Trametinib alleviates lipopolysaccharide-induced acute lung injury by inhibiting the MEK-ERK-Egr-1 pathway

International Immunopharmacology 80 (2020) 106152

Contents lists available at ScienceDirect

International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp

Trametinib alleviates lipopolysaccharide-induced acute lung injury by inhibiting the MEK-ERK-Egr-1 pathway

T

Shanshan Chena,1, Heng Xua,1, Ping Yeb, Chuangyan Wuc, Xiangchao Dingd, Shanshan Chene,f, ⁎ ⁎ ⁎ Hao Zhanga, Yanqiang Zoua, Jing Zhaoa, Sheng Lea, Jie Wua, , Shu Chena, , Jiahong Xiaa, a

Department of Cardiovascular Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China Department of Cardiovascular Medicine, Central Hospital of Wuhan, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430014, China c Department of Thoracic Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China d Department of Thoracic Surgery, Renmin Hospital of Wuhan University, Wuhan 430060, China e Key Laboratory for Molecular Diagnosis of Hubei Province, Central Hospital of Wuhan, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430014, China f Central Laboratory, Central Hospital of Wuhan, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430014, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Acute lung injury (ALI) Trametinib Early growth response (Egr)-1 Macrophages Lipopolysaccharide (LPS)

Acute lung injury (ALI) is a devastating clinical disorder with a high mortality rate and for which there is no effective treatment. The main characteristic of ALI is uncontrolled inflammation, and macrophages play a critical role in the development of this disorder. Trametinib, an inhibitor of MAPK/ERK kinase (MEK) activity that possesses anti-inflammatory properties, has been approved for clinical use. Herein, the influence of trametinib and its underlying mechanism were investigated using a lipopolysaccharide (LPS)-induced murine ALI model. We found that trametinib treatment prevented the LPS-facilitated expression of proinflammatory mediators in macrophages, and this anti-inflammatory action was closely correlated with suppression of the MEK-ERK-early growth response (Egr)-1 pathway. Furthermore, trametinib treatment alleviated LPS-induced ALI in mice, and attenuated edema, proinflammatory mediator production, and neutrophil infiltration. Trametinib pretreatment also attenuated the MEK-ERK-Egr-1 pathway in lung tissues. In conclusion, these data demonstrate that trametinib pretreatment suppresses inflammation in LPS-activated macrophages in vitro and protects against murine ALI established by LPS administration in vivo through inhibition of the MEK-ERK-Egr-1 pathway. Therefore, trametinib might have therapeutic potential for ALI.

1. Introduction Acute lung injury (ALI), which is characterized by dysregulated inflammation, alveolar edema and reduced lung compliance, is a devastating clinical disorder with substantial costs and high morbidity and mortality [1,2]. Unfortunately, despite numerous trials and studies, no specific and effective treatments are currently available for ALI; instead, the patients are only administered supportive management and bedside care [3,4]. Therefore, there remains an urgent need to unravel the underlying mechanism of ALI and identify novel therapeutic avenues for this disorder. Excessive inflammatory cell infiltration and uncontrolled inflammation are hallmarks of ALI. Lipopolysaccharide (LPS) is widely used to induce acute pulmonary inflammation in experimental ALI

[5–7]. The role of macrophages in initiating and maintaining the inflammatory response in ALI has been widely addressed in a large number of studies [8–10]. Through the pattern recognition of foreign substances, macrophages initiate host defense responses via a proinflammatory cascade and clear the pathogens. In addition, proinflammatory mediators, such as interleukin (IL)-1β and tumor necrosis factor (TNF)-α, potentiate chemokine secretion, which results in the accumulation of neutrophils, macrophages and lymphocytes and contributes to tissue damage through the generation of toxic mediators and reactive oxygen species [11]. Thus, the modulation of macrophages might represent a new therapeutic approach for ALI. Trametinib, an allosteric inhibitor of MAPK/ERK kinase (MEK) activity, has been approved for the treatment of metastatic melanoma and non-small-cell lung cancer [12,13]. Trametinib also confers protection

⁎

Corresponding authors at: Department of Cardiovascular Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Jiefang Road 1227, Wuhan 430022, China. E-mail addresses: [email protected] (J. Wu), [email protected] (S. Chen), [email protected] (J. Xia). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.intimp.2019.106152 Received 8 August 2019; Received in revised form 9 December 2019; Accepted 22 December 2019 1567-5769/ © 2020 Elsevier B.V. All rights reserved.

International Immunopharmacology 80 (2020) 106152

S. Chen, et al.

against kidney fibrosis and abdominal adhesion formation in mice [14,15]. Moreover, experimental studies have shown that trametinib exerts anti-inflammatory effects and ameliorates rheumatoid arthritis, malaria, sepsis and acute kidney injury [16–19]. However, the effect of trametinib on ALI has not been elucidated. Considering its clinical application and its effect on inflammation, we hypothesized that trametinib might exert inhibitory effects in ALI. In our current study, we first assessed the influence of trametinib on the LPS-induced expression and secretion of inflammatory mediators in murine peritoneal macrophages. We then employed RNA-sequencing to decipher the potential mechanisms, evaluated the effect of trametinib on LPS-induced murine ALI and explored the possible mechanisms.

