- Email: [email protected]
lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma Siyuan Chen, Chuping Xie, Xiarong Hu* The First Department of General Surgery, Affiliated Dongguan People’s Hospital, Southern Medical University (Dongguan People’s Hospital), Dongguan, Guangdong, 523059, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 August 2019 Accepted 21 September 2019 Available online xxx
Emerging evidence has revealed that dysregulation of lncRNAs correlate with the development and progression of hepatocellular carcinoma (HCC). In the present study, we globally investigated the expression of SNHG6 in 31 cancer type, and we found that SNHG6 was highly expressed in various cancers, especially in HCC. High expression of SNHG6 was associated with progression and poor prognosis in patients with HCC. Gain of function and loss of function assays showed that SNHG6 promoted HCC cell proliferation. Gene Set Enrichment Analysis (GSEA) and correlation analysis suggested that SNHG6 positively correlated with c-Myc and its downstream targets. Ectopic overexpression of SNHG6 markedly increased the expression of c-Myc and its downstream targets, whereas silencing SNHG6 had the opposite effect on the expression of c-Myc and its downstream targets. Mechanistic assays revealed that SNHG6 acted as a competing endogenous RNA (ceRNA) to sponge let-7c-5p and thereby modulating the depression of c-Myc by let-7c-5p. Taken together, SNHG6 promotes HCC cell proliferation via competitively binding let-7c-5p in hepatocellular carcinoma. © 2019 Published by Elsevier Inc.
Keywords: Long non-coding RNA SNHG6 ceRNA Hepatocellular carcinoma
1. Introduction Hepatocellular carcinoma (HCC) is a highly aggressive solid tumor with high incidence and mortality [1]. Despite the continuous advancement of HCC management, the therapeutic options for HCC remains unsatisfactory, and the prognosis in patients with HCC remain poor [2]. The pathogenesis of HCC is a complex progress related with multiple genes and signaling pathways dysregulation [3]. Therefore, further understanding the underlying molecular mechanisms for HCC onset and development are urgently needed. Long noncoding RNA (lncRNA) refers to a group of non-coding RNAs with over 200 bp in length [4]. Accumulating evidence suggested that lncRNA play essential role in diverse physiological and
Abbreviations: HCC, hepatocellular carcinoma; GSEA, Gene Set Enrichment Analysis; ceRNA, competing endogenous RNA; lncRNA, long noncoding RNA; SNHG6, Small nucleolar RNA host gene 6; TCGA, the Cancer Genome Atlas project; GEO, Gene expression Omnibus; ECL, enhanced chemiluminescence; SEM, standard error of mean; GTEx, Genotype-Tissue Expression; NAP1L1, nucleosome assembly protein 1 like 1; DMP1, dentin matrix protein-1; ERCC6, excision repair cross complementing 6. * Corresponding author. E-mail addresses: [email protected] (S. Chen), [email protected] (C. Xie), [email protected] (X. Hu).
pathological processes including proliferation, differentiation, inflammation, metastasis, and energy metabolism [5]. Dysregulation of lncRNAs have been reported to be associated with initiation and development of HCC [6]. MIR22HG inhibits HCC cell proliferation, migration and metastasis by competitively binding to human antigen R [7]. lncRNA PSTAR represses tumorigenicity via inhibiting hnRNP K deSUMOylation [8]. Lnc-UCID promotes G1/S transition and cell proliferation through preventing DHX9-medicated CDK6 downregulation [9]. However, the functions of a majority of lncRNAs remain poorly understood. Small nucleolar RNA host gene 6 (SNHG6), transcribed from U87HG, is a newly identified lncRNA [10]. It has been reported that no functionally important peptides encoded by SNHG6 [11]. Cao et al. found that overexpressed SNHG6 correlated with malignancy and poor prognosis in HCC [12]. Lei et al. showed that SNHG6 regulated ZEB1 expression via binding miR-101-3p [10]. However, the precisely function of SNHG6 in HCC still remains to be clarified. In the present study, we aimed to determine the expression and function of SNHG6 in HCC, and further investigate its underlying molecular mechanisms. We found that SNHG6 was highly expressed in HCC, which correlated with poor prognosis in patients with HCC. Functionally, forced expression of SNHG6 promoted HCC cell proliferation, whereas SNHG6 downregulation impaired
https://doi.org/10.1016/j.bbrc.2019.09.091 0006-291X/© 2019 Published by Elsevier Inc.
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
2
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
cellular proliferation ability. Mechanically, SNHG6 functions as an endogenous “sponge” through binding let-7c-5p and thus abolishing let-7c-5p-induced suppression of c-Myc. 2. Materials and methods 2.1. Cell culture Human HCC cell line MHCC-97H and HCC-LM3 cell line were obtained from Cell Bank of Type Culture Collection (CBTCC, Chinese Academy of Science, Shanghai, China). Cells were cultured in Dubecco’s modified Eagle’s medium (DMEM, Gibco, Grand Island, NY) containing 10% fetal bovine serum (Gibco) and incubated in humidified incubator containing 5% CO2. 2.2. Expression dataset We used HCCDB: Integrative Molecular Database of Hepatocellular Carcinoma (http://lifeome.net/database/hccdb/home.html) to explore the expression of SNHG6 in different cancer type. We analyzed the Cancer Genome Atlas project (TCGA dataset, https:// tcga-data.nci.nih.gov/tcga/) and Gene expression Omnibus (GEO, accession number GSE36376, GSE25097, GSE6764) dataset to explore the expression of SNHG6 in HCC. In addition, we used the Kaplan Meier Plotter (http://kmplot.com/analysis/index.php? p¼service) to analyze the correlation between the expression of SNHG6 and overall survival of HCC patients. 2.3. Lentivirus production and construction of SNHG6 stably overexpressing cell lines Lentivirus with full length of SNHG6 were constructed by Heyuan Biotechnology Co., Ltd (Shanghai, China). MHCC-97H and HCC-LM3 cells were infected with lentivirus harboring SNHG6 or negative control using the recombinant lentivirus-transducing units plus 8 mg/ml Polybrene provided by Heyuan Biotechnology Co., Ltd. FACS analysis for GFP was used to obtain SNHG3 stably expressing cells 48 h after cells were infected with lentivirus. 2.4. Small interfering RNA (siRNA), let-7c-5p mimic, and anti-let7c-5p transfection siRNA specifically targeting SNHG6, let-7c-5p mimic, and Antilet-7c-5p were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd (Guangzhou, China). HCC cells were seeded in 6-well plate, once the cell density reached 60%, siRNA, let-7c-5p mimic, and Anti-let-7c-5p were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The cells were harvested for further studies. 2.5. CCK-8 assay Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan) was used to explore the HCC cell proliferation ability according to the manufacturer’s instructions. 2 103 cells were seeded in 96-well plates. 10 ml CCK-8 reagents were added into each plate every 24 h. Cells with CCK-8 reagents were incubated at 37 C for 2 h and then assessed absorption under 450 nm light. 2.6. RNA extraction, reverse transcription, and qRT-PCR RNA was extracted using Trizol Total RNA Extraction Reagent Kit (Takara Biotechnology, Dalian China) following the manufacturer’s instructions. The RNA was reversed transcribed into cDNA by reverse transcription reagent kit (Takara Biotechnology). Real-time
PCR was performed in ABI Prism 7500 Sequence detection system (Applied Biosystems, Foster City, CA, USA). Primers in the present study were obtained from Invitrogen. The primer sequences were as follows: SNHG6 forward:50 - TGGGCTCTGCGAGGTGCAAG -30 SNHG6 reverse: 50 - ATGCCACACTTGAGGTAACG -30 b-actin forward:50 -TCAAGATCATTGCTCCTCCTGA-30 b-actin reverse: 50 -CTCGTCATACTCCTGCTTGCTG-30 c-Myc forward: 50 - TACAACACCCGAGCAAGGAC-30 c-Myc reverse, 50 -GAGGCTGCTGGTTTTCCACT-30 , CDK4 forward: 50 -TACAACACCCGAGCAAGGAC-30 CDK4 reverse, 50 -GAGGCTGCTGGTTTTCCACT-30 , BCLCL12 forward:50 -CTGTTCTGTAGCCGGGATGA-30 BCLCL12 reverse: 50 -TGGCAAGTTCAAGTCCACGG-30 ATF4 forward:50 -TAAGCCATGGCGTGAGTACC-30 ATF4 reverse: 50 -GCGCTCGTTAAATCGCTTCC-30 HMGA1 forward:50 -GCATCCCAGCCATCACTCTT-30 HMGA1 reverse: 50 -CTCAGTGCCGTCCTTTTCCT-30 PABPC1 forward:50 -CACCGGTGTTCCAACTGTTTA-30 PABPC1 reverse: 50 -CCTGGCATTTGCTCGGTACA-30 U6-F forward:50 - CTCGCTTCGGCAGCACA-30 U6-R reverse: 50 - AACGCTTCACGAATTTGCGT-30 has-let-7c-5p forward:50 - CGTGCGGTGAGGTAGTAGGTT-30 has-let-7c-5p reverse:50 - GTGCAGGGTCCGAGGTATTC-30 b-actin and U6 were used as internal control for mRNA and miRNA, respectively. 2.7. Luciferase reporter assay Wild-type c-Myc 30 UTR, SNHG6 sequences and mutant c-Myc 30 UTR, SNHG6 sequences were cloned and inserted into psiCHEK2.0 vector (Promega, Madison, WI, USA) to establish psi-CHEK- c-Myc30 -UTR-WT, psi-CHEK- c-Myc-30 -UTR-Mut, psi-CHEK- SNHG6-WT, and psi-CHEK- SNHG6-Mut luciferase reporter plasmids. HCC cells were co-transfected with 1 mg luciferase reporter plasmids along with let-7c-5p mimic, Anti-let-7c-5p, or plasmid harboring SNHG6-WT or SNHG6-Mut. 48 h later, cells were harvested and subjected to luciferase activity analysis using the dual-luciferase reporter assay system (Promega). 2.8. Western blot Protein were extraction using RIPA buffer (Cell signaling Technology, Boston, MA) supplemented with protease inhibitors (Roche, Mannheim, Germany). Quantified protein lysates were separated on a 10e12% SDS polyacrylamide gel, electrotransferred onto polyvinylidene fluoride (Millipore, Bedford, MA) membranes, blocked with 5% BSA for 1 h at room temperature, and immunoblotted with primary antibodies overnight at 4 C. After the incubation with the corresponding secondary antibodies conjugated to horseradish peroxidase, the signals of the membranes were detected by ECL (enhanced chemiluminescence) Western Blotting Substrate (Pierce, Rockford, IL). 2.9. Statistical analysis Statistical analysis was performed using SPSS22.0 (Abbott Laboratories, North Chicago, IL, USA). ALL data was shown as the mean ± standard error of mean (SEM) from at least three independent experiments. Student’s t -test, Chi-square test, or parametric generalized liner model with random effects were used for comparisons between groups. Overall survival was estimated using Kaplan-Meier and log-rank test. All statistical tests were two-sided. A P < 0.05 was regarded as significant.
