LncRNA MEG3 enhances 131I sensitivity in thyroid carcinoma via sponging miR-182

Biomedicine & Pharmacotherapy 105 (2018) 1232–1239

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

LncRNA MEG3 enhances miR-182

131

I sensitivity in thyroid carcinoma via sponging

Yang Liua, Peiru Yueb, Tao Zhoua, Fengzhen Zhanga, Huixiang Wanga, Xiaoqi Chenc,

T

⁎

a

Department of Nuclear Medicine, The First People’s Hospital of Shangqiu, Shangqiu, 476000, China Department of Oncology, The First People’s Hospital of Shangqiu, Shangqiu, 476000, China c Department of Digestive Oncology, the First Affiliated Hospital of Henan University of Traditional Chinese Medicine, Zhengzhou, 450000, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: lncRNA MEG3 Thyroid carcinoma131I radioactivity miR-182

Background: Long non-coding RNA (LncRNA) MEG3 has been demonstrated as a tumor suppressor in various cancers, including thyroid carcinoma (TC). However, the detail functions and possible mechanisms of MEG3 in 131 I resistance of TC remain to be uncovered. Methods: qRT-PCR was performed for the detection of MEG3 and miR-182 levels. 131I-resistant TC cells were constructed by continuous exposure to stepwise increased concentrations of 131I. Western blot assay was used to measure the protein expressions of γ-H2 AX and H2 AX. CCK-8 and flow cytometry assays were carried out for the evaluation of cell viability and apoptosis, respectively. Bioinformatics and dual-luciferse assays were conducted to prove the interaction of MEG3 and miR-182. Results: MEG3 expression was down-regulated in TC tumor tissues, and the cumulative survival rate was decreased in low MEG3 expression group in TC patients under 131I treatment. MEG3 expression appeared a decline and miR-182 expression displayed an increase in 131I-resistant FTC-133 (res-FTC-133) and TPC-1 (res-TPC-1) cells. Moreover, MEG3 overexpression suppressed 131I-resistant cell viability, promoted apoptosis and induced DNA damage. MEG3 was verified as a molecular sponge for miR-182, and inhibition of miR-182 exerted similar functions as MEG3 overexpression. Furthermore, MEG3 knockdown substantially abrogated the anti-cancer functions of anti-miR-182. Conclusions: MEG3 enhanced the radiosensitivity of 131I in TC cells via sponging miR-182, indicating that MEG3 may act as a potential biomarker and therapeutic target for TC patients with 131I resistance.

1. Introduction Thyroid cancer (TC) is a prevalent malignant tumor in endocrine system with a steadily increasing morbidity and mortality worldwide in the past decades [1,2]. TC has increased by 3% annually from 1974 to 2013 in United States [3], and a similar trend is also observed in China, especially in East China [4]. Specific genetic abnormalities and environmental exposures associated with immunologic functions represent a series of possible risk factors for the occurrence of TC [5]. Radioiodine (131I) has been considered as a common strategy for the treatment of TC, with the potential of destroying the occult lesions in remnant tissues after total or near total thyroidectomy [6]. However, several patients fail to respond to radioiodine ablation therapy due to the deficiency of radioiodine aggregate ability of thyroid follicular cells.

Thus, it is urgent to develop novel methods for improving the 131I therapeutic effect. Long non-coding RNAs (LncRNAs), a novel subgroup of non-protein transcripts with larger than 200 nucleotides in length, are closely involved in the modulation of cell apoptosis, proliferation and invasion through different biological and pathological pathways [7,8]. Mounting evidence has revealed the central participation of lncRNAs in various cancers, including TC [9,10]. Maternally expression gene 3 (MEG3), a lncRNA located on chromosome 14q32, is generally expressed in human normal tissues, while it is lost or decreased in many malignancies [11]. MEG3 have been demonstrated as a tumor-suppressor to be implicated in the etiology and progression of multiple cancers [12]. For instance, MEG3 expression was down-regulated in hepatocellular carcinoma, and MEG3 overexpression blocked cell proliferation at least

Abbreviations: TC, thyroid carcinoma; FCM, flow cytometry; lncRNAs, long non-coding RNAs; MEG3, maternally expression gene 3; miRNA, microRNAs; PTC, papillary thyroid cancer; CHL1, close homolog of LI ⁎ Corresponding author at: Department of Digestive Oncology, The First Affiliated Hospital of Henan University of Traditional Chinese Medicine, No.19 People’s Road, Zhengzhou, 450000, China. E-mail address: [email protected] (X. Chen). https://doi.org/10.1016/j.biopha.2018.06.087 Received 3 May 2018; Received in revised form 14 June 2018; Accepted 14 June 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.

