- Email: [email protected]
nesfatin-1 in Ya-fish (Schizothorax prenanti)
Gene 536 (2014) 238–246
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Molecular characterization, tissue distribution and feeding related changes of NUCB2A/nesfatin-1 in Ya-fish (Schizothorax prenanti) Fangjun Lin 1, Chaowei Zhou 1, Hu Chen, Hongwei Wu, Zhiming Xin, Ju Liu, Yundi Gao, Dengyue Yuan, Tao Wang, Rongbin Wei, Defang Chen, Shiyong Yang, Yan Wang, Yundan Pu, Zhiqiong Li ⁎ Department of Aquaculture, College of Animal Science and Technology, Sichuan Agricultural University, 46# Xinkang Road, Ya'an, China
a r t i c l e
i n f o
Article history: Accepted 12 December 2013 Available online 21 December 2013 Keywords: Ya-fish NUCB2A/Nesfatin-1 Cloning Tissue distribution Fasting
a b s t r a c t The protein nucleobindin-2 (NUCB2) was identified over a decade ago and recently raised great interest as its derived peptide nesfatin-1 was shown to reduce food intake and body weight in rodents. However, the involvement of NUCB2 in feeding behavior has not well been studied in fish. In the present study, we characterized the structure, distribution, and meal responsive of NUCB2A/nesfatin-1 in Ya-fish (Schizothorax prenanti) for the first time. The full length cDNA of Ya-fish was 2140 base pair (bp), which encoded a polypeptide of 487 amino acid residues including a 23 amino acid signal peptide. A high conservation in NUCB2 sequences was found in vertebrates, however the proposed propeptide cleavage site (Arg–Arg) conserved among other species is not present in Ya-fish NUCB2A sequence. Tissue distribution analysis revealed that Ya-fish NUCB2A mRNA was ubiquitously expressed in all test tissues, and abundant expression was detected in several regions including the hypothalamus, hepatopancreas, ovary and intestines. NUCB2A mRNA expression respond to feeding status change may vary and be tissue specific. NUCB2A mRNA levels significantly increased (P b 0.05) in the hypothalamus and intestines after feeding and substantially decreased (P b 0.01) during a week food deprivation in the hypothalamus. Meanwhile, NUCB2A mRNA in the hepatopancreas was significantly elevated (P b 0.001) during food deprivation, and a similar increase was also found after short-time fasting. This points toward a potential hepatopancreas specific local role for NUCB2A in the regulation of metabolism during food deprivation. Collectively, these results provide the molecular and functional evidence to support potential anorectic and metabolic roles for NUCB2A in Ya-fish. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Schizothorax prenanti, more commonly known as Ya-fish, is an endemic valuable cold temperate fish. Unfortunately, overharvesting and habitat loss are hurting the wild population numbers, so developing artificial cultivation becomes an important and urgent step for the utilization and conservation of the Ya-fish. Now, Ya-fish is popularly cultured in the southwest of China with millions of kilograms of fish produced each year, which is raising a high economic value. However, slow growth rate (it takes at least 3 to 5 years to grow into the marketable sizes, about 500 g) has been recognized as a major problem in Ya-fish, increasing the final production cost. Thus, the viability to farm this species requires new knowledge in order to develop new strategies to Abbreviations: NUCB2, Nucleobindin-2; LH, Luteinizing hormone; MS-222, Tricaine methane sulfonate; RT-PCR, Reverse transcription-polymerase chain reaction; RACE, Rapid amplification of cDNA ends; qPCR, Real-time quantitative PCR; bp, Base pair; ORF, Open reading frame; HPG, Hypothalamus-pituitary-gonad; HPO, Hypothalamo–pituitary–ovarian; PVN, Paraventricular nucleus. ⁎ Corresponding author at: Department of Aquaculture, College of Animal Science and Technology, Sichuan Agricultural University, China. Tel.: +86 835 2885654. E-mail address: [email protected] (Z. Li). 1 Fangjun Lin and Chaowei Zhou contributed equally to these work. 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.12.031
improve fish feeding and growth. In this regard, we have used the Yafish as an experimental model and examined the expression of genes related to feeding, growth and reproduction regulation in this species (Wei et al., 2013a,b,c). Feeding, one of the most basic needs common to all animals, is a behavior mediated by complex interactions between the brain and peripheral signals (Harrold et al., 2012; Lenard and Berthoud, 2008). A large number of secreted molecules including orexigenic and anorexigenic neuropeptides in the brain, particularly in the hypothalamus, have become the focus of recent attention for their important roles in the regulation of food intake (Kalra et al., 1999; Volkoff et al., 2005). One such molecule, nesfatin-1, appears to be a particularly interesting substance. Nesfatin-1 is an 82 amino acid regulatory peptide, derived from the precursor nucleobindin-2 (NUCB2) (Oh-I et al., 2006). NUCB2 is present in a number of animals, from hydra to humans, and the nesfatin-1 region displays a high identity among NUCB2 sequences reported thus far (Mohan and Unniappan, 2013). The main function of NUCB2/nesfatin-1 is its pivotal role in regulating feeding by reducing feed intake (Maejima et al., 2009; Oh-I et al., 2006; Stengel et al., 2009b). The underlying mechanisms of anorexigenic effect of nesfatin-1 have been established to be leptin-independent (Maejima et al., 2009; Oh-I et al., 2006). Central nesfatin-1 reduces
F. Lin et al. / Gene 536 (2014) 238–246
food intake is due to the reduction of meal size and decreased meal frequency associated with prolonged inter-meal intervals in mice (Goebel et al., 2011; Stengel et al., 2012). Because most peptides in the brain that regulate food intake also influence digestive processes (Tache et al., 1990), a central modulation of gastrointestinal motor function was also assumed for nesfatin-1. It was demonstrated that lateral brain ventricle injection of nesfatin-1 inhibited gastroduodenal motility and gastric acid secretion and delayed gastric emptying in rodent (Atsuchi et al., 2010; Goebel-Stengel et al., 2011; Stengel et al., 2009a; Xia et al., 2012), an effect that could contribute to the induction of satiety. Recent studies have revealed that nesfatin-1 is expressed not only in neurons of various brain areas, but also in peripheral organs (Ramanjaneya et al., 2010; Stengel et al., 2009b; Zhang et al., 2010). Studies in mice showing that circulating nesfatin-1 can cross the blood–brain barrier by a nonsaturable mechanism (Pan et al., 2007; Price et al., 2007), and peripheral administration of nesfatin-1 reduces food intake (Shimizu et al., 2009). The regulation of feeding, metabolism and reproduction are tightly interlinked (Gonzalez et al., 2012). Negative energy balance due to excessive energy demands or under nutrition has been shown to suppress reproduction (Crown et al., 2007). One report indicates that a functional knockdown of endogenous nesfatin-1 tone in the hypothalamus of female pubertal rats delays vaginal opening and reduces the weight of ovaries as well as the levels of luteinizing hormone (LH) (Garcia-Galiano et al., 2010). Consequently, nesfatin-1 as an appetite regulation hormone should inevitably have an impact on the reproduction. While the appetite regulatory effects of nesfatin-1 are well described in mammals, its role in the regulation of feeding in nonmammalian vertebrates still unclear although the burgeoning evidence for the presence of NUCB2/nesfatin-1 in chicken and goldfish (Gonzalez et al., 2010; Selvan et al., 2007). Here, to investigate whether NUCB2 has the same physiological function on feeding in Ya-fish, we first report the sequence of NUCB2A full-length cDNA in Ya-fish. Furthermore, the tissue distribution of NUCB2A mRNA in Ya-fish was studied. Moreover, the meal related changes in the hypothalamus, intestines and hepatopancreas NUCB2A mRNA expression were identified. Our results showed that NUCB2A mRNA is widely expressed in various tissues of the Ya-fish, and NUCB2A mRNA expression is related to feeding conditions of Ya-fish. These data will provide an initial step toward understanding the biological roles of NUCB2 in fish. 2. Materials and methods 2.1. Animals Ya-fish (236.55 ± 13.73 g body weight) for the cDNA cloning and tissues distribution study were about 3-year-old; one-year-old fish (35.81 ± 3.56 g body weight) were to evaluate meal related changes of NUCB2A mRNA expression. All fish were maintained at Sichuan Agricultural University Farm (Ya'an, China) in indoor tanks (0.5 cubic meter) supplied with a continuous flow of fresh water at 16 ± 1 °C. To reduce the effects of stress on animals, fish were acclimated for a minimum of 2 weeks prior to each study. All fish were fed commercial pellet diet twice a day at 8:00 and 16:00 to satiety unless otherwise stated. Fish were anesthetized in 0.02% tricaine methane sulfonate (MS222) before dissection of tissues for RNA isolations. Samples were collected and stored at −80 °C until total RNA extraction was performed. All experimental protocols using fish were approved by the Regulations for the Administration of Affairs Concerning Experimental Animals and approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from Ya-fish tissues using the RNAiso Plus (Takara, Dalian, China) with the manufacturer's standard protocol. The
239
concentration and integrity of the RNA was assessed by RNA electrophoresis and optical density absorption ratio (A260/280). Samples with an absorption ratio (1.8–2.0) were used for subsequent cDNA synthesis. cDNAs were synthesized using the PrimeScript™ RT reagent Kit (Takara, Dalian, China). First-strand cDNA of whole brain with 5′ or 3′ adaptors added was synthesized using SMART RACE cDNA Construction Kit (BD Biosciences Clonetech, Palo Alto, CA, USA) for rapid amplification of cDNA ends (RACE).
2.3. Molecular cloning The cDNA was used as template for reverse transcriptionpolymerase chain reaction (RT-PCR) with a pair of primers designed from the known homologous sequences in goldfish (Carassius auratus) (HM065567) and zebrafish (Danio rerio) (BC065437). PCR primers used to amplify NUCB2A gene in Ya-fish are listed in Table 1. Briefly, the pair of primers (NUCB2-F, NUCB2-R) was used for the amplification of NUCB2, and these primers were designed based on NUCB2A sequences of zebrafish and goldfish. A partial fragment of the Ya-fish NUCB2A mRNA was gel extracted, purified using a Universal DNA Purification kit (TIANGEN, China). To obtain the entire NUCB2A mRNA sequence, the partial Ya-fish NUCB2A cDNA was fully extended by using 5′RACE and 3′RACE respectively. The gene specific primers were used for 5′RACE and 3′RACE are listed in Table 1. PCR amplification conditions for 5′ and 3′ RACE were as follows: Initial denaturation for 5 min at 94 °C; 5 cycles at 94 °C for 30 s, 70 °C for 30 s, 72 °C for 2 min; 5 cycles at 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 2 min; 25 cycles at 94 °C for 30 s, 66 °C for 30 s, and 72 °C for 2 min; a final extension for 10 min at 72 °C; and then cooled to 4 °C. The PCR amplified fragments were cloned into pMD19-T vector (Takara, Dalian, China) and sequenced at BGI Sequencing (Beijing, China).