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3. Results
3
interrogating the TCGA datasets, SNHG6 was highly expressed in various cancers, especially in HCC (Supplementary Fig. 1C).
3.1. SNHG6 is highly expressed in various cancers It has been reported that lncRNAs tend to be poorly conserved compared to protein-coding genes [13]. Though a majority of lncRNAs exhibit poorly sequence conservation, some conserved lncRNAs do exist. SNHG6, the host gene of small nucleolar RNA U87, was highly conserved among primates including chimp, gorilla, mouse and dog (Supplementary Fig. 1A). SNHG6 was widely expressed in various organs and tissues according to the GenotypeTissue Expression (GTEx) benign tissue RNA-seq dataset. However, the expression of SNHG6 remained the lowest in the liver among different tissues (Supplementary Fig. 1B). Interestingly, when
3.2. High expression of SNHG6 correlates with poor prognosis in patients with HCC We analyzed RNA-seq data of 351 HCC patients from TCGA datasets to determine to expression of SNHG6 in HCC. As shown in Fig. 1A (left panel), SNHG6 was highly expressed in HCC tissues in comparison with non-tumor tissues. To eliminate the possibility that the difference between HCC tissue and non-tumor tissue was caused by imbalance sample size, we reanalyzed the data from 50 paired HCC tissues and non-tumor tissue. Consistently, SNHG6 was highly expressed in HCC (Fig. 1A, right panel). Moreover, data from
Fig. 1. Upregulation of SNHG6 correlates with poor prognosis in patients with HCC. (A). Left panel, analysis of SNHG6 expression in HCC patients from TCGA datasets (n ¼ 351). Right panel, Re-analysis of SNHG6 expression level in 50 paired HCC samples and adjacent non-tumor samples from TCGA datasets (n ¼ 50). (B). Expression of SNHG6 in HCC patients from GSE36376 and ICGC-LIRI-JP. (C). Expression of SNHG6 in healthy liver, cirrhotic liver, non-tumor tissue, early HCC and advanced HCC tissues. (D). Kaplan-Meier survival analysis of overall survival of HCC patients from ICGC-LIRI-JP database. (E). Kaplan-Meier survival analysis of overall survival of HCC patients from TCGA datasets using Kaplan Meier Plotter online program.
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
4
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
GSE36376 and ICGC-LIRI-JP confirmed that SNHG6 was overexpressed in HCC (Fig. 1B). Interestingly, data from GSE25097 and GSE6764 suggested that SNHG6 positively correlated with HCC tumor development (Fig. 1C). High expression of SNHG6 was associated with TNM stage, portal vein invasion, and vein invasion ((Supplementary Table 1). Notably, Kaplan-Meier analysis and logrank test suggested that SNHG6 overexpression predicted poor overall survival in patients with HCC (Fig. 1D). Consistently, data from TCGA showed that patients with SNHG6 overexpression had poorer overall survival time than those with low expression of SNHG6, though the difference between the two groups did not reach statistical significance. Since SNHG6 correlated with TNM stage, we reanalyzed the data from subgroups. Interestingly, patients with SNHG6 overexpression presented poorer overall survival time than those with SNHG6 low expression in advanced HCC (Fig. 1E).
3.3. SNHG6 promotes HCC cell proliferation To investigate the biological functions of SNHG6 in HCC, Lentiviral vectors harboring SNHG6 were introduced into MHCC-97H and HCC-LM3 cells (Fig. 2A). CCK-8 assays showed that ectopic overexpression of SNHG6 visibly promoted cell proliferation in MHCC-97H and HCC-LM3 cells (Fig. 2B). Moreover, the expression of SNHG6 was silenced in MHCC-97H and HCC-LM3 cells (Fig. 2C).
Silencing SNHG6 significantly inhibited HCC cell proliferation (Fig. 2D). 3.4. SNHG6 overexpression correlates with c-Myc and its targets GSEA analysis was carried out on HCC tumor sample in TCGA datasets to explore the biological pathway involved in HCC pathogenesis regulated by SNHG6. GSEA analysis suggested that SNHG6 overexpression positively correlated with c-Myc associated gene set (Fig. 3A). Correlation analysis from TCGA dataset showed that SNHG6 positively correlated with c-Myc’s downstream targets with E-box including CDK4, BCL2L12, ATF4, HMGA1, and PABPC1 (Fig. 3B). To find out whether SNHG6 regulated c-Myc and its downstream targets, expression of c-Myc and its targets were examined after ectopic overexpression or silencing SNHG6. Obviously, overexpression of SNHG6 significantly increased the expression of c-Myc and its downstream targets (Fig. 3C). Silencing SNHG6 had the opposite effect on the expression of c-Myc and its down streams (Fig. 3D). Overall, these results suggest that SNHG6 may promote HCC cell proliferation through regulating c-Myc pathway. 3.5. SNHG6 acts as a ceRNA to sponge let-7c-5p Growing number of evidences suggest that lncRNA can function
Fig. 2. Upregulation of SNHG6 promotes HCC cell proliferation. (A). Detection of SNHG6 expression level in MHCC-97H and HCC-LM3 cells after transfecting with lentiviral vectors harboring SNHG6 using qRT-PCR (***P < 0.001). (B). Proliferation ability was measured by CCK-8 assays after indicated treatments in MHCC-97H and HCC-LM3 cells (**P < 0.01, *P < 0.05). (C). The knockdown efficiency of SNHG6 in MHCC-97H and HCC-LM3 cells were determined by qRT-PCR. (***P < 0.001, **P < 0.01). (D). Proliferation ability was detected by CCK-8 assays after silencing SNHG6 in MHCC-97H and HCC-LM3 cells (***P < 0.001, **P < 0.01).