RAW264.7 cells were cultured in DMEM supplemented with 10% FBS at 37 °C in a humidified incubator with 5% CO2. 2.4. RNA-sequencing

2. Materials and methods

Total RNA was extracted from murine peritoneal macrophages subjected to 12 h of LPS (100 ng/ml) stimulation after 2 h of pretreatment with 100 nM trametinib (LPS + trametinib group, n = 3) or DMSO (LPS + DMSO group, n = 3) and sequenced using a BGISEQ-500 sequencer (BGI). Clean reads were analyzed using the HISAT2_FeatureCounts-DESeq2 pipeline. The detailed method is described in the supplemental methods. The microarray data are available through the National Center for Biotechnology Information Gene Expression Omnibus (GSE134486).

2.1. Materials

2.5. Egr-1 knockdown in RAW264.7 cells by siRNA

Trametinib was purchased from Selleck Chemicals (Houston, TX, USA), and LPS (Escherichia coli 0111:B4), dimethyl sulfoxide (DMSO), corn oil and thioglycolate broth were purchased from Sigma (St. Louis, MO, USA). The myeloperoxidase (MPO) and malondialdehyde (MDA) assay kits were acquired from Nanjing Jiancheng Bioengineering Institute (Nanjing, China), and enzyme-linked immunosorbent assay (ELISA) kits were purchased from Neobioscience (Guangdong, China). Primary antibodies against GAPDH, ERK1/2, p-ERK1/2, MEK1/2, pMEK1/2, and early growth response (Egr)-1 and HRP-linked anti-rabbit IgG antibody were purchased from Cell Signaling Technology (Beverly, MA, USA). The primary antibody against Gr-1 was obtained from Abcam (Cambridge, MA, USA), and the primary antibody against Flag was purchased from ABclonal (Wuhan, China). Phosphate buffer saline (PBS), Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), and Lipofectamine 3000 were purchased from Thermo Fisher Scientific (MA, USA). An enhanced BCA protein assay kit and RIPA buffer were purchased from Beyotime (Shanghai, China), and TRIzol reagent was obtained from Invitrogen (Carlsbad, CA, USA). PrimeScript RT Master Mix and TB Green Premix Ex Taq were purchased from Takara Clontech (Dalian, China), and puromycin was procured from Amresco (Solon, USA).

RAW264.7 cells were transfected with scrambled siRNA (100 nM) or Egr-1 siRNA (100 nM) (RiboBio, Guangzhou, China) using Lipofectamine 3000 following the manufacturer’s guidelines. Fortyeight hours later, the cells were cultured with fresh medium and then challenged with LPS (100 ng/ml) for the required time. The targeting sequences of Egr-1 siRNA are listed in Table 1. 2.6. Egr-1 overexpression in RAW264.7 cells by lentivirus Egr-1-containing lentiviral particles (Lv-Egr-1) and scramble control lentiviral particles (Lv-NC) were purchased from Genechem Company (Shanghai, China). RAW264.7 cells were infected at a multiplicity of infection (MOI) of 100 with Lv-Egr-1 or Lv-NC for 48 h according to the manufacturer’s instructions and then selected with puromycin (8 μg/ ml) for 1 week to obtain stable clones. 2.7. ELISA The protein levels of IL-1β, monocyte chemotactic protein (MCP) 1, and TNF-α in the conditioned medium or BALF were assessed using ELISA kits following the manufacturer’s recommended protocols.

2.2. Experimental animals and protocols

2.8. Wet/dry weight (W/D) ratio

The animal experimental procedures were approved by the Animal Care and Use Committee of Huazhong University of Science and Technology. Eight- to 10-week-old male mice on the C57BL/6 background were obtained from HFK Bioscience (Beijing, China) and housed in a specific pathogen-free (SPF) facility. The ALI model was established through the intratracheal administration of LPS. Briefly, the mice were randomly divided into two groups: the LPS group (n = 20) and the LPS + trametinib group (n = 20). The mice were orally administered corn oil containing trametinib (3 mg/kg/d) or DMSO for 3 days. On the third day, all the mice were intratracheally administered LPS (5 mg/kg) 2 h after the administration of corn oil with trametinib or DMSO. All the mice were sacrificed 12 h post LPS instillation, and lung samples and bronchoalveolar lavage fluid (BALF) were harvested as previously reported [20].

The freshly harvested lung samples were weighed to obtain the wet weight. The lung tissues were then dried for 48 h and reweighed to obtain the dry weight. Subsequently, the lung W/D ratio was calculated. 2.9. MPO activity and MDA levels in lung tissues To prepare 5% lung homogenates, the collected lung tissues were homogenized with sterile saline and then centrifuged. The activity of MPO and the levels of MDA in the lung homogenates were assessed using MPO and MDA assay kits, respectively. 2.10. Total protein concentration in the BALF The collected BALF was centrifuged, and the supernatants were prepared. Subsequently, the total BALF protein concentration was

2.3. Cell culture Murine primary peritoneal macrophages were isolated and cultured as previously reported [21]. In brief, we intraperitoneally injected mice with cold PBS 72 h post thioglycolate broth injection. The mice were then gently massaged. Subsequently, the peritoneal fluid was collected and centrifuged, and the cell pellet was resuspended. The macrophages were seeded in culture plates with DMEM containing 10% FBS, cultured at 37 °C for 1 h, and then gently washed to remove nonadherent cells and cultured with fresh medium.

Table 1 siRNA targeting sequences.

