- Email: [email protected]
Lidanpaidu prescription alleviates lipopolysaccharide-induced acute kidney injury by suppressing the NF-κB signaling pathway
Biomedicine & Pharmacotherapy 99 (2018) 245–252
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Lidanpaidu prescription alleviates lipopolysaccharide-induced acute kidney injury by suppressing the NF-κB signaling pathway Fan Zhang, Shan Lu, Siyi Jin, Keli Chen, Juan Li, Bisheng Huang, Yan Cao
T
⁎
Key Laboratory of Education Ministry on Traditional Chinese Medicine Resource and Compound Prescription, Hubei University of Chinese Medicine, Wuhan 430065, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Lidanpaidu prescription Acute kidney injury Inflammation NF-κB signaling pathway
The Lidanpaidu Prescription (LDP), a hospital preparation, composed of Chinese classical preparations, has been reported to have antiendotoxin, anticoagulant and other effects. However, its therapeutic effect on lipopolysaccharide (LPS)-induced acute kidney injury (AKI) and the mechanisms remain unclear. Therefore, we administered LPD pretreatment at different doses to examine the protective effects and mechanisms in LPS-induced AKI in mice. The kidney injury induced by LPS was assessed by histological examination. ELISA was used to detect the levels of inflammatory cytokines. The mRNA expression of the inflammatory genes IKKβ and TNF-α in kidney tissues was assessed by RT-PCR. Finally, Western blot was performed to assess the NF-κB signaling pathway related proteins, and the nuclear translocation of NF-kB P65 was detected by immunofluorescence laser confocal microscopy. The findings suggested that LDP significantly improved at 48 h animal survival (66.7%), compared with the LPS group (26.7%), determined by a Kaplan-Meier analysis. LDP attenuated the kidney histopathological changes induced by LPS and decreased the inflammatory cytokine levels in serum and renal tissue. Moreover, LDP markedly inhibited the expression of inflammatory genes and suppressed the activation of relevant proteins in the nucleus. In summary, these findings suggest that LDP reduces LPS-induced AKI via a mechanism related to the suppression of the NF-κB signaling pathway.
1. Introduction Sepsis is a systemic inflammatory response syndrome with a complex pathogenesis, mainly caused by invasive infection [1]. The main reasons for sepsis-induced death are an uncontrolled immune response, resulting in tissue and organ damage [2,3]. One of the most vulnerable target organs in endotoxin-induced sepsis is the kidney. More than 50% of patients in the ICU suffer from acute kidney injury (AKI) [4], and the mortality rate is as high as 30%–60% [5,6]. There are many therapeutic methods to investigate sepsis and its complications such as acute kidney injury [7], but there have been no significant decreases in its mortality rates. Lipopolysaccharide (LPS) is found in the outer membrane of Gramnegative bacteria. In mice and other animal models, LPS induces AKI and leads to a strong inflammatory response via nuclear factor-kappa B (NF-κB) activation [8]. When AKI occurs, endotoxin induces the production of cytokines, resulting in a systemic “cytokines storm”, accompanied by activation of the NF-κB signaling pathway. NF-κB is an important transcription factor downstream of the endotoxin signaling transduction pathway. When inflammation occurs, I kappa B kinase beta (IKK beta) is activated first, then the activated inhibitor kappa B
⁎
(IκB) kinase degrades the NF-κB inhibitory protein IκB and allows NFκB to translocate into the nucleus [9,10]. Therefore, inhibiting the NFκB signaling pathway might prevent AKI. The Lidanpaidu prescription(LDP) is composed of capillary artemisia, gardenia, salvia and six other kinds of traditional Chinese medicine (TCM), combined with the Yinchenhao decoction and the Dachengqi decoction, according to TCM syndrome differentiation therapy theory. The Yinchenhao decoction and Dachengqi decoction are famous prescriptions in the “Treatise on Febrile Diseases” written by Zhang Zhongjing during the Han Dynasty. Research and clinical application have shown that the Yinchenhao decoction and the Dachengqi decoction both have good cholagogic and anti-inflammatory effects [11,12]. The antiendotoxin effect of LDP has also been demonstrated by in vivo and vitro experiments [13–15]. LDP has also been awarded a national patent (patent application number CN200710051818.6, patent publication number CN100589820C). In the clinical, it is mainly used for the treatment of infections, trauma and functional lesions caused by endotoxemia [13–16], and has a good curative effect on respiratory tract infections and urinary system infections, especially nephritis. However, its mechanism of action is not clear. In the present study, we investigated the protective effects and the mechanisms of action of LDP
Corresponding author. E-mail address: [email protected] (Y. Cao).
https://doi.org/10.1016/j.biopha.2018.01.059 Received 19 September 2017; Received in revised form 4 January 2018; Accepted 5 January 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
group, LPS + dexamethasone hydrochloride [19] (5 mg/kg + LPS 7 mg/kg) group. All the mice were dosed by intragastric administration for seven days. One hour after the last intragastric administration, the LPS group, LPS + LDP group and dexamethasone group were injected intraperitoneally with LPS (7 mg/kg), and the control group was injected with normal saline in an equal volume. Then, the general condition and survival of the mice were monitored every 4 h up to 48 h and a survival curve was plotted. In the second round of studies, 48 mice were randomly divided into six groups (n = 8 each group): control group, LPS group (LPS 7 mg/kg), LPS + LDP (37.5, 75, and 150 g/ kg + LPS 7 mg/kg) groups, and a LPS + dexamethasone hydrochloride (5 mg/kg + LPS 7 mg/kg) group. The method of administration was as described above. Six hours after the LPS injection, the mice were culled and the blood and kidney tissues were harvested.
Table 1 The LDP prescription. TMC materials (pinyin)
Equivalent pharmaceutical name
Part used
Amount (g)
1 2 3
Yin chen Zhi zi Da huang
ArtemisiacapillarisThunb Gardenia jasminoides Ellis Rheum palmatum L．
30 15 15
4 5
Mang xiao Gan cao
Natrii Sulfas Radix Glycyrrhizae
6 7
Huang qi Dan shen
Radix Astragali seu Hedysari Radix Salviae Miltiorrhizae
8 9 Total
Jin yin hua Lian qiao
Flos Lonicerae Fructus Forsythiae
seedling fruit radix and rhizome mineral radix and rhizome radix radix and rhizome flower fruit
10 5 15 15 15 10 130
2.4. Measurement of inflammatory cytokines Retro-orbital blood samples were collected, then centrifuged at 4 °C for 20 min at 2500 rpm to collect the serum. The kidney tissues were ground in cold-PBS to obtain a homogenate. ELISA kits (Bioswamp) were used to measure TNF-α, IL-6 and IL-10 in serum and kidney homogenates, according to the manufacturer’s protocol.
in AKI caused by LPS in mice. 2. Materials and methods 2.1. Chemicals and reagents
2.5. Histopathological examination
Lipopolysaccharide (LPS; 0111:B4) was purchased from Sigma Chemical Co. (St. Louis, MO, USA). The FastQuant RT Kit and SuperReal PreMix Plus Kit were purchased from Tiangen Biotech Co. Ltd (Beijing, China). The Nuclear and Cytoplasmic Protein Extraction Kit, the BCA kit and BeyoECL Plus Kit were provided by Beyotime Co. Ltd. (Shanghai). TNF-α, IL-6, IL-10 ELISA kits were obtained from Bioswamp(Wuhan, China).