Table 1 The primers used for NUCB2 clone and real-time PCR. Primer
Sequence (5′–3′)
Primers for RT-PCR analysis NUCB2-F AACCAATCTGACACCATGT NUCB2-R TGACCTTTCTATGGCACAT 5′RACE primers UPM-Long CTAATACGACTCACTATAGG GCAAGCAGTGGTATCAAC GCAGAGT UPM-Short CTAATACGACTCACTATAGGGC NUCB2-5′ CGCAGCCTCTCCTCCTCCAT R1 TTCAACCA NUCB2-5′ TGCTCCTCTTCTTTCCTCCTGCCCTCCT R2 NUCB2-5′ TGGTTCTCACATGGTGGCTGGC R3 AAAGTC 3′RACE primers NUCB2-3′ GGAGGAGGAGAGGCTGCGAA F1 TGAGAG NUCB2-3′ CGAGGAGGGCAGGAGGAA F2 AGAAGAGGAG Midp GCTGTCAACGATACGCTACGTAACG Insp CGCTACGTAACGGCATGACAGTG Primers for quantitative real-time PCR analysis NUCB2-qF ACGAGGAGGGCAGGAGGAAA NUCB2-qR TGGGGTCAAAATCTTCAG GGTCAA β-actin-F CGAGCTGTCTTCCCATCCA β-actin-R TCACCAACGTAGCTGTCTTTCTG 18S-rRNA-F ACCACCCACAGAATCGAGAAA 18S-rRNAGCCTGCGGCTTAATTTGACT R β-actin and 18S were used as housekeeping genes.
Annealing temperature (°C)
Size
55.0
1522 bp
70.0 → 68.0 → 66.0
70.0 → 68.0 → 66.0
60.0
153 bp
60.0
86 bp
58.0
99 bp
240
F. Lin et al. / Gene 536 (2014) 238–246
Fig. 1. Nucleotide and predicted propeptide cleavage sites in amino acid sequence of Ya-fish NUCB2A mRNA. A is the nucleotide and deduced amino acid sequence of Ya-fish NUCB2A mRNA. The 5′and 3′ untranslated regions are in italics. The gray highlighted character indicates the putative signal peptide. The predicted propeptide cleavage sites required for processing are boxed. Nesfatin-1 peptide region is underlined in black, nesfatin-2 is underlined in wavy line, and nesfatin-3 is underlined with dotted line. The asterisk indicates the stop codon. B shows the signal peptide and general PC cleavage site (Lysine/Arginine residues) prediction results in sequence.
2.4. Structural and phylogenetic analysis
2.5. Tissue distribution of NUCB2A mRNA
The presence and location of signal peptide cleavage sites in amino acid sequence was predicted by SignalP 4.1 server (http:// www.cbs.dtu.dk/services/SignalP/) (Petersen et al., 2011). Prediction of arginine and lysine propeptide cleavage sites was performed by ProP 1.0 server (http://www.cbs.dtu.dk/services/ProP/) (Duckert et al., 2004). Phylogenetic analysis was conducted by using relevant amino acid sequences obtained from the GenBank. Multiple sequence alignments were conducted using ClustalW (http://www.ebi.ac.uk/ clustalw/) (Thompson et al., 1994). A phylogenetic tree based on the amino acid sequences was constructed by the neighbor-joining method in MEGA 5.1 program (http://www.megasoftware.net/index.html) (Kumar et al., 2008).
Real-time quantitative PCR (qPCR) analysis was performed by using the Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Tissues included: pituitary, eye, gill, heart, anterior intestine, middle intestine (midgut), posterior intestine (rectum), hepatopancreas, white muscle, red muscle, head kidney, trunk kidney, skin, spleen, testis, ovary and whole brain in addition to the functional regions, including the telencephalon, hypothalamus, midbrain, parencephalon and hindbrain (n = 10, 1:1 male-to-female sex ratio). Total RNA was extracted and cDNA was synthesized as described previously (Section 2.2). The gene-specific primers used are listed in Table 1. Yafish specific β-actin and 18S-rRNA primers served as internal controls to normalize cDNA quantity for each tissue sample. Quantification of
F. Lin et al. / Gene 536 (2014) 238–246
241
Fig. 1 (continued).
NUCB2A, β-actin and 18S-rRNA mRNA was performed in triplicate on all samples using SYBR Premix Ex Tap−2 (Perfect real time) (TaKaRa, Dalian, China) according to the manufacturer's instructions. The qPCR was conducted as follows: heated to 95 °C for 3 min as initial denaturation, followed by 40 cycles of denaturation at 95 °C for 15 s, and an annealing/extension temperature of 58/60 °C for 30 s. Melting curves were also plotted (60–90 °C) in order to make sure that a single PCR product was amplified for each pair of primers. The qPCR data were obtained as CT values, and analyzed using the comparative Ct method (2− ΔΔCt ) (Livak and Schmittgen, 2001). 2.6. Periprandial expression of NUCB2A mRNA in the hypothalamus, intestines and hepatopancreas Among tissues that expressed NUCB2A mRNA, the hypothalamus, intestines and hepatopancreas were of particular interest because of their well-established role in the regulation of food intake and energy homeostasis. In this study, we examined periprandial (pre- and postfeeding) changes of NUCB2A mRNA expression in the hypothalamus, intestines and hepatopancreas, three tissues that show abundant expression of NUCB2A mRNA. Seven groups of weight-matched Ya-fish (n = 8 per group) were acclimated for 2 weeks to tank conditions and fed daily at a scheduled time (11:00, 0 h) for 2 weeks. The hypothalamus, intestines and hepatopancreas samples were collected at: 3 h prior to feeding (− 3 h), 1 h prior to feeding (− 1 h), upon commencement of feeding (0 h), 1 h after feeding (1 h) and 3 h after feeding (3 h). Two unfed groups were sampled at 1 h, and 3 h and served as the unfed control. 2.7. Fasting induced changes of NUCB2A mRNA in the hypothalamus and hepatopancreas Fasting induces several neuroendocrine changes affecting the expression of appetite regulatory peptides in fish (Gonzalez and Unniappan, 2010; Wan et al., 2012). The objective of this study was to determine whether fasting changes NUCB2A mRNA expression in the hypothalamus and hepatopancreas of Ya-fish during fasting conditions over a one-week period. Six groups of weight-matched Ya-fish (n = 15 per group) were acclimated to tank conditions and fed daily at a scheduled time (16:00) for 2 weeks. Three groups of fish were then not exposed to food for 7 days, while three control groups were
fed daily. The hypothalamus and hepatopancreas were sampled on days 1, 3, 5 and 7 from the fasted fish as well as the fed control at 2 h post-feeding. The remaining unfed fish was refed from day 9 and sampled on days 9, 11 and 14 at 2 h post-refeeding.
2.8. Statistical analysis Expression levels were expressed as a ratio relative to a control group (the highest level of NUCB2A mRNA expression in all studies), which was set at 100%. Statistical analysis was carried out using Student's t-test or one-way ANOVA followed by a Student–Newman– Keul's post hoc test with the SPSS Statistical 18.0 software package (SPSS Inc., Chicago, IL, USA). All data are expressed as mean ± SEM. Differences between means were considered significant at least 95% confidence level (P b 0.05).
3. Results 3.1. Identification and sequencing of Ya-fish NUCB2A cDNA Ya-fish NUCB2A cDNA was amplified from the hepatopancreas and brain and sequenced (Fig. 1A; GenBank accession number: KF214758). The 2140 bp full length NUCB2A cDNA consists of a 196 bp 5′-untranslated region, a 1464 bp ORF and a 480 bp 3′-untranslated region (Fig. 1A). The 487 amino acid residues deduced NUCB2A protein includes a 23 amino acid signal peptide region and a 464 amino acid protein (Fig. 1A). The ProP 1.0 prediction server predicted the potential propeptide cleavage sites and showed the high score for cleavage at the Lys106–Arg107 and Lys179–Arg180 sites (Figs. 1A and B). S. prenanti NUCB2A amino acid sequence has high similarity to NUCB2 or NUCB2A (teleost only) of other vertebrate species such as C. auratus (80.8%), D. rerio (77.9%), Oreochromis niloticus (66.2%), Oryzias latipes (65.8%), Xenopus tropicalis (50.3%), Gallus gallus (50.8%), Mus musculus (46.7%), Bos taurus (48.5%), Homo sapiens (49.4%) (Fig. 2). In the phylogenetic analysis (Fig. 3), the Ya-fish NUCB2A amino acid sequence was clustered with the NUCB2A sequences of other bony fishes, while most strongly clustering with goldfish and zebrafish NUCB2A. The zebrafish NUCB2B sequence was divided from the NUCB2A sequences. In addition, the teleostean NUCB2 paralogous were divided from mammalian, avian, amphibian and with high bootstrap value.