Biomedicine & Pharmacotherapy 105 (2018) 1232–1239

Y. Liu et al.

Co. Ltd. (Shanghai, China). MiR-182 mimic (MiR-182) and matched scrambled negative control (miR-NC), miR-182 inhibitor (anti-miR182, a complementary sequence of mature miR-182) and corresponding scrambled negative control (anti-miR-NC) were also obtained from GenePharma Co. Ltd. Cells were cultured in 24-well plates at a density of 1 × 105 cells/well and then transfected with above oligonucleotides or plasmids under the action of Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's protocol.

partly through affecting miR-664-mediated regulation of ADH4 [13]. In TC, MEG3 appeared a decreased expression, and up-regulation of MEG3 strongly weakened cell migration and invasion through negatively regulating Rac1 [14]. However, there is still short of reliable researches on the effects and mechanisms of MEG3 in 131I-resistant TC. MicroRNAs (miRNA), a type of endogenous and conserved noncoding RNAs, have been widely reported to be associated with the occurance and development of cancers via regulation of special target genes. MiR-182, located in the region of chromosome 7q32.2 of human genome, is revealed as an oncogene in a variety of tumors, such as nonsmall cell lung cancer [15], prostate cancer [16], breast cancer [17], sarcomas [18], and ovarian cancer [19]. In papillary thyroid cancer (PTC), increased expression of miR-182 was observed in tumor tissues, and knockdown of miR-182 repressed cell proliferation and invasion by targeting close homolog of LI (CHL1) [20]. However, the exact roles of miR-182 in 131I-resistant TC have not been elucidated. It has been shown that lncRNAs could act as competing endogenous RNAs or molecular sponges of miRNAs to modulate the survival and development of multiple cancer cells [21]. In the present study, we observed that MEG3 expression was significantly reduced TC tumor tissues, and low MEG3 expression was associated with an unfavorable prognosis in TC patients. Then, 131I-resistant TC cells were established successfully, and further functional researches and mechanical assays suggested that MEG3 up-regulation promoted the sensitivity of 131I treatment in TC cells through acting as a sponge for miR-182, as reflected by the depressed viability, increased apoptotic rate, and enhanced DNA damage. In all, our study contributes to a better understanding of the involvement of MEG3 in TC progression, providing a potential target for TC patients with 131I resistance.

2.3. Quantitative real-time PCR (qRT-PCR) Total RNA was extracted from TC tissue specimens (tumor tissues and contiguous normal tissues) or TC cells by Trizol reagent (Takara, Dalian, China). MEG3 and miR-182 was severally transcribed into cDNA using High Capacity Reverse Transcription System Kit (Takara) and miRNA First-Stand cDNA Synthesis Kit (GeneCopoeia, Guangzhou, China). The cDNA primer for miR-182 was: 5′-AACATGTACAGTCCAT GGATG-d(T)30N-3′ (N = A, G, C or T); For U6 was: 5′-GTCGTATCCA GTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGG AAC-3′. Following that, qRT-PCR was performed on Applied Biosystems 7500 Real-time PCR Systems (Thermo Fisher Scientific, Waltham, MA, USA) using Universal SYBR Green PCR Kit (Takara) to evaluate the expressions of MEG3 and miR-182. GAPDH and U6 small nuclear RNA were obtained from GenePharma (Shanghai) for the normalization of MEG3 and miRNA-182. qRT-PCR primers were displayed as below. MEG3: 5′-CTGCCCATCTACACCTCACG-3′ (forward) and 5′-CTCTCCGC CGTCTGCGCTAGGGGCT-3′ (reverse); GAPDH: 5′-TATGATGATATCAA GAGGGTAGT-3′ (forward) and 5′-TGTATCCAAACTCATTGTCATAC-3′ (reverse); miR-182: 5′-G GCAATGGTAGAACTCACACT-3′ (forward) and 5′-AACATGTACAGTCCATGGATG-3′ (reverse); U6: 5′-TGCGGGTGCTC GCTTCGGCAGC-3′ (forward) and 5′−CCAGTGCAGGGTCCGAGGT-3′ (reverse). The relative levels of RNA were calculated using the 2−ΔΔCt method compared with the NC group.

2. Materials and methods 2.1. Patients and tissue specimens A total of 20 fresh tumor tissues and adjacent noncancerous tissues were obtained from TC patients, who were undergoing surgical resection at the First People’s Hospital of Shangqiu from June 2016 to July 2017. Following surgery, these specimens were stored in liquid nitrogen at −80 °C for the detection of MEG3 expression. A total of 48 patients diagnosed with TC were equally divided into low MEG3 expression group and high MEG3 expression group, and all of them received 131I treatment. Finally, cumulative survival rate was calculated at different periods after 131I treatment. This research was approved by the Research Ethic Committee of the First People’s Hospital of Shangqiu and written informed consents were obtained from all patients.

