinol. 176, 231–239. Peyon, P., Saied, H., Lin, X., Peter, R.E., 1999. Postprandial, seasonal and sexual variations in cholecystokinin gene expression in goldfish brain. Mol. Brain Res. 74, 190–196. Pico, C., Oliver, P., Sanchez, J., Palou, A., 2003. Gastric leptin: a putative role in the short-term regulation of food intake. Br. J. Nutr. 90, 735–741. Raybould, H.E., 2007. Mechanisms of CCK signaling from gut to brain. Curr. Opin. Pharmacol. 7, 570–574. Rønnestad, I., Nilsen, T.O., Murashita, K., Angotzi, A.R., Gamst Moen, A.-G., Stefansson, S.O., Kling, P., Thrandur Björnsson, B., Kurokawa, T., 2010. Leptin and leptin receptor genes in Atlantic salmon: cloning, phylogeny, tissue distribution and expression correlated to long-term feeding status. Gen. Comp. Endocrinol. 168, 55–70. Scherer, P.E., 2006. Adipose tissue from lipid storage compartment to endocrine organ. Diabetes 55, 1537–1545. Sierra-Honigmann, M.R.O., Nath, A.K., Murakami, C., Garcı´a-Cardeña, G., Papapetropoulos, A., Sessa, W.C., Madge, L.A., Schechner, J.S., Polverini, P.J., Polverini, P.J., 1998. Biological action of leptin as an angiogenic factor. Science 281, 1683–1686. Simpson, K., Parker, J., Plumer, J., Bloom, S., 2012. CCK, PYY and PP: the control of energy balance. Appet⁄⁄ite Control. Springer, 209–230. Song, J., Song, Z., Yue, B., Zheng, W., 2006. Assessing genetic diversity of wild populations of Prenantä9s schizothoracin, Schizothorax prenanti, using AFLP markers. Environ. Biol. Fishes 77, 79–86. Takeda, S., Elefteriou, F., Levasseur, R., Liu, X., Zhao, L., Parker, K.L., Armstrong, D., Ducy, P., Karsenty, G., 2002. Leptin regulates bone formation via the sympathetic nervous system. Cell 111, 305–317. Tartaglia, L.A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., Richards, G.J., Campfield, L.A., Clark, F.T., Deeds, J., 1995. Identification and expression cloning of a leptin receptor, OB-R. Cell 83, 1263–1271. Tinoco, A.B., Nisembaum, L.G., Isorna, E., Delgado, M.J., de Pedro, N., 2012. Leptins and leptin receptor expression in the goldfish (Carassius auratus). Regulation by food intake and fasting/overfeeding conditions. Peptides 34, 329–335. Valassi, E., Scacchi, M., Cavagnini, F., 2008. Neuroendocrine control of food intake. Nutr. Metab. Cardiovasc. Dis. 18, 158–168. Valen, R., Jordal, A.-E., Murashita, K., Rønnestad, I., 2011. Postprandial effects on appetite-related neuropeptide expression in the brain of Atlantic salmon, Salmo salar. Gen. Comp. Endocrinol. 171, 359–366. Webb Jr, K.A., Khan, I.A., Nunez, B.S., Rønnestad, I., Holt, G.J., 2010. Cholecystokinin: Molecular cloning and immunohistochemical localization in the gastrointestinal tract of larval red drum, Sciaenops ocellatus (L.). Gen. Comp. Endocrinol. 166, 152–159. Won, E.T., Baltzegar, D.A., Picha, M.E., Borski, R.J., 2012. Cloning and characterization of leptin in a Perciform fish, the striped bass (Morone saxatilis): Control of feeding and regulation by nutritional state. Gen. Comp. Endocrinol. 178, 98– 107. Woods, S.C., Seeley, R.J., Porte, D., Schwartz, M.W., 1998. Signals that regulate food intake and energy homeostasis. Science 280, 1378–1383. Yadav, V.K., Oury, F., Suda, N., Liu, Z.-W., Gao, X.-B., Confavreux, C., Klemenhagen, K.C., Tanaka, K.F., Gingrich, J.A., Guo, X.E., 2009. A serotonin-dependent mechanism explains the leptin regulation of bone mass, appetite, and energy expenditure. Cell 138, 976–989. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J.M., 1994. Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425–432. Zhang, F., Chen, Y., Heiman, M., DiMarchi, R., 2005. Leptin: structure, function and biology. Vitam. Horm. 71, 345–372. Zhang, H., Chen, H., Zhang, Y., Li, S., Lu, D., Zhang, H., Meng, Z., Liu, X., Lin, H., 2013. Molecular cloning, characterization and expression profiles of multiple leptin genes and a leptin receptor gene in orange-spotted grouper (Epinephelus coioides). Gen. Comp. Endocrinol. 181, 295–305.