242
F. Lin et al. / Gene 536 (2014) 238–246
3.2. Tissue distribution of NUCB2A mRNA in Ya-fish Ya-fish NUCB2A mRNA levels were analyzed by qPCR. No gender differences in NUCB2A mRNA expression of Ya-fish was observed within the brain, hepatopancreas and intestines, while the level of NUCB2A mRNA expression in ovary was significant higher than the testis (Fig. S2). Since they did not appear to have gender differences in the tissue distribution of NUCB2A mRNA expression, except the gonads. The data (except testis and ovary) shown in Fig. 4 was expressed as the average of the analysis of five males and five females. NUCB2A mRNA was expressed abundantly in the hepatopancreas, ovary, pituitary, fore and middle intestine, trunk kidney, head kidney, whole brain in addition to various regions of the brain, including the telencephalon, hypothalamus and midbrain (Fig. 4, Fig. S1). Relative to the hepatopancreas, lower levels of NUCB2A mRNA expression were detected in the testis, heart, white muscle, eye, gill, spleen, red muscle, rectum (Fig. 4). While the lowest level of NUCB2A mRNA expression was found in the skin (Fig. 4). 3.3. Periprandial expression of NUCB2A mRNA in the hypothalamus, intestines and hepatopancreas Ya-fish NUCB2A mRNA expression significantly increased in the hypothalamus and intestines of fed groups compared to unfed controls after the scheduled feeding time (Figs. 5A and B). Interestingly, there was an about 3.5 and 5-fold increase the levels of NUCB2A mRNA expression in the hepatopancreas of unfed fish compared to fed animals at 1 h and 3 h post-feeding, respectively (Fig. 5C). In unfed, there were no significant differences in the hypothalamus of NUCB2A mRNA expression levels between − 3 h, − 1 h, 0 h, 1 h and 3 h fish (Fig. 5A). In the intestines, levels at − 1 h and 0 h were higher than levels at −3 h, 1 h and 3 h (Fig. 5B). In the hepatopancreas, NUCB2A mRNA expression in unfed fish after the scheduled feeding time significantly higher than that of all other fish (Fig. 5C). In fed fish, there were no significant differences in the hepatopancreas of NUCB2A mRNA expression levels between −3 h, −1 h, 0 h, 1 h and 3 h fish (Fig. 5C). In the hypothalamus and intestines, NUCB2A mRNA expression in fed fish after the scheduled feeding time significantly higher than that of all unfed fish (Figs. 5A and B). 3.4. Fasting induced changes in NUCB2A mRNA expression in the hypothalamus and hepatopancreas Ya-fish hypothalamus NUCB2A mRNA expression of fed daily fish had a significant increase compared to fish deprived of food for 1, 3, 5 or 7 days (Fig. 6A). When 9 day food-deprived fish were refed, the level of NUCB2A mRNA expression detected higher than 9 day fed fish control group, however, no significant changes were observed (Fig. 6A). Similar to the unfed fish in the periprandial study, NUCB2A mRNA expression in the hepatopancreas was significantly elevated in fasted fish (Fig. 6B). Refed after a 9 day fasting brought the NUCB2A mRNA to control levels (Fig. 6B). 4. Discussion The protein NUCB2 was identified over a decade ago and implicated in intracellular processes (Barnikol-Watanabe et al., 1994; Miura et al., 1992). New developments began at the report that posttranslational processing of NUCB2 may produce nesfatin-1, and convergent studies showing that central and periphery administration of nesfatin-1 potently inhibit the food intake and body weight gain in rodents (Goebel et al., 2011; Maejima et al., 2009; Oh-I et al., 2006; Shimizu et al., 2009). Despite the effects of NUCB2 as a new anorexigenic factor and modulator of energy balance in mammals appear to be clear, its information in non-mammalian species is rarely reported. The presence of two paralogous NUCB2 genes, NUCB2A and NUCB2B, in teleost fishes presumably arose due to the teleost-specific
whole-genome duplication known as 3R (third round of genome duplication) (Jaillon et al., 2004; Taylor et al., 2003). In the present study, we cloned the 2140 bp full-length cDNA of NUCB2A from Ya-fish, an important commercial fish species endemic to China, for the first time. Sequence comparative analysis indicated that the sequence we obtained belongs to a subgroup of NUCB2 sequences in teleost fishes called NUCB2A. Amino acid sequences as well as phylogenetic analysis revealed that Ya-fish NUCB2A was highly conserved with the sequence among vertebrates, especially with teleost's such as goldfish (80.8%) and zebrafish (77.9%) (Fig. 2). The deduced protein had a putative signal peptide region of 23 amino acid residues, and followed by a 464 amino acid NUCB2A prohormone. Post-translational processing of a prohormone produces several peptides through cleavage at specific sites by prohormone convertases (Zhou et al., 1999), and NUCB2 through specific potential cleavage sites which consist of a pair of basic amino acids, Lys–Arg or Arg–Arg (Gonzalez et al., 2010; Oh-I et al., 2006). The ProP 1.0 prediction server predicted the sites and the Lys–Arg site is remain conserved in Ya-fish, however another proposed site (Arg–Arg) conserved among other species is not present in Ya-fish NUCB2A sequence, the Arg190 residue was substituted with Gln (Fig. 2). This result cloud evokes for think about an important debate regarding the question whether nesfatin-1 are secreted neuroendocrine transmitters (Stengel and Tache, 2010). To date mature nesfatin-1 was detected only in the cerebrospinal fluid of rats by Oh-I et al. in their initial study (Oh-I et al., 2006), whereas it was not present in hypothalamic protein extracts (Foo et al., 2008; Oh-I et al., 2006) and not in any peripheral tissues (Gonzalez et al., 2009, 2010; Stengel et al., 2009b). The biological roles, if any, of nesfatin-2 and − 3 still remain unknown, and thus far, the processed nesfatin-2 and −3 were not demonstrated in any literatures. Since NUCB2 displays biological activity upon central injection (Oh-I et al., 2006), this raises the possibility that NUCB2 may have a primarily intracellular role as recently suggested (Foo et al., 2008). Alternatively, the full length NUCB2 may be the biologically active compound that is released (Stengel and Tache, 2010). Moreover, the tissue distribution study showed that the Ya-fish NUCB2A mRNA expressed ubiquitously in various organs. Predominant expression was found in the hepatopancreas, hypothalamus, intestines, gonad, pituitary and kidney (Fig. 4, Fig. S1). The wide expression distribution pattern of NUCB2A mRNA in present study has also been observed in goldfish (Gonzalez et al., 2010), further supporting the presence of nesfatin-1 in peripheral tissues, and suggests that nesfatin-1 or other NUCB2 encoded peptides may have pleiotropic actions. For example, NUCB2A mRNA was highly expressed in the hypothalamic and gut, which regulate feeding, indicates a probable function in food intake control; the highest expression in hepatopancreas suggests a potential role in integrating metabolic activity and energy balance. The abundance of NUCB2A mRNA observed in the hypothalamic, pituitary and ovary (Fig. 4, Fig. S1) is suggestive of that NUCB2A probably plays a role in Ya-fish reproduction through actions on all three tissues in the fish hypothalamo–pituitary–ovarian (HPO) axis, which has been confirmed in goldfish (Gonzalez et al., 2012). NUCB2 mRNA expression and nesfatin-1 concentrations has been shown to selectively decrease in the paraventricular nucleus (PVN) under starvation, and serum levels of nesfatin-1 are substantially decreased in food-deprived animals, while refeeding returned NUCB2/ nesfatin-1 back to control levels (Gonzalez et al., 2010; Kohno et al., 2008; Li et al., 2010; Oh-I et al., 2006). However, there is scarce information about the fish NUCB2 mRNA expression profile in related tissues to respond the feeding status change. The present results confirm and extend these findings in teleost. Ya-fish NUCB2A mRNA levels significantly increased in the hypothalamus after feeding, while food deprivation induced substantially decreased NUCB2 mRNA expression, and refeeding restored the reduction (suggesting an anorexigenic effect) (Figs. 5A, 6A). Since the widened anterior portion of the foregut was commonly referred to as pseudogaster in stomachless fish (Field et al., 2003), and in stomach-containing teleost, gastric emptying is usually associated
F. Lin et al. / Gene 536 (2014) 238–246
243
Fig. 2. Comparison of NUCB2 amino acid sequences. The colored amino acids highlight the differences in conservation of the amino acids between species of NUCB2, NUCB2A and NUCB2B (teleost only). In addition, the predicted propeptide cleavage sites are shown in the red box. Species names and GenBank accession numbers used in the alignment were as follows: Carassius auratus (NUCB2A, ADK94363), Schizothorax prenanti (NUCB2A, KF214758), Danio rerio (NUCB2A, AAH65437; NUCB2B, AAH67334), Oreochromis niloticus (NUCB2A, XP_ 003442432), Oryzias latipes (NUCB2A, XP_004067067), Xenopus tropicalis (NUCB2, NP_001015824), Gallus gallus (NUCB2, NP_001006468), Mus musculus (NUCB2, AAH10459), Bos taurus (NUCB2, NP_001068849), and Homo sapiens (NUCB2, NP_005004).
244
F. Lin et al. / Gene 536 (2014) 238–246
Fig. 3. Phylogenetic analysis of NUCB2 amino acid sequences. Scale bar indicates the substitution rate per residue. Each node has a bootstrap value, as percentages, which was obtained for 1000 replicates. NUCB2A and NUCB2B (teleost only).
with a potential return of appetite (Grove et al., 1985; Riche et al., 2004). In support of a role for periphery NUCB2A/nesfatin-1 in the regulation of feeding, NUCB2A mRNA also has been observed dramatically increased in the intestines (Fig. 5B). This finding is consistent with the meal related changes in gastric endocrine cells of rodents (Stengel et al., 2009b). These results may implicate NUCB2A in the central and periphery mediation of post-prandial satiety signals, and highlights the growing evidence in support of a role for nesfatin-1 as a novel brain-gut regulatory peptide. Our results indicate a potential anorexigenic role for
NUCB2A/nesfatin-1 in Ya-fish, further studies are warranted to demonstrate the anorexigenic effect and elucidate the mechanisms of actions. In mammals, brain hypothalamus was the main site of NUCB2 synthesis (Oh-I et al., 2006). In contrast to mammals, our finding indicated that hepatopancreas seemed to be the major organ for NUCB2A in the teleost (Fig. 4). More interestingly, unlike other anorexia hormone such as leptin, NUCB2A mRNA in the hepatopancreas was elevated during food deprivation (Figs. 5C, 6B) other than increase in hepatic leptin expression after feeding (Huising et al., 2006; Tinoco et al., 2012). Thus,
Fig. 4. Differential expression of NUCB2A mRNA in Ya-fish. Quantitative data for NUCB2A mRNA in Ya-fish tissues was obtained by using real-time quantitative PCR. The results were expressed as relative expression levels after standardization by β-actin and 18S-rRNA, which served as a control to verify the quality and amount of samples. Error bars represent standard error of the mean (n = 10 fish, 1:1 male-to-female sex ratio).
F. Lin et al. / Gene 536 (2014) 238–246
245
Fig. 5. Periprandial changes in NUCB2A mRNA abundances in the hypothalamus, hepatopancreas and intestines of fed and unfed Ya-fish. Pre- and post-prandial changes in the expression of NUCB2A mRNA in the hypothalamus (A), intestines (B) and hepatopancreas (C) of fed and unfed Ya-fish. The mRNA expression was normalized to β-actin and 18S-rRNA, and the highest level of NUCB2A mRNA expression was normalized to 100%. Bars with dissimilar superscripts indicate groups that differ significantly (one-way ANOVA followed by a Student– Newman–Keul's post hoc test, P b 0.05). Asterisks represent significant differences between the fed and unfed groups at a given time (Student's t-test, * P b 0.05, ** P b 0.001). Error bars represent standard error of the mean (n = 8 fish/group).
the effects of food deprivation on NUCB2 mRNA expression may vary and be tissue specific. The significant increase in hepatopancreas NUCB2A mRNA is suggesting a direct role for NUCB2A encoded peptides in hepatopancreas function during food deprivation. Recent study shows that nesfatin-1 has an anti-hyperglycemic effect (Su et al., 2010). During the period of fasting, hepatopancreas gluconeogenesis acts as a primary source of glucose to promote the restoration of normoglycemia (Morata et al., 1982). This result further supporting the speculate that this up regulation of hepatopancreas NUCB2A mRNA suggests a potential tissue specific local role for NUCB2A encoded peptides in the regulation of cellular gluconeogenic process in catabolic states (Gonzalez et al., 2010). The role of NUCB2A on hepatopancreas physiology, specifically in different feeding conditions, should be investigated further. There were no gender differences in NUCB2A mRNA expression in the brain, intestines and hepatopancreas of Ya-fish (Fig. S2). This is similar to what has been reported no sex-dependent changes in plasma nesfatin-1 expression (Li et al., 2010; Ramanjaneya et al., 2010). Interestingly, however, the level of NUCB2A mRNA expression in Ya-fish ovary was significant higher than testis (Fig. S2). The differences in the abundance of NUCB2A mRNA in the ovary and testis can also be found in goldfish (Gonzalez et al., 2010). NUCB2 as a modulator of the hypothalamus–pituitary–gonad (HPG) axis has been confirmed involved in rat (female) puberty onset (Garcia-Galiano et al., 2010) and
testicular cell populations (Garcia-Galiano et al., 2012). Thus, there may be some sex-dependent effects of NUCB2 in fish ovary and testis. Furthermore, NUCB2 as an appetite regulation hormone appear to influence reproductive capability in animals (Garcia-Galiano et al., 2010, 2012; Gonzalez et al., 2012), but the nature of this effect needs much more investigation, especially to determine if it has direct effects on reproduction or simply appear to modulate reproduction based on the correlation between energy status and reproduction. Future studies focusing on the tissue-specific effects of NUCB2/nesfatin-1 in the regulation and integration of energy balance and reproduction in fish would be valuable. 5. Conclusion Together, the present study has cloned Ya-fish NUCB2A full-length cDNA, which encodes a 487-amino acid propeptide. The NUCB2A mRNA is widely expressed in various tissues of Ya-fish, and its expression in the hypothalamus, intestines and hepatopancreas with differential altered when feeding status change. These findings may provide new insights into teleost NUCB2 molecule and its food intake regulation characteristics. These data could contribute to future research on the development of feeding strategies in Ya-fish farming, and might also be helpful in dealing with feeding, growth and reproduction issues in other teleost species.