2.4. Cell viability assay Cell viability was evaluated using the Cell Counting Kit-8 (CCK-8) (Dojindo, Tokyo, Japan) according to manufacturer's procedures. Briefly, TC cells were placed into 96-well plates at a density of 5 × 103 cells/well and then transfected with indicated oligonucleotides or plasmids. At 0, 24, 48 and 72 h post-transfection, 10 μl CCK-8 reagent was added for additional 2 h of incubation, followed by the detection of absorbance at 450 nm using Thermo Scientific microplate reader (Thermo Fisher Scientific). 2.5. Cells apoptosis assay

2.2. Cell culture and transfection Cell apoptosis was measured using Annexin V-FITC/PI Apoptosis Detection Kit (BD Biosciences, Franklin Lakes, New Jersey, USA). Briefly, TC cells were digested with trypsin (without EDTA) (CW Bio, Beijing, China), washed with cold PBS, resuspended with binding buffer, and then stained with Annexin V-FITC and propidium iodide (PI) under a dark condition according to the instructions. After that, apoptotic cells were immediately visualized by a flow cytometry (BD Biosciences).

Thyroid cancer (TC) cell lines (FTC-133 and TPC-1), and 293 T cells were obtained from American Type Culture Collection (ATCC, Rockefeller, MD, USA). TC cells were grown in DMEM (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (HyClone, Logan, Utah, USA). 293 T cells were incubated in RPMI-1640 medium (Gibco) containing 10% FBS (Gibco) and 1% penicillin/streptomycin (HyClone). All culture was performed in a humidified atmosphere of 5% CO2 at 37 °C. To establish 131 I-resistant TC cell models, FTC-133 and TPC-1 cells were placed into 6-well plates and continuously exposed to stepwise increased concentrations of 131I. The culture medium was replaced every other day, and 131I radioactivity was calculated with a halftime decay of 8 days. The full-length MEG3 sequence was inserted into pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA) to establish MEG3-overexpression plasmid (MEG3), with pcDNA3.1 empty vector (vector) as an internal control. The scrambled interference sequence for MEG3 knockdown (siMEG3) and scramble control (si-NC) were synthesized by GenePharma

2.6. Western blot assay Total protein derived from TC cells were extracted by cell lysis buffer (Beyotime, Haimen, China). Subsequently, the proteins (50 μg) were divided in a 10% sodium dodecyl sulfate-polyacrylamide gel (SDSPAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). After blocked with 5% non-fat milk solution for 2 h at 37 °C, the membranes were incubated with primary antibodies anti-γ-H2 AX, anti-H2 AX and anti-β-actin (Cell Signaling 1233

Biomedicine & Pharmacotherapy 105 (2018) 1232–1239

Y. Liu et al.

indicating that MEG3 may have an intimate relationship with the prognosis of TC patients with 131I treatment.

Technology, Danvers, MA, USA) overnight at 4 °C, followed by further probed with HRP-conjugated anti-rabbit secondary antibody (Cell Signaling Technology) for another 1 h. Finally, the antibody-antigen reactions were visualized by chemiluminescence assay kits (BestBio, Shanghai,China).

3.2. Apoptosis and DNA damage were increased in constructed resistant TC cells models

131

I-

To explore the effects of MEG3 on 131I treatment in TC, 131I-resistant TC cell lines were established through long-term exposure of 131I-sensitive cells lines (FTC-133 and TPC-1) to a sub-lethal 131I concentration. After continuous passage for 8 generations, 131I-resistant TC cells (resFTC-133 and res-TPC-133) were successfully constructed, with 2∼3 times increase of 131I median lethal intensity compared with 131I-sensitive FTC-133 and TPC-133 cells (Fig. 2A). Moreover, flow cytometry analysis further verified that the apoptotic rates of res-FTC-133 and resTPC-133 cells were decreased compared with 131I-sensitive FTC-133 and TPC-133 cells after the radiotherapy of 131I (Fig. 2B). Since 131I therapy led to TC cell apoptosis mainly through inducing DNA damage, the protein expression of DNA damage marker γ-H2 AX was detected by western blot. The results showed an obvious reduction of γ-H2 AX protein level in 131I-resistant cells compared with that in 131I-sensitive cells. Overall, 131I-resistant TC cell models were generated successfully.

