- Email: [email protected]
LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway Ting Chen a, 1, Huajiang Lin b, 1, Xun Chen c, 1, Guantong Li b, Yanmian Zhao a, Lina Zheng a, Zhemin Shi a, Kun Zhang a, Wei Hong a, *, Tao Han b, ** a Department of Histology and Embryology, School of Basic Medical Sciences, Tianjin Medical University, Department of Hepatology and Gastroenterology, The Third Central Clinical College of Tianjin Medical University, Tianjin Key Laboratory of Artificial Cells, Artificial Cell Engineering Technology Research Center of Public Health Ministry, Tianjin, China b The Third Central Clinical College of Tianjin Medical University, Department of Hepatology and Gastroenterology, Tianjin Key Laboratory of Artificial Cells, Artificial Cell Engineering Technology Research Center of Public Health Ministry, Tianjin, China c Department of Hepatopancreatobiliary Surgery, The Affiliated Tumor Hospital of Zhengzhou University, Henan Cancer Hospital, Zhengzhou, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 11 October 2019 Accepted 2 November 2019 Available online xxx
Long non-coding RNAs (lncRNAs) play an important role in various physiological and pathological processes. However, the biological role of lncRNA Meg8 in liver fibrosis is largely unknown. In this study, we found that Meg8 was over-expressed in activated hepatic stellate cells (HSCs), injured hepatocytes (HCs) and fibrotic livers. Furthermore, we revealed that Meg8 suppressed the expression of the pro-fibrogenic and proliferation genes in activated HSCs. In addition, silencing Meg8 significantly inhibited the expression of the epithelial markers, while noticeably promoted the expression of the mesenchymal markers in primary HCs and AML12 cells. Mechanistically, we demonstrated that Meg8 suppressed HSCs activation and epithelial-mesenchymal transition (EMT) of HCs through inhibiting the Notch pathway. In conclusion, our findings indicate that Meg8 may serve as a novel protective molecule and a potential therapeutic target of liver fibrosis. © 2019 Elsevier Inc. All rights reserved.
Keywords: Liver fibrosis lncRNA HSCs EMT Notch
1. Introduction Liver fibrosis is a wound healing response to insults and an ultimate common pathway of chronic liver disease caused by viral infections, autoimmune conditions, toxic damage, genetic and metabolic diseases. Progressive liver fibrosis leads to cirrhosis, hepatic encephalopathy, and hepatocellular carcinoma [1]. Therefore, further exploration of the cellular and molecular mechanism of liver fibrosis can contribute to find more effective treatments. Activation of HSCs is considered to be a pivotal driver of fibrosis in experimental and human liver injury [2,3]. In the healthy liver,
* Corresponding author. Department of Histology and Embryology, School of Basic Medical Sciences, Tianjin Medical University, Tianjin, China. ** Corresponding author. Department of Hepatology and Gastroenterology, Tianjin Third Central Hospital, Tianjin, China. E-mail addresses: [email protected] (W. Hong), [email protected] (T. Han). 1 These authors contributed equally to this work.
HSCs distribute in the space of disse, between the sinusoidal endothelium cells and HCs, and reserve retinoid/vitamin A [1]. In fibrotic liver, the HSCs undergo an activation process that manifests as contractility, proliferation, loss of vitamin A storage and pathological production and deposition of extracellular matrix (ECM), including secretion of collagen I and III, high production of alpha smooth muscle actin (a-SMA) and expression of matrix metalloproteinases (MMPs) and their specific tissue inhibitors (TIMPs) [2,4]. Considering the vital role of HSCs during the occurrence and development of liver fibrosis, inhibition of HSCs activation is the major therapeutic target for the treatment of liver fibrosis. EMT describes the global process by which stationary epithelial cells undergo phenotypic changes involving in various types of cellular behavior, including tumor invasion, embryonic development, and organ fibrosis [5]. EMT occurs from epithelial to mesenchymal morphological changes in which epithelial markers including E-cadherin, Zo-1 and Cytokeratin are down-regulated, while the expression of mesenchymal markers are up-regulated, such as Vimentin, Fibronectin and N-cadherin [6]. Emerging
https://doi.org/10.1016/j.bbrc.2019.11.015 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
2
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
evidence also clarifies EMT as a significant source of myofibroblasts in procession lung, kidney and liver fibrosis [5]. Moreover, EMT of HCs in liver fibrosis are getting more and more attention. Hence, it is very meaningful to investigate the complex biological functions and mechanisms of HCs EMT in liver fibrosis. LncRNAs are a group of transcripts that longer than 200 nt with no protein coding capacity [7]. LncRNAs regulate gene expression through kinds of complex molecular mechanisms including chromatin modification, transcriptional regulation, and post transcriptional regulation according to their cellular location [8,9]. It has been reported that lncRNAs serve as a regulators of HSCs activation in liver fibrosis [10e12]. For instance, cholangiocytes-secreted exosomal H19 played a vital role in promoting the activation and proliferation of HSCs, thereby leading to liver fibrosis [13]. LncRNAMEG3 suppressed hepatic fibrosis though inhibiting Hedgehog pathway-mediated EMT process in vitro and in vivo [14]. Our group has recently found that lncRNA SCARNA10 promoted HCs apoptosis and HSCs activation through suppressing the binding of PRC2 to the promoters of target genes involved in TGF-b pathway, thus aggravating liver fibrosis [12]. Previous reports have shown that MEG8 contributed to epigenetic progression of EMT of lung and pancreatic cancer cells, and suppressed the proliferation and migration of both the vascular smooth muscle cell (VSMC) and trophoblast cells [15,16]. In addition, Meg8 resulted in down-regulated expression of a-SMA, Col1a1, Smad2 and Smad3 and formation of myofibroblast, thus alleviating the progression of kidney fibrosis [17]. However, the function and mechanism of Meg8 in liver fibrosis are unclear. This study reports our novel findings that Meg8 was overexpressed in activated HSCs, injured HCs and fibrotic livers. Knockdown of Meg8 promoted HSCs activation and HCs EMT via the Notch signaling, indicating that Meg8 may serve as a new protective molecule and a potential target for therapy of liver fibrosis. 2. Materials and methods 2.1. Cell culture The human HSC line LX-2 cells were obtained from Merck Millipore (Beijing, China). Cells were cultured in DMEM (Invitrogen, Camarillo, USA) supplemented with 10% fetal bovine serum, 100 U/ ml penicillin and 100 mg/ml streptomycin. The non-tumorigenic mouse HCs line AML12 cells were cultured in DMEM supplemented with 10% fetal bovine serum, dexamethasone (40 ng/ml), 1 ITS (Sigma-Aldrich), streptomycin (100 mg/ml) and penicillin (100 U/ml) in a 5% CO2 and 37 C humidified atmosphere.
2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) qPCR analysis was performed as described previously [11]. Primer sequences are listed.