Fig. 6. Food deprivation induced changes in NUCB2A mRNA expression in Ya-fish hypothalamus and hepatopancreas. Food deprivation reduced expression of NUCB2A mRNA in the Ya-fish hypothalamus (A) and increased its expression in the hepatopancreas (B), and refeeding restored the normal levels. The mRNA expression was normalized to β-actin and 18S-rRNA, and the highest level of NUCB2A mRNA expression was normalized to 100%. Asterisks represent significant differences between groups at the same time point. (Student's t-test, * P b 0.01, ** P b 0.001). Error bars represent standard error of the mean (n = 6 fish/group).
246
F. Lin et al. / Gene 536 (2014) 238–246
Disclosure summary The authors have nothing to disclose. Conflict of interest There is no conflict of interest. Acknowledgments This study was supported by grants from the Major Project of Education Department in Sichuan (12ZA120). Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2013.12.031. References Atsuchi, K., et al., 2010. Centrally administered nesfatin-1 inhibits feeding behaviour and gastroduodenal motility in mice. Neuroreport 21, 1008–1011. Barnikol-Watanabe, S., et al., 1994. Human protein NEFA, a novel DNA binding/EF-hand/ leucine zipper protein. Molecular cloning and sequence analysis of the cDNA, isolation and characterization of the protein. Biol. Chem. Hoppe Seyler 375, 497–512. Crown, A., Clifton, D.K., Steiner, R.A., 2007. Neuropeptide signaling in the integration of metabolism and reproduction. Neuroendocrinology 86, 175–182. Duckert, P., Brunak, S., Blom, N., 2004. Prediction of proprotein convertase cleavage sites. Protein Eng. Des. Sel. 17, 107–112. Field, H.A., Ober, E.A., Roeser, T., Stainier, D.Y., 2003. Formation of the digestive system in zebrafish. I. Liver morphogenesis. Dev. Biol. 253, 279–290. Foo, K., Brismar, H., Broberger, C., 2008. Distribution and neuropeptide coexistence of nucleobindin-2 mRNA/nesfatin-like immunoreactivity in the rat CNS. Neuroscience 156, 563–579. Garcia-Galiano, D., et al., 2010. The anorexigenic neuropeptide, nesfatin-1, is indispensable for normal puberty onset in the female rat. J. Neurosci. 30, 7783–7792. Garcia-Galiano, D., et al., 2012. Cellular distribution, regulated expression, and functional role of the anorexigenic peptide, NUCB2/nesfatin-1, in the testis. Endocrinology 153, 1959–1971. Goebel, M., Stengel, A., Wang, L.X., Tache, Y., 2011. Central nesfatin-1 reduces the nocturnal food intake in mice by reducing meal size and increasing inter-meal intervals. Peptides 32, 36–43. Goebel-Stengel, M., Wang, L.X., Stengel, A., Tache, Y., 2011. Localization of nesfatin-1 neurons in the mouse brain and functional implication. Brain Res. 1396, 20–34. Gonzalez, R., Unniappan, S., 2010. Molecular characterization, appetite regulatory effects and feeding related changes of peptide YY in goldfish. Gen. Comp. Endocrinol. 166, 273–279. Gonzalez, R., Tiwari, A., Unniappan, S., 2009. Pancreatic beta cells colocalize insulin and pronesfatin immunoreactivity in rodents. Biochem. Biophys. Res. Commun. 381, 643–648. Gonzalez, R., Kerbel, B., Chun, A., Unniappan, S., 2010. Molecular, cellular and physiological evidences for the anorexigenic actions of nesfatin-1 in goldfish. PLoS One 5, e15201. Gonzalez, R., et al., 2012. Nesfatin-1 regulates the hypothalamo–pituitary–ovarian axis of fish. Biol. Reprod. 87. Grove, D., Moctezuma, M., Flett, H., Foott, J., Watson, T., Flowerdew, M., 1985. Gastric emptying and the return of appetite in juvenile turbot, Scophthalmus maximus L., fed on artificial diets. J. Fish Biol. 26, 339–354. Harrold, J.A., Dovey, T.M., Blundell, J.E., Halford, J.C., 2012. CNS regulation of appetite. Neuropharmacology 63, 3–17. Huising, M.O., et al., 2006. Increased leptin expression in common carp (Cyprinus carpio) after food intake but not after fasting or feeding to satiation. Endocrinology 147, 5786–5797. Jaillon, O., et al., 2004. Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature 431, 946–957. Kalra, S.P., Dube, M.G., Pu, S., Xu, B., Horvath, T.L., Kalra, P.S., 1999. Interacting appetiteregulating pathways in the hypothalamic regulation of body weight. Endocr. Rev. 20, 68–99. Kohno, D., et al., 2008. Nesfatin-1 neurons in paraventricular and supraoptic nuclei of the rat hypothalamus coexpress oxytocin and vasopressin and are activated by refeeding. Endocrinology 149, 1295–1301. Kumar, S., Nei, M., Dudley, J., Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306.
Lenard, N.R., Berthoud, H.R., 2008. Central and peripheral regulation of food intake and physical activity: pathways and genes. Obesity 16, S11–S22. Li, Q.C., Wang, H.Y., Chen, X., Guan, H.Z., Jiang, Z.Y., 2010. Fasting plasma levels of nesfatin1 in patients with type 1 and type 2 diabetes mellitus and the nutrient-related fluctuation of nesfatin-1 level in normal humans. Regul. Pept. 159, 72–77. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Maejima, Y., et al., 2009. Nesfatin-1-regulated oxytocinergic signaling in the paraventricular nucleus causes anorexia through a leptin-independent melanocortin pathway. Cell Metab. 10, 355–365. Miura, K., Titani, K., Kurosawa, Y., Kanai, Y., 1992. Molecular cloning of nucleobindin, a novel DNA-binding protein that contains both a signal peptide and a leucine zipper structure. Biochem. Biophys. Res. Commun. 187, 375–380. Mohan, H., Unniappan, S., 2013. Phylogenetic aspects of nucleobindin-2/nesfatin-1. Curr. Pharm. Des. 19, 6929–6934. Morata, P., Vargas, A.M., Pita, M.L., Sánchez-Medina, F., 1982. Hormonal effects on the liver glucose metabolism in rainbow trout (Salmo gairdneri). Comp. Biochem. Physiol. B 72, 543–545. Oh-I, S., et al., 2006. Identification of nesfatin-1 as a satiety molecule in the hypothalamus. Nature 443, 709–712. Pan, W., Hsuchou, H., Kastin, A.J., 2007. Nesfatin-1 crosses the blood–brain barrier without saturation. Peptides 28, 2223–2228. Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8, 785–786. Price, T.O., Samson, W.K., Niehoff, M.L., Banks, W.A., 2007. Permeability of the blood–brain barrier to a novel satiety molecule nesfatin-1. Peptides 28, 2372–2381. Ramanjaneya, M., et al., 2010. Identification of nesfatin-1 in human and murine adipose tissue: a novel depot-specific adipokine with increased levels in obesity. Endocrinology 151, 3169–3180. Riche, M., Haley, D., Oetker, M., Garbrecht, S., Garling, D., 2004. Effect of feeding frequency on gastric evacuation and the return of appetite in tilapia Oreochromis niloticus (L.). Aquaculture 234, 657–673. Selvan, P.K., Hendricks, G.L., Maddineni, S.R., Krzysik-Walker, S.M., Ocon-Grove, O.M., Ramachandran, R., 2007. Cloning and characterization of chicken nucleobindin-2 (NUCB2) cDNA: the precursor for a putative anorexigenic peptide, nesfatin-1. Poult. Sci. 86, 222–223. Shimizu, H., et al., 2009. Peripheral administration of nesfatin-1 reduces food intake in mice: the leptin-independent mechanism. Endocrinology 150, 662–671. Stengel, A., Tache, Y., 2010. Nesfatin-1—role as possible new potent regulator of food intake. Regul. Pept. 163, 18–23. Stengel, A., et al., 2009a. Central nesfatin-1 reduces dark-phase food intake and gastric emptying in rats: differential role of corticotropin-releasing factor2 receptor. Endocrinology 150, 4911–4919. Stengel, A., et al., 2009b. Identification and characterization of nesfatin-1 immunoreactivity in endocrine cell types of the rat gastric oxyntic mucosa. Endocrinology 150, 232–238. Stengel, A., Goebel-Stengel, M., Wang, L.X., Kato, I., Mori, M., Tache, Y., 2012. Nesfatin1(30–59) but not the N- and C-terminal fragments, nesfatin-1(1–29) and nesfatin1(60–82) injected intracerebroventricularly decreases dark phase food intake by increasing inter-meal intervals in mice. Peptides 35, 143–148. Su, Y., Zhang, J., Tang, Y., Bi, F., Liu, J.N., 2010. The novel function of nesfatin-1: antihyperglycemia. Biochem. Biophys. Res. Commun. 391, 1039–1042. Tache, Y., Garrick, T., Raybould, H., 1990. Central nervous system action of peptides to influence gastrointestinal motor function. Gastroenterology 98, 517–528. Taylor, J.S., Braasch, I., Frickey, T., Meyer, A., Van de Peer, Y., 2003. Genome duplication, a trait shared by 22,000 species of ray-finned fish. Genome Res. 13, 382–390. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Tinoco, A.B., Nisembaum, L.G., Isorna, E., Delgado, M.J., de Pedro, N., 2012. Leptins and leptin receptor expression in the goldfish Carassius auratus. Regulation by food intake and fasting/overfeeding conditions. Peptides 34, 329–335. Volkoff, H., et al., 2005. Neuropeptides and the control of food intake in fish. Gen. Comp. Endocrinol. 142, 3–19. Wan, Y., Zhang, Y., Ji, P., Li, Y., Xu, P., Sun, X., 2012. Molecular characterization of CART, AgRP, and MC4R genes and their expression with fasting and re-feeding in common carp (Cyprinus carpio). Mol. Biol. Rep. 39, 2215–2223. Wei, R., et al., 2013a. Identification, tissue distribution and regulation of preproghrelin in the brain and gut of Schizothorax prenanti. Regul. Pept. 186, 18–25. Wei, R., et al., 2013b. Characterization, tissue distribution and regulation of agouti-related protein (AgRP) in a cyprinid fish Schizothorax prenanti. Gene 527, 193–200. Wei, R., et al., 2013c. Cloning, distribution and effects of fasting status of melanocortin 4 receptor (MC4R) in Schizothorax prenanti. Gene 532, 100–107. Xia, Z.F., et al., 2012. Nesfatin-1 inhibits gastric acid secretion via a central vagal mechanism in rats. Am. J. Physiol. Gastrointest. Liver Physiol. 303, G570–G577. Zhang, A.Q., et al., 2010. Expression of nesfatin-1/NUCB2 in rodent digestive system. World J. Gastroenterol. 16, 1735–1741. Zhou, A., Webb, G., Zhu, X., Steiner, D.F., 1999. Proteolytic processing in the secretory pathway. J. Biol. Chem. 274, 20745–20748.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Molecular characterization, tissue distribution and feeding related changes of NUCB2A/nesfatin-1 in Ya-fish (Schizothorax prenanti) Fangjun Lin 1, Chaowei Zhou 1, Hu Chen, Hongwei Wu, Zhiming Xin, Ju Liu, Yundi Gao, Dengyue Yuan, Tao Wang, Rongbin Wei, Defang Chen, Shiyong Yang, Yan Wang, Yundan Pu, Zhiqiong Li ⁎ Department of Aquaculture, College of Animal Science and Technology, Sichuan Agricultural University, 46# Xinkang Road, Ya'an, China
a r t i c l e
i n f o
Article history: Accepted 12 December 2013 Available online 21 December 2013 Keywords: Ya-fish NUCB2A/Nesfatin-1 Cloning Tissue distribution Fasting