2.7. Dual-luciferase reporter assay The wild-type MEG3 fragment containing miR-182 binding sites was amplified by PCR, and mutant MEG3 was constructed through the mutation of miR-182 complementary sites. After that, wild or mutant MEG3 was subcloned into psiCHECKTM-2 luciferase plasmid (Promega, Madison, WI, USA) to generate wild-MEG3 or mutated-MEG3 reporter. Then, 293 T cells were co-transfected with wild-MEG3 or mutatedMEG3 (0.2 μg) and miR-182 or miR-NC (100 nM) under the action of Lipofectamine 2000. Approximately 48 h after co-transfection, the luciferase activity was detected using Dual-Luciferase Reporter assay kit (Promega). 2.8. RNA immunoprecipitation (RIP) To analyze the potentially endogenous interaction between MEG3 and miR-182, RIP experiment was carried out in TC cells according to the manufacturer's instructions of Magna RIPTM RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA). Ago2 antibody (Cell Signaling Technology) was employed to precipitate the potential substance Ago2 in RNA-induced silencing complex (RISC). IgG antibody was used as a negative control. Then, immunoprecipitated RNA was purified using RNase-free DNase I and proteinase K (Thermo Fisher Scientific). Finally, MEG3 and miR-182 levels were detected by qRTPCR.

3.3. MEG3 expression was decreased while miR-182 expression was increased in 131I-resistant TC cells Subsequently, the expression levels of MEG3 and miR-182 in both I-resistant and 131I-sensitive cells were detected by qRT-PCR. MEG3 expression was notably down-regulated in res-FTC-133 and res-TPC-1 cells than that in FTC-133 and TPC-1cells (Fig. 3A). Inversely, miR-182 appeared a prominently high level in 131I-resistant cells compared with that in 131I-sensitive cells (Fig. 3B). Collectively, MEG3 and miR-182 expressions showed an opposite change in 131I-resisstant TC cells compared with their counterparts. 131

2.9. Statistical analysis All statistical assays were conducted using SPSS 20.0 software. Student's t-test and one-way ANOVA were applied to assess the differences between groups. All of the values were shown as means ± standard deviation (SD). P < 0.05 was considered to be statistically significant.

3.4. MEG3 blocked proliferation and enhanced apoptosis in TC cells

131

I-resistant

To further identify the functions of MEG3 in 131I-tolerant TC cells, MEG3 overexpression was achieved through the transfection of pcDNAMEG3 in res-FTC-133 and res-TPC-1 cells (Fig. 4A). CCK-8 and flow cytometry results revealed that MEG3-introduction significantly repressed proliferation (Fig. 4B) and promoted apoptosis (Fig. 4C) in 131Iresistant FTC-133 and TPC-1 cells. The protein expression of γ-H2 AX in 131 I-resistant cells was also highly induced following MEG3 overexpression, as confirmed by western blot (Fig. 4D), indicating more DNA damage and cytotoxicity. In summary, MEG3 up-regulation enhanced 131I therapy in TC cells via the suppression of cell proliferation, as well as the stimulation of apoptosis and DNA damage.

3. Results 3.1. MEG3 level was decreased in TC tumor tissues and low MEG3 expression exhibited a worse prognosis in clinic To explore the roles of MEG3 in TC, MEG3 levels were firstly detected by qRT-PCR. As illustrated in Fig. 1A, MEG3 displayed a significantly lowered expression in TC tumor tissues compared with that in contiguous normal tissues (n = 20). Additionally, 48 patients who underwent 131I treatment were followed up for 2000-day. The results showed that the rate of cumulative survival was higher in patients with high MEG3 expression than that with low MEG3 expression (Fig. 1B),

3.5. MEG3 acted as a molecule sponge for miR-182 To further investigate the molecular mechanism of MEG3 in the 131I Fig. 1. MEG3 expression was decreased in TC tumor tissue specimens, and associated with prognosis of patients after 131I treatment. (A) The expression of MEG3 in TC tumor tissues and adjacent normal tissues was detected by qRT-PCR. (B) A total of 48 patients received 131I treatment, followed by the statistics of cumulative survival rate in low and high MEG expression groups. *P < 0.05.

1234

Biomedicine & Pharmacotherapy 105 (2018) 1232–1239

Y. Liu et al.

Fig. 2. The continuous exposure of sub-lethal 131I led to the tolerance of TC cells. (A) FTC-133 and TPC-1 cells were treated with sub-lethal dose of 131I, and 131Iresistant FTC-133 and TPC-1 cells were obtained after 8 continuous passages. (B) After 131I radioactivity for 12 h, the apoptosis of sensitive and resistant TC cell lines was measured by flow cytometry. (C) Western blot assay was performed to detect the DNA damage marker γ-H2 AX expression in tolerant and sensitive cell lines under 131I exposure. *P < 0.05.