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 3. SNHG6 correlates with c-Myc and its downstream targets. (A) GSEA analysis suggested a positively correlation between high expression of SNHG6 and c-Myc as well as its target genes. (B). Correlation between SNHG6 and CDK4, BCL2L12, ATF4, HMGA1, and PABPC1 in HCC samples was analyzed from TCGA datasets. (C). Upregulation of SNHG6 increased mRNA expression level of c-Myc and its target genes with E-box (CDK4, BCL2L12, ATF4, HMGA1, and PABPC1) in MHCC-97H and HCC-LM3 cells as detected by qRT-PCR (***P < 0.001, **P < 0.01). (D). Down-regulation of SNHG6 decreased mRNA expression level of c-Myc and its target genes as detected by qRT-PCR (***P < 0.001, **P < 0.01).
as ceRNA through competitively binding with miRNAs [14]. We wondered if SNHG6 regulated c-Myc in a ceRNA dependent manner, bioinformatic analysis was carried out to look for the potential miRNAs that target both SNHG6 and c-Myc. Using TargetScan, 24 and 770 miRNAs predicted to target SNHG6 and c-Myc, respectively. 15 candidates yielded out to target both SNHG6 and cMyc after overlapping these 794 miRNAs. To further narrow in scope, we overlapped the 15 candidates with miRNAs downregulated in HCC analyzed by ONCOMIR (http://www.oncomir.org/ ). Finally, has-let-7c-5p was the only candidate which attracted our attention (Fig. 4A). To further clarify if c-Myc was the target of let-7c-5p, let-7c-5c mimic or Anti-let-7c-5c were introduced into SMMC-97H cells. Notably, overexpression of let-7c-5c remarkably decreased the expression of c-Myc both in mRNA and protein level, whereas Antilet-7c-5c obviously increased the expression of c-Myc (Fig. 4BeD). Additionally, luciferase reporter plasmids harboring wild-type (psiCHEK-c-Myc-30 -UTR-WT) and mutant (psiCHEK-c-Myc-30 -UTRMut) c-Myc 30 -UTR were transiently introduced into MHCC-97H cells (Fig. 4E, left panel). Luciferase reporter assays showed that let-7c-5p mimic significantly decreased the luciferase activity of psiCHEK-c-Myc-30 -UTR-WT reporter, while Anti-let-7c-5p had the opposite effect on psiCHEK-c-Myc-30 -UTR-WT reporter. However, neither let-7c-5p mimic or Anti-let-7c-5p had effect on psiCHEK-CMyc-30 -UTR-Mut reporter activity (Fig. 4E, right panel). These results suggested that c-Myc was the direct target of let-7c-5p.
Bioinformatics prediction suggested that SNHG6 contained a potential binding site for let-7c-5p (Fig. 4F, left panel). As shown in Fig. 4F, co-transfection of MHCC-97H cell with let-7c-5p mimic and psiCHEK-SNHG6-WT plasmid significantly reduced luciferase reporter activity compared with cells co-transfected with psiCHEKSNHG6-Mut and miR-NC. Conversely, Anti-let-7c-5p increased luciferase reporter activity of psiCHEK-SNHG6-WT, but not psiCHEK-SNHG6-Mut. These results indicated that wild-type SNHG6 rather than SNHG6 with mutated let-7c-5p binding site could bind to let-7c-5p. Furthermore, si-SNHG6-2 reduced the luciferase activity of psiCHEK-c-Myc-30 -UTR-WT, inhibition of let-7c-5p in SNHG6-downregulated cells reversed the decrease of psiCHEK-cMyc-30 -UTR-WT luciferase activity caused by SNHG6 downregulation (Fig. 4G). qRT-PCR and Western blot assays indicated that silencing SNHG6 or forced expression of let-7c-5p visibly decreased c-Myc expression levels in MHCC-97H cells. As a rescue experiment, inhibition of let-7c-5p in SNHG6 silencing cells reversed the decrease in c-Myc expression (Fig. 4H and I). To investigate if SNHG6 regulates c-Myc expression due to direct targeting of let-7c-5p binding sites in SNHG6 sequence, we knockdowned endogenous SNHG6 and then transfected MHCC-97H cells with SNHG6-Mut, which contained mutations at the putative let7c-5p binding site, or SNHG6-WT. Western blot assays showed that silencing SNHG6 decreased c-Myc expression. Interestingly, transfection with SNHG6-WT reversed the decrease in c-Myc expression caused by SNHG6 down-regulation, whereas
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
6
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 4. SNHG6 functions as a ceRNA and regulates c-Myc expression by sponging let-7c-5p. (A) A schematic diagram of the protocol used to search for potential miRNAs targeting both SNHG6 and c-Myc. (CeD). Expression of c-Myc was detected by qRT-PCR in MHCC-97H cells after transfection with let-7c-5p mimic (C) or Anti-let-7c-5p (D). (E) Left panel, diagram of the putative binding site (red) of let-7c-5p on the 30 -UTR of c-Myc predicted by TargetScan and the mutant sequences was shown in blue. Right panel, relative luciferase reporter activities with psiCHEK-c-Myc-3-UTR-WT or psiCHEK-c-Myc-3-UTR-Mut after transfection with let-7c-5p mimic and Anti-let-7c-5p in MHCC-97H (***P < 0.001). (F). Left panel, diagram of the putative binding site (red) of let-7c-5p on SNHG6 predicted by TargetScan and the mutant sequences was shown in blue. Right panel, relative luciferase reporter activities with psiCHEK-SNHG6-WT or psiCHEK-SNHG6-Mut after transfection with let-7c-5p mimic and Anti-let-7c-5p in MHCC-97H (***P < 0.001). (G). Relative luciferase reporter activity of psiCHEK-c-Myc-3-UTR-WT was measured after indicated treatments (***P < 0.001). (HeI) mRNA (H) and protein (I) expression levels of c-Myc in MHCC-97H cell after indicated treatments were detected by qRT-PCR and Western blot. (J) Western blot analysis of c-Myc expression following transfection of MHCC-97H cells with si-SNHG6-2 or co-transfection with si-SNHG6-2 and SNHG6-WT or SNHG6-Mut. (K). Proliferation ability was measured by CCK-8 assays after indicated treatments in MHCC-97H cells (***P < 0.001). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
transfection with SNHG6-Mut did not (Fig. 4J). These results indicated that SNHG6 regulated c-Myc expression by sequestering endogenous let-7c-5p. In addition, CCK-8 assays showed that knock-downed SNHG6 significantly inhibited HCC cell proliferation. As a rescue experiment, introduction of SNHG6-WT reversed the inhibition in cell proliferation caused by SNHG6 downregulation, whereas enforced expression of SNHG6-Mut barely had such effect (Fig. 4K). Taken together, SNHG6 functions as an endogenous “sponge” through binding let-7c-5p and thus abolishing let-7c-5p-induced suppression of c-Myc. 4. Discussion A growing number of evidences have demonstrated that lncRNAs may be important biomarkers for initiation, development, prognosis and treatment of HCC [15e17]. In this study, we found SNHG6 was highly expressed in HCC, and increased expression of SNHG6 positively correlated with tumor TNM stage, portal vein invasion, and vein invasion. Moreover, high expression of SNHG6 predicted poor prognosis especially in patients with advanced HCC. Functional exploration suggested that SNHG6 visibly promoted HCC cell proliferation. Mechanistic analysis demonstrated that SNHG6 acted as a ceRNA to sequester let-7c-5p, thereby derepressing c-Myc from let-7c-5p. Functional miRNAs were reported to regulate target mRNAs both in physiological and pathological processes [18,19]. Previous studies have found multiple targets of let-7c-5p, including nucleosome assembly protein 1 like 1 (NAP1L1), dentin matrix protein-1 (DMP1) and excision repair cross complementing 6 (ERCC6) [20e22]. In the current study, we first identified c-Myc as a direct target of let-7c-5p in HCC using luciferase activity, qRT-PCR and Western blot assays. It is well-known that oncogene c-Myc is a strong transcription factor which is frequently abnormally amplified in human malignances [23]. Accumulating evidences show that c-Myc overexpression play a crucial role in tumorigenesis of HCC as a powerful regulator [24]. Evidences based on multiple studies have confirmed that c-Myc promotes invasion, cell proliferation, tumor growth and metastasis [25]. In this study, we found that let-7c-5p negatively regulated c-Myc expression level, and let-7c-5p might inhibit HCC cell proliferation by modulating c-Myc. Recently, the ceRNA mechanism has been proposed by Tay et al. Under this condition, Most RNA transcripts (mRNAs or lncRNAs) harboring same miRNA-binding sites are capable to communicate and modulate each’s expression through competing for binding to shared miRNAs [26]. Evidence based on many studies has demonstrated that lncRNAs communicate with miRNAs through a ceRNA crosstalk. lncRNA TTN-AS1 promotes epithelial to mesenchymal transition by sponging miR-142-p in lung adenocarcinoma [27]. lncRNA FAM225A promotes nasopharyngeal carcinoma metastasis via acting as ceRNA to sponge miR-590-3p [28]. lncRNA H19 facilitates tumor formation through sequestering miR-20b-5p as a ceRNA [29]. In the present study, we proposed a ceRNA communicating model including SNHG6, let-7c-5p, and c-Myc. SNHG6, sharing a let-7c-5p response element with c-Myc, increased the expression of c-Myc. Dual-luciferase reporter assays reveal that both silencing SNHG6 and let-7c-5p overexpression impaired the luciferase activity of psiCHKE-c-Myc-30 -UTR. Furthermore, Anti-let7c-5p reversed the effect of silencing SNHG6 on psiCHKE-c-Myc-30 UTR luciferase activity. In addition, transfection with SNHG6-WT reversed the decrease in c-Myc expression caused by SNHG6 down-regulation. Taken together, SNHG6, sharing the same let-7c5p-responsive element with c-Myc, promotes HCC progression in a ceRNA dependent manner. In conclusion, upregulation of SNHG6 correlates with HCC progression and predicts poor prognosis especially for patient with
7
advanced HCC. SNHG6 upregulates c-Myc to promote HCC cell proliferation via sequestering let-7c-5p in a ceRNA dependent manner. Conflicts of interest There is no conflict of Interest to be declared. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.09.091. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.09.091. References [1] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA A Cancer J. Clin. 68 (2018) 394e424. [2] Q. Zhou, W. Zhang, Z. Wang, S. Liu, Long non-coding RNA PTTG3P functions as an oncogene by sponging miR-383 and up-regulating CCND1 and PARP2 in hepatocellular carcinoma, BMC Canc. 19 (2019) 731. [3] Y. Yan, Y. Lu, K. Mao, M. Zhang, H. Liu, Q. Zhou, J. Lin, J. Zhang, J. Wang, Z. Xiao, Identification and validation of a prognostic four-genes signature for hepatocellular carcinoma: integrated ceRNA network analysis, Hepatol Int. 13 (5) (2019), https://doi.org/10.1007/s12072-019-09962-3. [4] D. Zhang, C. Cao, L. Liu, D. Wu, Up-regulation of LncRNA SNHG20 predicts poor prognosis in hepatocellular carcinoma, J. Cancer 7 (2016) 608e617. [5] M.C. Jiang, J.J. Ni, W.Y. Cui, B.Y. Wang, W. Zhuo, Emerging roles of lncRNA in cancer and therapeutic opportunities, Am. J. Cancer Res. 9 (2019) 1354e1366. [6] H. Shi, Y. Xu, X. Yi, D. Fang, X. Hou, Current Research Progress on Long Noncoding RNAs Associated with Hepatocellular Carcinoma, 2019, p. 1534607, 2019. [7] D.Y. Zhang, X.J. Zou, C.H. Cao, T. Zhang, L. Lei, X.L. Qi, L. Liu, D.H. Wu, Identification and functional characterization of long non-coding RNA MIR22HG as a tumor suppressor for hepatocellular carcinoma, Theranostics 8 (2018) 3751e3765. [8] G. Qin, X. Tu, H. Li, P. Cao, X. Chen, J. Song, H. Han, Y. Li, B. Guo, L. Yang, P. Yan, P. Li, C. Gao, J. Zhang, Y. Yang, J. Zheng, H.Q. Ju, L. Lu, X. Wang, C. Yu, Y. Sun, B. Xing, H. Ji, D. Lin, F. He, G. Zhou, Long Noncoding RNA P53-Stabilizing and Activating RNA Promotes P53 Signaling by Inhibiting Heterogeneous Nuclear Ribonucleoprotein K deSUMOylation and Suppresses Hepatocellular Carcinoma, 2019. [9] Y.L. Wang, J.Y. Liu, J.E. Yang, X.M. Yu, Z.L. Chen, Y.J. Chen, M. Kuang, Y. Zhu, S.M. Zhuang, Lnc-ucid promotes G1/S transition and hepatoma growth by preventing DHX9-mediated CDK6 Down-regulation 70 (2019) 259e275. [10] L. Chang, Y. Yuan, C. Li, T. Guo, H. Qi, Y. Xiao, X. Dong, Z. Liu, Q. Liu, Upregulation of SNHG6 regulates ZEB1 expression by competitively binding miR101-3p and interacting with UPF1 in hepatocellular carcinoma, Cancer Lett. 383 (2016) 183e194. [11] J.A. Makarova, D.A. Kramerov, Noncoding RNA of U87 host gene is associated with ribosomes and is relatively resistant to nonsense-mediated decay, Gene 363 (2005) 51e60. [12] C. Cao, T. Zhang, D. Zhang, L. Xie, X. Zou, L. Lei, D. Wu, L. Liu, The long noncoding RNA, SNHG6-003, functions as a competing endogenous RNA to promote the progression of hepatocellular carcinoma, Oncogene 36 (2017) 1112e1122. [13] Y. Hosono, Y.S. Niknafs, J.R. Prensner, M.K. Iyer, S.M. Dhanasekaran, R. Mehra, S. Pitchiaya, J. Tien, J. Escara-Wilke, A. Poliakov, S.C. Chu, S. Saleh, K. Sankar, F. Su, S. Guo, Y. Qiao, S.M. Freier, H.H. Bui, X. Cao, R. Malik, T.M. Johnson, D.G. Beer, F.Y. Feng, W. Zhou, A.M. Chinnaiyan, Oncogenic role of THOR, a conserved cancer/testis long non-coding RNA, Cell 171 (2017) 1559e1572, e1520. [14] Y. Zhao, T. Du, L. Du, P. Li, J. Li, W. Duan, Y. Wang, C. Wang, Long Noncoding RNA LINC02418 Regulates MELK Expression by Acting as a ceRNA and May Serve as a Diagnostic Marker for Colorectal Cancer, vol. 10, 2019, p. 568. [15] M. Abbastabar, M. Sarfi, A. Golestani, E. Khalili, lncRNA involvement in
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
8
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[16]
[17]
[18] [19]
[20]
[21]
[22]
hepatocellular carcinoma metastasis and prognosis, Excli J. 17 (2018) 900e913. Y.H. Lin, M.H. Wu, C.T. Yeh, K.H. Lin, Long Non-coding RNAs as Mediators of Tumor Microenvironment and Liver Cancer Cell Communication, vol. 19, 2018. J.K. DiStefano, Long noncoding RNAs in the initiation, progression, and metastasis of hepatocellular carcinoma, Non Coding RNA Res. 2 (2017) 129e136. Y. Zhao, Z. Wang, W. Zhang, MicroRNAs Play an Essential Role in Autophagy Regulation in Various Disease Phenotypes, 2019. A. Tajbakhsh, V. Bianconi, M. Pirro, S.M. Gheibi Hayat, T.P. Johnston, A. Sahebkar, Efferocytosis and atherosclerosis: regulation of phagocyte function by MicroRNAs, Trends Endocrinol. Metab. 30 (9) (2019), https://doi.org/ 10.1016/j.tem.2019.07.006. Y. Huang, B. Xiang, Y. Liu, Y. Wang, H. Kan, LncRNA CDKN2B-AS1 promotes tumor growth and metastasis of human hepatocellular carcinoma by targeting let-7c-5p/NAP1L1 axis, Cancer Lett. 437 (2018) 56e66. H. Yuan, H. Zhang, L. Hong, H. Zhao, J. Wang, H. Li, H. Che, Z. Zhang, MicroRNA let-7c-5p suppressed lipopolysaccharide-induced dental pulp inflammation by inhibiting dentin matrix protein-1-mediated nuclear factor kappa B (NFkappaB) pathway in vitro and in vivo, Med. Sci. Monit. 24 (2018) 6656e6665. X. Fu, X. Mao, Y. Wang, X. Ding, Y. Li, Let-7c-5p inhibits cell proliferation and induces cell apoptosis by targeting ERCC6 in breast cancer, Oncol. Rep. 38 (2017) 1851e1856.
[23] M. Caforio, C. Sorino, S. Iacovelli, M. Fanciulli, F. Locatelli, V. Folgiero, Recent advances in searching c-Myc transcriptional cofactors during tumorigenesis 37 (2018) 239. [24] D.B. Zimonjic, N.C. Popescu, Role of DLC1 tumor suppressor gene and MYC oncogene in pathogenesis of human hepatocellular carcinoma: potential prospects for combined targeted therapeutics (review), Int. J. Oncol. 41 (2012) 393e406. [25] M. Elbadawy, T. Usui, H. Yamawaki, K. Sasaki, Emerging roles of C-myc in cancer stem cell-related signaling and resistance to cancer chemotherapy: a potential therapeutic target against colorectal cancer, Int. J. Mol. Sci. 20 (2019). [26] Y. Tay, J. Rinn, P.P. Pandolfi, The multilayered complexity of ceRNA crosstalk and competition, Nature 505 (2014) 344e352. [27] Y. Jia, Y. Duan, T. Liu, X. Wang, W. Lv, M. Wang, J. Wang, L. Liu, LncRNA TTNAS1 promotes migration, invasion, and epithelial mesenchymal transition of lung adenocarcinoma via sponging miR-142-5p to regulate CDK5 10 (2019) 573. [28] Z.Q. Zheng, Z.X. Li, G.Q. Zhou, L. Lin, L.L. Zhang, J.W. Lv, X.D. Huang, Long Noncoding RNA FAM225A Promotes Nasopharyngeal Carcinoma Tumorigenesis and Metastasis by Acting as ceRNA to Sponge miR-590-3p/miR-1275 and Upregulate ITGB3, 2019. [29] H. Zhu, Y.M. Jin, X.M. Lyu, L.M. Fan, F. Wu, Long Noncoding RNA H19 Regulates HIF-1alpha/AXL Signaling through Inhibiting miR-20b-5p in Endometrial Cancer, 2019, pp. 1e11.