a b s t r a c t The protein nucleobindin-2 (NUCB2) was identified over a decade ago and recently raised great interest as its derived peptide nesfatin-1 was shown to reduce food intake and body weight in rodents. However, the involvement of NUCB2 in feeding behavior has not well been studied in fish. In the present study, we characterized the structure, distribution, and meal responsive of NUCB2A/nesfatin-1 in Ya-fish (Schizothorax prenanti) for the first time. The full length cDNA of Ya-fish was 2140 base pair (bp), which encoded a polypeptide of 487 amino acid residues including a 23 amino acid signal peptide. A high conservation in NUCB2 sequences was found in vertebrates, however the proposed propeptide cleavage site (Arg–Arg) conserved among other species is not present in Ya-fish NUCB2A sequence. Tissue distribution analysis revealed that Ya-fish NUCB2A mRNA was ubiquitously expressed in all test tissues, and abundant expression was detected in several regions including the hypothalamus, hepatopancreas, ovary and intestines. NUCB2A mRNA expression respond to feeding status change may vary and be tissue specific. NUCB2A mRNA levels significantly increased (P b 0.05) in the hypothalamus and intestines after feeding and substantially decreased (P b 0.01) during a week food deprivation in the hypothalamus. Meanwhile, NUCB2A mRNA in the hepatopancreas was significantly elevated (P b 0.001) during food deprivation, and a similar increase was also found after short-time fasting. This points toward a potential hepatopancreas specific local role for NUCB2A in the regulation of metabolism during food deprivation. Collectively, these results provide the molecular and functional evidence to support potential anorectic and metabolic roles for NUCB2A in Ya-fish. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Schizothorax prenanti, more commonly known as Ya-fish, is an endemic valuable cold temperate fish. Unfortunately, overharvesting and habitat loss are hurting the wild population numbers, so developing artificial cultivation becomes an important and urgent step for the utilization and conservation of the Ya-fish. Now, Ya-fish is popularly cultured in the southwest of China with millions of kilograms of fish produced each year, which is raising a high economic value. However, slow growth rate (it takes at least 3 to 5 years to grow into the marketable sizes, about 500 g) has been recognized as a major problem in Ya-fish, increasing the final production cost. Thus, the viability to farm this species requires new knowledge in order to develop new strategies to Abbreviations: NUCB2, Nucleobindin-2; LH, Luteinizing hormone; MS-222, Tricaine methane sulfonate; RT-PCR, Reverse transcription-polymerase chain reaction; RACE, Rapid amplification of cDNA ends; qPCR, Real-time quantitative PCR; bp, Base pair; ORF, Open reading frame; HPG, Hypothalamus-pituitary-gonad; HPO, Hypothalamo–pituitary–ovarian; PVN, Paraventricular nucleus. ⁎ Corresponding author at: Department of Aquaculture, College of Animal Science and Technology, Sichuan Agricultural University, China. Tel.: +86 835 2885654. E-mail address: [email protected] (Z. Li). 1 Fangjun Lin and Chaowei Zhou contributed equally to these work. 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.12.031
improve fish feeding and growth. In this regard, we have used the Yafish as an experimental model and examined the expression of genes related to feeding, growth and reproduction regulation in this species (Wei et al., 2013a,b,c). Feeding, one of the most basic needs common to all animals, is a behavior mediated by complex interactions between the brain and peripheral signals (Harrold et al., 2012; Lenard and Berthoud, 2008). A large number of secreted molecules including orexigenic and anorexigenic neuropeptides in the brain, particularly in the hypothalamus, have become the focus of recent attention for their important roles in the regulation of food intake (Kalra et al., 1999; Volkoff et al., 2005). One such molecule, nesfatin-1, appears to be a particularly interesting substance. Nesfatin-1 is an 82 amino acid regulatory peptide, derived from the precursor nucleobindin-2 (NUCB2) (Oh-I et al., 2006). NUCB2 is present in a number of animals, from hydra to humans, and the nesfatin-1 region displays a high identity among NUCB2 sequences reported thus far (Mohan and Unniappan, 2013). The main function of NUCB2/nesfatin-1 is its pivotal role in regulating feeding by reducing feed intake (Maejima et al., 2009; Oh-I et al., 2006; Stengel et al., 2009b). The underlying mechanisms of anorexigenic effect of nesfatin-1 have been established to be leptin-independent (Maejima et al., 2009; Oh-I et al., 2006). Central nesfatin-1 reduces
F. Lin et al. / Gene 536 (2014) 238–246
food intake is due to the reduction of meal size and decreased meal frequency associated with prolonged inter-meal intervals in mice (Goebel et al., 2011; Stengel et al., 2012). Because most peptides in the brain that regulate food intake also influence digestive processes (Tache et al., 1990), a central modulation of gastrointestinal motor function was also assumed for nesfatin-1. It was demonstrated that lateral brain ventricle injection of nesfatin-1 inhibited gastroduodenal motility and gastric acid secretion and delayed gastric emptying in rodent (Atsuchi et al., 2010; Goebel-Stengel et al., 2011; Stengel et al., 2009a; Xia et al., 2012), an effect that could contribute to the induction of satiety. Recent studies have revealed that nesfatin-1 is expressed not only in neurons of various brain areas, but also in peripheral organs (Ramanjaneya et al., 2010; Stengel et al., 2009b; Zhang et al., 2010). Studies in mice showing that circulating nesfatin-1 can cross the blood–brain barrier by a nonsaturable mechanism (Pan et al., 2007; Price et al., 2007), and peripheral administration of nesfatin-1 reduces food intake (Shimizu et al., 2009). The regulation of feeding, metabolism and reproduction are tightly interlinked (Gonzalez et al., 2012). Negative energy balance due to excessive energy demands or under nutrition has been shown to suppress reproduction (Crown et al., 2007). One report indicates that a functional knockdown of endogenous nesfatin-1 tone in the hypothalamus of female pubertal rats delays vaginal opening and reduces the weight of ovaries as well as the levels of luteinizing hormone (LH) (Garcia-Galiano et al., 2010). Consequently, nesfatin-1 as an appetite regulation hormone should inevitably have an impact on the reproduction. While the appetite regulatory effects of nesfatin-1 are well described in mammals, its role in the regulation of feeding in nonmammalian vertebrates still unclear although the burgeoning evidence for the presence of NUCB2/nesfatin-1 in chicken and goldfish (Gonzalez et al., 2010; Selvan et al., 2007). Here, to investigate whether NUCB2 has the same physiological function on feeding in Ya-fish, we first report the sequence of NUCB2A full-length cDNA in Ya-fish. Furthermore, the tissue distribution of NUCB2A mRNA in Ya-fish was studied. Moreover, the meal related changes in the hypothalamus, intestines and hepatopancreas NUCB2A mRNA expression were identified. Our results showed that NUCB2A mRNA is widely expressed in various tissues of the Ya-fish, and NUCB2A mRNA expression is related to feeding conditions of Ya-fish. These data will provide an initial step toward understanding the biological roles of NUCB2 in fish. 2. Materials and methods 2.1. Animals Ya-fish (236.55 ± 13.73 g body weight) for the cDNA cloning and tissues distribution study were about 3-year-old; one-year-old fish (35.81 ± 3.56 g body weight) were to evaluate meal related changes of NUCB2A mRNA expression. All fish were maintained at Sichuan Agricultural University Farm (Ya'an, China) in indoor tanks (0.5 cubic meter) supplied with a continuous flow of fresh water at 16 ± 1 °C. To reduce the effects of stress on animals, fish were acclimated for a minimum of 2 weeks prior to each study. All fish were fed commercial pellet diet twice a day at 8:00 and 16:00 to satiety unless otherwise stated. Fish were anesthetized in 0.02% tricaine methane sulfonate (MS222) before dissection of tissues for RNA isolations. Samples were collected and stored at −80 °C until total RNA extraction was performed. All experimental protocols using fish were approved by the Regulations for the Administration of Affairs Concerning Experimental Animals and approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from Ya-fish tissues using the RNAiso Plus (Takara, Dalian, China) with the manufacturer's standard protocol. The
239
concentration and integrity of the RNA was assessed by RNA electrophoresis and optical density absorption ratio (A260/280). Samples with an absorption ratio (1.8–2.0) were used for subsequent cDNA synthesis. cDNAs were synthesized using the PrimeScript™ RT reagent Kit (Takara, Dalian, China). First-strand cDNA of whole brain with 5′ or 3′ adaptors added was synthesized using SMART RACE cDNA Construction Kit (BD Biosciences Clonetech, Palo Alto, CA, USA) for rapid amplification of cDNA ends (RACE).
2.3. Molecular cloning The cDNA was used as template for reverse transcriptionpolymerase chain reaction (RT-PCR) with a pair of primers designed from the known homologous sequences in goldfish (Carassius auratus) (HM065567) and zebrafish (Danio rerio) (BC065437). PCR primers used to amplify NUCB2A gene in Ya-fish are listed in Table 1. Briefly, the pair of primers (NUCB2-F, NUCB2-R) was used for the amplification of NUCB2, and these primers were designed based on NUCB2A sequences of zebrafish and goldfish. A partial fragment of the Ya-fish NUCB2A mRNA was gel extracted, purified using a Universal DNA Purification kit (TIANGEN, China). To obtain the entire NUCB2A mRNA sequence, the partial Ya-fish NUCB2A cDNA was fully extended by using 5′RACE and 3′RACE respectively. The gene specific primers were used for 5′RACE and 3′RACE are listed in Table 1. PCR amplification conditions for 5′ and 3′ RACE were as follows: Initial denaturation for 5 min at 94 °C; 5 cycles at 94 °C for 30 s, 70 °C for 30 s, 72 °C for 2 min; 5 cycles at 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 2 min; 25 cycles at 94 °C for 30 s, 66 °C for 30 s, and 72 °C for 2 min; a final extension for 10 min at 72 °C; and then cooled to 4 °C. The PCR amplified fragments were cloned into pMD19-T vector (Takara, Dalian, China) and sequenced at BGI Sequencing (Beijing, China).