2

Gene

Targeting sequences

Egr-1 siRNA1 Egr-1 siRNA2 Egr-1 siRNA3

CCAACAGTGGCAACACTTT CCTTCGCTCACTCCACTAT GCTGCCTCTTCACTCTCTT

International Immunopharmacology 80 (2020) 106152

S. Chen, et al.

effect on LPS-induced MEK1/2 and ERK1/2 phosphorylation. A Western blot analysis indicated that murine peritoneal macrophages exhibited significantly increased MEK1/2 activation at various time points after LPS stimulation and that the administration of trametinib effectively attenuated this activation induced by LPS exposure for 10 min or 30 min (Fig. 1A). Moreover, augmented ERK1/2 activation was observed in macrophages challenged with LPS for 10 min, and this alteration was markedly dampened by trametinib pretreatment (Fig. 1A). The influence of trametinib on proinflammatory mediator expression and secretion in murine peritoneal macrophages was then evaluated. The qPCR assay results indicated that LPS treatment robustly upregulated the expression of the cytokines IL-1β and TNF-α and of the chemokine MCP1 (Fig. 1B). Additionally, elevated protein concentrations of IL-1β, MCP1 and TNF-α were detected in the supernatants obtained from LPS-challenged macrophages (Fig. 1C). The pretreatment of macrophages with trametinib decreased the LPS-induced expression and secretion of all the tested cytokines and chemokine (Fig. 1B and C). In summary, these data indicate that trametinib attenuates LPS-induced MEK-ERK activation and the expression and secretion of proinflammatory mediators in murine peritoneal macrophages.

assessed using an enhanced BCA protein assay kit. 2.11. Western blot analysis Cellular and tissue proteins were extracted in RIPA buffer. The protein concentrations were determined using an enhanced BCA protein assay kit. Thirty micrograms of denatured protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to polyvinylidene difluoride membranes (Roche, Indianapolis, IN, USA). The membranes were then blocked for 1 h at room temperature and probed overnight with primary antibodies against GAPDH, ERK1/2, p-ERK1/2, MEK1/2, p-MEK1/2, Egr-1 and Flag at 4 °C. The membranes were then incubated with an HRP-linked anti-rabbit IgG antibody and finally detected with ECL reagents (GE Healthcare RPN2235, Chalfont, UK) using a ChemiDocTM XRS+ system (Bio-Rad, Hercules, CA, USA). The quantification of each protein was performed using ImageJ software (NIH, MD, USA). 2.12. RNA isolation and quantitative real-time PCR (qPCR) Total RNA was isolated using TRIzol reagent. PrimeScript RT Master Mix was used to synthesize complementary DNA (cDNA). qPCRs were performed using TB Green Premix Ex Taq following the manufacturer’s recommended protocols. The relative expression of the messenger RNA (mRNA) of interest was analyzed using the 2−ΔΔCt method and normalized to that of GAPDH. The primers used are listed in Table 2.

3.2. Transcriptomic profile of trametinib in LPS-treated murine peritoneal macrophages To further illustrate the mechanism of trametinib, an RNA-sequencing analysis was performed, and the expression profile of 16,713 genes was thus obtained. The differentially expressed genes (DEGs) between the LPS + trametinib group (LT1, LT2, LT3) and the LPS + DMSO group (LD1, LD2, LD3) were identified using the DESeq2 package. Among the 872 identified DEGs, 361 genes were upregulated, and 511 genes were downregulated (adjusted P value < 0.001, log2(fold change) > 1). In peritoneal macrophages, trametinib pretreatment attenuated the expression of genes whose expression was highly induced by LPS, such as Egr-1, Cxcl2, Cebpd, Fos, Ccl4, Ccl3, Cxcl1, Rbpj, Egr-2, Il1a, Nlrp3, Il12a, Maf, Tnf, Ccl9, Tlr13, Clec4d, Ifnar1, Utp6, and Evi2a (Fig. 2A). We subsequently performed pathway annotations of the DEGs using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, and the significantly enriched terms were identified. The downregulated DEGs were particularly enriched in the following pathways: cytokine-cytokine receptor interaction, MAPK signaling pathway, chemokine signaling pathway, NF-κB signaling pathway and AGE-RAGE signaling pathway in diabetic complications (Fig. 2B). A gene set enrichment analysis (GSEA) showed that trametinib negatively modulated LPS-induced peritoneal macrophage gene expression (Fig. 2C). To reveal the macrophage‐related annotated functional terms, the biological significance of the identified DEGs was explored by gene ontology (GO) category enrichment analysis. The GO terms were mainly enriched in various biological processes, such as cellular process and single-organism process, in several molecular functions, including binding and catalytic activity, and in a number of cellular components, such as cell and cell part (Fig. 2D).

2.13. Lung pathology The lung samples were fixed, embedded and then sectioned, and the resulting lung slices were stained with hematoxylin and eosin (HE). The extent of lung injury was scored in a blinded manner, as previously reported [22]. Neutrophil infiltration was evaluated by immunofluorescence staining with anti-Gr-1 antibody. 2.14. Statistical analysis The results are expressed as the means ± standard deviation (SD). Two-group and multigroup comparisons were performed using unpaired Student’s t-test and one-way analysis of variance (ANOVA), respectively. All the results were analyzed using GraphPad Prism 7 (San Diego, CA, USA). A P value less than 0.05 was considered statistically significant. 3. Results 3.1. The MEK inhibitor trametinib prevents the LPS-induced expression and secretion of proinflammatory mediators in murine peritoneal macrophages Because trametinib is a potent MEK inhibitor, we characterized its Table 2 Primers for quantitative real-time PCR.