The kidney tissues were fixed in 10% formaldehyde, embedded in paraffin, then cut into 5 μm-thick slices followed by staining with hematoxylin and eosin (H&E). Histological changes were observed under a light microscope. 2.6. RT-PCR analysis
2.2. Preparation of LDP Total mRNAs was extracted from the kidney homogenates, and the purity and concentration of RNA were determined by a ultramicro UV detector. The mRNAs were reversely transcribed into first strand cDNA by the FastQuant RT Kit (Tiangen Biotech). Then semi-quantitative realtime PCR was conducted using the first strand cDNA and SuperReal PreMix Plus (SYBR Green) Kit (Tiangen Biotech) according to the manufacturer’s instructions. Real-time qPCR was performed for 35 cycles in 20 μL reaction volumes using a Roche L480 Real-time PCR System. The upstream and downstream primer sequences were as described previously [20] as follows: for β-actin: sense primer: 5′-TTGT TACCAACTGGGACG-3′, antisense primer: 5′-GGCATAGAGGTCTTTA CGG-3′; for IKKβ: sense primer: 5′- AGGCGACAGGTGAACAGAT -3′, antisense primer: 5′- CTAAGAGCCGATGCGATG -3′; for TNF-α: sense primer: 5′- GGCAGGTCTACTTTGGAGTCATTGC -3′, antisense primer: 5′- ACATTCGAGGCTCCAGTGAATTCGG -3′. Cycling of IKKβ began at 95 °C for 15 min, then cycled 35 times: denatured at 95 °C for 20 s, annealed at 56 °C for 30 s and extended at 72 °C for 40 s. Cycling of
The Lidanpaidu Prescription, supplied by Shiyan Taihe Hospital, was prepared according to the preparation method described by Zheng et al. [16]. All the herbal medicines (Table 1) in the preparation were shown to be endotoxin-free by Professor Keli Chen of Hubei University of Chinese Medicine, according to the Chinese Pharmacopoeia (2015 version). The component analysis of the extract has been provided by other authors [16–18]. 2.3. Animals and treatments In total, 108 mice (BABL/c mice, 6–8 weeks old) were purchased from the Hubei experimental animal research center (Wuhan, China). All procedures were approved by the Ethics Committee of Hubei University of Chinese Medicine. In the first group of studies, 60 BALB/c mice were randomly divided into four groups: control group (saline), LPS group (LPS 7 mg/kg), LPS + LDP (LDP 75 g/kg + LPS 7 mg/kg)
Fig. 1. Survival rate analysis. **P < 0.01 vs LPS group.
246
△△
P < 0.01 vs control group;
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
Fig. 2. Expression of inflammatory cytokines in serum and kidney tissues. n = 8, mean ± SEM.
△△
P < 0.01 vs. control group; *P < 0.05 vs. LPS group;
**
P < 0.01 vs. LPS group.
2.7. Western blot analysis
TNF-α was initiated at 95 °C for 15 min, then cycled 35 times: denatured at 95 °C for 20 s, annealed at 60 °C for 30 s and extended at 72 °C for 40 s. Gene expression was measured by the 2−ΔΔCT computational method.
The total protein, cytoplasmic and nuclear proteins were separated from renal tissue homogenates on ice. The concentration of the extracted protein was measured using a BCA kit (Beyotime). The protein samples were fractionated by 12% SDS-PAGE and then transferred to PVDF membranes (Millipore). After blocking with 5% nonfat milk, the 247
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
Fig. 3. HE staining of kidney tissues. (hematoxylin and eosin staining, A: magnification × 200; B: magnification × 400).
images were obtained using a confocal laser scanning microscope (Nikon C2).
PVDF membranes were then incubated with diluted antibodies against p-NF-κB (1:1000; CST; catalog number: 3033T), Lamin B1 (1:1000; CST; 12586S), IκB (1:1000; CST; 4812S), p-IκB (1:1000; CST; 9245S) and β-actin (1:1000; CST; 4970S) overnight at 4 °C. After incubating the membrane with the appropriate secondary antibody at room temperature for 1 h, the immunoreactive strip was labeled using the BeyoECL Plus Kit (Beyotime). The blot was obtained using a gel imaging system (Bio-Rad).
2.9. Statistical analysis All results are expressed as mean ± SEM. SPSS statistical 22.0 statistical software was used for the analysis. The comparison of the means of between the various groups was analyzed by one-way ANOVA. Survival was assessed using Kaplan-Meier curves and the logrank test was performed to analyze the data. P < 0.05 or P < 0.01 indicated statistical significance.
2.8. Immunofluorescence In order to observe the nuclear translocation of NF-κB p65 protein in the different groups, we conducted immunofluorescence confocal laser scanning experiments according to a method described in the literature [21]. In brief, the kidneys were fixed in formalin and embedded in paraffin. The sections were then incubated with 0.3% Triton X-100 and 10% BSA. NF-κB antibody (1:200; CST; catalog number: 8242S) was used to label the protein and nuclei were stained with DAPI. Finally, the
3. Results 3.1. Protective effect of LDP on the survival of mice with fatal sepsis Mice in the LPS group started to die at 12 h with the lowest 48 h survival rate (26.7%); the LPS + LDP group had the first dead mice at 248
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
3.3. Inhibitory effect of LDP on pathological changes The kidney tissue morphology was normal in the control group as shown in Fig. 3. However, there were obvious injuries in the kidney tissues in the LPS group, including flat and sloughed tubular epithelial cells, loss of the brush border and visible bare membranes. These kidney tissue injuries were markedly ameliorated in the LDP (37.5, 75, 150 g/kg) and dexamethasone (5 mg/kg) groups. 3.4. Inhibitory effect of LDP on TNF-α and IKKβ mRNA There was a marked rise in the expression of TNF-α and IKKβ mRNA in the LPS group. The mRNA expression was markedly decreased in the LDP (37.5, 75, 150 g/kg) and dexamethasone (5 mg/kg) groups. LPS could significantly upregulated the expression of inflammatory genes and LDP administration reduced the expression of these genes, in a dose-dependent manner (Fig.4). Fig. 4. Effect of LDP on the expression of mRNA in kidney tissue. n = 8, mean ± SEM. △△ P < 0.01 vs. control group; *P < 0.05 vs. LPS group; **P < 0.01 vs. LPS group.
3.5. Effect of LDP on NF-κB signaling pathway-related proteins NF-κB signaling pathway-related proteins were assessed through Western blot analysis. The data show that the phosphorylation ratio of IκBα in the LPS group was the highest of all the groups. Pretreatment with LDP and dexamethasone decreased the IκBα phosphorylation ratio. Furthermore, phosphorylated NF-κB p65 was markedly upregulated in both the nuclear and cytoplasmic protein in the LPS group and down-regulated in the pretreated groups (Fig. 5). Immunofluorescent confocal microscopy indicated that the expression of p65 in the control group was low and mainly existed in the cytoplasm. The expression of p65 in the LPS group was the highest and mainly existed in the nucleus. The nuclear p65 levels in the pretreatment groups were significantly lower than in the LPS group. The images indicated that the activated cells were located in the renal tubules and the renal cortices (Fig. 6).