Table 1 The primers used for NUCB2 clone and real-time PCR. Primer
Sequence (5′–3′)
Primers for RT-PCR analysis NUCB2-F AACCAATCTGACACCATGT NUCB2-R TGACCTTTCTATGGCACAT 5′RACE primers UPM-Long CTAATACGACTCACTATAGG GCAAGCAGTGGTATCAAC GCAGAGT UPM-Short CTAATACGACTCACTATAGGGC NUCB2-5′ CGCAGCCTCTCCTCCTCCAT R1 TTCAACCA NUCB2-5′ TGCTCCTCTTCTTTCCTCCTGCCCTCCT R2 NUCB2-5′ TGGTTCTCACATGGTGGCTGGC R3 AAAGTC 3′RACE primers NUCB2-3′ GGAGGAGGAGAGGCTGCGAA F1 TGAGAG NUCB2-3′ CGAGGAGGGCAGGAGGAA F2 AGAAGAGGAG Midp GCTGTCAACGATACGCTACGTAACG Insp CGCTACGTAACGGCATGACAGTG Primers for quantitative real-time PCR analysis NUCB2-qF ACGAGGAGGGCAGGAGGAAA NUCB2-qR TGGGGTCAAAATCTTCAG GGTCAA β-actin-F CGAGCTGTCTTCCCATCCA β-actin-R TCACCAACGTAGCTGTCTTTCTG 18S-rRNA-F ACCACCCACAGAATCGAGAAA 18S-rRNAGCCTGCGGCTTAATTTGACT R β-actin and 18S were used as housekeeping genes.
Annealing temperature (°C)
Size
55.0
1522 bp
70.0 → 68.0 → 66.0
70.0 → 68.0 → 66.0
60.0
153 bp
60.0
86 bp
58.0
99 bp
240
F. Lin et al. / Gene 536 (2014) 238–246
Fig. 1. Nucleotide and predicted propeptide cleavage sites in amino acid sequence of Ya-fish NUCB2A mRNA. A is the nucleotide and deduced amino acid sequence of Ya-fish NUCB2A mRNA. The 5′and 3′ untranslated regions are in italics. The gray highlighted character indicates the putative signal peptide. The predicted propeptide cleavage sites required for processing are boxed. Nesfatin-1 peptide region is underlined in black, nesfatin-2 is underlined in wavy line, and nesfatin-3 is underlined with dotted line. The asterisk indicates the stop codon. B shows the signal peptide and general PC cleavage site (Lysine/Arginine residues) prediction results in sequence.
2.4. Structural and phylogenetic analysis
2.5. Tissue distribution of NUCB2A mRNA
The presence and location of signal peptide cleavage sites in amino acid sequence was predicted by SignalP 4.1 server (http:// www.cbs.dtu.dk/services/SignalP/) (Petersen et al., 2011). Prediction of arginine and lysine propeptide cleavage sites was performed by ProP 1.0 server (http://www.cbs.dtu.dk/services/ProP/) (Duckert et al., 2004). Phylogenetic analysis was conducted by using relevant amino acid sequences obtained from the GenBank. Multiple sequence alignments were conducted using ClustalW (http://www.ebi.ac.uk/ clustalw/) (Thompson et al., 1994). A phylogenetic tree based on the amino acid sequences was constructed by the neighbor-joining method in MEGA 5.1 program (http://www.megasoftware.net/index.html) (Kumar et al., 2008).
Real-time quantitative PCR (qPCR) analysis was performed by using the Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Tissues included: pituitary, eye, gill, heart, anterior intestine, middle intestine (midgut), posterior intestine (rectum), hepatopancreas, white muscle, red muscle, head kidney, trunk kidney, skin, spleen, testis, ovary and whole brain in addition to the functional regions, including the telencephalon, hypothalamus, midbrain, parencephalon and hindbrain (n = 10, 1:1 male-to-female sex ratio). Total RNA was extracted and cDNA was synthesized as described previously (Section 2.2). The gene-specific primers used are listed in Table 1. Yafish specific β-actin and 18S-rRNA primers served as internal controls to normalize cDNA quantity for each tissue sample. Quantification of
F. Lin et al. / Gene 536 (2014) 238–246
241
Fig. 1 (continued).
NUCB2A, β-actin and 18S-rRNA mRNA was performed in triplicate on all samples using SYBR Premix Ex Tap−2 (Perfect real time) (TaKaRa, Dalian, China) according to the manufacturer's instructions. The qPCR was conducted as follows: heated to 95 °C for 3 min as initial denaturation, followed by 40 cycles of denaturation at 95 °C for 15 s, and an annealing/extension temperature of 58/60 °C for 30 s. Melting curves were also plotted (60–90 °C) in order to make sure that a single PCR product was amplified for each pair of primers. The qPCR data were obtained as CT values, and analyzed using the comparative Ct method (2− ΔΔCt ) (Livak and Schmittgen, 2001). 2.6. Periprandial expression of NUCB2A mRNA in the hypothalamus, intestines and hepatopancreas Among tissues that expressed NUCB2A mRNA, the hypothalamus, intestines and hepatopancreas were of particular interest because of their well-established role in the regulation of food intake and energy homeostasis. In this study, we examined periprandial (pre- and postfeeding) changes of NUCB2A mRNA expression in the hypothalamus, intestines and hepatopancreas, three tissues that show abundant expression of NUCB2A mRNA. Seven groups of weight-matched Ya-fish (n = 8 per group) were acclimated for 2 weeks to tank conditions and fed daily at a scheduled time (11:00, 0 h) for 2 weeks. The hypothalamus, intestines and hepatopancreas samples were collected at: 3 h prior to feeding (− 3 h), 1 h prior to feeding (− 1 h), upon commencement of feeding (0 h), 1 h after feeding (1 h) and 3 h after feeding (3 h). Two unfed groups were sampled at 1 h, and 3 h and served as the unfed control. 2.7. Fasting induced changes of NUCB2A mRNA in the hypothalamus and hepatopancreas Fasting induces several neuroendocrine changes affecting the expression of appetite regulatory peptides in fish (Gonzalez and Unniappan, 2010; Wan et al., 2012). The objective of this study was to determine whether fasting changes NUCB2A mRNA expression in the hypothalamus and hepatopancreas of Ya-fish during fasting conditions over a one-week period. Six groups of weight-matched Ya-fish (n = 15 per group) were acclimated to tank conditions and fed daily at a scheduled time (16:00) for 2 weeks. Three groups of fish were then not exposed to food for 7 days, while three control groups were
fed daily. The hypothalamus and hepatopancreas were sampled on days 1, 3, 5 and 7 from the fasted fish as well as the fed control at 2 h post-feeding. The remaining unfed fish was refed from day 9 and sampled on days 9, 11 and 14 at 2 h post-refeeding.
2.8. Statistical analysis Expression levels were expressed as a ratio relative to a control group (the highest level of NUCB2A mRNA expression in all studies), which was set at 100%. Statistical analysis was carried out using Student's t-test or one-way ANOVA followed by a Student–Newman– Keul's post hoc test with the SPSS Statistical 18.0 software package (SPSS Inc., Chicago, IL, USA). All data are expressed as mean ± SEM. Differences between means were considered significant at least 95% confidence level (P b 0.05).
3. Results 3.1. Identification and sequencing of Ya-fish NUCB2A cDNA Ya-fish NUCB2A cDNA was amplified from the hepatopancreas and brain and sequenced (Fig. 1A; GenBank accession number: KF214758). The 2140 bp full length NUCB2A cDNA consists of a 196 bp 5′-untranslated region, a 1464 bp ORF and a 480 bp 3′-untranslated region (Fig. 1A). The 487 amino acid residues deduced NUCB2A protein includes a 23 amino acid signal peptide region and a 464 amino acid protein (Fig. 1A). The ProP 1.0 prediction server predicted the potential propeptide cleavage sites and showed the high score for cleavage at the Lys106–Arg107 and Lys179–Arg180 sites (Figs. 1A and B). S. prenanti NUCB2A amino acid sequence has high similarity to NUCB2 or NUCB2A (teleost only) of other vertebrate species such as C. auratus (80.8%), D. rerio (77.9%), Oreochromis niloticus (66.2%), Oryzias latipes (65.8%), Xenopus tropicalis (50.3%), Gallus gallus (50.8%), Mus musculus (46.7%), Bos taurus (48.5%), Homo sapiens (49.4%) (Fig. 2). In the phylogenetic analysis (Fig. 3), the Ya-fish NUCB2A amino acid sequence was clustered with the NUCB2A sequences of other bony fishes, while most strongly clustering with goldfish and zebrafish NUCB2A. The zebrafish NUCB2B sequence was divided from the NUCB2A sequences. In addition, the teleostean NUCB2 paralogous were divided from mammalian, avian, amphibian and with high bootstrap value.