3.3. Trametinib treatment suppresses the LPS-induced Egr-1 expression in macrophages

Gene

Sense (5′–3′)

Anti-sense (5′–3′)

GAPDH IL-1β MCP1 TNF-α Egr-1 Cebpd Fos Rbpj Maf TF mPGES-1 ICAM-1

CTCATGACCACAGTCCATGC TGTAATGAAAGACGGCACACC GCTCAGCCAGATGCAGTTAA CTTCTGTCTACTGAACTTCGGG TCGGCTCCTTTCCTCACTCA CGACTTCAGCGCCTACATTGA CGGGTTTCAACGCCGACTA AACAGCGATGACATTGGTGTG AGCAGTTGGTGACCATGTCG TGGGGGTTGGGTGTACGAT GGATGCGCTGAAACGTGGA TCCGCTACCATCACCGTGTAT

CACATTGGGGGTAGGAACAC TCTTCTTTGGGTATTGCTTGG TCTTGAGCTTGGTGACAAAAACT CAGGCTTGTCACTCGAATTTTG CTCATAGGGTTGTTCGCTCGG GAAGAGGTCGGCGAAGAGTT TTGGCACTAGAGACGGACAGA ACCGAAGGCGATTGAACAGTG TGGAGATCTCCTGCTTGAGG AGCGTAGTAGTAGGTCTGTGG CAGGAATGAGTACACGAAGCC TAGCCAGCACCGTGAATGTG

The general gene expression levels of each sample subjected to RNAsequencing are shown in a heatmap produced using GENE-E. In addition, the substantially downregulated DEGs are shown, and various transcription factors, such as Egr-1, the Fos proto-oncogene (Fos), CCAAT/enhancer binding protein delta (Cebpd), recombination signal binding protein for immunoglobulin kappa J region (Rbpj), and MAF bZIP transcription factor (Maf), act as critical elements for these DEGs (Fig. 3A). Through a qPCR analysis of LPS-activated murine peritoneal macrophages, we validated that the expression of the transcription factor Egr-1 exhibited the greatest change between the trametinib- and vehicle-pretreated groups (Fig. 3B). We then repeated the validation of 3

International Immunopharmacology 80 (2020) 106152

S. Chen, et al.

Fig. 1. Effects of MEK inhibitor trametinib treatment on proinflammatory mediator expression and secretion in murine peritoneal macrophages. (A) The levels of pMEK1/2, MEK1/2, p-ERK1/2, and ERK1/2 in murine peritoneal macrophages were assessed by Western blotting. The cells were pretreated with trametinib (100 nM) or vehicle (DMSO) for 2 h before LPS (100 ng/ml) challenge. (B and C) The mRNA expression of IL-1β, MCP1, and TNF-α was assayed by qPCR (B). The secretion of IL-1β, MCP1, and TNF-α in the supernatants was assayed by ELISA (C). After 2 h of vehicle or trametinib (100 nM) pretreatment, murine peritoneal macrophages were challenged with LPS (100 ng/ml) for 12 h. The results are shown as the means ± SD (n = 3–4). *P < 0.05. NS, not significant.

3.5. Trametinib inhibits LPS-induced murine ALI

Egr-1 expression in RAW264.7 cells, and a qPCR analysis indicated that the Egr-1 mRNA levels were greatly augmented by LPS and effectively attenuated by trametinib pretreatment (Fig. 3C). Consistent with this observation, LPS-induced Egr-1 protein expression was also strongly suppressed by trametinib pretreatment (Fig. 3D). Collectively, these results show that trametinib limits Egr-1 expression in LPS-activated macrophages.

To clarify the influence of trametinib on ALI, murine ALI was induced by LPS injection. Lung tissues from LPS-treated mice showed profound pathological injury, with alveolar wall thickening, alveolar edema, hemorrhage, and inflammatory cell accumulation (Fig. 5A). However, trametinib pretreatment alleviated these pathological changes (Fig. 5A). Similar results were obtained for the lung injury score (Fig. 5B). Taken together, these results indicate that trametinib orchestrates inhibitory effects on LPS-induced murine ALI.

3.4. Trametinib prevents the LPS-induced proinflammatory mediator expression and secretion in macrophages by inhibiting Egr-1

3.6. Trametinib attenuates edema and the inflammatory response in LPSinduced ALI mice

To define the role of Egr-1 in macrophages, we used siRNA to knock down Egr-1 in RAW264.7 cells and confirmed the most effective Egr-1 siRNA by Western blotting (Fig. 4A). Significantly, the knockdown of Egr-1 reduced both the mRNA and protein levels of IL-1β, MCP1 and TNF-α in LPS-activated macrophages (Fig. 4B and C). To further clarify the role of Egr-1 in trametinib-treated macrophages, we used lentivirus to overexpress Egr-1 in RAW264.7 cells and confirmed the infection efficiency (Fig. 4D) by measuring the percentage of green fluorescent protein (GFP)-positive cells and the degree of Egr-1 overexpression by determining Egr-1 (Fig. 4E) or Flag (Fig. 4F) expression through a Western blot analysis. As shown in Fig. 4G, Egr-1 overexpression inhibited the trametinib-mediated suppression of IL-1β, TNF-α and MCP1 mRNA expression in LPS-activated macrophages. Consequently, these results indicate that trametinib suppresses the LPS-induced expression and secretion of IL-1β, TNF-α and MCP1 in macrophages by inhibiting Egr-1.