12 h with 66.7% 48 h survival, while the first death in the LPS + dexamethasone group occurred at 24 h with 80.0% 48 h survival. No deaths occurred in the control group. The difference between the LPS group versus the control group (χ² = 17.414, P = 0.000), the LPS + LDP group versus the LPS group (χ² = 8.310, P = 0.004), and the LPS + dexamethasone group versus the LPS group (χ² = 11.649, P = 0.001) were significant. (Fig.1)
3.2. Inhibitory effect of LDP on expression of inflammatory cytokines expression There was a dramatic increase in inflammatory cytokine expression in the LPS group, as shown in Fig. 2. These levels in were significantly suppressed in a dose-dependent manner by LDP (37.5, 75, 150 g/kg) and dexamethasone hydrochloride (5 mg/kg). There were no significant differences between the treatment and control groups.
4. Discussion Acute kidney injury is caused by sepsis in 47.5% of patients in the ICU [22]. The mortality of AKI caused by sepsis is also significantly
Fig. 5. The expression of the NF-κB signaling pathway related proteins. n = 3, x ± s.
△△
249
P < 0.01 vs. control group; *P < 0.05 vs. LPS group;
**
P < 0.01 vs. LPS group.
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
Fig. 6. Effects of LDP on the expression and translocation of NF-kB and p65 into the nucleus. A: control group; B: LPS group; C: LPS + LDP (37.5 g/ kg + LPS 7 mg/kg) groups; D: LPS + LDP (75 g/ kg + LPS 7 mg/kg) groups; E: LPS + LDP (150 g/ kg + LPS 7 mg/kg) groups; F: LPS + dexamethasone hydrochloride (5 mg/kg + LPS 7 mg/kg) group. (Magnification × 400).
stimulated by LPS [24]. In this study, we used LPS-induced AKI in mice as a model to explore the protective effect of LDP and its possible protective mechanisms. The results show that LDP could reduce the damage of septic AKI induced by LPS via a mechanism related to inhibition of the NF-κB signaling pathway. Based on the survival test, the LDP and dexamethasone group appeared to be protected from fatal endotoxemia, compared with the LPS
higher than that of non-sepsis acute renal injury. At present, there is no effective treatment for septic AKI. Endotoxin can lead to multiple organ dysfunction in animals, such as the heart, lung, liver, kidney and other organs. In the LPS-induced model, the role of LPS is time-dependent. The first organ to be damaged by LPS in animals is the lungs, followed by other organs. The peak of renal damage is 6 h after intraperitoneal injection of LPS [23]. The NF-κB signaling pathway is activated when 250
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
artemisia, honeysuckle and gardenia are the main components. Therefore, the main effective constituents chlorogenic acid, teniposide and salvianolic acid B were determined by HPLC for a qualitative identification and quantitative determination. The chemical constituents of Chinese herbal formulas are the material basis for their efficacy. Chinese herbal formulas focus on the interactions between drugs and are therefore multi-target, multi-ingredient and multi-effect formulations [30]. In a previous study, we also found that LDP has a good anti-endotoxin effect in vivo and in vitro. However, the mechanism of the antiendotoxin effect is still unclear. Therefore, we conducted this study to explore the mechanism of action of LDP.
group (26.7% survival). LPS stimulation can activate macrophages and induce the secretion of inflammatory cytokines [25]. Based on the ELISA results, the proinflammatory cytokines TNF-α and IL-6 in serum and kidney tissues were obviously higher after LPS stimulation; TNF-α and IL-6 are critical proinflammatory cytokines in the pathogenesis of inflammatory diseases. A significant reduction in TNF-α and IL-6 suggested that LDP treatment had an anti-inflammatory effect in LPS-induced AKI. Previous research [8,26] has shown that inhibiting the production of inflammatory cytokines can effectively treat AKI induced by LPS. Meanwhile, upregulation of the anti-inflammatory factor IL-10 indicated that the body was attempting to regulate inflammation after LPS administration; the decrease in IL-10 levels after LDP treatment revealed that it has a good prognosis in the treatment of AKI. In addition, the histological analysis also demonstrated that LDP alleviated renal injury. NF-κB is an important transcription factor associated with the pathogenesis of various inflammatory diseases [20]. Many extracellular stimuli, such as LPS, TNF-α and IL-6, can activate the NF-kB signaling pathway. When stimulated, the IKKβ subunit is phosphorylated and activated, so that the Ser32 and Ser36 sites of the IkBα protein are phosphorylated. Subsequently, the IκB protein is ubiquitinated and degraded by 26S proteolytic enzymes. Finally, p50/p65 is released and transported into the nucleus to specifically bind to target sequences and modulate gene expression [27]. In order to determine the protective mechanism of LDP, we examined the effects of LDP on activation of the NF-κB signaling pathway. The results suggest that the IKKβ mRNA, NFκB mRNA, IκB and phosphorylated IκB protein in kidney tissue were increased after the administration of LPS. Simultaneously, we also detected the content of phosphorylated NF-κB protein in the nucleus and cytoplasm to show that the signaling pathway was activated. Western blot analysis found that, in the LPS group, NF-κB was significantly increased in the nucleus and cytoplasm, indicating that phosphorylated NF-κB protein entered the nucleus and the signaling pathway was activated [28,29]. After treatment with LDP and dexamethasone, the expression of NF-κB pathway-related genes and proteins was markedly suppressed in a dose-dependent relationship, i.e. the effects of 75 g/kg and 150 g/kg were obviously better than that of 37.5 g/kg. However, there was no significant difference between 75 g/kg and 150 g/kg, and we speculate that we may have reached the plateau region of the doseresponse curve. Moreover, immunofluorescence confocal laser analysis revealed that the NF-κB p65 was transferred into the nucleus after LPS injection and the NF-κB signaling pathway was activated. NF-κB nuclear translocation was also inhibited by LDP. These results