Moreover, MEG3 overexpression and knockdown models were constructed via the transfection of pcDNA-MEG3 in res-FTC-133 cells or siMEG3 in res-TPC-1 cells (Fig. 5D), followed by the demonstration of the negative modulation of MEG3 on miR-182 expression using qRT-PCR assay (Fig. 5E). Accordingly, qRT-PCR result displayed a markedly increased miR-182 levels in TC tumor tissue specimens compared to that in adjacent non-cancerous tissues (Fig. 5F). Also, a negative correlation was found between MEG3 and miR-182 expression in TC tumor tissues (Fig. 5G). Together, these data suggested that MEG3 acted as a negative regulator for miR-182 via direct interaction.

tolerance characteristics of TC cells, miRcode online website was employed to search for the potential miRNAs which could interact with MEG3. The prediction results showed the existence of complementary binding sites between MEG3 and miR-182 (Fig. 5A). Then, Dual-Luciferase and RIP experiments were performed to further confirm this prediction. As expected, the luciferase activity of wild-MEG3 reporter (containing miR-182 binding sites) was notably repressed by miR-182 overexpression compared with that in miR-NC group. However, there was no obvious change of the luciferase activity in mutated-MEG3 reporter after the transfection of miR-182 or miR-NC in 293 T cells (Fig. 5B). RIP results displayed both MEG3 and miR-182 were greatly enriched by Ago2 antibody in res-FTC-133 cells (Fig. 5C), indicating the potentially endogenous interaction between MEG3 and miR-182. 1235

Biomedicine & Pharmacotherapy 105 (2018) 1232–1239

Y. Liu et al.

Fig. 3. MEG3 expression was declined and miR-182 expression was facilitated in sensitive TC cells were measured by qRT-PCR. *P < 0.05.

3.6. MEG3 knockdown reversed the function of miR-182 inhibitor in resistant TC cells

131

131

I-resistant TC cells. MEG3 (A) and miR-182 (B) expressions in resistant and

explore whether MEG3 exerted regulatory effects in 131I-resistant TC cells by miR-182. The results manifested that down-regulation of miR182 suppressed proliferation (Fig. 6A), induced apoptosis (Fig. 6B) and enhanced γ-H2 AX expression (Fig. 6C) in both res-FTC-133 and res-

I-

In this study, restoration experiments were further conducted to

Fig. 4. MEG3 upregulation repressed proliferation, induced apoptosis and increased DNA damage in 131I-tolerant TC cells. (A) MEG3 overexpression was performed by the introduction of pcDNA-MEG3 into res-FTC-133 and res-TPC-1 cells. (B) The viability was determined in 131I-tolerant FTC-133 and TPC-1 cells after transfection with pcDNA-MEG3 or pcDNA-3.1 vector by CCK-8 analysis. (C) Flow cytometry analysis was conducted to determine the effect of MEG3 on the apoptotic rate in resFTC-133 and res-TPC-1 cells. (D) The expression of DNA damage marker γ-H2 AX was measured by western blot in resistant TC cells following transfection with MEG3 or vector. *P < 0.05. 1236

Biomedicine & Pharmacotherapy 105 (2018) 1232–1239

Y. Liu et al.

Fig. 5. MEG3 acted as a molecular sponge for miR-182. (A) The predicted binding sites of miR-182 on MEG3, as well as the mutant sites in the mutant-MEG3 reporter. (B) Luciferase reporter analyses were performed in 293 T cells after the transfection of wild-MEG3 or mulated-MEG3 along with miR-182 or miR-NC. (C) The enrichment degrees of MEG3 and miR-182 were assessed by RIP assays with anti-Ago2 in res-FTC-133 cells. (D and E) MEG3 miR-182 expressions were assessed in pcDNA-MEG3-transfected res-FTC-133 cells and si-MEG3-transfected res-TPC-1 cells. (F) The expression of miR-182 in TC tumor tissues and adjacent normal tissues was detected by qRT-PCR. (G) Correlation analysis of MEG3 and miR-182 expression in 20 TC tumor tissue specimens. *P < 0.05.