The influence of trametinib on edema, proinflammatory mediator generation and proinflammatory cell accumulation in the injured lung was assessed. Impaired lung W/D ratios accompanied by decreased BALF total protein levels were observed in LPS + trametinib-treated mice compared with LPS-treated mice, which indicates that trametinib pretreatment inhibits LPS-induced lung edema (Fig. 6A and B). Furthermore, trametinib pretreatment also limited the secretion of IL-1β, MCP1 and TNF-α in the BALF (Fig. 6C). In addition, lung tissues obtained from LPS + trametinib-treated mice exhibited lower MPO activity and reduced MDA levels compared with lung samples from LPStreated mice, which suggests that trametinib treatment attenuates neutrophil infiltration (Fig. 6D and E). In parallel, the trametinibmediated inhibition of neutrophil infiltration was also identified by Gr1 staining (Fig. 6F). Together, these results indicate that trametinib alleviates alveolar edema, proinflammatory mediator production and neutrophil accumulation in LPS-treated mice. 4

International Immunopharmacology 80 (2020) 106152

S. Chen, et al.

Fig. 2. Transcriptomic profile of trametinib-treated murine peritoneal macrophages. (A) A volcano plot of the significantly (fold change > 1 and adjusted P value < 0.01) upregulated (red) or downregulated (blue) DEGs was created. Gray represents nonsignificant (NS) DEGs. The fold changes in gene expression (the LPS + trametinib group versus the LPS + DMSO group) and the adjusted P values for the macrophage transcriptomes are shown (n = 3). The canonical LPSregulated genes of interest are marked. (B) The important pathways enriched in the downregulated DEGs were determined using Fisher’s exact test using the thresholds P < 0.05 and FDR < 0.05. (C) A GSEA was performed to evaluate the effect of trametinib on LPS-induced peritoneal macrophage gene expression. The LPS-induced peritoneal macrophage genes were identified by comparing two groups of gene expression profile datasets in GSE73310 (WT LPS_IFNg versus WT Control). (D) The significant GO terms with a P value < 0.05 were screened and the important pathways were selected using Fisher’s exact test based on a P value < 0.05. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

MEK1/2 and ERK1/2 activation compared with LPS-treated mice. Consistent with this alteration, the lung Egr-1 mRNA and protein levels were strongly reduced by trametinib treatment (Fig. 7B and C). Additionally, trametinib treatment reduced the expression of intercellular adhesion molecule-1 (ICAM-1), procoagulant molecule tissue factor (TF) and prostaglandin E synthase (mPGES-1) in the lung samples, and

3.7. Trametinib treatment suppresses LPS-induced lung MEK-ERK phosphorylation and Egr-1 and Egr-1-dependent gene expression To explore the mechanism through which trametinib attenuates murine ALI, the phosphorylation of MEK-ERK in the lung was assessed. As shown in Fig. 7A, LPS + trametinib-treated mice displayed impaired 5

International Immunopharmacology 80 (2020) 106152

S. Chen, et al.

Fig. 3. Influence of trametinib treatment on Egr-1 expression in macrophages. (A) Heatmap of relative expression values of genes of interest based on RNAsequencing results. (B) The expression of Egr-1, Fos, Cebpd, Rbpj, and Maf in murine peritoneal macrophages was validated by qPCR. Murine peritoneal macrophages were subjected to 2 h of trametinib (100 nM) or vehicle (DMSO) pretreatment and then 12 h of LPS (100 ng/ml) stimulation. (C-D) Egr-1 expression in RAW264.7 cells was assessed by qPCR (C) or Western blotting (D). RAW264.7 cells were pretreated with 100 nM trametinib or vehicle for 2 h and then treated with 100 ng/ml LPS for 1 h. The results are shown as the means ± SD (n = 3). #P < 0.05, cells treated with both LPS and trametinib vs. cells treated with LPS but not trametinib. *P < 0.05.

between the murine peritoneal macrophages pretreated with trametinib and those that were not pretreated with trametinib. Indeed, it has been documented that MEK-ERK activation exerts crucial modulatory effects on Egr-1 expression [23,24]. In the current study, the increased Egr-1 expression induced by LPS stimulation was profoundly attenuated in the presence of the MEK inhibitor trametinib. Egr-1 is a transcription factor involved in inflammatory responses [25–27]. Mice deficient in Egr-1 display decreased vascular inflammation in concert with reduced IL-1β, VCAM-1 and MCP1 expression in aortic tissues and limited atherosclerosis [28]. Additionally, after LPS treatment, Egr-1-/- mice show decreased MCP1 mRNA expression in the lung and liver and reduced TNF-α levels in the serum compared with Egr-1+/+ mice [23,29]. Moreover, LPS-induced Egr-1 expression is necessary for the induction of TNF-α in RAW264.7 cells and human monocytic cells [25,26]. In line with previous findings, we found that reducing Egr-1 expression by siRNA inhibited the expression and secretion of IL-1β, MCP1, and TNF-α in RAW264.7 cells challenged with LPS. Furthermore, Egr-1 overexpression suppressed the trametinib-mediated inhibition of IL-1β, TNF-α and MCP1 mRNA expression in LPS-challenged RAW264.7 cells. Egr-1 inhibition exerts protective effects on ALI [30,31]. A previous study demonstrated that carbon monoxide (CO) prevents LPS-induced ALI through the inhibition of Egr-1 [30]. In our study, trametinib suppressed lung MEK-ERK phosphorylation and Egr-1 expression in ALI model mice. As expected, the severe lung injury caused by the establishment of ALI was abrogated by trametinib pretreatment. The trametinib-pretreated mice exhibited reduced lung injury scores, a lower total protein concentration, decreased levels of proinflammatory mediator in the BALF, and reduced MPO activity and MDA levels in the lung. In addition, the expression of lung TF, mPGES-1 and ICAM-1, which are common factors in organ injury and modulated by Egr-1 [30,32,33], was inhibited in the trametinib-pretreated mice in comparison with the vehicle-pretreated mice. In summary, we demonstrate that trametinib effectively suppresses inflammation and alleviates murine ALI, at least to a large extent, through suppression of the MEK-ERK-Egr-1 pathway. Thus, trametinib

their modulation is reportedly associated with Egr-1 (Fig. 7D). In general, these data suggest that trametinib inhibits the MEK-ERK-Egr-1 pathway and blocks the transcription of Egr-1-dependent genes in the injured lung.