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma Siyuan Chen, Chuping Xie, Xiarong Hu* The First Department of General Surgery, Affiliated Dongguan People’s Hospital, Southern Medical University (Dongguan People’s Hospital), Dongguan, Guangdong, 523059, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 August 2019 Accepted 21 September 2019 Available online xxx
Emerging evidence has revealed that dysregulation of lncRNAs correlate with the development and progression of hepatocellular carcinoma (HCC). In the present study, we globally investigated the expression of SNHG6 in 31 cancer type, and we found that SNHG6 was highly expressed in various cancers, especially in HCC. High expression of SNHG6 was associated with progression and poor prognosis in patients with HCC. Gain of function and loss of function assays showed that SNHG6 promoted HCC cell proliferation. Gene Set Enrichment Analysis (GSEA) and correlation analysis suggested that SNHG6 positively correlated with c-Myc and its downstream targets. Ectopic overexpression of SNHG6 markedly increased the expression of c-Myc and its downstream targets, whereas silencing SNHG6 had the opposite effect on the expression of c-Myc and its downstream targets. Mechanistic assays revealed that SNHG6 acted as a competing endogenous RNA (ceRNA) to sponge let-7c-5p and thereby modulating the depression of c-Myc by let-7c-5p. Taken together, SNHG6 promotes HCC cell proliferation via competitively binding let-7c-5p in hepatocellular carcinoma. © 2019 Published by Elsevier Inc.
Keywords: Long non-coding RNA SNHG6 ceRNA Hepatocellular carcinoma
1. Introduction Hepatocellular carcinoma (HCC) is a highly aggressive solid tumor with high incidence and mortality [1]. Despite the continuous advancement of HCC management, the therapeutic options for HCC remains unsatisfactory, and the prognosis in patients with HCC remain poor [2]. The pathogenesis of HCC is a complex progress related with multiple genes and signaling pathways dysregulation [3]. Therefore, further understanding the underlying molecular mechanisms for HCC onset and development are urgently needed. Long noncoding RNA (lncRNA) refers to a group of non-coding RNAs with over 200 bp in length [4]. Accumulating evidence suggested that lncRNA play essential role in diverse physiological and
Abbreviations: HCC, hepatocellular carcinoma; GSEA, Gene Set Enrichment Analysis; ceRNA, competing endogenous RNA; lncRNA, long noncoding RNA; SNHG6, Small nucleolar RNA host gene 6; TCGA, the Cancer Genome Atlas project; GEO, Gene expression Omnibus; ECL, enhanced chemiluminescence; SEM, standard error of mean; GTEx, Genotype-Tissue Expression; NAP1L1, nucleosome assembly protein 1 like 1; DMP1, dentin matrix protein-1; ERCC6, excision repair cross complementing 6. * Corresponding author. E-mail addresses: [email protected] (S. Chen), [email protected] (C. Xie), [email protected] (X. Hu).
pathological processes including proliferation, differentiation, inflammation, metastasis, and energy metabolism [5]. Dysregulation of lncRNAs have been reported to be associated with initiation and development of HCC [6]. MIR22HG inhibits HCC cell proliferation, migration and metastasis by competitively binding to human antigen R [7]. lncRNA PSTAR represses tumorigenicity via inhibiting hnRNP K deSUMOylation [8]. Lnc-UCID promotes G1/S transition and cell proliferation through preventing DHX9-medicated CDK6 downregulation [9]. However, the functions of a majority of lncRNAs remain poorly understood. Small nucleolar RNA host gene 6 (SNHG6), transcribed from U87HG, is a newly identified lncRNA [10]. It has been reported that no functionally important peptides encoded by SNHG6 [11]. Cao et al. found that overexpressed SNHG6 correlated with malignancy and poor prognosis in HCC [12]. Lei et al. showed that SNHG6 regulated ZEB1 expression via binding miR-101-3p [10]. However, the precisely function of SNHG6 in HCC still remains to be clarified. In the present study, we aimed to determine the expression and function of SNHG6 in HCC, and further investigate its underlying molecular mechanisms. We found that SNHG6 was highly expressed in HCC, which correlated with poor prognosis in patients with HCC. Functionally, forced expression of SNHG6 promoted HCC cell proliferation, whereas SNHG6 downregulation impaired
https://doi.org/10.1016/j.bbrc.2019.09.091 0006-291X/© 2019 Published by Elsevier Inc.
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
2
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
cellular proliferation ability. Mechanically, SNHG6 functions as an endogenous “sponge” through binding let-7c-5p and thus abolishing let-7c-5p-induced suppression of c-Myc. 2. Materials and methods 2.1. Cell culture Human HCC cell line MHCC-97H and HCC-LM3 cell line were obtained from Cell Bank of Type Culture Collection (CBTCC, Chinese Academy of Science, Shanghai, China). Cells were cultured in Dubecco’s modified Eagle’s medium (DMEM, Gibco, Grand Island, NY) containing 10% fetal bovine serum (Gibco) and incubated in humidified incubator containing 5% CO2. 2.2. Expression dataset We used HCCDB: Integrative Molecular Database of Hepatocellular Carcinoma (http://lifeome.net/database/hccdb/home.html) to explore the expression of SNHG6 in different cancer type. We analyzed the Cancer Genome Atlas project (TCGA dataset, https:// tcga-data.nci.nih.gov/tcga/) and Gene expression Omnibus (GEO, accession number GSE36376, GSE25097, GSE6764) dataset to explore the expression of SNHG6 in HCC. In addition, we used the Kaplan Meier Plotter (http://kmplot.com/analysis/index.php? p¼service) to analyze the correlation between the expression of SNHG6 and overall survival of HCC patients. 2.3. Lentivirus production and construction of SNHG6 stably overexpressing cell lines Lentivirus with full length of SNHG6 were constructed by Heyuan Biotechnology Co., Ltd (Shanghai, China). MHCC-97H and HCC-LM3 cells were infected with lentivirus harboring SNHG6 or negative control using the recombinant lentivirus-transducing units plus 8 mg/ml Polybrene provided by Heyuan Biotechnology Co., Ltd. FACS analysis for GFP was used to obtain SNHG3 stably expressing cells 48 h after cells were infected with lentivirus. 2.4. Small interfering RNA (siRNA), let-7c-5p mimic, and anti-let7c-5p transfection siRNA specifically targeting SNHG6, let-7c-5p mimic, and Antilet-7c-5p were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd (Guangzhou, China). HCC cells were seeded in 6-well plate, once the cell density reached 60%, siRNA, let-7c-5p mimic, and Anti-let-7c-5p were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The cells were harvested for further studies. 2.5. CCK-8 assay Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan) was used to explore the HCC cell proliferation ability according to the manufacturer’s instructions. 2 103 cells were seeded in 96-well plates. 10 ml CCK-8 reagents were added into each plate every 24 h. Cells with CCK-8 reagents were incubated at 37 C for 2 h and then assessed absorption under 450 nm light. 2.6. RNA extraction, reverse transcription, and qRT-PCR RNA was extracted using Trizol Total RNA Extraction Reagent Kit (Takara Biotechnology, Dalian China) following the manufacturer’s instructions. The RNA was reversed transcribed into cDNA by reverse transcription reagent kit (Takara Biotechnology). Real-time
PCR was performed in ABI Prism 7500 Sequence detection system (Applied Biosystems, Foster City, CA, USA). Primers in the present study were obtained from Invitrogen. The primer sequences were as follows: SNHG6 forward:50 - TGGGCTCTGCGAGGTGCAAG -30 SNHG6 reverse: 50 - ATGCCACACTTGAGGTAACG -30 b-actin forward:50 -TCAAGATCATTGCTCCTCCTGA-30 b-actin reverse: 50 -CTCGTCATACTCCTGCTTGCTG-30 c-Myc forward: 50 - TACAACACCCGAGCAAGGAC-30 c-Myc reverse, 50 -GAGGCTGCTGGTTTTCCACT-30 , CDK4 forward: 50 -TACAACACCCGAGCAAGGAC-30 CDK4 reverse, 50 -GAGGCTGCTGGTTTTCCACT-30 , BCLCL12 forward:50 -CTGTTCTGTAGCCGGGATGA-30 BCLCL12 reverse: 50 -TGGCAAGTTCAAGTCCACGG-30 ATF4 forward:50 -TAAGCCATGGCGTGAGTACC-30 ATF4 reverse: 50 -GCGCTCGTTAAATCGCTTCC-30 HMGA1 forward:50 -GCATCCCAGCCATCACTCTT-30 HMGA1 reverse: 50 -CTCAGTGCCGTCCTTTTCCT-30 PABPC1 forward:50 -CACCGGTGTTCCAACTGTTTA-30 PABPC1 reverse: 50 -CCTGGCATTTGCTCGGTACA-30 U6-F forward:50 - CTCGCTTCGGCAGCACA-30 U6-R reverse: 50 - AACGCTTCACGAATTTGCGT-30 has-let-7c-5p forward:50 - CGTGCGGTGAGGTAGTAGGTT-30 has-let-7c-5p reverse:50 - GTGCAGGGTCCGAGGTATTC-30 b-actin and U6 were used as internal control for mRNA and miRNA, respectively. 2.7. Luciferase reporter assay Wild-type c-Myc 30 UTR, SNHG6 sequences and mutant c-Myc 30 UTR, SNHG6 sequences were cloned and inserted into psiCHEK2.0 vector (Promega, Madison, WI, USA) to establish psi-CHEK- c-Myc30 -UTR-WT, psi-CHEK- c-Myc-30 -UTR-Mut, psi-CHEK- SNHG6-WT, and psi-CHEK- SNHG6-Mut luciferase reporter plasmids. HCC cells were co-transfected with 1 mg luciferase reporter plasmids along with let-7c-5p mimic, Anti-let-7c-5p, or plasmid harboring SNHG6-WT or SNHG6-Mut. 48 h later, cells were harvested and subjected to luciferase activity analysis using the dual-luciferase reporter assay system (Promega). 2.8. Western blot Protein were extraction using RIPA buffer (Cell signaling Technology, Boston, MA) supplemented with protease inhibitors (Roche, Mannheim, Germany). Quantified protein lysates were separated on a 10e12% SDS polyacrylamide gel, electrotransferred onto polyvinylidene fluoride (Millipore, Bedford, MA) membranes, blocked with 5% BSA for 1 h at room temperature, and immunoblotted with primary antibodies overnight at 4 C. After the incubation with the corresponding secondary antibodies conjugated to horseradish peroxidase, the signals of the membranes were detected by ECL (enhanced chemiluminescence) Western Blotting Substrate (Pierce, Rockford, IL). 2.9. Statistical analysis Statistical analysis was performed using SPSS22.0 (Abbott Laboratories, North Chicago, IL, USA). ALL data was shown as the mean ± standard error of mean (SEM) from at least three independent experiments. Student’s t -test, Chi-square test, or parametric generalized liner model with random effects were used for comparisons between groups. Overall survival was estimated using Kaplan-Meier and log-rank test. All statistical tests were two-sided. A P < 0.05 was regarded as significant.