Gene symbol
Sequence 5’ - 30
musGapdh Forword musGapdh Reverse musCol1a1 Forword musCol1a1 Reverse musa-SMA Forword musa-SMA Reverse musMmp2 Forword musMmp2 Reverse musPcna Forword musPcna Reverse musNotch2 Forword musNotch2 Reverse musNotch3 Forword musNotch3 Reverse musMeg8 Forword musMeg8 Reverse musHes1 Forword musHes1 Reverse musE-cadherin Forword musE-cadherin Reverse musN-cadherin Forword musN-cadherin Reverse musVimentin Forword musVimentin Reverse humGAPDH Forword humGAPDH Reverse humCOL1a1 Forword humCOL1a1 Reverse huma-SMA Forword huma-SMA Reverse humMMP2 Forword humMMP2 Reverse humPCNA Forword humPCNA Reverse humNOTCH2 Forword humNOTCH2 Reverse humNOTCH3 Forword humNOTCH3 Reverse humHES1 Forword humHES1 Reverse humMEG8 Forword humMEG8 Reverse humE-Cadherin Forword humE-Cadherin Reverse humN-Cadherin Forword humN-Cadherin Reverse humVimentin Forword humVimentin Reverse
GGCATGGACTGTGGTCATGAG TGCACCACCAACTGCTTAGC ATCGGTCATGCTCTCTCCAAACCA ACTGCAACATGGAGACAGGTCAGA TCGGATACTTCAGCGTCAGGA GTCCCAGACATCAGGGAGTAA GTGTTCTTCGCAGGGAATGAG GATGCTTCCAAACTTCACGCT TTTGAGGCACGCCTGATCC GGAGACGTGAGACGAGTCCAT TGACTGTTCCCTCACTATGG CACGTCTTGCTATTCCTCTG TTGTCTGGATGGAAGCCCATGT ACTGAACTCTGGCAAACGCCT CATCTAGACCCGTAACGCCC CATTCCTCGGGTGTGGAGAC CTCCCGGCATTCCAAGCTAG AGCGGGTCACCTCGTTCATG AACCCAAGCACGTATCAGGG GAGTGTTGGGGGCATCATCA ACAGCGCAGTCTTACCGAAG TGGCTCGCTGCTTTCATAC CTTGAACGGAAAGTGGAATCCT GTCAGGCTTGGAAACGTCC ACCCAGAAGACTGTGGATGG TTCAGCTCAGGGATGACCTT AACCAAGGCTGCAACCTGGA GGCTGAGTAGGGTACACGCAGG GCCATGTTCTATCGGGTACTTC CAGGGCTGTTTTCCCATCCAT GTGTTCTTCGCAGGGAATGAG GATGCTTCCAAACTTCACGCT TCCATCCTCAAGAAGGTGTT GGTAGGTGTCGAAGCCC GGTGAATCTCTGCAGTCGGT ACAATAGGCACCAGCCCATC TTGCAGCGTGACCGAGATAG ACAAGACTGAGAGGGTGGGT CCTCAGCACTTGCTCAGTAGTT ACCGGGGACGAGGAATTTTT CTCTGTGAATCAGGAGAGAAGAGA TTCACCTTGGGGAAATGACCA CATGAGTGTCCCCCGGTATC CAGTATCAGCCGCTTTCAGA TCAGGCTCCAAGCACCCCTTCA ATGACGGCCGTGGCTGTGTT ATTCCACTTTGCGTTCAAGG CTTCAGAGAGAGGAAGCCGA
2.2. Isolation and culture of primary HSCs and HCs
2.5. Western blot analysis
Primary mouse HSCs and HCs were separated by pronase/ collagenase perfusion digestion and density gradient centrifugation, respectively [12].
Immunoblotting analysis was performed as described previously [12]. The primary antibodies involved in this study include COL1a1 (Abcam, ab34710), MMP2 (Abcam, ab92536), PCNA (Cell Signaling Technology, 13110), a-SMA (Abcam, ab5694), E-Cadherin (Cell Signaling Technology 9782), N-Cadherin (Cell Signaling Technology 9782), Vimentin (Cell Signaling Technology 9782), NOTCH2 (Cell Signaling Technology, 5732), NOTCH3 (Abcam, ab23426), HES1 (Abcam, ab71559). GAPDH was used as an internal control.
2.3. Immunofluorescence Immunofluorescence analysis was performed as described previously [18]. The primary antibodies involved in this study include aSMA (1:300, Abcam, ab5694), COL1a1 (1:500, Abcam, ab34710), NCadherin (1:200, Abcam, ab98952), Vimentin (1:200, Abcam, ab8978) and were incubated in PBS away from light with appropriate the fluorescent dye-conjugated secondary antibody (Thermo Fisher Scientific, Alexa Fluor 594) for 1 h at room temperature. The stained cells were observed with a Zeiss confocal microscope LSM700.
2.6. Cells transfection Meg8 siRNAs and negative control (NC) were gained from GenePharma, and the sequences are as follows: siMeg8-1 (mouse),
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
sense 50 -GCUGAUGUAUAGGUUCUAATT-30 and anti-sense 50 -UUAGAACCUAUACAUCAGCTT-30 ; siMeg8-3 (mouse), sense 50 -GCACACUAC- UGUUGAAUUATT-30 and anti-sense 50 -UAAUUCAACAGUAG UGUGCTT-30 ; siMEG8-1 (human), sense 50 -GGAAUAGACGAGAUUGGAUTT-30 and anti-sense 50 -AUCCAAUCUCGUCUAUUCCTT30 ; siMEG8-3 (human), sense 50 -GGUCAUGAGCUCUGUGGUUTT-30 and anti-sense 50 -AACCACAGAGCUCAUGACCTT-30 ; NC (mouse/human), sense 50 -UUCUCCGAACGUGUC- ACGUTT-30 , and anti-sense 50 -ACGUGACACGUUCGGAGAATT-30 . The siMeg8 and NC with Opti-MEM were transfected into cultured cell using Lipofectamine™ RNAiMAX transfection reagent (Invitrogen, USA). 2.7. Statistical analysis All data are represented as the means ± SD. SPSS 13.0 (IBM, Armonk, NY, USA) was used to perform the Student t-test or oneway analysis of variance (more than two groups), a p-value <0.05 was considered statistically significant. 3. Results
3
fibrotic livers induced by CCl4 . As shown in Fig. 1A, Meg8 transcript was significantly up-regulated with persistent liver injury, correlating with Col1a1 and a-SMA, both of which are liver fibrotic marker genes (Fig. 1A). These results were further confirmed in the BDL-induced mice liver fibrosis model (Fig. 1B). Also, we isolated primary HSCs from the healthy livers and subsequently cultured the cells up to 2, 7 and 14 days for activation in vitro [19]. The activated cells were collected to evaluate the expression of Meg8. The RNA level of Meg8, Col1a1 and a-SMA was gradually increased during HSCs activation at day 7 and 14, compared with day 2 (Fig. 1C). Moreover, we isolated primary HSCs and HCs from CCl4-or oiltreated mice and found the expression of Meg8 was significantly over-expressed in both cell types from CCl4-treated mice compared with those from healthy controls, consistent with an enhancement of a-SMA (Fig. 1D) and collagen (Fig. 1E). Additionally, nuclearcytoplasmic fractionation of cells demonstrated that Meg8 was predominantly distributed in the nucleus of LX-2 and AML12 cells, suggesting that Meg8 may function in the nucleus (Fig. 1F). Taken together, our results show that Meg8 is over-expressed in activated HSCs, injured HCs and fibrotic livers, suggesting that Meg8 may get involved in the progression of liver fibrosis.
3.1. Meg8 is over-expressed in activated HSCs, injured HCs and fibrotic livers
3.2. Meg8 silencing promotes the activation of HSCs
To explore whether Meg8 was correlated to the progression of liver fibrosis, we firstly determined the transcript of Meg8 in mice
HSCs activation is mainly characterized by promoting cell proliferation, accumulation and deposition of ECM [1]. To evaluate the
Fig. 1. Meg8 is over-expressed in activated HSCs, injured HCs and fibrotic livers. (A, B) qRT-PCR analysis of Col1a1, a-SMA and Meg8 in livers from mice treated with CCl4 or underwent BDL. (C) The RNA level of a-SMA, Col1a1 and Meg8 was detected in primary HSCs cultured at day 2, 7 and 14 by qRT-PCR. (D, E) Primary HSCs and primary HCs were isolated from livers of Balb/c mice treated for 8 weeks with CCl4 or oil, and the RNA level of Meg8, Col1a1 and a-SMA was determined by qRT-PCR. (F) RNA was extracted from the nuclei or cytoplasm of LX-2 and AML12 cells. A total of 1 mg of RNA was used for the qRT-PCR analysis of Meg8, NEAT1 (nuclear retained), and GAPDH (cytoplasm retained) expression. All data are presented as means ± SD for at least triplicate experiments.*p < 0.05.
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
4
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
function of Meg8 in HSCs, we firstly used three siRNAs specifically targeting Meg8 to knock down its expression. siMeg8-1 and siMeg8-3 showed an efficiency knockdown effect and were applied for the subsequent experiments. As shown in Fig. 2A and B, knockdown of Meg8 significantly promoted the expression of profibrotic and proliferative genes including Col1a1,a-SMA, Mmp2 and Pcna detected by qRT-PCR and Western blot in primary HSCs at day 2. Consistently, immunofluorescent analysis indicated an upregulated expression of COL1a1 and a-SMA in siMeg8 group (Fig. 2C). Since it has recently been reported that the isolated primary HSCs were gradually activated within 14 days [20], we therefore investigated whether Meg8 was involved in the progression of HSCs activation. Silencing Meg8 noticeably upregulated the expression of a-SMA, Col1a1, Mmp2 and Pcna in primary HSCs at day 12 (Fig. 2D and E). In addition, we also confirmed these results in LX-2 cells (Fig. 2F and G). These results indicate that silencing Meg8 promotes the activation of HSCs.