expression was decreased in TC tumor tissues, and low MEG3 expression was associated with the poor prognosis of TC patients with 131I treatment, indicating the potential correlation between MEG3 and 131I resistance in TC. To further demonstrate the participation of MEG3 in 131 resistance of TC, 131I-resistant TC cell lines were built via continuous exposing to sub-lethal 131I. Moreover, the levels of MEG3 in 131I-resistant TC cells were dramatically lower than those in respective 131Isensitive cells. Further gain-of-function experiments revealed that MEG3 restoration notably attenuated proliferation, and stimulated apoptosis and DNA damage in 131I-resistant TC cells, indicating the improvement of MEG3 on 131I sensitivity in TC. These data supported our assumption that MEG3 was closely correlated with 131I-sensitivity of TC. However, the detail mechanisms underlying how MEG3 influence 131I radiosensibility is still far from being fully addressed. MiR-182, a critical small non-coding RNA, is elucidated as a carcinogen in several types of cancers, such as non-small cell lung cancer [30] and prostate cancer [31]. As reported by Dettmer et al., an notable up-regulation of miR-182 was observed in follicular thyroid carcinomas [32]. Liu et al. also found that miR-182 expression was highly induced in human anaplastic thyroid cancer (ATC), and restoration of miR-182 strongly contributed to the chemoresistance of ATC through repressing tripartite motif 8 (TRIM8) expression [33]. In addition, an up-regulation of miR-182 expression was observed in papillary thyroid cancer (PTC), and silencing of miR-182 resulted in a dramatic decrease in cell proliferation and invasion ability by targeting close homolog of LI (CHL1) [20]. In this study, we demonstrated a prominent elevation of miR-182 in TC tissue tumors. Moreover, miR-182 expression was enhanced 131I-resistent TC cell lines, indicating the possible implication of miR-182 in 131I resistance of TC. A growing body of evidence has indicated that lncRNAs have the potential to modulate tumorigenesis through acting as a “molecular sponge” for miRNAs [34]. Here, we proved that MEG3 was physically associated with miR-182, and inhibited miR-182 expression by direct interaction. Further restoration experiments uncovered that MEG3 knockdown counteracted anti-miR-182-induced anti-proliferation and pro-apoptosis effects in 131I-insensitive TC cell lines. In addition, the

TPC-1 cells, while these effects were greatly abated following depletion of MEG3 (Fig. 6A-6C). Overall, these data indicated that MEG3 enhanced 131I therapy effect in TC via inhibiting miR-182 expression. 4. Discussion It is well known that 131I exposure is a common strategy for TC therapy through inducing various types of DNA damage [22]. Thus, enhancing the sensitivity of TC cells to 131I can greatly improve the therapeutic effects of TC clinically. In recent years, lncRNAs have drawn extensive attention owing to their involvement in a wide range of malignancies [23]. Moreover, increasing lncRNAs have been discovered as important players in thyroid carcinogenesis through modulating different cellular genes [24]. For example, Li et al. disclosed that lncRNA n340790 accelerated cell proliferation, migration and invasion, as well as repressed apoptosis by sponging miR-1254 in TC [25]. Cheng et al. reported that lncRNA-SLC6 A9 expression was downregulated in 131I-insensitive patients and 131I-resistatn TC cells, and overexpression of SLC6 A9 increased TC cell sensitivity to 131I treatment via positively modulating Poly (ADP-ribose) polymerase 1 (PARP1) [26]. Hence, identification of lncRNAs related with 131I-resistance of TC is of great significance for understanding the mechanism underlying 131 I-resistance and may provide a novel biomarker for the radiotherapy of TC. MEG3 is considered to be an imprinted gene belonging to DLK1MEG3 imprinted domain. Previous surveys demonstrated the general tumor-suppressive function of MEG3 in different kinds of cancers. For example, MEG3 levels were reduced in bladder cancer tissues, and down-regulated MEG3 activated autophagy and facilitated cell proliferation in bladder cancer [27]. MEG3 was also found to be able to inhibit cell proliferation and induced apoptosis in prostate cancer [28]. MEG3, epigenetically modulated by miR-29, decreased both anchoragedependent and -independent cell growth, and induced apoptosis in hepatocellular cancer [29]. A previous document elucidated a downregulation of MEG3 in TC tumor tissues, and MEG3 hindered TC cell migration and invasion [14]. Consistently, our study found that MEG3 1237

Biomedicine & Pharmacotherapy 105 (2018) 1232–1239

Y. Liu et al.

Fig. 6. MEG3 modulated proliferation, apoptosis and DNA damage of 131I-tolerant TC cells through interacting with miR-182. (A) MEG3 knockdown reversed the inhibition of anti-miR-182 on cell viability both in res-FTC-133 and res-TPC-1 cells. (B) The apoptosis induced by miR-182 inhibitor in 131I-resistant TC cells was abated following down-regulation of MEG3. (C) Depletion of MEG3 attenuated anti-miR-182-mediated DNA damage in 131I-resistant TC cells. *P < 0.05.

expression of DNA damage protein γ-H2 AX induced by miR-182 inhibitor was also dramatically attenuated following MEG3 knockdown. All these data suggested that MEG3 enhanced 131I sensitivity of TC through sponging miR-182.