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3. Results
3
interrogating the TCGA datasets, SNHG6 was highly expressed in various cancers, especially in HCC (Supplementary Fig. 1C).
3.1. SNHG6 is highly expressed in various cancers It has been reported that lncRNAs tend to be poorly conserved compared to protein-coding genes [13]. Though a majority of lncRNAs exhibit poorly sequence conservation, some conserved lncRNAs do exist. SNHG6, the host gene of small nucleolar RNA U87, was highly conserved among primates including chimp, gorilla, mouse and dog (Supplementary Fig. 1A). SNHG6 was widely expressed in various organs and tissues according to the GenotypeTissue Expression (GTEx) benign tissue RNA-seq dataset. However, the expression of SNHG6 remained the lowest in the liver among different tissues (Supplementary Fig. 1B). Interestingly, when
3.2. High expression of SNHG6 correlates with poor prognosis in patients with HCC We analyzed RNA-seq data of 351 HCC patients from TCGA datasets to determine to expression of SNHG6 in HCC. As shown in Fig. 1A (left panel), SNHG6 was highly expressed in HCC tissues in comparison with non-tumor tissues. To eliminate the possibility that the difference between HCC tissue and non-tumor tissue was caused by imbalance sample size, we reanalyzed the data from 50 paired HCC tissues and non-tumor tissue. Consistently, SNHG6 was highly expressed in HCC (Fig. 1A, right panel). Moreover, data from
Fig. 1. Upregulation of SNHG6 correlates with poor prognosis in patients with HCC. (A). Left panel, analysis of SNHG6 expression in HCC patients from TCGA datasets (n ¼ 351). Right panel, Re-analysis of SNHG6 expression level in 50 paired HCC samples and adjacent non-tumor samples from TCGA datasets (n ¼ 50). (B). Expression of SNHG6 in HCC patients from GSE36376 and ICGC-LIRI-JP. (C). Expression of SNHG6 in healthy liver, cirrhotic liver, non-tumor tissue, early HCC and advanced HCC tissues. (D). Kaplan-Meier survival analysis of overall survival of HCC patients from ICGC-LIRI-JP database. (E). Kaplan-Meier survival analysis of overall survival of HCC patients from TCGA datasets using Kaplan Meier Plotter online program.
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
4
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
GSE36376 and ICGC-LIRI-JP confirmed that SNHG6 was overexpressed in HCC (Fig. 1B). Interestingly, data from GSE25097 and GSE6764 suggested that SNHG6 positively correlated with HCC tumor development (Fig. 1C). High expression of SNHG6 was associated with TNM stage, portal vein invasion, and vein invasion ((Supplementary Table 1). Notably, Kaplan-Meier analysis and logrank test suggested that SNHG6 overexpression predicted poor overall survival in patients with HCC (Fig. 1D). Consistently, data from TCGA showed that patients with SNHG6 overexpression had poorer overall survival time than those with low expression of SNHG6, though the difference between the two groups did not reach statistical significance. Since SNHG6 correlated with TNM stage, we reanalyzed the data from subgroups. Interestingly, patients with SNHG6 overexpression presented poorer overall survival time than those with SNHG6 low expression in advanced HCC (Fig. 1E).
3.3. SNHG6 promotes HCC cell proliferation To investigate the biological functions of SNHG6 in HCC, Lentiviral vectors harboring SNHG6 were introduced into MHCC-97H and HCC-LM3 cells (Fig. 2A). CCK-8 assays showed that ectopic overexpression of SNHG6 visibly promoted cell proliferation in MHCC-97H and HCC-LM3 cells (Fig. 2B). Moreover, the expression of SNHG6 was silenced in MHCC-97H and HCC-LM3 cells (Fig. 2C).
Silencing SNHG6 significantly inhibited HCC cell proliferation (Fig. 2D). 3.4. SNHG6 overexpression correlates with c-Myc and its targets GSEA analysis was carried out on HCC tumor sample in TCGA datasets to explore the biological pathway involved in HCC pathogenesis regulated by SNHG6. GSEA analysis suggested that SNHG6 overexpression positively correlated with c-Myc associated gene set (Fig. 3A). Correlation analysis from TCGA dataset showed that SNHG6 positively correlated with c-Myc’s downstream targets with E-box including CDK4, BCL2L12, ATF4, HMGA1, and PABPC1 (Fig. 3B). To find out whether SNHG6 regulated c-Myc and its downstream targets, expression of c-Myc and its targets were examined after ectopic overexpression or silencing SNHG6. Obviously, overexpression of SNHG6 significantly increased the expression of c-Myc and its downstream targets (Fig. 3C). Silencing SNHG6 had the opposite effect on the expression of c-Myc and its down streams (Fig. 3D). Overall, these results suggest that SNHG6 may promote HCC cell proliferation through regulating c-Myc pathway. 3.5. SNHG6 acts as a ceRNA to sponge let-7c-5p Growing number of evidences suggest that lncRNA can function
Fig. 2. Upregulation of SNHG6 promotes HCC cell proliferation. (A). Detection of SNHG6 expression level in MHCC-97H and HCC-LM3 cells after transfecting with lentiviral vectors harboring SNHG6 using qRT-PCR (***P < 0.001). (B). Proliferation ability was measured by CCK-8 assays after indicated treatments in MHCC-97H and HCC-LM3 cells (**P < 0.01, *P < 0.05). (C). The knockdown efficiency of SNHG6 in MHCC-97H and HCC-LM3 cells were determined by qRT-PCR. (***P < 0.001, **P < 0.01). (D). Proliferation ability was detected by CCK-8 assays after silencing SNHG6 in MHCC-97H and HCC-LM3 cells (***P < 0.001, **P < 0.01).