3.3. Knockdown of Meg8 promotes EMT of HCs To investigate whether Meg8 is involved in EMT of HCs in vitro, the expression of E-cadherin, N-cadherin and Vimentin, all of which are EMT markers, were determined in Meg8-silenced
primary HCs and AML12 cells. Knockdown of Meg8 significantly reduced E-cadherin expression (Fig. 3A and B). In contrast, silencing Meg8 remarkably enhanced the expression of N-cadherin and Vimentin in primary HCs (Fig. 3A and B) and similar data were obtained in AML-12 cells (Fig. 3C and D). In addition, immunofluorescent assay also revealed that knockdown of Meg8 promoted EMT of AML12 cells (Fig. 3E). Taken together, our data demonstrate that Meg8 inhibits EMT of HCs.
3.4. Meg8 silencing promotes activation of HSCs and EMT of HCs through the Notch pathway We next sought to examine the potential molecular mechanism by which Meg8 suppresses HSCs activation and HCs EMT. Since the Notch pathway has been reported to be closely related to HSCs activation and HCs EMT of liver fibrosis [11], we firstly examined whether Meg8 regulates the activation of the Notch pathway. We found that Meg8 silencing significantly promoted the expression of Notch2, Notch3 and Hes1 in primary HSCs (Fig. 4A and B), suggesting that Meg8 inactivated the Notch pathway in primary HSCs. These results were also confirmed in LX-2 cells (data not shown). Also, we detected Notch pathway related genes in Meg8-silenced primary HCs and the results showed that the expression of
Fig. 2. Meg8 silencing promotes the activation of HSCs. (A, B) Primary HSCs at day 2 were transfected with siMeg8 or siRNA-control for 48 h. The RNA and protein levels of Meg8, aSMA, Col1a1, Mmp2 and Pcna were detected by qRT-PCR (A) and Western blot (B). GAPDH was used as an internal control. (C) The expression of a-SMA and COL1a1 was detected in primary HSCs at day 2 by confocol microscopy. DAPI-stained nuclei blue; scale bar, 20 mm. The expression of Meg8, a-SMA, Col1a1, Mmp2 and Pcna was detected by qRT-PCR and Western blot in Meg8-silenced primary HSCs at day 12 (D, E) and LX-2 cells (F, G). All data are presented as means ± SD for at least triplicate experiments.*p < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Notch2, Notch3 and Hes1 were also significantly increased (Fig. 4C and D), indicating that Meg8 suppresses the Notch pathway in primary HCs. These results were also confirmed in AML12 cells (results not shown). To further investigate whether Meg8 inhibits HSCs activation and HCs EMT through the Notch pathway, a gsecretase inhibitor RO4929097 was applied to block the Notch signaling in Meg8-silenced LX-2 and AML12 cells [21]. The mRNA and protein level of COL1a1 and a-SMA was up-regulated in MEG8silenced LX-2 cells, while over-expression of a-SMA and COL1a1 by knockdown of MEG8 was abolished by RO4929097 (Fig. 4E and F). Consistently, silencing Meg8 significantly promoted N-cadherin expression in AML12 cells, which could be eliminated through blocking the Notch pathway (Fig. 4G and H), suggesting this signaling mediates the function of Meg8. Taken together, these findings strongly indicate that Meg8 inhibits HSCs activation and HCs EMT via the Notch pathway. 4. Discussion This study reports our novel findings that lncRNA Meg8 was over-expressed in activated HSCs, injured HCs and fibrotic livers.
5
Furthermore, we found that Meg8 silencing promoted HSCs activation and HCs EMT. Mechanistically, we demonstrated that Meg8 inhibited liver fibrosis via suppressing the Notch pathway, suggesting that Meg8 may serve as a new protective molecule and a potential target for therapy of liver fibrosis. Liver fibrosis is a chronic wound healing response to liver damage of any etiology, resulting in an imbalance in the dynamic extracellular matrix remodeling process [22]. However, the molecular basis of liver fibrosis is incompletely understood, which limited the identification of therapeutic targets. Increasing researches have confirmed that dysfunction of lncRNAs are closely related to liver fibrosis [11,12,23]. In our study, we demonstrated that lncRNA-Meg8 was over-expressed in activated HSCs, injured HCs and fibrotic livers. Further investigation found that silencing Meg8 significantly promoted expression of a-SMA, Col1a1, MMP2 and PCNA in quiescent primary HSCs, activated primary HSCs and LX-2 cells. Consistent with the previous reports that knockdown of Meg8 resulted in increased expression of a-SMA, Col1a1, Smad2 and Smad3, and myofibroblast formation in kidney fibrosis [17]. However, the expression and function of Meg8 in liver fibrosis seem to be inconsistent, and the possible reason is that Meg8 is a
Fig. 3. Knockdown of Meg8 promotes EMT of HCs. (A, B) Primary HCs were transfected with siMeg8 or siRNA-control for 48 h. The expression of Meg8, E-cadherin, N-cadherin and Vimentin was detected by qRT-PCR (A) and Western blot (B). GAPDH was used as an internal control. (C, D) AML12 cells were transfected with siMeg8 or siRNA-control for 48 h. The expression of Meg8, E-cadherin, N-cadherin and Vimentin was detected by qRT-PCR (C) and Western blot (D). (E) The expression of N-Cadherin and Vimentin was detected in AML12 cells by confocal microscopy. DAPI-stained nuclei blue; scale bar, 20 mm. GAPDH was used as an internal control. All data are presented as means ± SD for at least triplicate experiments. *p < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
6
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
protective molecule and compensatory increased to resist continuous damage during liver fibrosis, which is consistent with other reports [24,25]. For instance, chemokine Cxcl9 expression was significantly up-regulated in CCl4-induced mice liver fibrosis model, while Cxcl9 strongly attenuated neoangiogenesis and experimental liver fibrosis [24]. It has also been reported that the expression of Malat1 was over-expressed in breast cancer, but forced Malat1 restrained breast cancer metastasis in transgenic, xenograft, and syngeneic models [25]. Taken together, Meg8 is over-expressed in activated HSCs, injured HCs and fibrotic liver tissues, and silencing Meg8 promotes the activation of HSCs, making this molecule as an essential mediator to reverse hepatic fibrosis and a candidate for novel therapeutic strategies. EMT has appeared as a contributor to liver fibrosis, while EMT of HCs in liver fibrosis is controversial. Taura et al. reported that HCs did not obtain the expression of mesenchymal marker, nor exhibit a morphological changes that were significantly different with normal HCs in vivo [26]. Nevertheless, Zeisberg, Kaimori et al. and several groups demonstrated that primary HCs and AML12 cells were capable of EMT genotypic and phenotypic changes and type I collagen synthesis [27,28]. Moreover, Terashima et al. found that
MEG8 expression was immediately increased during TGF-b induced EMT of lung cancer and Panc1 pancreatic cancer cell lines [29]. In our study, we also investigated whether Meg8 was involved in the EMT progression of HCs. Firstly, we found that the expression of Meg8 was increased in primary HCs of CCl4 treated mice, prompting that Meg8 plays an important role in HCs. Furthermore, we found that silencing Meg8 evidently decreased E-cadherin expression, while the expression of N-cadherin and Vimentin were obviously enhanced in primary HCs and AML12 cells, suggesting that Meg8 silencing induces EMT of HCs in vitro. Notch signaling is involved in regulating cell differentiation, survival and apoptosis and plays a part in HSCs activiation and the procession of EMT [30]. For instance, the Notch signaling was activated in CCl4 induced liver fibrosis, and blocking Notch signaling can observably alleviate liver fibrosis [31]. Moreover, we have previously shown lnc-LFAR1 silencing evidently inactivated the TGF-b/Smad signal and Notch pathways in primary HSCs and HCs, suppressing CCl4-and BDL-induced mice liver fibrosis in vivo and in vitro [11]. In our study, we have identified that Meg8 inhibited activation of HSCs and EMT of HCs. Therefore, we supposed whether Meg8 regulated HSCs activation and HCs EMT via
Fig. 4. Meg8 silencing promotes activation of HSCs and EMT of HCs through Notch pathway. The cells were transfected with siMeg8 or siRNA-control for 48 h. (A, B) The expression of Meg8, Notch2, Notch3 and Hes1 was detected in primary HSCs by qRT-PCR (A) and Western blot (B). The RNA and protein levels of Meg8, Notch2, Notch3 and Hes1 were detected by qRT-PCR and Western blot in Meg8-silenced primary HCs, GAPDH was used as an internal control (C, D). AML12 and LX-2 cells were respectively transfected with siMeg8 or siRNA-control for 48 h and further treated with 10 ng/ml RO4929097 for additional 24 h. The siRNA-control transfected cells were treated with the same volume diluted with dimethyl sulfoxide (DMSO). (E, F) The expression of HES1, a-SMA and COL1a1 was detected by qRT-PCR (E) and Western blot (F) in LX-2 cells. (G, H) The expression of Hes1 and Ncadherin was detected by qRT-PCR (G) and Western blot (H) in AML12 cells. GAPDH was used as an internal control. All data are presented as means ± SD for at least triplicate experiments. *p < 0.05, stands for vs siRNA-Control þ DMSO. #p < 0.05 stands for siRNA-Control þ RO4929097.