4. Discussion Uncontrolled inflammatory responses accompanied by excessive proinflammatory cell accumulation and enhanced proinflammatory mediator generation in the lung are key factors in the pathogenesis of ALI. Macrophages orchestrate specific functions during ALI by generating proinflammatory mediators such as IL-1β, TNF-α and MCP1, all of which are elevated in the BALF and serum of patients with ALI. Importantly, TNF-α and IL-1β are regarded as promising biomarkers for predicting morbidity and mortality in patients with ALI [2]. In the present study, our data showed that trametinib treatment alleviated murine ALI established by LPS administration and prevented lung edema, proinflammatory mediator generation and neutrophil accumulation. In addition, we found that trametinib treatment inhibited the MEK-ERK-Egr-1 pathway in lung samples in vivo and in macrophages in vitro. In the current study, the increased expression and secretion of IL-1β, TNF-α and MCP1 in LPS-challenged murine primary macrophages was inhibited by trametinib pretreatment. The anti-inflammatory properties of trametinib were closely correlated with suppression of MEK-ERK activation, because trametinib is a potent MEK inhibitor and has been demonstrated to repress the production of proinflammatory mediators under inflammatory conditions by blocking MEK-ERK phosphorylation [16,17,19]. Consistent with previous work, we found that compared with vehicle-treated macrophages, trametinib-treated macrophages displayed a marked reduction in MEK-ERK activation after exposure to LPS. However, the exact role of the pharmacological antagonism of MEK-ERK phosphorylation by trametinib remains poorly understood. To further decipher the mechanism of action of trametinib, we performed an RNA-sequencing analysis and found that Egr-1 mRNA expression exhibited the greatest post-LPS-challenge difference 6

International Immunopharmacology 80 (2020) 106152

S. Chen, et al.

Fig. 4. Effect of Egr-1 on the trametinib-mediated inhibition of the expression and production of proinflammatory mediators in RAW264.7 cells. (A) The siRNAmediated inhibition of Egr-1 was examined by Western blotting. Forty-eight hours after transfection with scrambled siRNA (100 nM) or Egr-1 siRNA (100 nM), the macrophages were treated with LPS (100 ng/ml) for 1 h. (B and C) The influence of Egr-1 knockdown on the expression and secretion of IL-1β, MCP1, and TNF-α was evaluated by qPCR (B) and ELISA (C), respectively. Forty-eight hours after transfection with scrambled siRNA (100 nM) or Egr-1 siRNA (100 nM), the macrophages were treated with LPS (100 ng/ml) for 6 h. (D) The lentivirus infection efficiency was assayed by measuring the percentage of GFP-positive cells. Scale bars: 100 μm. (E and F) Egr-1 overexpression was confirmed by determining the expression of Egr-1(E) or Flag (F) protein in Lv-Egr-1 and Lv-NC RAW264.7 cells through a Western blot analysis. (G) The influence of Egr-1 overexpression on the expression of IL-1β, MCP1, and TNF-α was evaluated by qPCR. Lv-Egr-1 and Lv-NC RAW264.7 cells were pretreated with vehicle (DMSO) or trametinib (100 nM) for 2 h and then challenged with LPS (100 ng/ml) for 6 h (TNF-α) or 12 h (IL-1β and MCP1). The results are shown as the means ± SD (n = 3). *P < 0.05, **P < 0.005.

Validation, Software, Formal analysis, Resources, Data curation, Writing - original draft. Ping Ye: Methodology, Funding acquisition, Investigation. Chuangyan Wu: Methodology. Xiangchao Ding: Methodology. Shanshan Chen: Funding acquisition, Investigation. Hao Zhang: Methodology. Yanqiang Zou: Methodology. Jing Zhao: Resources. Sheng Le: Resources. Jie Wu: Conceptualization, Funding acquisition, Writing - original draft. Shu Chen: Conceptualization, Funding acquisition, Writing - original draft. Jiahong Xia: Conceptualization, Methodology, Funding acquisition, Writing - original draft, Writing - review & editing.

might serve as an effective treatment for ALI in clinical practice. Funding This work was supported by the National Natural Science Foundation of China (81730015, 81571560, 81701585, 81570325, 81801586, 81800413, and 81800296) and the Natural Science Foundation of Hubei Province (2017CFB357 and 2019AAA032). CRediT authorship contribution statement Shanshan Chen: Methodology, Validation, Formal analysis, Data curation, Writing - original draft, Writing - review & editing. Heng Xu: 7

International Immunopharmacology 80 (2020) 106152

S. Chen, et al.

Fig. 5. Effect of trametinib treatment on LPS-induced murine ALI. (A) The lung histopathological alterations are shown by HE staining. Scale bars: 100 μm. (B) The lung injury score was calculated to evaluate the severity of the histopathological injury. The results are shown as the means ± SD (n = 8). *P < 0.05.