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 3. SNHG6 correlates with c-Myc and its downstream targets. (A) GSEA analysis suggested a positively correlation between high expression of SNHG6 and c-Myc as well as its target genes. (B). Correlation between SNHG6 and CDK4, BCL2L12, ATF4, HMGA1, and PABPC1 in HCC samples was analyzed from TCGA datasets. (C). Upregulation of SNHG6 increased mRNA expression level of c-Myc and its target genes with E-box (CDK4, BCL2L12, ATF4, HMGA1, and PABPC1) in MHCC-97H and HCC-LM3 cells as detected by qRT-PCR (***P < 0.001, **P < 0.01). (D). Down-regulation of SNHG6 decreased mRNA expression level of c-Myc and its target genes as detected by qRT-PCR (***P < 0.001, **P < 0.01).
as ceRNA through competitively binding with miRNAs [14]. We wondered if SNHG6 regulated c-Myc in a ceRNA dependent manner, bioinformatic analysis was carried out to look for the potential miRNAs that target both SNHG6 and c-Myc. Using TargetScan, 24 and 770 miRNAs predicted to target SNHG6 and c-Myc, respectively. 15 candidates yielded out to target both SNHG6 and cMyc after overlapping these 794 miRNAs. To further narrow in scope, we overlapped the 15 candidates with miRNAs downregulated in HCC analyzed by ONCOMIR (http://www.oncomir.org/ ). Finally, has-let-7c-5p was the only candidate which attracted our attention (Fig. 4A). To further clarify if c-Myc was the target of let-7c-5p, let-7c-5c mimic or Anti-let-7c-5c were introduced into SMMC-97H cells. Notably, overexpression of let-7c-5c remarkably decreased the expression of c-Myc both in mRNA and protein level, whereas Antilet-7c-5c obviously increased the expression of c-Myc (Fig. 4BeD). Additionally, luciferase reporter plasmids harboring wild-type (psiCHEK-c-Myc-30 -UTR-WT) and mutant (psiCHEK-c-Myc-30 -UTRMut) c-Myc 30 -UTR were transiently introduced into MHCC-97H cells (Fig. 4E, left panel). Luciferase reporter assays showed that let-7c-5p mimic significantly decreased the luciferase activity of psiCHEK-c-Myc-30 -UTR-WT reporter, while Anti-let-7c-5p had the opposite effect on psiCHEK-c-Myc-30 -UTR-WT reporter. However, neither let-7c-5p mimic or Anti-let-7c-5p had effect on psiCHEK-CMyc-30 -UTR-Mut reporter activity (Fig. 4E, right panel). These results suggested that c-Myc was the direct target of let-7c-5p.
Bioinformatics prediction suggested that SNHG6 contained a potential binding site for let-7c-5p (Fig. 4F, left panel). As shown in Fig. 4F, co-transfection of MHCC-97H cell with let-7c-5p mimic and psiCHEK-SNHG6-WT plasmid significantly reduced luciferase reporter activity compared with cells co-transfected with psiCHEKSNHG6-Mut and miR-NC. Conversely, Anti-let-7c-5p increased luciferase reporter activity of psiCHEK-SNHG6-WT, but not psiCHEK-SNHG6-Mut. These results indicated that wild-type SNHG6 rather than SNHG6 with mutated let-7c-5p binding site could bind to let-7c-5p. Furthermore, si-SNHG6-2 reduced the luciferase activity of psiCHEK-c-Myc-30 -UTR-WT, inhibition of let-7c-5p in SNHG6-downregulated cells reversed the decrease of psiCHEK-cMyc-30 -UTR-WT luciferase activity caused by SNHG6 downregulation (Fig. 4G). qRT-PCR and Western blot assays indicated that silencing SNHG6 or forced expression of let-7c-5p visibly decreased c-Myc expression levels in MHCC-97H cells. As a rescue experiment, inhibition of let-7c-5p in SNHG6 silencing cells reversed the decrease in c-Myc expression (Fig. 4H and I). To investigate if SNHG6 regulates c-Myc expression due to direct targeting of let-7c-5p binding sites in SNHG6 sequence, we knockdowned endogenous SNHG6 and then transfected MHCC-97H cells with SNHG6-Mut, which contained mutations at the putative let7c-5p binding site, or SNHG6-WT. Western blot assays showed that silencing SNHG6 decreased c-Myc expression. Interestingly, transfection with SNHG6-WT reversed the decrease in c-Myc expression caused by SNHG6 down-regulation, whereas
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
6
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 4. SNHG6 functions as a ceRNA and regulates c-Myc expression by sponging let-7c-5p. (A) A schematic diagram of the protocol used to search for potential miRNAs targeting both SNHG6 and c-Myc. (CeD). Expression of c-Myc was detected by qRT-PCR in MHCC-97H cells after transfection with let-7c-5p mimic (C) or Anti-let-7c-5p (D). (E) Left panel, diagram of the putative binding site (red) of let-7c-5p on the 30 -UTR of c-Myc predicted by TargetScan and the mutant sequences was shown in blue. Right panel, relative luciferase reporter activities with psiCHEK-c-Myc-3-UTR-WT or psiCHEK-c-Myc-3-UTR-Mut after transfection with let-7c-5p mimic and Anti-let-7c-5p in MHCC-97H (***P < 0.001). (F). Left panel, diagram of the putative binding site (red) of let-7c-5p on SNHG6 predicted by TargetScan and the mutant sequences was shown in blue. Right panel, relative luciferase reporter activities with psiCHEK-SNHG6-WT or psiCHEK-SNHG6-Mut after transfection with let-7c-5p mimic and Anti-let-7c-5p in MHCC-97H (***P < 0.001). (G). Relative luciferase reporter activity of psiCHEK-c-Myc-3-UTR-WT was measured after indicated treatments (***P < 0.001). (HeI) mRNA (H) and protein (I) expression levels of c-Myc in MHCC-97H cell after indicated treatments were detected by qRT-PCR and Western blot. (J) Western blot analysis of c-Myc expression following transfection of MHCC-97H cells with si-SNHG6-2 or co-transfection with si-SNHG6-2 and SNHG6-WT or SNHG6-Mut. (K). Proliferation ability was measured by CCK-8 assays after indicated treatments in MHCC-97H cells (***P < 0.001). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
transfection with SNHG6-Mut did not (Fig. 4J). These results indicated that SNHG6 regulated c-Myc expression by sequestering endogenous let-7c-5p. In addition, CCK-8 assays showed that knock-downed SNHG6 significantly inhibited HCC cell proliferation. As a rescue experiment, introduction of SNHG6-WT reversed the inhibition in cell proliferation caused by SNHG6 downregulation, whereas enforced expression of SNHG6-Mut barely had such effect (Fig. 4K). Taken together, SNHG6 functions as an endogenous “sponge” through binding let-7c-5p and thus abolishing let-7c-5p-induced suppression of c-Myc. 4. Discussion A growing number of evidences have demonstrated that lncRNAs may be important biomarkers for initiation, development, prognosis and treatment of HCC [15e17]. In this study, we found SNHG6 was highly expressed in HCC, and increased expression of SNHG6 positively correlated with tumor TNM stage, portal vein invasion, and vein invasion. Moreover, high expression of SNHG6 predicted poor prognosis especially in patients with advanced HCC. Functional exploration suggested that SNHG6 visibly promoted HCC cell proliferation. Mechanistic analysis demonstrated that SNHG6 acted as a ceRNA to sequester let-7c-5p, thereby derepressing c-Myc from let-7c-5p. Functional miRNAs were reported to regulate target mRNAs both in physiological and pathological processes [18,19]. Previous studies have found multiple targets of let-7c-5p, including nucleosome assembly protein 1 like 1 (NAP1L1), dentin matrix protein-1 (DMP1) and excision repair cross complementing 6 (ERCC6) [20e22]. In the current study, we first identified c-Myc as a direct target of let-7c-5p in HCC using luciferase activity, qRT-PCR and Western blot assays. It is well-known that oncogene c-Myc is a strong transcription factor which is frequently abnormally amplified in human malignances [23]. Accumulating evidences show that c-Myc overexpression play a crucial role in tumorigenesis of HCC as a powerful regulator [24]. Evidences based on multiple studies have confirmed that c-Myc promotes invasion, cell proliferation, tumor growth and metastasis [25]. In this study, we found that let-7c-5p negatively regulated c-Myc expression level, and let-7c-5p might inhibit HCC cell proliferation by modulating c-Myc. Recently, the ceRNA mechanism has been proposed by Tay et al. Under this condition, Most RNA transcripts (mRNAs or lncRNAs) harboring same miRNA-binding sites are capable to communicate and modulate each’s expression