are consistent with the Western blot results and intuitively visible. These results indicate that LDP prevents LPS-induced AKI by suppressing NF-κB activation. There are a number of limitations to this study. First, although we found that LDP has a protective effect on LPS-induced AKI, this was only after pretreatment, rather than a therapeutic effect. Due to the complex ingredients of Chinese medicine, the specific ingredients may be the original materials or metabolites, so Chinese medicine has a relatively long period of drug administration and most of traditional Chinese medicines show a time-lag effects. Whether LDP has a therapeutic effect on LPS-induced AKI in mice needs to be further explored. In addition, it is unclear which ingredient in LDP mediated these effects. This requires further isolation, purification and identification to obtain the active components. Although this study showed that LDP can alleviate LPS-induced AKI by suppressing activation of the NF-kB signaling pathway, whether it has effects on other related pathways and targets remains to be determined. In previous studies, we identified some components of LDP using the HPLC-UV method [16–18]. Among the ingredients, chlorogenic acid is usually used in the quality control of Flos Lonicerae in the Chinese pharmacopeia. Similarly, teniposide is used for the quality control of gardenia, salvianolic acid for cortex moutan, and rhein, emodin and chrysophanol for rhubarb. In the Lidanpaidu prescription, capillary
5. Conclusion In conclusion, we demonstrate that LDP suppresses the production of inflammatory cytokines, reduces pathological damage and inhibits activation of the NF-κB signaling pathway. Therefore, LDP can effectively reduce AKI caused by LPS, and may be a potential alternative treatment for AKI in Chinese medicine. Conflict of interest The authors declare no conflict of interest. Acknowledgment This work was supported by the natural science foundation of Hubei provincial science and Technology Department (grant numbers 2014CFB243) References [1] J.A. Buras, Holzmann B, M. Sitkovsky, Animal models of sepsis: setting the stage, Nat. Rev. Drug Discov. 4 (2005) 854–865. [2] T. Calandra, B. Echtenacher, D.L. Roy, J. Pugin, C.N. Metz, L. Hültner, Protection from septic shock by neutralization of macrophage migration inhibitory factor, Nat. Med. 6 (2000) 164. [3] W.D. Döcke, F. Randow, U. Syrbe, D. Krausch, K. Asadullah, P. Reinke, H.D. Volk, W. Kox, Monocyte deactivation in septic patients: restoration by IFN-γ treatment, Nat. Med. 3 (1997) 678. [4] S. Uchino, J.A. Kellum, R. Bellomo, G.S. Doig, H. Morimatsu, S. Morgera, Acute renal failure in critically ill patients: a multinational, multicenter study, JAMA J. Am. Med. Assoc. 294 (2005) 813. [5] J. Klenzak, J. Himmelfarb, Sepsis and the kidney, Crit. Care Clin. 21 (2005) 211. [6] M. Ostermann, R.W. Chang, Acute kidney injury in the intensive care unit according to rifle, Crit. Care Med. 35 (2007) 1837–1843. [7] A. Zarjou, A. Agarwal, Sepsis and acute kidney injury, J. Am. Soc. Nephrol. JASN 22 (2011) 999. [8] H.Y. Ye, J. Jin, L.W. Jin, Y. Chen, Z.H. Zhou, Z.Y. Li, Chlorogenic acid attenuates lipopolysaccharide-induced acute kidney injury by inhibiting TLR4/NF-κB signal pathway, Inflammation 40 (2017) 523–529. [9] J.A. Brockman, D.C. Scherer, T.A. Mckinsey, S.M. Hall, X. Qi, W.Y. Lee, Coupling of signal response domain in Iκbα to multiple pathway for NF-κB activation, Mol. Cell. Biol. 15 (1995) 2809–2818. [10] M.J. May, S. Ghosh, Rel/nf-κb and iκb proteins: an overview, Semin. Cancer Biol. 8 (1997) 63–73. [11] Y.P. Mu, P. Liu, L. Wang, Evolution and modern research of yinchenhao decoction, Chin. J. Exp. Tradit. Med. Formulae 12 (2006) 67–71 in Chinese. [12] C.Y. Ma, J. Zhou, H.L. Li, Y. Geng, J.W. Tang, C.R. Peng, Effect of dachengqi decoction on cytokines tumor necrosis inflammatory cytokines in rats with endotoxaemia, Chin. J. Exp. Tradit. Med. Formulae 17 (2011) 130–133 in Chinese. [13] J. Li, M.X. Chang, K.L. Chen, T.X. Zhao, G. Chen, Protective effect of Lidanpaidu oral liquid on antipyretic and pathological damage in rabbits induced by LPS, Pharmacol. Clin. Chin. Mater. Med. 25 (2009) 59–61 in Chinese. [14] M.X. Chang, J. Zhang, K.L. Chen, Study on the anti endotoxin effect of Lidanpaidu oral liquid in vitro, Chin. Tradit. Pat. Med. 29 (2007) 1506–1508 in Chinese. [15] M.M. Wu, K.L. Chen, M.X. Chang, Experimental study on the anti-endotoxemia of Lidanpaidu oral liquid, Acta Chin. Med. 32 (2017) 594–597 in Chinese. [16] J. Zheng, T. Qin, S. Du, L. Huang, Study on preparation and quality standard of jinyinqingre oral liquid, J. Pediatr. Pharm. 19 (2013) 610–614. [17] L. Huang, C. Zhang, L. Lu, S. Du, Determination of rhein, emodin and chrysophanol in lidan paidu oral liquids by HPLC, China Pharmacist 15 (2012) 1122–1124 in Chinese. [18] L. Huang, J. Zheng, S. Du, Study on HPLC fingerprint chromatogram of jinyin qingre oral liquids, China Pharm. 17 (2014) 71–74. [19] Y. Chen, Y. Du, Y. Li, X.Q. Wang, P. Gao, Y. Guang, Y. Fang, Y. Meng, X.J. Zhao,
251
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
[20]
[21]
[22]
[23]
[24] [25]
NF-κB signaling pathway, J. Ethnopharmacol. 183 (2016) 159–165. [26] D. Xu, M. Chen, X. Ren, Y. Wu, Leonurine ameliorates LPS-induced acute kidney injury via suppressing ros-mediated nf-κb signaling pathway, Fitoterapia 97 (2014) 148–155. [27] Q. Li, I.M. Verma, NF-κB regulation in the immune system, Nat. Rev. Immunol. 2 (2002) 975. [28] G. Li, J. Fu, Y. Zhao, K. Ji, T. Luan, B. Zang, Alpha-lipoic acid exerts anti-inflammatory effects on lipopolysaccharide-stimulated rat mesangial cells via inhibition of nuclear factor kappa B (NF-κB) signaling pathway, Inflammation 38 (2015) 510–519. [29] L. Huang, J.N. Xie, J.P. Liang, Y.H. Li, Y. Zhou, Sophoridine inhibits NF-κB signaling pathway activation in kidney tissue of endotoxemia mice, Yao xue xue bao = Acta pharm. Sinica 46 (2011) 1072–1077. [30] H.M. Yan, X.Y. Chen, Z.H. Zhang, D.H. Yu, X.B. Jia, Discussion about research ideas of chinese materia medica based on chinese materia medica components and “composition structure” theory, Chin. Tradit. Herb. Drugs 46 (2015) 1103–1110 in Chinese.