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
the Notch pathway. Our data have revealed that Meg8 silencing significantly promoted Notch2, Notch3 and Hes1 expression in primary HSCs, HCs and corresponding cell lines. Moreover, when we transfected with siMeg8 and followed by RO4929097 treatment, we found that blocking the Notch pathway abolished Meg8 silencing induced up-regulation of both the pro-fibrotic and the mesenchymal marker genes, indicating that Meg8 inhibited HSCs activation and HCs EMT through suppressing the Notch pathway at the transcription level. In addition, it has been reported that lncRNAs were involved in complicatly pathophysiological processes at epigenetic, transcriptional or posttranscriptional level to modulate target genes expression depending on their cellular location [8]. Hence, if lncRNAs are located in the nucleus, they may regluate the expression of related genes at the transcriptional level. In the current study, Meg8 was predominantly distributed in the nucleus of LX-2 and AML12 cells (Fig. 1F), revealing that Meg8 regulated the expression of target genes at the transcriptional level, which was consistent with the way that Meg8 regulated the Notch pathway. In conclusion, our results identified that Meg8 attenuates liver fibrosis by suppressing HSCs activation and HCs EMT and serves as a novel regulator of Notch signaling, thus providing novel insight into the molecular mechanisms of liver fibrosis. Declaration of competing interest The authors declare no conflicts of interest. Acknowledgement This work was supported by the National Natural Science Foundation of China (No 81870429; 81670558; 81800542; 81971331), the Natural Science Foundation of Tianjin (grant numbers 18JCQNJC81500; 18JCZDJC99000 and 19JCZDJC36700), and the National 13th 5-year Plan for Hepatitis Research (No.2017ZX10203201-007). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.11.015. References [1] S.D. Kamdem, R. Moyou-Somo, F. Brombacher, et al., Host regulators of liver fibrosis during human schistosomiasis, Front. Immunol. 9 (2018) 2781. [2] S.C. Yanguas, B. Cogliati, J. Willebrords, et al., Experimental models of liver fibrosis, Arch. Toxicol. 90 (2016) 1025e1048. [3] T. Tsuchida, S.L. Friedman, Mechanisms of hepatic stellate cell activation, Nat. Rev. Gastroenterol. Hepatol. 14 (2017) 397e411. [4] S.L. Friedman, Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver, Physiol. Rev. 88 (2008) 125e172. [5] R.C. Stone, I. Pastar, N. Ojeh, et al., Epithelial-mesenchymal transition in tissue repair and fibrosis, Cell Tissue Res. 365 (2016) 495e506. [6] N. Shrestha, L. Chand, M.K. Han, et al., Glutamine inhibits CCl4 induced liver fibrosis in mice and TGF-beta1 mediated epithelial-mesenchymal transition in mouse hepatocytes, Food Chem. Toxicol. 93 (2016) 129e137.
7
[7] X. Yang, B. Yao, Y. Niu, et al., Hypoxia-induced lncRNA EIF3J-AS1 accelerates hepatocellular carcinoma progression via targeting miR-122-5p/CTNND2 axis, Biochem. Biophys. Res. Commun. 518 (2019) 239e245. [8] K. Zhang, Z.M. Shi, Y.N. Chang, et al., The ways of action of long non-coding RNAs in cytoplasm and nucleus, Gene 547 (2014) 1e9. [9] F. Kopp, J.T. Mendell, Functional classification and experimental dissection of long noncoding RNAs, Cell 172 (2018) 393e407. [10] E.B. Bian, Z.G. Xiong, J. Li, New advances of lncRNAs in liver fibrosis, with specific focus on lncRNA-miRNA interactions, J. Cell. Physiol. 234 (2019) 2194e2203. [11] K. Zhang, X. Han, Z. Zhang, et al., The liver-enriched lnc-LFAR1 promotes liver fibrosis by activating TGFbeta and Notch pathways, Nat. Commun. 8 (2017) 144. [12] K. Zhang, Y. Han, Z. Hu, et al., SCARNA10, a nuclear-retained long non-coding RNA, promotes liver fibrosis and serves as a potential biomarker, Theranostics 9 (2019) 3622e3638. [13] X. Li, R. Liu, Z. Huang, et al., Cholangiocyte-derived exosomal long noncoding RNA H19 promotes cholestatic liver injury in mouse and humans, Hepatology 68 (2018) 599e615. [14] F. Yu, W. Geng, P. Dong, et al., LncRNA-MEG3 inhibits activation of hepatic stellate cells through SMO protein and miR-212, Cell Death Dis. 9 (2018) 1014. [15] B. Zhang, Y. Dong, Z. Zhao, LncRNA MEG8 regulates vascular smooth muscle cell proliferation, migration and apoptosis by targeting PPARalpha, Biochem. Biophys. Res. Commun. 510 (2019) 171e176. [16] F. Sheng, N. Sun, Y. Ji, et al., Aberrant expression of imprinted lncRNA MEG8 causes trophoblast dysfunction and abortion, J. Cell. Biochem. 120 (2019) 17378e17390. [17] R. Bijkerk, Y.W. Au, W. Stam, et al., Long non-coding RNAs Rian and Miat mediate myofibroblast formation in kidney fibrosis, Front. Pharmacol. 10 (2019) 215. [18] J. Wang, Y. Hong, S. Shao, et al., FFAR1-and FFAR4-dependent activation of Hippo pathway mediates DHA-induced apoptosis of androgen-independent prostate cancer cells, Biochem. Biophys. Res. Commun. 506 (2018) 590e596. [19] A. Geerts, History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells, Semin. Liver Dis. 21 (2001) 311e335. [20] I. Mederacke, D.H. Dapito, S. Affo, et al., High-yield and high-purity isolation of hepatic stellate cells from normal and fibrotic mouse livers, Nat. Protoc. 10 (2015) 305e315. [21] L. Luistro, W. He, M. Smith, et al., Preclinical profile of a potent gammasecretase inhibitor targeting notch signaling with in vivo efficacy and pharmacodynamic properties, Cancer Res. 69 (2009) 7672e7680. [22] S.S. Choi, A.M. Diehl, Epithelial-to-mesenchymal transitions in the liver, Hepatology 50 (2009) 2007e2013. [23] Z. Yang, S. Jiang, J. Shang, et al., LncRNA: shedding light on mechanisms and opportunities in fibrosis and aging, Ageing Res. Rev. 52 (2019) 17e31. [24] H. Sahin, E. Borkham-Kamphorst, C. Kuppe, et al., Chemokine Cxcl9 attenuates liver fibrosis-associated angiogenesis in mice, Hepatology 55 (2012) 1610e1619. [25] J. Kim, H.L. Piao, B.J. Kim, et al., Long noncoding RNA MALAT1 suppresses breast cancer metastasis, Nat. Genet. 50 (2018) 1705e1715. [26] K. Taura, K. Miura, K. Iwaisako, et al., Hepatocytes do not undergo epithelialmesenchymal transition in liver fibrosis in mice, Hepatology 51 (2010) 1027e1036. [27] M. Zeisberg, C. Yang, M. Martino, et al., Fibroblasts derive from hepatocytes in liver fibrosis via epithelial to mesenchymal transition, J. Biol. Chem. 282 (2007) 23337e23347. [28] A. Kaimori, J. Potter, J.Y. Kaimori, et al., Transforming growth factor-beta1 induces an epithelial-to-mesenchymal transition state in mouse hepatocytes in vitro, J. Biol. Chem. 282 (2007) 22089e22101. [29] M. Terashima, A. Ishimura, S. Wanna-Udom, et al., MEG8 long noncoding RNA contributes to epigenetic progression of the epithelial-mesenchymal transition of lung and pancreatic cancer cells, J. Biol. Chem. 293 (2018) 18016e18030. [30] D. Henrique, F. Schweisguth, Mechanisms of Notch Signaling: a Simple Logic Deployed in Time and Space, Development vol. 146 (2019). [31] Y. Chen, S. Zheng, D. Qi, et al., Inhibition of Notch signaling by a gammasecretase inhibitor attenuates hepatic fibrosis in rats, PLoS One 7 (2012), e46512.