242
F. Lin et al. / Gene 536 (2014) 238–246
3.2. Tissue distribution of NUCB2A mRNA in Ya-fish Ya-fish NUCB2A mRNA levels were analyzed by qPCR. No gender differences in NUCB2A mRNA expression of Ya-fish was observed within the brain, hepatopancreas and intestines, while the level of NUCB2A mRNA expression in ovary was significant higher than the testis (Fig. S2). Since they did not appear to have gender differences in the tissue distribution of NUCB2A mRNA expression, except the gonads. The data (except testis and ovary) shown in Fig. 4 was expressed as the average of the analysis of five males and five females. NUCB2A mRNA was expressed abundantly in the hepatopancreas, ovary, pituitary, fore and middle intestine, trunk kidney, head kidney, whole brain in addition to various regions of the brain, including the telencephalon, hypothalamus and midbrain (Fig. 4, Fig. S1). Relative to the hepatopancreas, lower levels of NUCB2A mRNA expression were detected in the testis, heart, white muscle, eye, gill, spleen, red muscle, rectum (Fig. 4). While the lowest level of NUCB2A mRNA expression was found in the skin (Fig. 4). 3.3. Periprandial expression of NUCB2A mRNA in the hypothalamus, intestines and hepatopancreas Ya-fish NUCB2A mRNA expression significantly increased in the hypothalamus and intestines of fed groups compared to unfed controls after the scheduled feeding time (Figs. 5A and B). Interestingly, there was an about 3.5 and 5-fold increase the levels of NUCB2A mRNA expression in the hepatopancreas of unfed fish compared to fed animals at 1 h and 3 h post-feeding, respectively (Fig. 5C). In unfed, there were no significant differences in the hypothalamus of NUCB2A mRNA expression levels between − 3 h, − 1 h, 0 h, 1 h and 3 h fish (Fig. 5A). In the intestines, levels at − 1 h and 0 h were higher than levels at −3 h, 1 h and 3 h (Fig. 5B). In the hepatopancreas, NUCB2A mRNA expression in unfed fish after the scheduled feeding time significantly higher than that of all other fish (Fig. 5C). In fed fish, there were no significant differences in the hepatopancreas of NUCB2A mRNA expression levels between −3 h, −1 h, 0 h, 1 h and 3 h fish (Fig. 5C). In the hypothalamus and intestines, NUCB2A mRNA expression in fed fish after the scheduled feeding time significantly higher than that of all unfed fish (Figs. 5A and B). 3.4. Fasting induced changes in NUCB2A mRNA expression in the hypothalamus and hepatopancreas Ya-fish hypothalamus NUCB2A mRNA expression of fed daily fish had a significant increase compared to fish deprived of food for 1, 3, 5 or 7 days (Fig. 6A). When 9 day food-deprived fish were refed, the level of NUCB2A mRNA expression detected higher than 9 day fed fish control group, however, no significant changes were observed (Fig. 6A). Similar to the unfed fish in the periprandial study, NUCB2A mRNA expression in the hepatopancreas was significantly elevated in fasted fish (Fig. 6B). Refed after a 9 day fasting brought the NUCB2A mRNA to control levels (Fig. 6B). 4. Discussion The protein NUCB2 was identified over a decade ago and implicated in intracellular processes (Barnikol-Watanabe et al., 1994; Miura et al., 1992). New developments began at the report that posttranslational processing of NUCB2 may produce nesfatin-1, and convergent studies showing that central and periphery administration of nesfatin-1 potently inhibit the food intake and body weight gain in rodents (Goebel et al., 2011; Maejima et al., 2009; Oh-I et al., 2006; Shimizu et al., 2009). Despite the effects of NUCB2 as a new anorexigenic factor and modulator of energy balance in mammals appear to be clear, its information in non-mammalian species is rarely reported. The presence of two paralogous NUCB2 genes, NUCB2A and NUCB2B, in teleost fishes presumably arose due to the teleost-specific
whole-genome duplication known as 3R (third round of genome duplication) (Jaillon et al., 2004; Taylor et al., 2003). In the present study, we cloned the 2140 bp full-length cDNA of NUCB2A from Ya-fish, an important commercial fish species endemic to China, for the first time. Sequence comparative analysis indicated that the sequence we obtained belongs to a subgroup of NUCB2 sequences in teleost fishes called NUCB2A. Amino acid sequences as well as phylogenetic analysis revealed that Ya-fish NUCB2A was highly conserved with the sequence among vertebrates, especially with teleost's such as goldfish (80.8%) and zebrafish (77.9%) (Fig. 2). The deduced protein had a putative signal peptide region of 23 amino acid residues, and followed by a 464 amino acid NUCB2A prohormone. Post-translational processing of a prohormone produces several peptides through cleavage at specific sites by prohormone convertases (Zhou et al., 1999), and NUCB2 through specific potential cleavage sites which consist of a pair of basic amino acids, Lys–Arg or Arg–Arg (Gonzalez et al., 2010; Oh-I et al., 2006). The ProP 1.0 prediction server predicted the sites and the Lys–Arg site is remain conserved in Ya-fish, however another proposed site (Arg–Arg) conserved among other species is not present in Ya-fish NUCB2A sequence, the Arg190 residue was substituted with Gln (Fig. 2). This result cloud evokes for think about an important debate regarding the question whether nesfatin-1 are secreted neuroendocrine transmitters (Stengel and Tache, 2010). To date mature nesfatin-1 was detected only in the cerebrospinal fluid of rats by Oh-I et al. in their initial study (Oh-I et al., 2006), whereas it was not present in hypothalamic protein extracts (Foo et al., 2008; Oh-I et al., 2006) and not in any peripheral tissues (Gonzalez et al., 2009, 2010; Stengel et al., 2009b). The biological roles, if any, of nesfatin-2 and − 3 still remain unknown, and thus far, the processed nesfatin-2 and −3 were not demonstrated in any literatures. Since NUCB2 displays biological activity upon central injection (Oh-I et al., 2006), this raises the possibility that NUCB2 may have a primarily intracellular role as recently suggested (Foo et al., 2008). Alternatively, the full length NUCB2 may be the biologically active compound that is released (Stengel and Tache, 2010). Moreover, the tissue distribution study showed that the Ya-fish NUCB2A mRNA expressed ubiquitously in various organs. Predominant expression was found in the hepatopancreas, hypothalamus, intestines, gonad, pituitary and kidney (Fig. 4, Fig. S1). The wide expression distribution pattern of NUCB2A mRNA in present study has also been observed in goldfish (Gonzalez et al., 2010), further supporting the presence of nesfatin-1 in peripheral tissues, and suggests that nesfatin-1 or other NUCB2 encoded peptides may have pleiotropic actions. For example, NUCB2A mRNA was highly expressed in the hypothalamic and gut, which regulate feeding, indicates a probable function in food intake control; the highest expression in hepatopancreas suggests a potential role in integrating metabolic activity and energy balance. The abundance of NUCB2A mRNA observed in the hypothalamic, pituitary and ovary (Fig. 4, Fig. S1) is suggestive of that NUCB2A probably plays a role in Ya-fish reproduction through actions on all three tissues in the fish hypothalamo–pituitary–ovarian (HPO) axis, which has been confirmed in goldfish (Gonzalez et al., 2012). NUCB2 mRNA expression and nesfatin-1 concentrations has been shown to selectively decrease in the paraventricular nucleus (PVN) under starvation, and serum levels of nesfatin-1 are substantially decreased in food-deprived animals, while refeeding returned NUCB2/ nesfatin-1 back to control levels (Gonzalez et al., 2010; Kohno et al., 2008; Li et al., 2010; Oh-I et al., 2006). However, there is scarce information about the fish NUCB2 mRNA expression profile in related tissues to respond the feeding status change. The present results confirm and extend these findings in teleost. Ya-fish NUCB2A mRNA levels significantly increased in the hypothalamus after feeding, while food deprivation induced substantially decreased NUCB2 mRNA expression, and refeeding restored the reduction (suggesting an anorexigenic effect) (Figs. 5A, 6A). Since the widened anterior portion of the foregut was commonly referred to as pseudogaster in stomachless fish (Field et al., 2003), and in stomach-containing teleost, gastric emptying is usually associated
F. Lin et al. / Gene 536 (2014) 238–246
243
Fig. 2. Comparison of NUCB2 amino acid sequences. The colored amino acids highlight the differences in conservation of the amino acids between species of NUCB2, NUCB2A and NUCB2B (teleost only). In addition, the predicted propeptide cleavage sites are shown in the red box. Species names and GenBank accession numbers used in the alignment were as follows: Carassius auratus (NUCB2A, ADK94363), Schizothorax prenanti (NUCB2A, KF214758), Danio rerio (NUCB2A, AAH65437; NUCB2B, AAH67334), Oreochromis niloticus (NUCB2A, XP_ 003442432), Oryzias latipes (NUCB2A, XP_004067067), Xenopus tropicalis (NUCB2, NP_001015824), Gallus gallus (NUCB2, NP_001006468), Mus musculus (NUCB2, AAH10459), Bos taurus (NUCB2, NP_001068849), and Homo sapiens (NUCB2, NP_005004).
244
F. Lin et al. / Gene 536 (2014) 238–246
Fig. 3. Phylogenetic analysis of NUCB2 amino acid sequences. Scale bar indicates the substitution rate per residue. Each node has a bootstrap value, as percentages, which was obtained for 1000 replicates. NUCB2A and NUCB2B (teleost only).
with a potential return of appetite (Grove et al., 1985; Riche et al., 2004). In support of a role for periphery NUCB2A/nesfatin-1 in the regulation of feeding, NUCB2A mRNA also has been observed dramatically increased in the intestines (Fig. 5B). This finding is consistent with the meal related changes in gastric endocrine cells of rodents (Stengel et al., 2009b). These results may implicate NUCB2A in the central and periphery mediation of post-prandial satiety signals, and highlights the growing evidence in support of a role for nesfatin-1 as a novel brain-gut regulatory peptide. Our results indicate a potential anorexigenic role for
NUCB2A/nesfatin-1 in Ya-fish, further studies are warranted to demonstrate the anorexigenic effect and elucidate the mechanisms of actions. In mammals, brain hypothalamus was the main site of NUCB2 synthesis (Oh-I et al., 2006). In contrast to mammals, our finding indicated that hepatopancreas seemed to be the major organ for NUCB2A in the teleost (Fig. 4). More interestingly, unlike other anorexia hormone such as leptin, NUCB2A mRNA in the hepatopancreas was elevated during food deprivation (Figs. 5C, 6B) other than increase in hepatic leptin expression after feeding (Huising et al., 2006; Tinoco et al., 2012). Thus,
Fig. 4. Differential expression of NUCB2A mRNA in Ya-fish. Quantitative data for NUCB2A mRNA in Ya-fish tissues was obtained by using real-time quantitative PCR. The results were expressed as relative expression levels after standardization by β-actin and 18S-rRNA, which served as a control to verify the quality and amount of samples. Error bars represent standard error of the mean (n = 10 fish, 1:1 male-to-female sex ratio).
F. Lin et al. / Gene 536 (2014) 238–246
245
Fig. 5. Periprandial changes in NUCB2A mRNA abundances in the hypothalamus, hepatopancreas and intestines of fed and unfed Ya-fish. Pre- and post-prandial changes in the expression of NUCB2A mRNA in the hypothalamus (A), intestines (B) and hepatopancreas (C) of fed and unfed Ya-fish. The mRNA expression was normalized to β-actin and 18S-rRNA, and the highest level of NUCB2A mRNA expression was normalized to 100%. Bars with dissimilar superscripts indicate groups that differ significantly (one-way ANOVA followed by a Student– Newman–Keul's post hoc test, P b 0.05). Asterisks represent significant differences between the fed and unfed groups at a given time (Student's t-test, * P b 0.05, ** P b 0.001). Error bars represent standard error of the mean (n = 8 fish/group).
the effects of food deprivation on NUCB2 mRNA expression may vary and be tissue specific. The significant increase in hepatopancreas NUCB2A mRNA is suggesting a direct role for NUCB2A encoded peptides in hepatopancreas function during food deprivation. Recent study shows that nesfatin-1 has an anti-hyperglycemic effect (Su et al., 2010). During the period of fasting, hepatopancreas gluconeogenesis acts as a primary source of glucose to promote the restoration of normoglycemia (Morata et al., 1982). This result further supporting the speculate that this up regulation of hepatopancreas NUCB2A mRNA suggests a potential tissue specific local role for NUCB2A encoded peptides in the regulation of cellular gluconeogenic process in catabolic states (Gonzalez et al., 2010). The role of NUCB2A on hepatopancreas physiology, specifically in different feeding conditions, should be investigated further. There were no gender differences in NUCB2A mRNA expression in the brain, intestines and hepatopancreas of Ya-fish (Fig. S2). This is similar to what has been reported no sex-dependent changes in plasma nesfatin-1 expression (Li et al., 2010; Ramanjaneya et al., 2010). Interestingly, however, the level of NUCB2A mRNA expression in Ya-fish ovary was significant higher than testis (Fig. S2). The differences in the abundance of NUCB2A mRNA in the ovary and testis can also be found in goldfish (Gonzalez et al., 2010). NUCB2 as a modulator of the hypothalamus–pituitary–gonad (HPG) axis has been confirmed involved in rat (female) puberty onset (Garcia-Galiano et al., 2010) and
testicular cell populations (Garcia-Galiano et al., 2012). Thus, there may be some sex-dependent effects of NUCB2 in fish ovary and testis. Furthermore, NUCB2 as an appetite regulation hormone appear to influence reproductive capability in animals (Garcia-Galiano et al., 2010, 2012; Gonzalez et al., 2012), but the nature of this effect needs much more investigation, especially to determine if it has direct effects on reproduction or simply appear to modulate reproduction based on the correlation between energy status and reproduction. Future studies focusing on the tissue-specific effects of NUCB2/nesfatin-1 in the regulation and integration of energy balance and reproduction in fish would be valuable. 5. Conclusion Together, the present study has cloned Ya-fish NUCB2A full-length cDNA, which encodes a 487-amino acid propeptide. The NUCB2A mRNA is widely expressed in various tissues of Ya-fish, and its expression in the hypothalamus, intestines and hepatopancreas with differential altered when feeding status change. These findings may provide new insights into teleost NUCB2 molecule and its food intake regulation characteristics. These data could contribute to future research on the development of feeding strategies in Ya-fish farming, and might also be helpful in dealing with feeding, growth and reproduction issues in other teleost species.