Panaxadiol saponin and dexamethasone improve renal function in lipopolysaccharide-induced mouse model of acute kidney injury, Plos One 10 (2015) e0134653. H. Ni, M. Ergin, Q. Huang, J. Qin, H.M. Amin, R.L. Martinez, Analysis of expression of nuclear factor κb (NF‐κB) in multiple myeloma: downregulation of NF‐κB induces apoptosis, Br. J. Haematol. 115 (2015) 279–286. H. Wu, G. Zhao, K. Jiang, C. Li, C. Qiu, G. Deng, Engeletin alleviates lipopolysaccharide-induced endometritis in mice by inhibiting tlr4-mediated NF-κB activation, J. Agric. Food Chem. 64 (2016) 6171. S.M. Bagshaw, S. Uchino, R. Bellomo, H. Morimatsu, S. Morgera, M. Schetz, Septic acute kidney injury in critically ill patients: clinical characteristics and outcomes, Hong Kong J. Nephrol. 17 (2015) 431–439. P. Zhou, Y.B. Wu, C.G. Zhao, X. Teng, L. Li, B. Li, Effects of glutamine on extracellular signal regulated kinase and p38mapk expression in the kidney in young rats with endotoxemia, Chin. J. Contemp. Pediatr. 11 (2009) 301 in Chinese. J.R. Bradley, TNF-mediated inflammatory disease, J. Pathol. 214 (2008) 149–160. X.T. Zhai, Z.Y. Zhang, C.H. Jiang, J.Q. Chen, J.Q. Ye, X.B. Jia, Nauclea officinalis inhibits inflammation in LPS-mediated raw 264.7 macrophages by suppressing the
252
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Lidanpaidu prescription alleviates lipopolysaccharide-induced acute kidney injury by suppressing the NF-κB signaling pathway Fan Zhang, Shan Lu, Siyi Jin, Keli Chen, Juan Li, Bisheng Huang, Yan Cao
T
⁎
Key Laboratory of Education Ministry on Traditional Chinese Medicine Resource and Compound Prescription, Hubei University of Chinese Medicine, Wuhan 430065, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Lidanpaidu prescription Acute kidney injury Inflammation NF-κB signaling pathway
The Lidanpaidu Prescription (LDP), a hospital preparation, composed of Chinese classical preparations, has been reported to have antiendotoxin, anticoagulant and other effects. However, its therapeutic effect on lipopolysaccharide (LPS)-induced acute kidney injury (AKI) and the mechanisms remain unclear. Therefore, we administered LPD pretreatment at different doses to examine the protective effects and mechanisms in LPS-induced AKI in mice. The kidney injury induced by LPS was assessed by histological examination. ELISA was used to detect the levels of inflammatory cytokines. The mRNA expression of the inflammatory genes IKKβ and TNF-α in kidney tissues was assessed by RT-PCR. Finally, Western blot was performed to assess the NF-κB signaling pathway related proteins, and the nuclear translocation of NF-kB P65 was detected by immunofluorescence laser confocal microscopy. The findings suggested that LDP significantly improved at 48 h animal survival (66.7%), compared with the LPS group (26.7%), determined by a Kaplan-Meier analysis. LDP attenuated the kidney histopathological changes induced by LPS and decreased the inflammatory cytokine levels in serum and renal tissue. Moreover, LDP markedly inhibited the expression of inflammatory genes and suppressed the activation of relevant proteins in the nucleus. In summary, these findings suggest that LDP reduces LPS-induced AKI via a mechanism related to the suppression of the NF-κB signaling pathway.
1. Introduction Sepsis is a systemic inflammatory response syndrome with a complex pathogenesis, mainly caused by invasive infection [1]. The main reasons for sepsis-induced death are an uncontrolled immune response, resulting in tissue and organ damage [2,3]. One of the most vulnerable target organs in endotoxin-induced sepsis is the kidney. More than 50% of patients in the ICU suffer from acute kidney injury (AKI) [4], and the mortality rate is as high as 30%–60% [5,6]. There are many therapeutic methods to investigate sepsis and its complications such as acute kidney injury [7], but there have been no significant decreases in its mortality rates. Lipopolysaccharide (LPS) is found in the outer membrane of Gramnegative bacteria. In mice and other animal models, LPS induces AKI and leads to a strong inflammatory response via nuclear factor-kappa B (NF-κB) activation [8]. When AKI occurs, endotoxin induces the production of cytokines, resulting in a systemic “cytokines storm”, accompanied by activation of the NF-κB signaling pathway. NF-κB is an important transcription factor downstream of the endotoxin signaling transduction pathway. When inflammation occurs, I kappa B kinase beta (IKK beta) is activated first, then the activated inhibitor kappa B
⁎
(IκB) kinase degrades the NF-κB inhibitory protein IκB and allows NFκB to translocate into the nucleus [9,10]. Therefore, inhibiting the NFκB signaling pathway might prevent AKI. The Lidanpaidu prescription(LDP) is composed of capillary artemisia, gardenia, salvia and six other kinds of traditional Chinese medicine (TCM), combined with the Yinchenhao decoction and the Dachengqi decoction, according to TCM syndrome differentiation therapy theory. The Yinchenhao decoction and Dachengqi decoction are famous prescriptions in the “Treatise on Febrile Diseases” written by Zhang Zhongjing during the Han Dynasty. Research and clinical application have shown that the Yinchenhao decoction and the Dachengqi decoction both have good cholagogic and anti-inflammatory effects [11,12]. The antiendotoxin effect of LDP has also been demonstrated by in vivo and vitro experiments [13–15]. LDP has also been awarded a national patent (patent application number CN200710051818.6, patent publication number CN100589820C). In the clinical, it is mainly used for the treatment of infections, trauma and functional lesions caused by endotoxemia [13–16], and has a good curative effect on respiratory tract infections and urinary system infections, especially nephritis. However, its mechanism of action is not clear. In the present study, we investigated the protective effects and the mechanisms of action of LDP
Corresponding author. E-mail address: [email protected] (Y. Cao).
https://doi.org/10.1016/j.biopha.2018.01.059 Received 19 September 2017; Received in revised form 4 January 2018; Accepted 5 January 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
group, LPS + dexamethasone hydrochloride [19] (5 mg/kg + LPS 7 mg/kg) group. All the mice were dosed by intragastric administration for seven days. One hour after the last intragastric administration, the LPS group, LPS + LDP group and dexamethasone group were injected intraperitoneally with LPS (7 mg/kg), and the control group was injected with normal saline in an equal volume. Then, the general condition and survival of the mice were monitored every 4 h up to 48 h and a survival curve was plotted. In the second round of studies, 48 mice were randomly divided into six groups (n = 8 each group): control group, LPS group (LPS 7 mg/kg), LPS + LDP (37.5, 75, and 150 g/ kg + LPS 7 mg/kg) groups, and a LPS + dexamethasone hydrochloride (5 mg/kg + LPS 7 mg/kg) group. The method of administration was as described above. Six hours after the LPS injection, the mice were culled and the blood and kidney tissues were harvested.
Table 1 The LDP prescription. TMC materials (pinyin)
Equivalent pharmaceutical name
Part used
Amount (g)
1 2 3
Yin chen Zhi zi Da huang
ArtemisiacapillarisThunb Gardenia jasminoides Ellis Rheum palmatum L．
30 15 15
4 5
Mang xiao Gan cao
Natrii Sulfas Radix Glycyrrhizae
6 7
Huang qi Dan shen
Radix Astragali seu Hedysari Radix Salviae Miltiorrhizae
8 9 Total
Jin yin hua Lian qiao
Flos Lonicerae Fructus Forsythiae
seedling fruit radix and rhizome mineral radix and rhizome radix radix and rhizome flower fruit
10 5 15 15 15 10 130
2.4. Measurement of inflammatory cytokines Retro-orbital blood samples were collected, then centrifuged at 4 °C for 20 min at 2500 rpm to collect the serum. The kidney tissues were ground in cold-PBS to obtain a homogenate. ELISA kits (Bioswamp) were used to measure TNF-α, IL-6 and IL-10 in serum and kidney homogenates, according to the manufacturer’s protocol.
in AKI caused by LPS in mice. 2. Materials and methods 2.1. Chemicals and reagents
2.5. Histopathological examination
Lipopolysaccharide (LPS; 0111:B4) was purchased from Sigma Chemical Co. (St. Louis, MO, USA). The FastQuant RT Kit and SuperReal PreMix Plus Kit were purchased from Tiangen Biotech Co. Ltd (Beijing, China). The Nuclear and Cytoplasmic Protein Extraction Kit, the BCA kit and BeyoECL Plus Kit were provided by Beyotime Co. Ltd. (Shanghai). TNF-α, IL-6, IL-10 ELISA kits were obtained from Bioswamp(Wuhan, China).