Declaration of Competing Interest

Appendix A. Supplementary material

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Supplementary data to this article can be found online at https:// doi.org/10.1016/j.intimp.2019.106152.

Fig. 6. Effect of trametinib treatment on edema and inflammation induced by ALI. (A) The lung W/D ratios were determined. (B) The concentration of all proteins in the BALF was assessed using a BCA kit. (C) The secretion of IL-1β, MCP1, and TNF-α in the BALF was detected by ELISA. (D-E) The MPO activity and MDA levels in lung homogenates were evaluated using MPO and MDA assay kits, respectively. (F) Gr-1 immunofluorescence staining was performed for the evaluation of neutrophil accumulation. Scale bars: 50 μm. The results are shown as the means ± SD (n = 6–8), *P < 0.05. 8

International Immunopharmacology 80 (2020) 106152

S. Chen, et al.

Fig. 7. Influence of trametinib treatment on the MEK-ERK-Egr-1 pathway and Egr-1-dependent gene expression in vivo. (A) The levels of p-MEK1/2, MEK1/2, pERK1/2 and ERK1/2 in the lung were assessed by Western blotting. (B-C) Lung Egr-1 expression was assessed by qPCR (B) or Western blotting (C). (D) The expression of TF, mPGES-1, and ICAM-1 in the lung was characterized by qPCR. The results are shown as the means ± SD (n = 6–8), *P < 0.05.

References:

(2015) 667–673. [17] J.A. Smith, P.R. Mayeux, R.G. Schnellmann, Delayed mitogen-activated protein kinase/extracellular signal-regulated kinase inhibition by trametinib attenuates systemic inflammatory responses and multiple organ injury in murine sepsis*, Crit. Care Med. 44 (2016) e711–e720. [18] X. Wu, K.K. Dayanand, R.P. Thylur, C.C. Norbury, D.C. Gowda, Small molecule–based inhibition of MEK1/2 proteins dampens inflammatory responses to malaria, reduces parasite load, and mitigates pathogenic outcomes, J. Biol. Chem. 292 (2017) 13615–13634. [19] T. Yamaguchi, R. Kakefuda, A. Tanimoto, Y. Watanabe, N. Tajima, Suppressive effect of an orally active MEK1/2 inhibitor in two different animal models for rheumatoid arthritis: a comparison with leflunomide, Inflamm. Res. 61 (2012) 445–454. [20] K. Xu, C. Wu, S. Tong, P. Xiong, S. Wang, The selective Nlrp3 inflammasome inhibitor Mcc950 attenuates lung ischemia-reperfusion injury, Biochem. Biophys. Res. Commun. 503 (2018) 3031–3037. [21] A. Layoun, M. Samba, M.M. Santos, Isolation of murine peritoneal macrophages to carry out gene expression analysis upon Toll-like receptors stimulation, J. Vis. Exp. (2015) e52749. [22] E.K. Wolthuis, A.P. Vlaar, G. Choi, J.J. Roelofs, N.P. Juffermans, M.J. Schultz, Mechanical ventilation using non-injurious ventilation settings causes lung injury in the absence of pre-existing lung injury in healthy mice, Crit. Care 13 (2009) R1. [23] M.T. Pritchard, S. Roychowdhury, M.R. McMullen, L. Guo, G.E. Arteel, L.E. Nagy, Early growth response-1 contributes to galactosamine/lipopolysaccharide-induced acute liver injury in mice. American Journal of Physiology-Gastrointestinal and Liver, Physiology 293 (2007) G1124–G1133. [24] F. Bea, M.H. Puolakkainen, T. McMillen, F.N. Hudson, N. Mackman, C.C. Kuo, L.A. Campbell, M.E. Rosenfeld, Chlamydia pneumoniae induces tissue factor expression in mouse macrophages via activation of Egr-1 and the MEK-ERK1/2 pathway, Circ. Res. 92 (2003) 394–401. [25] M. Guha, M.A. O'Connell, R. Pawlinski, A. Hollis, P. McGovern, S.F. Yan, D. Stern, N. Mackman, Lipopolysaccharide activation of the MEK-ERK1/2 pathway in human monocytic cells mediates tissue factor and tumor necrosis factor alpha expression by inducing Elk-1 phosphorylation and Egr-1 expression, Blood 98 (2001) 1429–1439. [26] L. Shi, R. Kishore, M.R. McMullen, L.E. Nagy, Lipopolysaccharide stimulation of ERK1/2 increases TNF-α production via Egr-1, Am. J. Physiol.-Cell Physiol. 282 (2002) C1205–C1211. [27] J. Zhang, S. Xie, W. Ma, Y. Teng, Y. Tian, X. Huang, Y. Zhang, A newly identified MicroRNA, mmu-miR-7578, functions as a negative regulator on inflammatory cytokines tumor necrosis factor-α and interleukin-6 via TargetingEgr1 in vivo, J. Biol. Chem. 288 (2013) 4310–4320. [28] E. Harja, L.G. Bucciarelli, Y. Lu, D.M. Stern, Y.S. Zou, A.M. Schmidt, S. Yan, Early growth response-1 promotes atherogenesis, Circ. Res. 94 (2004) 333–339. [29] R. Pawlinski, B. Pedersen, B. Kehrle, W.C. Aird, R.D. Frank, M. Guha, N. Mackman, Regulation of tissue factor and inflammatory mediators by Egr-1 in a mouse endotoxemia model, Blood 101 (2003) 3940–3947. [30] M. Bilban, F.H. Bach, S.L. Otterbein, E. Ifedigbo, D'Avila J de Costa, H. Esterbauer, B.Y. Chin, A. Usheva, S.C. Robson, O. Wagner, L.E. Otterbein, Carbon monoxide