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway Ting Chen a, 1, Huajiang Lin b, 1, Xun Chen c, 1, Guantong Li b, Yanmian Zhao a, Lina Zheng a, Zhemin Shi a, Kun Zhang a, Wei Hong a, *, Tao Han b, ** a Department of Histology and Embryology, School of Basic Medical Sciences, Tianjin Medical University, Department of Hepatology and Gastroenterology, The Third Central Clinical College of Tianjin Medical University, Tianjin Key Laboratory of Artificial Cells, Artificial Cell Engineering Technology Research Center of Public Health Ministry, Tianjin, China b The Third Central Clinical College of Tianjin Medical University, Department of Hepatology and Gastroenterology, Tianjin Key Laboratory of Artificial Cells, Artificial Cell Engineering Technology Research Center of Public Health Ministry, Tianjin, China c Department of Hepatopancreatobiliary Surgery, The Affiliated Tumor Hospital of Zhengzhou University, Henan Cancer Hospital, Zhengzhou, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 11 October 2019 Accepted 2 November 2019 Available online xxx
Long non-coding RNAs (lncRNAs) play an important role in various physiological and pathological processes. However, the biological role of lncRNA Meg8 in liver fibrosis is largely unknown. In this study, we found that Meg8 was over-expressed in activated hepatic stellate cells (HSCs), injured hepatocytes (HCs) and fibrotic livers. Furthermore, we revealed that Meg8 suppressed the expression of the pro-fibrogenic and proliferation genes in activated HSCs. In addition, silencing Meg8 significantly inhibited the expression of the epithelial markers, while noticeably promoted the expression of the mesenchymal markers in primary HCs and AML12 cells. Mechanistically, we demonstrated that Meg8 suppressed HSCs activation and epithelial-mesenchymal transition (EMT) of HCs through inhibiting the Notch pathway. In conclusion, our findings indicate that Meg8 may serve as a novel protective molecule and a potential therapeutic target of liver fibrosis. © 2019 Elsevier Inc. All rights reserved.
Keywords: Liver fibrosis lncRNA HSCs EMT Notch
1. Introduction Liver fibrosis is a wound healing response to insults and an ultimate common pathway of chronic liver disease caused by viral infections, autoimmune conditions, toxic damage, genetic and metabolic diseases. Progressive liver fibrosis leads to cirrhosis, hepatic encephalopathy, and hepatocellular carcinoma [1]. Therefore, further exploration of the cellular and molecular mechanism of liver fibrosis can contribute to find more effective treatments. Activation of HSCs is considered to be a pivotal driver of fibrosis in experimental and human liver injury [2,3]. In the healthy liver,
* Corresponding author. Department of Histology and Embryology, School of Basic Medical Sciences, Tianjin Medical University, Tianjin, China. ** Corresponding author. Department of Hepatology and Gastroenterology, Tianjin Third Central Hospital, Tianjin, China. E-mail addresses: [email protected] (W. Hong), [email protected] (T. Han). 1 These authors contributed equally to this work.
HSCs distribute in the space of disse, between the sinusoidal endothelium cells and HCs, and reserve retinoid/vitamin A [1]. In fibrotic liver, the HSCs undergo an activation process that manifests as contractility, proliferation, loss of vitamin A storage and pathological production and deposition of extracellular matrix (ECM), including secretion of collagen I and III, high production of alpha smooth muscle actin (a-SMA) and expression of matrix metalloproteinases (MMPs) and their specific tissue inhibitors (TIMPs) [2,4]. Considering the vital role of HSCs during the occurrence and development of liver fibrosis, inhibition of HSCs activation is the major therapeutic target for the treatment of liver fibrosis. EMT describes the global process by which stationary epithelial cells undergo phenotypic changes involving in various types of cellular behavior, including tumor invasion, embryonic development, and organ fibrosis [5]. EMT occurs from epithelial to mesenchymal morphological changes in which epithelial markers including E-cadherin, Zo-1 and Cytokeratin are down-regulated, while the expression of mesenchymal markers are up-regulated, such as Vimentin, Fibronectin and N-cadherin [6]. Emerging
https://doi.org/10.1016/j.bbrc.2019.11.015 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
2
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
evidence also clarifies EMT as a significant source of myofibroblasts in procession lung, kidney and liver fibrosis [5]. Moreover, EMT of HCs in liver fibrosis are getting more and more attention. Hence, it is very meaningful to investigate the complex biological functions and mechanisms of HCs EMT in liver fibrosis. LncRNAs are a group of transcripts that longer than 200 nt with no protein coding capacity [7]. LncRNAs regulate gene expression through kinds of complex molecular mechanisms including chromatin modification, transcriptional regulation, and post transcriptional regulation according to their cellular location [8,9]. It has been reported that lncRNAs serve as a regulators of HSCs activation in liver fibrosis [10e12]. For instance, cholangiocytes-secreted exosomal H19 played a vital role in promoting the activation and proliferation of HSCs, thereby leading to liver fibrosis [13]. LncRNAMEG3 suppressed hepatic fibrosis though inhibiting Hedgehog pathway-mediated EMT process in vitro and in vivo [14]. Our group has recently found that lncRNA SCARNA10 promoted HCs apoptosis and HSCs activation through suppressing the binding of PRC2 to the promoters of target genes involved in TGF-b pathway, thus aggravating liver fibrosis [12]. Previous reports have shown that MEG8 contributed to epigenetic progression of EMT of lung and pancreatic cancer cells, and suppressed the proliferation and migration of both the vascular smooth muscle cell (VSMC) and trophoblast cells [15,16]. In addition, Meg8 resulted in down-regulated expression of a-SMA, Col1a1, Smad2 and Smad3 and formation of myofibroblast, thus alleviating the progression of kidney fibrosis [17]. However, the function and mechanism of Meg8 in liver fibrosis are unclear. This study reports our novel findings that Meg8 was overexpressed in activated HSCs, injured HCs and fibrotic livers. Knockdown of Meg8 promoted HSCs activation and HCs EMT via the Notch signaling, indicating that Meg8 may serve as a new protective molecule and a potential target for therapy of liver fibrosis. 2. Materials and methods 2.1. Cell culture The human HSC line LX-2 cells were obtained from Merck Millipore (Beijing, China). Cells were cultured in DMEM (Invitrogen, Camarillo, USA) supplemented with 10% fetal bovine serum, 100 U/ ml penicillin and 100 mg/ml streptomycin. The non-tumorigenic mouse HCs line AML12 cells were cultured in DMEM supplemented with 10% fetal bovine serum, dexamethasone (40 ng/ml), 1 ITS (Sigma-Aldrich), streptomycin (100 mg/ml) and penicillin (100 U/ml) in a 5% CO2 and 37 C humidified atmosphere.
2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) qPCR analysis was performed as described previously [11]. Primer sequences are listed.
Gene symbol
Sequence 5’ - 30
musGapdh Forword musGapdh Reverse musCol1a1 Forword musCol1a1 Reverse musa-SMA Forword musa-SMA Reverse musMmp2 Forword musMmp2 Reverse musPcna Forword musPcna Reverse musNotch2 Forword musNotch2 Reverse musNotch3 Forword musNotch3 Reverse musMeg8 Forword musMeg8 Reverse musHes1 Forword musHes1 Reverse musE-cadherin Forword musE-cadherin Reverse musN-cadherin Forword musN-cadherin Reverse musVimentin Forword musVimentin Reverse humGAPDH Forword humGAPDH Reverse humCOL1a1 Forword humCOL1a1 Reverse huma-SMA Forword huma-SMA Reverse humMMP2 Forword humMMP2 Reverse humPCNA Forword humPCNA Reverse humNOTCH2 Forword humNOTCH2 Reverse humNOTCH3 Forword humNOTCH3 Reverse humHES1 Forword humHES1 Reverse humMEG8 Forword humMEG8 Reverse humE-Cadherin Forword humE-Cadherin Reverse humN-Cadherin Forword humN-Cadherin Reverse humVimentin Forword humVimentin Reverse
GGCATGGACTGTGGTCATGAG TGCACCACCAACTGCTTAGC ATCGGTCATGCTCTCTCCAAACCA ACTGCAACATGGAGACAGGTCAGA TCGGATACTTCAGCGTCAGGA GTCCCAGACATCAGGGAGTAA GTGTTCTTCGCAGGGAATGAG GATGCTTCCAAACTTCACGCT TTTGAGGCACGCCTGATCC GGAGACGTGAGACGAGTCCAT TGACTGTTCCCTCACTATGG CACGTCTTGCTATTCCTCTG TTGTCTGGATGGAAGCCCATGT ACTGAACTCTGGCAAACGCCT CATCTAGACCCGTAACGCCC CATTCCTCGGGTGTGGAGAC CTCCCGGCATTCCAAGCTAG AGCGGGTCACCTCGTTCATG AACCCAAGCACGTATCAGGG GAGTGTTGGGGGCATCATCA ACAGCGCAGTCTTACCGAAG TGGCTCGCTGCTTTCATAC CTTGAACGGAAAGTGGAATCCT GTCAGGCTTGGAAACGTCC ACCCAGAAGACTGTGGATGG TTCAGCTCAGGGATGACCTT AACCAAGGCTGCAACCTGGA GGCTGAGTAGGGTACACGCAGG GCCATGTTCTATCGGGTACTTC CAGGGCTGTTTTCCCATCCAT GTGTTCTTCGCAGGGAATGAG GATGCTTCCAAACTTCACGCT TCCATCCTCAAGAAGGTGTT GGTAGGTGTCGAAGCCC GGTGAATCTCTGCAGTCGGT ACAATAGGCACCAGCCCATC TTGCAGCGTGACCGAGATAG ACAAGACTGAGAGGGTGGGT CCTCAGCACTTGCTCAGTAGTT ACCGGGGACGAGGAATTTTT CTCTGTGAATCAGGAGAGAAGAGA TTCACCTTGGGGAAATGACCA CATGAGTGTCCCCCGGTATC CAGTATCAGCCGCTTTCAGA TCAGGCTCCAAGCACCCCTTCA ATGACGGCCGTGGCTGTGTT ATTCCACTTTGCGTTCAAGG CTTCAGAGAGAGGAAGCCGA
2.2. Isolation and culture of primary HSCs and HCs
2.5. Western blot analysis
Primary mouse HSCs and HCs were separated by pronase/ collagenase perfusion digestion and density gradient centrifugation, respectively [12].