The kidney tissues were fixed in 10% formaldehyde, embedded in paraffin, then cut into 5 μm-thick slices followed by staining with hematoxylin and eosin (H&E). Histological changes were observed under a light microscope. 2.6. RT-PCR analysis
2.2. Preparation of LDP Total mRNAs was extracted from the kidney homogenates, and the purity and concentration of RNA were determined by a ultramicro UV detector. The mRNAs were reversely transcribed into first strand cDNA by the FastQuant RT Kit (Tiangen Biotech). Then semi-quantitative realtime PCR was conducted using the first strand cDNA and SuperReal PreMix Plus (SYBR Green) Kit (Tiangen Biotech) according to the manufacturer’s instructions. Real-time qPCR was performed for 35 cycles in 20 μL reaction volumes using a Roche L480 Real-time PCR System. The upstream and downstream primer sequences were as described previously [20] as follows: for β-actin: sense primer: 5′-TTGT TACCAACTGGGACG-3′, antisense primer: 5′-GGCATAGAGGTCTTTA CGG-3′; for IKKβ: sense primer: 5′- AGGCGACAGGTGAACAGAT -3′, antisense primer: 5′- CTAAGAGCCGATGCGATG -3′; for TNF-α: sense primer: 5′- GGCAGGTCTACTTTGGAGTCATTGC -3′, antisense primer: 5′- ACATTCGAGGCTCCAGTGAATTCGG -3′. Cycling of IKKβ began at 95 °C for 15 min, then cycled 35 times: denatured at 95 °C for 20 s, annealed at 56 °C for 30 s and extended at 72 °C for 40 s. Cycling of
The Lidanpaidu Prescription, supplied by Shiyan Taihe Hospital, was prepared according to the preparation method described by Zheng et al. [16]. All the herbal medicines (Table 1) in the preparation were shown to be endotoxin-free by Professor Keli Chen of Hubei University of Chinese Medicine, according to the Chinese Pharmacopoeia (2015 version). The component analysis of the extract has been provided by other authors [16–18]. 2.3. Animals and treatments In total, 108 mice (BABL/c mice, 6–8 weeks old) were purchased from the Hubei experimental animal research center (Wuhan, China). All procedures were approved by the Ethics Committee of Hubei University of Chinese Medicine. In the first group of studies, 60 BALB/c mice were randomly divided into four groups: control group (saline), LPS group (LPS 7 mg/kg), LPS + LDP (LDP 75 g/kg + LPS 7 mg/kg)
Fig. 1. Survival rate analysis. **P < 0.01 vs LPS group.
246
△△
P < 0.01 vs control group;
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
Fig. 2. Expression of inflammatory cytokines in serum and kidney tissues. n = 8, mean ± SEM.
△△
P < 0.01 vs. control group; *P < 0.05 vs. LPS group;
**
P < 0.01 vs. LPS group.
2.7. Western blot analysis
TNF-α was initiated at 95 °C for 15 min, then cycled 35 times: denatured at 95 °C for 20 s, annealed at 60 °C for 30 s and extended at 72 °C for 40 s. Gene expression was measured by the 2−ΔΔCT computational method.
The total protein, cytoplasmic and nuclear proteins were separated from renal tissue homogenates on ice. The concentration of the extracted protein was measured using a BCA kit (Beyotime). The protein samples were fractionated by 12% SDS-PAGE and then transferred to PVDF membranes (Millipore). After blocking with 5% nonfat milk, the 247
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
Fig. 3. HE staining of kidney tissues. (hematoxylin and eosin staining, A: magnification × 200; B: magnification × 400).
images were obtained using a confocal laser scanning microscope (Nikon C2).
PVDF membranes were then incubated with diluted antibodies against p-NF-κB (1:1000; CST; catalog number: 3033T), Lamin B1 (1:1000; CST; 12586S), IκB (1:1000; CST; 4812S), p-IκB (1:1000; CST; 9245S) and β-actin (1:1000; CST; 4970S) overnight at 4 °C. After incubating the membrane with the appropriate secondary antibody at room temperature for 1 h, the immunoreactive strip was labeled using the BeyoECL Plus Kit (Beyotime). The blot was obtained using a gel imaging system (Bio-Rad).
2.9. Statistical analysis All results are expressed as mean ± SEM. SPSS statistical 22.0 statistical software was used for the analysis. The comparison of the means of between the various groups was analyzed by one-way ANOVA. Survival was assessed using Kaplan-Meier curves and the logrank test was performed to analyze the data. P < 0.05 or P < 0.01 indicated statistical significance.
2.8. Immunofluorescence In order to observe the nuclear translocation of NF-κB p65 protein in the different groups, we conducted immunofluorescence confocal laser scanning experiments according to a method described in the literature [21]. In brief, the kidneys were fixed in formalin and embedded in paraffin. The sections were then incubated with 0.3% Triton X-100 and 10% BSA. NF-κB antibody (1:200; CST; catalog number: 8242S) was used to label the protein and nuclei were stained with DAPI. Finally, the
3. Results 3.1. Protective effect of LDP on the survival of mice with fatal sepsis Mice in the LPS group started to die at 12 h with the lowest 48 h survival rate (26.7%); the LPS + LDP group had the first dead mice at 248
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
3.3. Inhibitory effect of LDP on pathological changes The kidney tissue morphology was normal in the control group as shown in Fig. 3. However, there were obvious injuries in the kidney tissues in the LPS group, including flat and sloughed tubular epithelial cells, loss of the brush border and visible bare membranes. These kidney tissue injuries were markedly ameliorated in the LDP (37.5, 75, 150 g/kg) and dexamethasone (5 mg/kg) groups. 3.4. Inhibitory effect of LDP on TNF-α and IKKβ mRNA There was a marked rise in the expression of TNF-α and IKKβ mRNA in the LPS group. The mRNA expression was markedly decreased in the LDP (37.5, 75, 150 g/kg) and dexamethasone (5 mg/kg) groups. LPS could significantly upregulated the expression of inflammatory genes and LDP administration reduced the expression of these genes, in a dose-dependent manner (Fig.4). Fig. 4. Effect of LDP on the expression of mRNA in kidney tissue. n = 8, mean ± SEM. △△ P < 0.01 vs. control group; *P < 0.05 vs. LPS group; **P < 0.01 vs. LPS group.
3.5. Effect of LDP on NF-κB signaling pathway-related proteins NF-κB signaling pathway-related proteins were assessed through Western blot analysis. The data show that the phosphorylation ratio of IκBα in the LPS group was the highest of all the groups. Pretreatment with LDP and dexamethasone decreased the IκBα phosphorylation ratio. Furthermore, phosphorylated NF-κB p65 was markedly upregulated in both the nuclear and cytoplasmic protein in the LPS group and down-regulated in the pretreated groups (Fig. 5). Immunofluorescent confocal microscopy indicated that the expression of p65 in the control group was low and mainly existed in the cytoplasm. The expression of p65 in the LPS group was the highest and mainly existed in the nucleus. The nuclear p65 levels in the pretreatment groups were significantly lower than in the LPS group. The images indicated that the activated cells were located in the renal tubules and the renal cortices (Fig. 6).