5. Conclusion This study revealed that MEG3 suppressed proliferation, induced apoptosis, and enhanced DNA damage in 131I-resistant TC cells by the negative modulation of miR-182. Therefore, our results imply that MEG3 function as a stabilizer for 131I sensitivity and may serve as a potential therapy target for TC patients with 131I treatment failure. 1238

Biomedicine & Pharmacotherapy 105 (2018) 1232–1239

Y. Liu et al.

Conflicts of interest [17]

The authors declare that they have no conflicts of interest. References

[18]

[1] V.C. La, M. Malvezzi, C. Bosetti, W. Garavello, P. Bertuccio, F. Levi, E. Negri, Thyroid cancer mortality and incidence: a global overview, Int. J. Cancer 136 (2015) 2187–2195. [2] C.M. Kitahara, S.S. Devesa, J.A. Sosa, Increases in thyroid cancer incidence and mortality, JAMA 318 (2017) 389–390. [3] H. Lim, S.S. Devesa, J.A. Sosa, D. Check, C.M. Kitahara, Trends in thyroid cancer incidence and mortality in the United States, 1974-2013, JAMA 317 (2017) 1338–1348. [4] W.Q. Chen, R.S. Zheng, S.W. Zhang, H.M. Zeng, C.F. Xia, T.T. Zuo, Z.X. Yang, X.N. Zou, J. He, Cancer incidence and mortality in China, 2013, Cancer Lett. 401 (2017) 63–71. [5] C.A. Clarke, P. Reynolds, I. Oakley-Girvan, E. Lee, Y. Lu, J. Yang, L.M. Moy, L. Bernstein, P.L. Horn-Ross, Indicators of microbial-rich environments and the development of papillary thyroid cancer in the California teachers study, Cancer Epidemiol. 39 (2015) 548–553. [6] M.E. Cabanillas, D.G. Mcfadden, C. Durante, Thyroid cancer, Lancet 388 (2016) 2783–2795. [7] Z.R. Li, B. Gao, S. Hao, W.G. Tian, Y. Chen, L.L. Wang, X.H. Zhang, D.L. Luo, Knockdown of lncRNA-PANDAR suppresses the proliferation, cell cycle and promotes apoptosis in thyroid cancer cells, EXCLI J. 16 (2017) 354–362. [8] G. Yang, X. Lu, L. Yuan, LncRNA: a link between RNA and cancer, Biochim. Biophys. Acta 1839 (2014) 1097–1109. [9] T. Liao, N. Qu, R.L. Shi, K. Guo, B. Ma, Y.M. Cao, J. Xiang, Z.W. Lu, Y.X. Zhu, D.S. Li, BRAF-activated LncRNA functions as a tumor suppressor in papillary thyroid cancer, Oncotarget 8 (2016) 238–247. [10] J.K. Huang, W.H. Song, B.Y. Lu, Y.B. Huang, H.M. Dong, X.K. Ma, Z.Z. Zhu, R. Zhou, L. Ma, LncRNA-MALAT1 promotes angiogenesis of thyroid cancer by modulating tumor-associated macrophage FGF2 protein secretion, J. Cell. Biochem. 18 (2017) 4821–4830. [11] M. Sun, R. Xia, F.Y. Jin, T.P. Xu, Z.J. Liu, W. De, X.H. Liu, Downregulated long noncoding RNA MEG3 is associated with poor prognosis and promotes cellproliferation in gastric cancer, Tumour Biol. 35 (2014) 1065–1073. [12] Y.Q. He, Y.H. Luo, B.Y. Liang, L. Ye, G.X. Lu, W.M. He, Potential applications of MEG3 in cancer diagnosis and prognosis, Oncotarget 8 (2017) 73282–73295. [13] J.H. He, Z.P. Han, J.M. Liu, J.B. Zhou, M.X. Zou, Y.B. Lv, Y.G. Li, M.R. Cao, Overexpression of Long Non-coding RNA MEG3 inhibits proliferation of Hepatocellular Carcinoma Huh7 cells via negative modulation of miRNA-664, J. Cell. Biochem. 118 (2017) 3713–3721. [14] C. Wang, G. Yan, Y. Zhang, X. Jia, P. Bo, Long non-coding RNA MEG3 suppresses migration and invasion of thyroid carcinoma by targeting of Rac1, Neoplasma 62 (2015) 541–549. [15] H. Chang, Y.H. Liu, L.L. Wang, J. Wang, Z.H. Zhao, J.F. Qu, S.F. Wang, MiR-182 promotes cell proliferation by suppressing FBXW7 and FBXW11 in non-small cell lung cancer, Am. J. Transl. Res. 10 (2018) 1131–1142. [16] I. Casanovasalas, J. Rubiobriones, A. Calatrava, C. Mancarella, E. Masia, J. Casanova, A. Fernandezserra, L. Rubio, M. Ramirezbackhaus, A. Arminan, Identification of miR-187 and miR-182 as biomarkers of early diagnosis and

[19]

[20]