Immunoblotting analysis was performed as described previously [12]. The primary antibodies involved in this study include COL1a1 (Abcam, ab34710), MMP2 (Abcam, ab92536), PCNA (Cell Signaling Technology, 13110), a-SMA (Abcam, ab5694), E-Cadherin (Cell Signaling Technology 9782), N-Cadherin (Cell Signaling Technology 9782), Vimentin (Cell Signaling Technology 9782), NOTCH2 (Cell Signaling Technology, 5732), NOTCH3 (Abcam, ab23426), HES1 (Abcam, ab71559). GAPDH was used as an internal control.
2.3. Immunofluorescence Immunofluorescence analysis was performed as described previously [18]. The primary antibodies involved in this study include aSMA (1:300, Abcam, ab5694), COL1a1 (1:500, Abcam, ab34710), NCadherin (1:200, Abcam, ab98952), Vimentin (1:200, Abcam, ab8978) and were incubated in PBS away from light with appropriate the fluorescent dye-conjugated secondary antibody (Thermo Fisher Scientific, Alexa Fluor 594) for 1 h at room temperature. The stained cells were observed with a Zeiss confocal microscope LSM700.
2.6. Cells transfection Meg8 siRNAs and negative control (NC) were gained from GenePharma, and the sequences are as follows: siMeg8-1 (mouse),
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
sense 50 -GCUGAUGUAUAGGUUCUAATT-30 and anti-sense 50 -UUAGAACCUAUACAUCAGCTT-30 ; siMeg8-3 (mouse), sense 50 -GCACACUAC- UGUUGAAUUATT-30 and anti-sense 50 -UAAUUCAACAGUAG UGUGCTT-30 ; siMEG8-1 (human), sense 50 -GGAAUAGACGAGAUUGGAUTT-30 and anti-sense 50 -AUCCAAUCUCGUCUAUUCCTT30 ; siMEG8-3 (human), sense 50 -GGUCAUGAGCUCUGUGGUUTT-30 and anti-sense 50 -AACCACAGAGCUCAUGACCTT-30 ; NC (mouse/human), sense 50 -UUCUCCGAACGUGUC- ACGUTT-30 , and anti-sense 50 -ACGUGACACGUUCGGAGAATT-30 . The siMeg8 and NC with Opti-MEM were transfected into cultured cell using Lipofectamine™ RNAiMAX transfection reagent (Invitrogen, USA). 2.7. Statistical analysis All data are represented as the means ± SD. SPSS 13.0 (IBM, Armonk, NY, USA) was used to perform the Student t-test or oneway analysis of variance (more than two groups), a p-value <0.05 was considered statistically significant. 3. Results
3
fibrotic livers induced by CCl4 . As shown in Fig. 1A, Meg8 transcript was significantly up-regulated with persistent liver injury, correlating with Col1a1 and a-SMA, both of which are liver fibrotic marker genes (Fig. 1A). These results were further confirmed in the BDL-induced mice liver fibrosis model (Fig. 1B). Also, we isolated primary HSCs from the healthy livers and subsequently cultured the cells up to 2, 7 and 14 days for activation in vitro [19]. The activated cells were collected to evaluate the expression of Meg8. The RNA level of Meg8, Col1a1 and a-SMA was gradually increased during HSCs activation at day 7 and 14, compared with day 2 (Fig. 1C). Moreover, we isolated primary HSCs and HCs from CCl4-or oiltreated mice and found the expression of Meg8 was significantly over-expressed in both cell types from CCl4-treated mice compared with those from healthy controls, consistent with an enhancement of a-SMA (Fig. 1D) and collagen (Fig. 1E). Additionally, nuclearcytoplasmic fractionation of cells demonstrated that Meg8 was predominantly distributed in the nucleus of LX-2 and AML12 cells, suggesting that Meg8 may function in the nucleus (Fig. 1F). Taken together, our results show that Meg8 is over-expressed in activated HSCs, injured HCs and fibrotic livers, suggesting that Meg8 may get involved in the progression of liver fibrosis.
3.1. Meg8 is over-expressed in activated HSCs, injured HCs and fibrotic livers
3.2. Meg8 silencing promotes the activation of HSCs
To explore whether Meg8 was correlated to the progression of liver fibrosis, we firstly determined the transcript of Meg8 in mice
HSCs activation is mainly characterized by promoting cell proliferation, accumulation and deposition of ECM [1]. To evaluate the
Fig. 1. Meg8 is over-expressed in activated HSCs, injured HCs and fibrotic livers. (A, B) qRT-PCR analysis of Col1a1, a-SMA and Meg8 in livers from mice treated with CCl4 or underwent BDL. (C) The RNA level of a-SMA, Col1a1 and Meg8 was detected in primary HSCs cultured at day 2, 7 and 14 by qRT-PCR. (D, E) Primary HSCs and primary HCs were isolated from livers of Balb/c mice treated for 8 weeks with CCl4 or oil, and the RNA level of Meg8, Col1a1 and a-SMA was determined by qRT-PCR. (F) RNA was extracted from the nuclei or cytoplasm of LX-2 and AML12 cells. A total of 1 mg of RNA was used for the qRT-PCR analysis of Meg8, NEAT1 (nuclear retained), and GAPDH (cytoplasm retained) expression. All data are presented as means ± SD for at least triplicate experiments.*p < 0.05.
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
4
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
function of Meg8 in HSCs, we firstly used three siRNAs specifically targeting Meg8 to knock down its expression. siMeg8-1 and siMeg8-3 showed an efficiency knockdown effect and were applied for the subsequent experiments. As shown in Fig. 2A and B, knockdown of Meg8 significantly promoted the expression of profibrotic and proliferative genes including Col1a1,a-SMA, Mmp2 and Pcna detected by qRT-PCR and Western blot in primary HSCs at day 2. Consistently, immunofluorescent analysis indicated an upregulated expression of COL1a1 and a-SMA in siMeg8 group (Fig. 2C). Since it has recently been reported that the isolated primary HSCs were gradually activated within 14 days [20], we therefore investigated whether Meg8 was involved in the progression of HSCs activation. Silencing Meg8 noticeably upregulated the expression of a-SMA, Col1a1, Mmp2 and Pcna in primary HSCs at day 12 (Fig. 2D and E). In addition, we also confirmed these results in LX-2 cells (Fig. 2F and G). These results indicate that silencing Meg8 promotes the activation of HSCs.
3.3. Knockdown of Meg8 promotes EMT of HCs To investigate whether Meg8 is involved in EMT of HCs in vitro, the expression of E-cadherin, N-cadherin and Vimentin, all of which are EMT markers, were determined in Meg8-silenced
primary HCs and AML12 cells. Knockdown of Meg8 significantly reduced E-cadherin expression (Fig. 3A and B). In contrast, silencing Meg8 remarkably enhanced the expression of N-cadherin and Vimentin in primary HCs (Fig. 3A and B) and similar data were obtained in AML-12 cells (Fig. 3C and D). In addition, immunofluorescent assay also revealed that knockdown of Meg8 promoted EMT of AML12 cells (Fig. 3E). Taken together, our data demonstrate that Meg8 inhibits EMT of HCs.