12 h with 66.7% 48 h survival, while the first death in the LPS + dexamethasone group occurred at 24 h with 80.0% 48 h survival. No deaths occurred in the control group. The difference between the LPS group versus the control group (χ² = 17.414, P = 0.000), the LPS + LDP group versus the LPS group (χ² = 8.310, P = 0.004), and the LPS + dexamethasone group versus the LPS group (χ² = 11.649, P = 0.001) were significant. (Fig.1)
3.2. Inhibitory effect of LDP on expression of inflammatory cytokines expression There was a dramatic increase in inflammatory cytokine expression in the LPS group, as shown in Fig. 2. These levels in were significantly suppressed in a dose-dependent manner by LDP (37.5, 75, 150 g/kg) and dexamethasone hydrochloride (5 mg/kg). There were no significant differences between the treatment and control groups.
4. Discussion Acute kidney injury is caused by sepsis in 47.5% of patients in the ICU [22]. The mortality of AKI caused by sepsis is also significantly
Fig. 5. The expression of the NF-κB signaling pathway related proteins. n = 3, x ± s.
△△
249
P < 0.01 vs. control group; *P < 0.05 vs. LPS group;
**
P < 0.01 vs. LPS group.
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
Fig. 6. Effects of LDP on the expression and translocation of NF-kB and p65 into the nucleus. A: control group; B: LPS group; C: LPS + LDP (37.5 g/ kg + LPS 7 mg/kg) groups; D: LPS + LDP (75 g/ kg + LPS 7 mg/kg) groups; E: LPS + LDP (150 g/ kg + LPS 7 mg/kg) groups; F: LPS + dexamethasone hydrochloride (5 mg/kg + LPS 7 mg/kg) group. (Magnification × 400).
stimulated by LPS [24]. In this study, we used LPS-induced AKI in mice as a model to explore the protective effect of LDP and its possible protective mechanisms. The results show that LDP could reduce the damage of septic AKI induced by LPS via a mechanism related to inhibition of the NF-κB signaling pathway. Based on the survival test, the LDP and dexamethasone group appeared to be protected from fatal endotoxemia, compared with the LPS
higher than that of non-sepsis acute renal injury. At present, there is no effective treatment for septic AKI. Endotoxin can lead to multiple organ dysfunction in animals, such as the heart, lung, liver, kidney and other organs. In the LPS-induced model, the role of LPS is time-dependent. The first organ to be damaged by LPS in animals is the lungs, followed by other organs. The peak of renal damage is 6 h after intraperitoneal injection of LPS [23]. The NF-κB signaling pathway is activated when 250
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
artemisia, honeysuckle and gardenia are the main components. Therefore, the main effective constituents chlorogenic acid, teniposide and salvianolic acid B were determined by HPLC for a qualitative identification and quantitative determination. The chemical constituents of Chinese herbal formulas are the material basis for their efficacy. Chinese herbal formulas focus on the interactions between drugs and are therefore multi-target, multi-ingredient and multi-effect formulations [30]. In a previous study, we also found that LDP has a good anti-endotoxin effect in vivo and in vitro. However, the mechanism of the antiendotoxin effect is still unclear. Therefore, we conducted this study to explore the mechanism of action of LDP.
group (26.7% survival). LPS stimulation can activate macrophages and induce the secretion of inflammatory cytokines [25]. Based on the ELISA results, the proinflammatory cytokines TNF-α and IL-6 in serum and kidney tissues were obviously higher after LPS stimulation; TNF-α and IL-6 are critical proinflammatory cytokines in the pathogenesis of inflammatory diseases. A significant reduction in TNF-α and IL-6 suggested that LDP treatment had an anti-inflammatory effect in LPS-induced AKI. Previous research [8,26] has shown that inhibiting the production of inflammatory cytokines can effectively treat AKI induced by LPS. Meanwhile, upregulation of the anti-inflammatory factor IL-10 indicated that the body was attempting to regulate inflammation after LPS administration; the decrease in IL-10 levels after LDP treatment revealed that it has a good prognosis in the treatment of AKI. In addition, the histological analysis also demonstrated that LDP alleviated renal injury. NF-κB is an important transcription factor associated with the pathogenesis of various inflammatory diseases [20]. Many extracellular stimuli, such as LPS, TNF-α and IL-6, can activate the NF-kB signaling pathway. When stimulated, the IKKβ subunit is phosphorylated and activated, so that the Ser32 and Ser36 sites of the IkBα protein are phosphorylated. Subsequently, the IκB protein is ubiquitinated and degraded by 26S proteolytic enzymes. Finally, p50/p65 is released and transported into the nucleus to specifically bind to target sequences and modulate gene expression [27]. In order to determine the protective mechanism of LDP, we examined the effects of LDP on activation of the NF-κB signaling pathway. The results suggest that the IKKβ mRNA, NFκB mRNA, IκB and phosphorylated IκB protein in kidney tissue were increased after the administration of LPS. Simultaneously, we also detected the content of phosphorylated NF-κB protein in the nucleus and cytoplasm to show that the signaling pathway was activated. Western blot analysis found that, in the LPS group, NF-κB was significantly increased in the nucleus and cytoplasm, indicating that phosphorylated NF-κB protein entered the nucleus and the signaling pathway was activated [28,29]. After treatment with LDP and dexamethasone, the expression of NF-κB pathway-related genes and proteins was markedly suppressed in a dose-dependent relationship, i.e. the effects of 75 g/kg and 150 g/kg were obviously better than that of 37.5 g/kg. However, there was no significant difference between 75 g/kg and 150 g/kg, and we speculate that we may have reached the plateau region of the doseresponse curve. Moreover, immunofluorescence confocal laser analysis revealed that the NF-κB p65 was transferred into the nucleus after LPS injection and the NF-κB signaling pathway was activated. NF-κB nuclear translocation was also inhibited by LDP. These results are consistent with the Western blot results and intuitively visible. These results indicate that LDP prevents LPS-induced AKI by suppressing NF-κB activation. There are a number of limitations to this study. First, although we found that LDP has a protective effect on LPS-induced AKI, this was only after pretreatment, rather than a therapeutic effect. Due to the complex ingredients of Chinese medicine, the specific ingredients may be the original materials or metabolites, so Chinese medicine has a relatively long period of drug administration and most of traditional Chinese medicines show a time-lag effects. Whether LDP has a therapeutic effect on LPS-induced AKI in mice needs to be further explored. In addition, it is unclear which ingredient in LDP mediated these effects. This requires further isolation, purification and identification to obtain the active components. Although this study showed that LDP can alleviate LPS-induced AKI by suppressing activation of the NF-kB signaling pathway, whether it has effects on other related pathways and targets remains to be determined. In previous studies, we identified some components of LDP using the HPLC-UV method [16–18]. Among the ingredients, chlorogenic acid is usually used in the quality control of Flos Lonicerae in the Chinese pharmacopeia. Similarly, teniposide is used for the quality control of gardenia, salvianolic acid for cortex moutan, and rhein, emodin and chrysophanol for rhubarb. In the Lidanpaidu prescription, capillary