[21] [22] [23] [24] [25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

1239

prognosis in patients with prostate cancer treated with radical prostatectomy, J. Urol. 192 (2014) 252–259. C.H. Chiang, M.F. Hou, W.C. Hung, Up-regulation of miR-182 by β-catenin in breast cancer increases tumorigenicity and invasiveness by targeting the matrix metalloproteinase inhibitor RECK, Biochim. Biophys. Acta 1830 (2013) 3067–3076. M. Sachdeva, J.K. Mito, C.L. Lee, M. Zhang, Z. Li, R.D. Dodd, D. Cason, L. Luo, Y. Ma, M.D. Van, MicroRNA-182 drives metastasis of primary sarcomas by targeting multiple genes, J. Clin. Invest. 124 (2014) 4305–4319. X. Xu, B. Ayub, Z. Liu, V.A. Serna, W. Qiang, Y. Liu, E. Hernando, S. Zabludoff, T. Kurita, B. Kong, Anti-MiR-182 reduces ovarian cancer burden, invasion, and metastasis: an in vivo study in orthotopic xenografts of nude mice, Mol. Cancer Ther. 13 (2014) 1729–1739. H. Zhu, J. Fang, J. Zhang, Z. Zhao, L. Liu, J. Wang, Q. Xi, M. Gu, miR-182 targets CHL1 and controls tumor growth and invasion in papillary thyroid carcinoma, Biochem. Biophys. Res. Commun. 450 (2014) 857–862. Y. Tay, J. Rinn, P.P. Pandolfi, The multilayered complexity of ceRNA crosstalk and competition, Nature 505 (2014) 344–352. J. Robbins, A.B. Schneider, Thyroid cancer following exposure to radioactive iodine, Rev. Endocr. Metab. Disord. 1 (2000) 197–203. G. Yang, X. Lu, L. Yuan, LncRNA: a link between RNA and cancer, Biochim. Biophys. Acta 1839 (2014) 1097–1109. A.K. Murugan, A.K. Munirajan, A.S. Alzahrani, Long noncoding RNAs: emerging players in thyroid cancer pathogenesis, Endocr. Relat. Cancer. 25 (2018) R59–R82. Q. Li, S. Wei, X. Li, L. Zhang, J. Xiao, The lncRNA n340790 accelerates carcinogenesis of thyroid cancer by regulating miR-1254, Am. J. Transl. Res. 9 (2017) 2181–2194. C. Xiang, M. Zhang, Q. Zhao, Q. Xie, H. Yan, X. Yu, P. Wang, Y. Wang, LncRNASLC6A9-5:2: a potent sensitizer in 131I-resistant papillary thyroid carcinoma with PARP-1 induction, Oncotarget 8 (2017) 22954–22967. L. Ying, Y. Huang, H. Chen, Y. Wang, L. Xia, Y. Chen, Y. Liu, F. Qiu, Downregulated MEG3 activates autophagy and increases cell proliferation in bladder cancer, Mol. Biosyst. 9 (2013) 407–411. G. Luo, M. Wang, X. Wu, D. Tao, X. Xiao, L. Wang, F. Min, F. Zeng, G. Jiang, Long Non-coding RNA MEG3 inhibits cell proliferation and induces Apoptosis in prostate cancer, Cell. Physiol. Biochem. 37 (2015) 2209–2220. C. Braconi, T. Kogure, N. Valeri, N. Huang, G. Nuovo, S. Costinean, M. Negrini, E. Miotto, C.M. Croce, T. Patel, microRNA-29 can regulate expression of the long non-coding RNA gene MEG3 in hepatocellular cancer, Oncogene 30 (2011) 4750–4756. H. Chang, Y.H. Liu, L.L. Wang, J. Wang, Z.H. Zhao, J.F. Qu, S.F. Wang, MiR-182 promotes cell proliferation by suppressing FBXW7 and FBXW11 in non-small cell lung cancer, Am. J. Transl. Res. 10 (2018) 1131–1142. D.W. Wang, G.L. Lu, Y. Shao, D. Xu, MiR-182 promotes prostate cancer progression through activating Wnt/β-catenin signal pathway, Biomed. Pharmacother. 99 (2018) 334–339. M. Dettmer, A. Vogetseder, M.B. Durso, H. Moch, P. Komminoth, A. Perren, Y.E. Nikiforov, M.N. Nikiforova, MicroRNA expression array identifies novel diagnostic markers for conventional and oncocytic follicular thyroid carcinomas, J. Clin. Endocrinol. Metab. 98 (2013) E1–E7. L. Yao, Z. Bing, T. Shi, H. Qin, miR-182 promotes tumor growth and increases chemoresistance of human anaplastic thyroid cancer by targeting tripartite motif 8, Onco Targets Ther. 10 (2017) 1115–1122. J.H. Yoon, K. Abdelmohsen, M. Gorospe, Functional interactions among microRNAs and long noncoding RNAs, Semin. Cell Dev. Biol. 34 (2014) 9–14.