3.4. Meg8 silencing promotes activation of HSCs and EMT of HCs through the Notch pathway We next sought to examine the potential molecular mechanism by which Meg8 suppresses HSCs activation and HCs EMT. Since the Notch pathway has been reported to be closely related to HSCs activation and HCs EMT of liver fibrosis [11], we firstly examined whether Meg8 regulates the activation of the Notch pathway. We found that Meg8 silencing significantly promoted the expression of Notch2, Notch3 and Hes1 in primary HSCs (Fig. 4A and B), suggesting that Meg8 inactivated the Notch pathway in primary HSCs. These results were also confirmed in LX-2 cells (data not shown). Also, we detected Notch pathway related genes in Meg8-silenced primary HCs and the results showed that the expression of
Fig. 2. Meg8 silencing promotes the activation of HSCs. (A, B) Primary HSCs at day 2 were transfected with siMeg8 or siRNA-control for 48 h. The RNA and protein levels of Meg8, aSMA, Col1a1, Mmp2 and Pcna were detected by qRT-PCR (A) and Western blot (B). GAPDH was used as an internal control. (C) The expression of a-SMA and COL1a1 was detected in primary HSCs at day 2 by confocol microscopy. DAPI-stained nuclei blue; scale bar, 20 mm. The expression of Meg8, a-SMA, Col1a1, Mmp2 and Pcna was detected by qRT-PCR and Western blot in Meg8-silenced primary HSCs at day 12 (D, E) and LX-2 cells (F, G). All data are presented as means ± SD for at least triplicate experiments.*p < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Notch2, Notch3 and Hes1 were also significantly increased (Fig. 4C and D), indicating that Meg8 suppresses the Notch pathway in primary HCs. These results were also confirmed in AML12 cells (results not shown). To further investigate whether Meg8 inhibits HSCs activation and HCs EMT through the Notch pathway, a gsecretase inhibitor RO4929097 was applied to block the Notch signaling in Meg8-silenced LX-2 and AML12 cells [21]. The mRNA and protein level of COL1a1 and a-SMA was up-regulated in MEG8silenced LX-2 cells, while over-expression of a-SMA and COL1a1 by knockdown of MEG8 was abolished by RO4929097 (Fig. 4E and F). Consistently, silencing Meg8 significantly promoted N-cadherin expression in AML12 cells, which could be eliminated through blocking the Notch pathway (Fig. 4G and H), suggesting this signaling mediates the function of Meg8. Taken together, these findings strongly indicate that Meg8 inhibits HSCs activation and HCs EMT via the Notch pathway. 4. Discussion This study reports our novel findings that lncRNA Meg8 was over-expressed in activated HSCs, injured HCs and fibrotic livers.
5
Furthermore, we found that Meg8 silencing promoted HSCs activation and HCs EMT. Mechanistically, we demonstrated that Meg8 inhibited liver fibrosis via suppressing the Notch pathway, suggesting that Meg8 may serve as a new protective molecule and a potential target for therapy of liver fibrosis. Liver fibrosis is a chronic wound healing response to liver damage of any etiology, resulting in an imbalance in the dynamic extracellular matrix remodeling process [22]. However, the molecular basis of liver fibrosis is incompletely understood, which limited the identification of therapeutic targets. Increasing researches have confirmed that dysfunction of lncRNAs are closely related to liver fibrosis [11,12,23]. In our study, we demonstrated that lncRNA-Meg8 was over-expressed in activated HSCs, injured HCs and fibrotic livers. Further investigation found that silencing Meg8 significantly promoted expression of a-SMA, Col1a1, MMP2 and PCNA in quiescent primary HSCs, activated primary HSCs and LX-2 cells. Consistent with the previous reports that knockdown of Meg8 resulted in increased expression of a-SMA, Col1a1, Smad2 and Smad3, and myofibroblast formation in kidney fibrosis [17]. However, the expression and function of Meg8 in liver fibrosis seem to be inconsistent, and the possible reason is that Meg8 is a
Fig. 3. Knockdown of Meg8 promotes EMT of HCs. (A, B) Primary HCs were transfected with siMeg8 or siRNA-control for 48 h. The expression of Meg8, E-cadherin, N-cadherin and Vimentin was detected by qRT-PCR (A) and Western blot (B). GAPDH was used as an internal control. (C, D) AML12 cells were transfected with siMeg8 or siRNA-control for 48 h. The expression of Meg8, E-cadherin, N-cadherin and Vimentin was detected by qRT-PCR (C) and Western blot (D). (E) The expression of N-Cadherin and Vimentin was detected in AML12 cells by confocal microscopy. DAPI-stained nuclei blue; scale bar, 20 mm. GAPDH was used as an internal control. All data are presented as means ± SD for at least triplicate experiments. *p < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
6
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
protective molecule and compensatory increased to resist continuous damage during liver fibrosis, which is consistent with other reports [24,25]. For instance, chemokine Cxcl9 expression was significantly up-regulated in CCl4-induced mice liver fibrosis model, while Cxcl9 strongly attenuated neoangiogenesis and experimental liver fibrosis [24]. It has also been reported that the expression of Malat1 was over-expressed in breast cancer, but forced Malat1 restrained breast cancer metastasis in transgenic, xenograft, and syngeneic models [25]. Taken together, Meg8 is over-expressed in activated HSCs, injured HCs and fibrotic liver tissues, and silencing Meg8 promotes the activation of HSCs, making this molecule as an essential mediator to reverse hepatic fibrosis and a candidate for novel therapeutic strategies. EMT has appeared as a contributor to liver fibrosis, while EMT of HCs in liver fibrosis is controversial. Taura et al. reported that HCs did not obtain the expression of mesenchymal marker, nor exhibit a morphological changes that were significantly different with normal HCs in vivo [26]. Nevertheless, Zeisberg, Kaimori et al. and several groups demonstrated that primary HCs and AML12 cells were capable of EMT genotypic and phenotypic changes and type I collagen synthesis [27,28]. Moreover, Terashima et al. found that
MEG8 expression was immediately increased during TGF-b induced EMT of lung cancer and Panc1 pancreatic cancer cell lines [29]. In our study, we also investigated whether Meg8 was involved in the EMT progression of HCs. Firstly, we found that the expression of Meg8 was increased in primary HCs of CCl4 treated mice, prompting that Meg8 plays an important role in HCs. Furthermore, we found that silencing Meg8 evidently decreased E-cadherin expression, while the expression of N-cadherin and Vimentin were obviously enhanced in primary HCs and AML12 cells, suggesting that Meg8 silencing induces EMT of HCs in vitro. Notch signaling is involved in regulating cell differentiation, survival and apoptosis and plays a part in HSCs activiation and the procession of EMT [30]. For instance, the Notch signaling was activated in CCl4 induced liver fibrosis, and blocking Notch signaling can observably alleviate liver fibrosis [31]. Moreover, we have previously shown lnc-LFAR1 silencing evidently inactivated the TGF-b/Smad signal and Notch pathways in primary HSCs and HCs, suppressing CCl4-and BDL-induced mice liver fibrosis in vivo and in vitro [11]. In our study, we have identified that Meg8 inhibited activation of HSCs and EMT of HCs. Therefore, we supposed whether Meg8 regulated HSCs activation and HCs EMT via
Fig. 4. Meg8 silencing promotes activation of HSCs and EMT of HCs through Notch pathway. The cells were transfected with siMeg8 or siRNA-control for 48 h. (A, B) The expression of Meg8, Notch2, Notch3 and Hes1 was detected in primary HSCs by qRT-PCR (A) and Western blot (B). The RNA and protein levels of Meg8, Notch2, Notch3 and Hes1 were detected by qRT-PCR and Western blot in Meg8-silenced primary HCs, GAPDH was used as an internal control (C, D). AML12 and LX-2 cells were respectively transfected with siMeg8 or siRNA-control for 48 h and further treated with 10 ng/ml RO4929097 for additional 24 h. The siRNA-control transfected cells were treated with the same volume diluted with dimethyl sulfoxide (DMSO). (E, F) The expression of HES1, a-SMA and COL1a1 was detected by qRT-PCR (E) and Western blot (F) in LX-2 cells. (G, H) The expression of Hes1 and Ncadherin was detected by qRT-PCR (G) and Western blot (H) in AML12 cells. GAPDH was used as an internal control. All data are presented as means ± SD for at least triplicate experiments. *p < 0.05, stands for vs siRNA-Control þ DMSO. #p < 0.05 stands for siRNA-Control þ RO4929097.