through competing for binding to shared miRNAs [26]. Evidence based on many studies has demonstrated that lncRNAs communicate with miRNAs through a ceRNA crosstalk. lncRNA TTN-AS1 promotes epithelial to mesenchymal transition by sponging miR-142-p in lung adenocarcinoma [27]. lncRNA FAM225A promotes nasopharyngeal carcinoma metastasis via acting as ceRNA to sponge miR-590-3p [28]. lncRNA H19 facilitates tumor formation through sequestering miR-20b-5p as a ceRNA [29]. In the present study, we proposed a ceRNA communicating model including SNHG6, let-7c-5p, and c-Myc. SNHG6, sharing a let-7c-5p response element with c-Myc, increased the expression of c-Myc. Dual-luciferase reporter assays reveal that both silencing SNHG6 and let-7c-5p overexpression impaired the luciferase activity of psiCHKE-c-Myc-30 -UTR. Furthermore, Anti-let7c-5p reversed the effect of silencing SNHG6 on psiCHKE-c-Myc-30 UTR luciferase activity. In addition, transfection with SNHG6-WT reversed the decrease in c-Myc expression caused by SNHG6 down-regulation. Taken together, SNHG6, sharing the same let-7c5p-responsive element with c-Myc, promotes HCC progression in a ceRNA dependent manner. In conclusion, upregulation of SNHG6 correlates with HCC progression and predicts poor prognosis especially for patient with
7
advanced HCC. SNHG6 upregulates c-Myc to promote HCC cell proliferation via sequestering let-7c-5p in a ceRNA dependent manner. Conflicts of interest There is no conflict of Interest to be declared. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.09.091. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.09.091. References [1] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA A Cancer J. Clin. 68 (2018) 394e424. [2] Q. Zhou, W. Zhang, Z. Wang, S. Liu, Long non-coding RNA PTTG3P functions as an oncogene by sponging miR-383 and up-regulating CCND1 and PARP2 in hepatocellular carcinoma, BMC Canc. 19 (2019) 731. [3] Y. Yan, Y. Lu, K. Mao, M. Zhang, H. Liu, Q. Zhou, J. Lin, J. Zhang, J. Wang, Z. Xiao, Identification and validation of a prognostic four-genes signature for hepatocellular carcinoma: integrated ceRNA network analysis, Hepatol Int. 13 (5) (2019), https://doi.org/10.1007/s12072-019-09962-3. [4] D. Zhang, C. Cao, L. Liu, D. Wu, Up-regulation of LncRNA SNHG20 predicts poor prognosis in hepatocellular carcinoma, J. Cancer 7 (2016) 608e617. [5] M.C. Jiang, J.J. Ni, W.Y. Cui, B.Y. Wang, W. Zhuo, Emerging roles of lncRNA in cancer and therapeutic opportunities, Am. J. Cancer Res. 9 (2019) 1354e1366. [6] H. Shi, Y. Xu, X. Yi, D. Fang, X. Hou, Current Research Progress on Long Noncoding RNAs Associated with Hepatocellular Carcinoma, 2019, p. 1534607, 2019. [7] D.Y. Zhang, X.J. Zou, C.H. Cao, T. Zhang, L. Lei, X.L. Qi, L. Liu, D.H. Wu, Identification and functional characterization of long non-coding RNA MIR22HG as a tumor suppressor for hepatocellular carcinoma, Theranostics 8 (2018) 3751e3765. [8] G. Qin, X. Tu, H. Li, P. Cao, X. Chen, J. Song, H. Han, Y. Li, B. Guo, L. Yang, P. Yan, P. Li, C. Gao, J. Zhang, Y. Yang, J. Zheng, H.Q. Ju, L. Lu, X. Wang, C. Yu, Y. Sun, B. Xing, H. Ji, D. Lin, F. He, G. Zhou, Long Noncoding RNA P53-Stabilizing and Activating RNA Promotes P53 Signaling by Inhibiting Heterogeneous Nuclear Ribonucleoprotein K deSUMOylation and Suppresses Hepatocellular Carcinoma, 2019. [9] Y.L. Wang, J.Y. Liu, J.E. Yang, X.M. Yu, Z.L. Chen, Y.J. Chen, M. Kuang, Y. Zhu, S.M. Zhuang, Lnc-ucid promotes G1/S transition and hepatoma growth by preventing DHX9-mediated CDK6 Down-regulation 70 (2019) 259e275. [10] L. Chang, Y. Yuan, C. Li, T. Guo, H. Qi, Y. Xiao, X. Dong, Z. Liu, Q. Liu, Upregulation of SNHG6 regulates ZEB1 expression by competitively binding miR101-3p and interacting with UPF1 in hepatocellular carcinoma, Cancer Lett. 383 (2016) 183e194. [11] J.A. Makarova, D.A. Kramerov, Noncoding RNA of U87 host gene is associated with ribosomes and is relatively resistant to nonsense-mediated decay, Gene 363 (2005) 51e60. [12] C. Cao, T. Zhang, D. Zhang, L. Xie, X. Zou, L. Lei, D. Wu, L. Liu, The long noncoding RNA, SNHG6-003, functions as a competing endogenous RNA to promote the progression of hepatocellular carcinoma, Oncogene 36 (2017) 1112e1122. [13] Y. Hosono, Y.S. Niknafs, J.R. Prensner, M.K. Iyer, S.M. Dhanasekaran, R. Mehra, S. Pitchiaya, J. Tien, J. Escara-Wilke, A. Poliakov, S.C. Chu, S. Saleh, K. Sankar, F. Su, S. Guo, Y. Qiao, S.M. Freier, H.H. Bui, X. Cao, R. Malik, T.M. Johnson, D.G. Beer, F.Y. Feng, W. Zhou, A.M. Chinnaiyan, Oncogenic role of THOR, a conserved cancer/testis long non-coding RNA, Cell 171 (2017) 1559e1572, e1520. [14] Y. Zhao, T. Du, L. Du, P. Li, J. Li, W. Duan, Y. Wang, C. Wang, Long Noncoding RNA LINC02418 Regulates MELK Expression by Acting as a ceRNA and May Serve as a Diagnostic Marker for Colorectal Cancer, vol. 10, 2019, p. 568. [15] M. Abbastabar, M. Sarfi, A. Golestani, E. Khalili, lncRNA involvement in
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091
8
S. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[16]
[17]
[18] [19]
[20]
[21]
[22]
hepatocellular carcinoma metastasis and prognosis, Excli J. 17 (2018) 900e913. Y.H. Lin, M.H. Wu, C.T. Yeh, K.H. Lin, Long Non-coding RNAs as Mediators of Tumor Microenvironment and Liver Cancer Cell Communication, vol. 19, 2018. J.K. DiStefano, Long noncoding RNAs in the initiation, progression, and metastasis of hepatocellular carcinoma, Non Coding RNA Res. 2 (2017) 129e136. Y. Zhao, Z. Wang, W. Zhang, MicroRNAs Play an Essential Role in Autophagy Regulation in Various Disease Phenotypes, 2019. A. Tajbakhsh, V. Bianconi, M. Pirro, S.M. Gheibi Hayat, T.P. Johnston, A. Sahebkar, Efferocytosis and atherosclerosis: regulation of phagocyte function by MicroRNAs, Trends Endocrinol. Metab. 30 (9) (2019), https://doi.org/ 10.1016/j.tem.2019.07.006. Y. Huang, B. Xiang, Y. Liu, Y. Wang, H. Kan, LncRNA CDKN2B-AS1 promotes tumor growth and metastasis of human hepatocellular carcinoma by targeting let-7c-5p/NAP1L1 axis, Cancer Lett. 437 (2018) 56e66. H. Yuan, H. Zhang, L. Hong, H. Zhao, J. Wang, H. Li, H. Che, Z. Zhang, MicroRNA let-7c-5p suppressed lipopolysaccharide-induced dental pulp inflammation by inhibiting dentin matrix protein-1-mediated nuclear factor kappa B (NFkappaB) pathway in vitro and in vivo, Med. Sci. Monit. 24 (2018) 6656e6665. X. Fu, X. Mao, Y. Wang, X. Ding, Y. Li, Let-7c-5p inhibits cell proliferation and induces cell apoptosis by targeting ERCC6 in breast cancer, Oncol. Rep. 38 (2017) 1851e1856.
[23] M. Caforio, C. Sorino, S. Iacovelli, M. Fanciulli, F. Locatelli, V. Folgiero, Recent advances in searching c-Myc transcriptional cofactors during tumorigenesis 37 (2018) 239. [24] D.B. Zimonjic, N.C. Popescu, Role of DLC1 tumor suppressor gene and MYC oncogene in pathogenesis of human hepatocellular carcinoma: potential prospects for combined targeted therapeutics (review), Int. J. Oncol. 41 (2012) 393e406. [25] M. Elbadawy, T. Usui, H. Yamawaki, K. Sasaki, Emerging roles of C-myc in cancer stem cell-related signaling and resistance to cancer chemotherapy: a potential therapeutic target against colorectal cancer, Int. J. Mol. Sci. 20 (2019). [26] Y. Tay, J. Rinn, P.P. Pandolfi, The multilayered complexity of ceRNA crosstalk and competition, Nature 505 (2014) 344e352. [27] Y. Jia, Y. Duan, T. Liu, X. Wang, W. Lv, M. Wang, J. Wang, L. Liu, LncRNA TTNAS1 promotes migration, invasion, and epithelial mesenchymal transition of lung adenocarcinoma via sponging miR-142-5p to regulate CDK5 10 (2019) 573. [28] Z.Q. Zheng, Z.X. Li, G.Q. Zhou, L. Lin, L.L. Zhang, J.W. Lv, X.D. Huang, Long Noncoding RNA FAM225A Promotes Nasopharyngeal Carcinoma Tumorigenesis and Metastasis by Acting as ceRNA to Sponge miR-590-3p/miR-1275 and Upregulate ITGB3, 2019. [29] H. Zhu, Y.M. Jin, X.M. Lyu, L.M. Fan, F. Wu, Long Noncoding RNA H19 Regulates HIF-1alpha/AXL Signaling through Inhibiting miR-20b-5p in Endometrial Cancer, 2019, pp. 1e11.
Please cite this article as: S. Chen et al., lncRNA SNHG6 functions as a ceRNA to up-regulate c-Myc expression via sponging let-7c-5p in hepatocellular carcinoma, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.091