5. Conclusion In conclusion, we demonstrate that LDP suppresses the production of inflammatory cytokines, reduces pathological damage and inhibits activation of the NF-κB signaling pathway. Therefore, LDP can effectively reduce AKI caused by LPS, and may be a potential alternative treatment for AKI in Chinese medicine. Conflict of interest The authors declare no conflict of interest. Acknowledgment This work was supported by the natural science foundation of Hubei provincial science and Technology Department (grant numbers 2014CFB243) References [1] J.A. Buras, Holzmann B, M. Sitkovsky, Animal models of sepsis: setting the stage, Nat. Rev. Drug Discov. 4 (2005) 854–865. [2] T. Calandra, B. Echtenacher, D.L. Roy, J. Pugin, C.N. Metz, L. Hültner, Protection from septic shock by neutralization of macrophage migration inhibitory factor, Nat. Med. 6 (2000) 164. [3] W.D. Döcke, F. Randow, U. Syrbe, D. Krausch, K. Asadullah, P. Reinke, H.D. Volk, W. Kox, Monocyte deactivation in septic patients: restoration by IFN-γ treatment, Nat. Med. 3 (1997) 678. [4] S. Uchino, J.A. Kellum, R. Bellomo, G.S. Doig, H. Morimatsu, S. Morgera, Acute renal failure in critically ill patients: a multinational, multicenter study, JAMA J. Am. Med. Assoc. 294 (2005) 813. [5] J. Klenzak, J. Himmelfarb, Sepsis and the kidney, Crit. Care Clin. 21 (2005) 211. [6] M. Ostermann, R.W. Chang, Acute kidney injury in the intensive care unit according to rifle, Crit. Care Med. 35 (2007) 1837–1843. [7] A. Zarjou, A. Agarwal, Sepsis and acute kidney injury, J. Am. Soc. Nephrol. JASN 22 (2011) 999. [8] H.Y. Ye, J. Jin, L.W. Jin, Y. Chen, Z.H. Zhou, Z.Y. Li, Chlorogenic acid attenuates lipopolysaccharide-induced acute kidney injury by inhibiting TLR4/NF-κB signal pathway, Inflammation 40 (2017) 523–529. [9] J.A. Brockman, D.C. Scherer, T.A. Mckinsey, S.M. Hall, X. Qi, W.Y. Lee, Coupling of signal response domain in Iκbα to multiple pathway for NF-κB activation, Mol. Cell. Biol. 15 (1995) 2809–2818. [10] M.J. May, S. Ghosh, Rel/nf-κb and iκb proteins: an overview, Semin. Cancer Biol. 8 (1997) 63–73. [11] Y.P. Mu, P. Liu, L. Wang, Evolution and modern research of yinchenhao decoction, Chin. J. Exp. Tradit. Med. Formulae 12 (2006) 67–71 in Chinese. [12] C.Y. Ma, J. Zhou, H.L. Li, Y. Geng, J.W. Tang, C.R. Peng, Effect of dachengqi decoction on cytokines tumor necrosis inflammatory cytokines in rats with endotoxaemia, Chin. J. Exp. Tradit. Med. Formulae 17 (2011) 130–133 in Chinese. [13] J. Li, M.X. Chang, K.L. Chen, T.X. Zhao, G. Chen, Protective effect of Lidanpaidu oral liquid on antipyretic and pathological damage in rabbits induced by LPS, Pharmacol. Clin. Chin. Mater. Med. 25 (2009) 59–61 in Chinese. [14] M.X. Chang, J. Zhang, K.L. Chen, Study on the anti endotoxin effect of Lidanpaidu oral liquid in vitro, Chin. Tradit. Pat. Med. 29 (2007) 1506–1508 in Chinese. [15] M.M. Wu, K.L. Chen, M.X. Chang, Experimental study on the anti-endotoxemia of Lidanpaidu oral liquid, Acta Chin. Med. 32 (2017) 594–597 in Chinese. [16] J. Zheng, T. Qin, S. Du, L. Huang, Study on preparation and quality standard of jinyinqingre oral liquid, J. Pediatr. Pharm. 19 (2013) 610–614. [17] L. Huang, C. Zhang, L. Lu, S. Du, Determination of rhein, emodin and chrysophanol in lidan paidu oral liquids by HPLC, China Pharmacist 15 (2012) 1122–1124 in Chinese. [18] L. Huang, J. Zheng, S. Du, Study on HPLC fingerprint chromatogram of jinyin qingre oral liquids, China Pharm. 17 (2014) 71–74. [19] Y. Chen, Y. Du, Y. Li, X.Q. Wang, P. Gao, Y. Guang, Y. Fang, Y. Meng, X.J. Zhao,
251
Biomedicine & Pharmacotherapy 99 (2018) 245–252
F. Zhang et al.
[20]
[21]
[22]
[23]
[24] [25]
NF-κB signaling pathway, J. Ethnopharmacol. 183 (2016) 159–165. [26] D. Xu, M. Chen, X. Ren, Y. Wu, Leonurine ameliorates LPS-induced acute kidney injury via suppressing ros-mediated nf-κb signaling pathway, Fitoterapia 97 (2014) 148–155. [27] Q. Li, I.M. Verma, NF-κB regulation in the immune system, Nat. Rev. Immunol. 2 (2002) 975. [28] G. Li, J. Fu, Y. Zhao, K. Ji, T. Luan, B. Zang, Alpha-lipoic acid exerts anti-inflammatory effects on lipopolysaccharide-stimulated rat mesangial cells via inhibition of nuclear factor kappa B (NF-κB) signaling pathway, Inflammation 38 (2015) 510–519. [29] L. Huang, J.N. Xie, J.P. Liang, Y.H. Li, Y. Zhou, Sophoridine inhibits NF-κB signaling pathway activation in kidney tissue of endotoxemia mice, Yao xue xue bao = Acta pharm. Sinica 46 (2011) 1072–1077. [30] H.M. Yan, X.Y. Chen, Z.H. Zhang, D.H. Yu, X.B. Jia, Discussion about research ideas of chinese materia medica based on chinese materia medica components and “composition structure” theory, Chin. Tradit. Herb. Drugs 46 (2015) 1103–1110 in Chinese.
Panaxadiol saponin and dexamethasone improve renal function in lipopolysaccharide-induced mouse model of acute kidney injury, Plos One 10 (2015) e0134653. H. Ni, M. Ergin, Q. Huang, J. Qin, H.M. Amin, R.L. Martinez, Analysis of expression of nuclear factor κb (NF‐κB) in multiple myeloma: downregulation of NF‐κB induces apoptosis, Br. J. Haematol. 115 (2015) 279–286. H. Wu, G. Zhao, K. Jiang, C. Li, C. Qiu, G. Deng, Engeletin alleviates lipopolysaccharide-induced endometritis in mice by inhibiting tlr4-mediated NF-κB activation, J. Agric. Food Chem. 64 (2016) 6171. S.M. Bagshaw, S. Uchino, R. Bellomo, H. Morimatsu, S. Morgera, M. Schetz, Septic acute kidney injury in critically ill patients: clinical characteristics and outcomes, Hong Kong J. Nephrol. 17 (2015) 431–439. P. Zhou, Y.B. Wu, C.G. Zhao, X. Teng, L. Li, B. Li, Effects of glutamine on extracellular signal regulated kinase and p38mapk expression in the kidney in young rats with endotoxemia, Chin. J. Contemp. Pediatr. 11 (2009) 301 in Chinese. J.R. Bradley, TNF-mediated inflammatory disease, J. Pathol. 214 (2008) 149–160. X.T. Zhai, Z.Y. Zhang, C.H. Jiang, J.Q. Chen, J.Q. Ye, X.B. Jia, Nauclea officinalis inhibits inflammation in LPS-mediated raw 264.7 macrophages by suppressing the
252