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015
T. Chen et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
the Notch pathway. Our data have revealed that Meg8 silencing significantly promoted Notch2, Notch3 and Hes1 expression in primary HSCs, HCs and corresponding cell lines. Moreover, when we transfected with siMeg8 and followed by RO4929097 treatment, we found that blocking the Notch pathway abolished Meg8 silencing induced up-regulation of both the pro-fibrotic and the mesenchymal marker genes, indicating that Meg8 inhibited HSCs activation and HCs EMT through suppressing the Notch pathway at the transcription level. In addition, it has been reported that lncRNAs were involved in complicatly pathophysiological processes at epigenetic, transcriptional or posttranscriptional level to modulate target genes expression depending on their cellular location [8]. Hence, if lncRNAs are located in the nucleus, they may regluate the expression of related genes at the transcriptional level. In the current study, Meg8 was predominantly distributed in the nucleus of LX-2 and AML12 cells (Fig. 1F), revealing that Meg8 regulated the expression of target genes at the transcriptional level, which was consistent with the way that Meg8 regulated the Notch pathway. In conclusion, our results identified that Meg8 attenuates liver fibrosis by suppressing HSCs activation and HCs EMT and serves as a novel regulator of Notch signaling, thus providing novel insight into the molecular mechanisms of liver fibrosis. Declaration of competing interest The authors declare no conflicts of interest. Acknowledgement This work was supported by the National Natural Science Foundation of China (No 81870429; 81670558; 81800542; 81971331), the Natural Science Foundation of Tianjin (grant numbers 18JCQNJC81500; 18JCZDJC99000 and 19JCZDJC36700), and the National 13th 5-year Plan for Hepatitis Research (No.2017ZX10203201-007). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.11.015. References [1] S.D. Kamdem, R. Moyou-Somo, F. Brombacher, et al., Host regulators of liver fibrosis during human schistosomiasis, Front. Immunol. 9 (2018) 2781. [2] S.C. Yanguas, B. Cogliati, J. Willebrords, et al., Experimental models of liver fibrosis, Arch. Toxicol. 90 (2016) 1025e1048. [3] T. Tsuchida, S.L. Friedman, Mechanisms of hepatic stellate cell activation, Nat. Rev. Gastroenterol. Hepatol. 14 (2017) 397e411. [4] S.L. Friedman, Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver, Physiol. Rev. 88 (2008) 125e172. [5] R.C. Stone, I. Pastar, N. Ojeh, et al., Epithelial-mesenchymal transition in tissue repair and fibrosis, Cell Tissue Res. 365 (2016) 495e506. [6] N. Shrestha, L. Chand, M.K. Han, et al., Glutamine inhibits CCl4 induced liver fibrosis in mice and TGF-beta1 mediated epithelial-mesenchymal transition in mouse hepatocytes, Food Chem. Toxicol. 93 (2016) 129e137.
7
[7] X. Yang, B. Yao, Y. Niu, et al., Hypoxia-induced lncRNA EIF3J-AS1 accelerates hepatocellular carcinoma progression via targeting miR-122-5p/CTNND2 axis, Biochem. Biophys. Res. Commun. 518 (2019) 239e245. [8] K. Zhang, Z.M. Shi, Y.N. Chang, et al., The ways of action of long non-coding RNAs in cytoplasm and nucleus, Gene 547 (2014) 1e9. [9] F. Kopp, J.T. Mendell, Functional classification and experimental dissection of long noncoding RNAs, Cell 172 (2018) 393e407. [10] E.B. Bian, Z.G. Xiong, J. Li, New advances of lncRNAs in liver fibrosis, with specific focus on lncRNA-miRNA interactions, J. Cell. Physiol. 234 (2019) 2194e2203. [11] K. Zhang, X. Han, Z. Zhang, et al., The liver-enriched lnc-LFAR1 promotes liver fibrosis by activating TGFbeta and Notch pathways, Nat. Commun. 8 (2017) 144. [12] K. Zhang, Y. Han, Z. Hu, et al., SCARNA10, a nuclear-retained long non-coding RNA, promotes liver fibrosis and serves as a potential biomarker, Theranostics 9 (2019) 3622e3638. [13] X. Li, R. Liu, Z. Huang, et al., Cholangiocyte-derived exosomal long noncoding RNA H19 promotes cholestatic liver injury in mouse and humans, Hepatology 68 (2018) 599e615. [14] F. Yu, W. Geng, P. Dong, et al., LncRNA-MEG3 inhibits activation of hepatic stellate cells through SMO protein and miR-212, Cell Death Dis. 9 (2018) 1014. [15] B. Zhang, Y. Dong, Z. Zhao, LncRNA MEG8 regulates vascular smooth muscle cell proliferation, migration and apoptosis by targeting PPARalpha, Biochem. Biophys. Res. Commun. 510 (2019) 171e176. [16] F. Sheng, N. Sun, Y. Ji, et al., Aberrant expression of imprinted lncRNA MEG8 causes trophoblast dysfunction and abortion, J. Cell. Biochem. 120 (2019) 17378e17390. [17] R. Bijkerk, Y.W. Au, W. Stam, et al., Long non-coding RNAs Rian and Miat mediate myofibroblast formation in kidney fibrosis, Front. Pharmacol. 10 (2019) 215. [18] J. Wang, Y. Hong, S. Shao, et al., FFAR1-and FFAR4-dependent activation of Hippo pathway mediates DHA-induced apoptosis of androgen-independent prostate cancer cells, Biochem. Biophys. Res. Commun. 506 (2018) 590e596. [19] A. Geerts, History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells, Semin. Liver Dis. 21 (2001) 311e335. [20] I. Mederacke, D.H. Dapito, S. Affo, et al., High-yield and high-purity isolation of hepatic stellate cells from normal and fibrotic mouse livers, Nat. Protoc. 10 (2015) 305e315. [21] L. Luistro, W. He, M. Smith, et al., Preclinical profile of a potent gammasecretase inhibitor targeting notch signaling with in vivo efficacy and pharmacodynamic properties, Cancer Res. 69 (2009) 7672e7680. [22] S.S. Choi, A.M. Diehl, Epithelial-to-mesenchymal transitions in the liver, Hepatology 50 (2009) 2007e2013. [23] Z. Yang, S. Jiang, J. Shang, et al., LncRNA: shedding light on mechanisms and opportunities in fibrosis and aging, Ageing Res. Rev. 52 (2019) 17e31. [24] H. Sahin, E. Borkham-Kamphorst, C. Kuppe, et al., Chemokine Cxcl9 attenuates liver fibrosis-associated angiogenesis in mice, Hepatology 55 (2012) 1610e1619. [25] J. Kim, H.L. Piao, B.J. Kim, et al., Long noncoding RNA MALAT1 suppresses breast cancer metastasis, Nat. Genet. 50 (2018) 1705e1715. [26] K. Taura, K. Miura, K. Iwaisako, et al., Hepatocytes do not undergo epithelialmesenchymal transition in liver fibrosis in mice, Hepatology 51 (2010) 1027e1036. [27] M. Zeisberg, C. Yang, M. Martino, et al., Fibroblasts derive from hepatocytes in liver fibrosis via epithelial to mesenchymal transition, J. Biol. Chem. 282 (2007) 23337e23347. [28] A. Kaimori, J. Potter, J.Y. Kaimori, et al., Transforming growth factor-beta1 induces an epithelial-to-mesenchymal transition state in mouse hepatocytes in vitro, J. Biol. Chem. 282 (2007) 22089e22101. [29] M. Terashima, A. Ishimura, S. Wanna-Udom, et al., MEG8 long noncoding RNA contributes to epigenetic progression of the epithelial-mesenchymal transition of lung and pancreatic cancer cells, J. Biol. Chem. 293 (2018) 18016e18030. [30] D. Henrique, F. Schweisguth, Mechanisms of Notch Signaling: a Simple Logic Deployed in Time and Space, Development vol. 146 (2019). [31] Y. Chen, S. Zheng, D. Qi, et al., Inhibition of Notch signaling by a gammasecretase inhibitor attenuates hepatic fibrosis in rats, PLoS One 7 (2012), e46512.
Please cite this article as: T. Chen et al., LncRNA Meg8 suppresses activation of hepatic stellate cells and epithelial-mesenchymal transition of hepatocytes via the Notch pathway, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.015