Fig. 6. Food deprivation induced changes in NUCB2A mRNA expression in Ya-fish hypothalamus and hepatopancreas. Food deprivation reduced expression of NUCB2A mRNA in the Ya-fish hypothalamus (A) and increased its expression in the hepatopancreas (B), and refeeding restored the normal levels. The mRNA expression was normalized to β-actin and 18S-rRNA, and the highest level of NUCB2A mRNA expression was normalized to 100%. Asterisks represent significant differences between groups at the same time point. (Student's t-test, * P b 0.01, ** P b 0.001). Error bars represent standard error of the mean (n = 6 fish/group).
246
F. Lin et al. / Gene 536 (2014) 238–246
Disclosure summary The authors have nothing to disclose. Conflict of interest There is no conflict of interest. Acknowledgments This study was supported by grants from the Major Project of Education Department in Sichuan (12ZA120). Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2013.12.031. References Atsuchi, K., et al., 2010. Centrally administered nesfatin-1 inhibits feeding behaviour and gastroduodenal motility in mice. Neuroreport 21, 1008–1011. Barnikol-Watanabe, S., et al., 1994. Human protein NEFA, a novel DNA binding/EF-hand/ leucine zipper protein. Molecular cloning and sequence analysis of the cDNA, isolation and characterization of the protein. Biol. Chem. Hoppe Seyler 375, 497–512. Crown, A., Clifton, D.K., Steiner, R.A., 2007. Neuropeptide signaling in the integration of metabolism and reproduction. Neuroendocrinology 86, 175–182. Duckert, P., Brunak, S., Blom, N., 2004. Prediction of proprotein convertase cleavage sites. Protein Eng. Des. Sel. 17, 107–112. Field, H.A., Ober, E.A., Roeser, T., Stainier, D.Y., 2003. Formation of the digestive system in zebrafish. I. Liver morphogenesis. Dev. Biol. 253, 279–290. Foo, K., Brismar, H., Broberger, C., 2008. Distribution and neuropeptide coexistence of nucleobindin-2 mRNA/nesfatin-like immunoreactivity in the rat CNS. Neuroscience 156, 563–579. Garcia-Galiano, D., et al., 2010. The anorexigenic neuropeptide, nesfatin-1, is indispensable for normal puberty onset in the female rat. J. Neurosci. 30, 7783–7792. Garcia-Galiano, D., et al., 2012. Cellular distribution, regulated expression, and functional role of the anorexigenic peptide, NUCB2/nesfatin-1, in the testis. Endocrinology 153, 1959–1971. Goebel, M., Stengel, A., Wang, L.X., Tache, Y., 2011. Central nesfatin-1 reduces the nocturnal food intake in mice by reducing meal size and increasing inter-meal intervals. Peptides 32, 36–43. Goebel-Stengel, M., Wang, L.X., Stengel, A., Tache, Y., 2011. Localization of nesfatin-1 neurons in the mouse brain and functional implication. Brain Res. 1396, 20–34. Gonzalez, R., Unniappan, S., 2010. Molecular characterization, appetite regulatory effects and feeding related changes of peptide YY in goldfish. Gen. Comp. Endocrinol. 166, 273–279. Gonzalez, R., Tiwari, A., Unniappan, S., 2009. Pancreatic beta cells colocalize insulin and pronesfatin immunoreactivity in rodents. Biochem. Biophys. Res. Commun. 381, 643–648. Gonzalez, R., Kerbel, B., Chun, A., Unniappan, S., 2010. Molecular, cellular and physiological evidences for the anorexigenic actions of nesfatin-1 in goldfish. PLoS One 5, e15201. Gonzalez, R., et al., 2012. Nesfatin-1 regulates the hypothalamo–pituitary–ovarian axis of fish. Biol. Reprod. 87. Grove, D., Moctezuma, M., Flett, H., Foott, J., Watson, T., Flowerdew, M., 1985. Gastric emptying and the return of appetite in juvenile turbot, Scophthalmus maximus L., fed on artificial diets. J. Fish Biol. 26, 339–354. Harrold, J.A., Dovey, T.M., Blundell, J.E., Halford, J.C., 2012. CNS regulation of appetite. Neuropharmacology 63, 3–17. Huising, M.O., et al., 2006. Increased leptin expression in common carp (Cyprinus carpio) after food intake but not after fasting or feeding to satiation. Endocrinology 147, 5786–5797. Jaillon, O., et al., 2004. Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature 431, 946–957. Kalra, S.P., Dube, M.G., Pu, S., Xu, B., Horvath, T.L., Kalra, P.S., 1999. Interacting appetiteregulating pathways in the hypothalamic regulation of body weight. Endocr. Rev. 20, 68–99. Kohno, D., et al., 2008. Nesfatin-1 neurons in paraventricular and supraoptic nuclei of the rat hypothalamus coexpress oxytocin and vasopressin and are activated by refeeding. Endocrinology 149, 1295–1301. Kumar, S., Nei, M., Dudley, J., Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306.
Lenard, N.R., Berthoud, H.R., 2008. Central and peripheral regulation of food intake and physical activity: pathways and genes. Obesity 16, S11–S22. Li, Q.C., Wang, H.Y., Chen, X., Guan, H.Z., Jiang, Z.Y., 2010. Fasting plasma levels of nesfatin1 in patients with type 1 and type 2 diabetes mellitus and the nutrient-related fluctuation of nesfatin-1 level in normal humans. Regul. Pept. 159, 72–77. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Maejima, Y., et al., 2009. Nesfatin-1-regulated oxytocinergic signaling in the paraventricular nucleus causes anorexia through a leptin-independent melanocortin pathway. Cell Metab. 10, 355–365. Miura, K., Titani, K., Kurosawa, Y., Kanai, Y., 1992. Molecular cloning of nucleobindin, a novel DNA-binding protein that contains both a signal peptide and a leucine zipper structure. Biochem. Biophys. Res. Commun. 187, 375–380. Mohan, H., Unniappan, S., 2013. Phylogenetic aspects of nucleobindin-2/nesfatin-1. Curr. Pharm. Des. 19, 6929–6934. Morata, P., Vargas, A.M., Pita, M.L., Sánchez-Medina, F., 1982. Hormonal effects on the liver glucose metabolism in rainbow trout (Salmo gairdneri). Comp. Biochem. Physiol. B 72, 543–545. Oh-I, S., et al., 2006. Identification of nesfatin-1 as a satiety molecule in the hypothalamus. Nature 443, 709–712. Pan, W., Hsuchou, H., Kastin, A.J., 2007. Nesfatin-1 crosses the blood–brain barrier without saturation. Peptides 28, 2223–2228. Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8, 785–786. Price, T.O., Samson, W.K., Niehoff, M.L., Banks, W.A., 2007. Permeability of the blood–brain barrier to a novel satiety molecule nesfatin-1. Peptides 28, 2372–2381. Ramanjaneya, M., et al., 2010. Identification of nesfatin-1 in human and murine adipose tissue: a novel depot-specific adipokine with increased levels in obesity. Endocrinology 151, 3169–3180. Riche, M., Haley, D., Oetker, M., Garbrecht, S., Garling, D., 2004. Effect of feeding frequency on gastric evacuation and the return of appetite in tilapia Oreochromis niloticus (L.). Aquaculture 234, 657–673. Selvan, P.K., Hendricks, G.L., Maddineni, S.R., Krzysik-Walker, S.M., Ocon-Grove, O.M., Ramachandran, R., 2007. Cloning and characterization of chicken nucleobindin-2 (NUCB2) cDNA: the precursor for a putative anorexigenic peptide, nesfatin-1. Poult. Sci. 86, 222–223. Shimizu, H., et al., 2009. Peripheral administration of nesfatin-1 reduces food intake in mice: the leptin-independent mechanism. Endocrinology 150, 662–671. Stengel, A., Tache, Y., 2010. Nesfatin-1—role as possible new potent regulator of food intake. Regul. Pept. 163, 18–23. Stengel, A., et al., 2009a. Central nesfatin-1 reduces dark-phase food intake and gastric emptying in rats: differential role of corticotropin-releasing factor2 receptor. Endocrinology 150, 4911–4919. Stengel, A., et al., 2009b. Identification and characterization of nesfatin-1 immunoreactivity in endocrine cell types of the rat gastric oxyntic mucosa. Endocrinology 150, 232–238. Stengel, A., Goebel-Stengel, M., Wang, L.X., Kato, I., Mori, M., Tache, Y., 2012. Nesfatin1(30–59) but not the N- and C-terminal fragments, nesfatin-1(1–29) and nesfatin1(60–82) injected intracerebroventricularly decreases dark phase food intake by increasing inter-meal intervals in mice. Peptides 35, 143–148. Su, Y., Zhang, J., Tang, Y., Bi, F., Liu, J.N., 2010. The novel function of nesfatin-1: antihyperglycemia. Biochem. Biophys. Res. Commun. 391, 1039–1042. Tache, Y., Garrick, T., Raybould, H., 1990. Central nervous system action of peptides to influence gastrointestinal motor function. Gastroenterology 98, 517–528. Taylor, J.S., Braasch, I., Frickey, T., Meyer, A., Van de Peer, Y., 2003. Genome duplication, a trait shared by 22,000 species of ray-finned fish. Genome Res. 13, 382–390. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Tinoco, A.B., Nisembaum, L.G., Isorna, E., Delgado, M.J., de Pedro, N., 2012. Leptins and leptin receptor expression in the goldfish Carassius auratus. Regulation by food intake and fasting/overfeeding conditions. Peptides 34, 329–335. Volkoff, H., et al., 2005. Neuropeptides and the control of food intake in fish. Gen. Comp. Endocrinol. 142, 3–19. Wan, Y., Zhang, Y., Ji, P., Li, Y., Xu, P., Sun, X., 2012. Molecular characterization of CART, AgRP, and MC4R genes and their expression with fasting and re-feeding in common carp (Cyprinus carpio). Mol. Biol. Rep. 39, 2215–2223. Wei, R., et al., 2013a. Identification, tissue distribution and regulation of preproghrelin in the brain and gut of Schizothorax prenanti. Regul. Pept. 186, 18–25. Wei, R., et al., 2013b. Characterization, tissue distribution and regulation of agouti-related protein (AgRP) in a cyprinid fish Schizothorax prenanti. Gene 527, 193–200. Wei, R., et al., 2013c. Cloning, distribution and effects of fasting status of melanocortin 4 receptor (MC4R) in Schizothorax prenanti. Gene 532, 100–107. Xia, Z.F., et al., 2012. Nesfatin-1 inhibits gastric acid secretion via a central vagal mechanism in rats. Am. J. Physiol. Gastrointest. Liver Physiol. 303, G570–G577. Zhang, A.Q., et al., 2010. Expression of nesfatin-1/NUCB2 in rodent digestive system. World J. Gastroenterol. 16, 1735–1741. Zhou, A., Webb, G., Zhu, X., Steiner, D.F., 1999. Proteolytic processing in the secretory pathway. J. Biol. Chem. 274, 20745–20748.