[1] A.P.M. Wheeler, G.R.P. Bernard, Acute lung injury and the acute respiratory distress syndrome: a clinical review, Lancet 369 (2007) 1553–1564. [2] Y. Butt, A. Kurdowska, T.C. Allen, Acute lung injury: a clinical and molecular review, Arch. Pathol. Lab. Med. 140 (2016) 345–350. [3] E. Fan, D. Brodie, A.S. Slutsky, Acute respiratory distress syndrome: advances in diagnosis and treatment, JAMA 319 (2018) 698–710. [4] K. Tsushima, L.S. King, N.R. Aggarwal, A. De Gorordo, F.R. D'Alessio, K. Kubo, Acute lung injury review, Internal Med. 48 (2009) 621–629. [5] W.A. Altemeier, G. Matute-Bello, S.A. Gharib, R.W. Glenny, T.R. Martin, W.C. Liles, Modulation of lipopolysaccharide-induced gene transcription and promotion of lung injury by mechanical ventilation, J. Immunol. 175 (2005) 3369–3376. [6] G. Matute-Bello, C.W. Frevert, T.R. Martin, Animal models of acute lung injury, Am. J. Physiol.-Lung Cell. Mol. Physiol. 295 (2008) L379–L399. [7] G. Matute-Bello, G. Downey, B.B. Moore, S.D. Groshong, M.A. Matthay, A.S. Slutsky, W.M. Kuebler, An official american thoracic society workshop report: features and measurements of experimental acute lung injury in animals, Am. J. Respir. Cell Mol. Biol. 44 (2011) 725–738. [8] N.R. Aggarwal, L.S. King, F.R. D'Alessio, Diverse macrophage populations mediate acute lung inflammation and resolution, Am. J. Physiol.-Lung Cell. Mol. Physiol. 306 (2014) L709–L725. [9] J. Lomas-Neira, C. Chung, M. Perl, S. Gregory, W. Biffl, A. Ayala, Role of alveolar macrophage and migrating neutrophils in hemorrhage-induced priming for ALI subsequent to septic challenge, Am. J. Physiol.-Lung Cell. Mol. Physiol. 290 (2006) L51–L58. [10] X. Huang, H. Xiu, S. Zhang, G. Zhang, The role of macrophages in the pathogenesis of ALI/ARDS, Mediators Inflamm. 2018 (2018) 1–8. [11] M. Bhatia, S. Moochhala, Role of inflammatory mediators in the pathophysiology of acute respiratory distress syndrome, J. Pathol. 202 (2004) 145–156. [12] A.G. Gilmartin, M.R. Bleam, A. Groy, K.G. Moss, E.A. Minthorn, S.G. Kulkarni, C.M. Rominger, S. Erskine, K.E. Fisher, J. Yang, F. Zappacosta, R. Annan, D. Sutton, S.G. Laquerre, GSK1120212 (JTP-74057) is an inhibitor of MEK activity and activation with favorable pharmacokinetic properties for sustained in vivo pathway inhibition, Clin. Cancer Res. 17 (2011) 989–1000. [13] R.J. Kelly, Dabrafenib and trametinib for the treatment of non-small cell lung cancer, Expert Rev. Anticancer Ther. 18 (2018) 1063–1068. [14] P. Andrikopoulos, J. Kieswich, S. Pacheco, L. Nadarajah, S.M. Harwood, C.E. O'Riordan, C. Thiemermann, M.M. Yaqoob, The MEK inhibitor trametinib ameliorates kidney fibrosis by suppressing ERK1/2 and mTORC1 signaling, J. Am. Soc. Nephrol. 30 (2019) 33–49. [15] E.J. Macarak, C.E. Lotto, D. Koganti, X. Jin, P.J. Wermuth, A. Olsson, M. Montgomery, J. Rosenbloom, Trametinib prevents mesothelial-mesenchymal transition and ameliorates abdominal adhesion formation, J. Surg. Res. 227 (2018) 198–210. [16] D. Shi-lin, X. Yuan, S. Zhan, T. Luo-jia, T. Chao-yang, Trametinib, a novel MEK kinase inhibitor, suppresses lipopolysaccharide-induced tumor necrosis factor (TNF)-α production and endotoxin shock, Biochem. Biophys. Res. Commun. 458

9

International Immunopharmacology 80 (2020) 106152

S. Chen, et al.

[32] N. Ngiam, V. Peltekova, D. Engelberts, G. Otulakowski, M. Post, B.P. Kavanagh, Early growth response-1 worsens ventilator-induced lung injury by up-regulating prostanoid synthesis, Am. J. Respir. Crit. Care Med. 181 (2010) 947–956. [33] N. Ngiam, M. Post, B.P. Kavanagh, Early growth response factor-1 in acute lung injury, Am. J. Physiol.-Lung Cell. Mol. Physiol. 293 (2007) L1089–L1091.

orchestrates a protective response through PPARγ, Immunity 24 (2006) 601–610. [31] A. Hoetzel, T. Dolinay, S. Vallbracht, Y. Zhang, H.P. Kim, E. Ifedigbo, S. Alber, A.M. Kaynar, R. Schmidt, S.W. Ryter, A.M.K. Choi, Carbon monoxide protects against ventilator-induced lung injury via PPAR-γ and inhibition of Egr-1, Am. J. Respir. Crit. Care Med. 177 (2008) 1223–1232.

10