- Email: [email protected]
Localization and regulation of glucagon receptors in the chick eye and preproglucagon and glucagon receptor expression in the mouse eye
Experimental Eye Research 79 (2004) 321–329 www.elsevier.com/locate/yexer
Localization and regulation of glucagon receptors in the chick eye and preproglucagon and glucagon receptor expression in the mouse eye Marita P. Feldkaemper*, Eva Burkhardt, Frank Schaeffel Section of Neurobiology of the Eye, University Eye Hospital Tuebingen, Calwerstraße 7/1, 72076 Tuebingen, Germany Received 18 September 2003; accepted in revised form 6 April 2004 Available online 20 July 2004
Abstract Myopia is a condition in which the eye is too long for the focal length of cornea and lens. Analysis of the messengers that are released by the retina to control axial eye growth in the animal model of the chicken revealed that glucagon-immunoreactive amacrine cells are involved in the retinal image processing that controls the growth of the sclera. It was found that the amount of retinal glucagon mRNA increased during treatment with positive lenses and pharmacological studies supported the idea that glucagon may act as a stop signal for eye growth. Glucagon exerts its regulatory effects by binding to a single type of glucagon receptor. In this study, we have sequenced the chicken glucagon receptor and compared its DNA and amino acid sequence with the human and mouse homologues. After sequencing about 80% of the receptor, we found a homology between 79·4 and 75·6% on cDNA level. At the protein level, about 73% of the amino acids were identical. Moreover, the cellular localization and regulation of the glucagon receptor in the chick retina was studied. In situ hybridization studies showed that many cells in the ganglion cell layer and inner nuclear layer, and some cells in the outer nuclear layer, express the receptor mRNA. Injection of the glucagon agonist Lys17,18,Glu21-glucagon induced a down-regulation of glucagon receptor mRNA content. Since the mouse would be an attractive mammalian model to study the biochemical and genetic basis of myopia, and because recent studies have demonstrated that form deprivation myopia can be induced, the expression of preproglucagon and glucagon receptor genes were also studied in the mouse retina and were found to be expressed. q 2004 Elsevier Ltd. All rights reserved. Keywords: animal; myopia/metabolism; chickens/anatomy and histology; retina/cytology; eye/growth and development/metabolism
1. Introduction Using animal models, it was shown that ocular growth is precisely regulated by visual experience. If emmetropic animals wear negative or positive spectacle lenses, their eyes respond with enhanced or reduced axial growth, respectively, and thereby compensate for the imposed refractive errors. This lens compensation is largely independent of higher cortical processing or accommodation. A local biochemical mechanism within the retina is involved in compensation. Previous studies have shown that glucagonergic ZENKimmunoreactive amacrine cells respond to defocus in the retinal image and even to its sign (Fischer et al., 1999; Bitzer and Schaeffel, 2002). The glucagonergic cells show a sign of * Corresponding author. Dr Marita P. Feldkaemper, Section of Neurobiology of the Eye, University Eye Hospital Tuebingen, Calwerstraße 7/1, 72076 Tuebingen, Germany. E-mail address: [email protected] (M.P. Feldkaemper). 0014-4835/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. DOI:10.1016/j.exer.2004.04.009
defocus specific up-regulation of the transcription factor ZENK with positive lenses, and down-regulation with negative lenses already after 30 min of treatment. Until now, only little information about the role of glucagon in retinal signal processing is available and neither the upstream regulatory pathways nor the downstream signal-transduction cascades are known. Apart from its well documented role as a key regulator of synthesis and mobilization of glucose in the liver and thereby as a counter regulatory hormone, opposing the actions of insulin, it has been shown to act as a neurotransmitter or neuromodulator in the central nervous system (Saskai et al., 1985; Morawska et al., 1998). Pharmacological experiments were in line with the hypothesis that glucagon may act as an eye growth inhibiting signal since intravitreal injection of glucagon agonists completely inhibited both lens-induced myopia development (Feldkaemper and Schaeffel, 2002) and form deprivation myopia (Lencses et al., 2000; Stell et al., 2000) in a dosedependent manner. Moreover, intravitreal injection of glucagon completely suppressed choroidal thinning that
322
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
normally occurs if negative lenses or diffusers are worn (Zhu et al., 2001). Recently, it was also found that the glucagon mRNA content is regulated in a bi-directional way, depending on the sign of imposed defocus. This result supports the idea that glucagon may act as a stop-and-go signal for eye growth. There was evidence of a transient increase in glucagon receptor mRNA levels in lens-treated eyes after both negative or positive lens wear (Feldkaemper et al., 2000; Buck et al., 2004). Another finding that is in line of a potential role of glucagon in the control of refractive errors was that intravitreal quisqualate injection resulted in the destruction of various different amacrine cell types but that deprivation myopia could still be induced. Among the retinal cells that appeared almost unaffected by the treatment were amacrine cells immunoreactive for glucagon (Fischer et al., 1998). Therefore, it seems likely that the glucagon cells are involved in the visual regulation of ocular growth and that glucagon may act as a stop signal for axial eye elongation. The present study was performed to obtain more information on the glucagon downstream signalling cascade. Glucagon exerts its regulatory effects by binding to the glucagon receptor which is closely related to the glucagonlike peptide-1, secretin, vasoactive intestinal peptide, and gastric inhibitory polypeptide receptors, and which belongs to the superfamily of G-protein coupled receptors (GPCR) (Jelinek et al., 1993). Binding of glucagon to the receptor leads to a rapid and long-lasting action. Stimulation of the glucagon receptor modulates adenylate cyclase and initiates the production of cAMP. The glucagon receptor activates extracellular signal-regulated protein kinase 1/2 via cAMPdependent protein kinase (Jiang et al., 2001). In addition, glucagon can exert its effects on signalling pathways via cAMP-independent interactions leading to stimulation of phospholipase C and release of Ca2þ from IP3-sensitive intracellular Ca2þ stores (Hansen et al., 1998; Navarro et al., 1999; Mayo et al., 2003), consistent with earlier descriptions of dual glucagon signalling pathways in hepatocytes (Wakelam et al., 1986). High levels of glucagon receptor mRNA were found in rat and mouse liver and kidney (Burcelin et al., 1995; Yamato et al., 1997) and, to a lesser extent, in heart, adipose tissue, spleen, pancreatic islets, ovary and thymus stomach, small intestine, adrenal glands, pancreas, thyroid, and skeletal muscle (Svoboda et al., 1994; Hansen et al., 1998). The presence of glucagon receptor mRNA in tissues known to be responsive to glucagon suggests that these effects are mediated by specific glucagon receptors. The detection of glucagon receptor mRNA in the spleen, thymus, thyroid, adrenal gland, ovary and skeletal muscle, all tissues where glucagon was is not expected to act suggests that there may be novel functions of glucagon that have yet to be analysed. Previous studies demonstrated the existence of two classes of binding sites: a high-affinity class with a KD of 7 ^ 0·8 nM and a Bmax of 2·3 ^ 0·2 pmol mg21 of protein and a lowaffinity class with a KD of 84·4 ^ 2·5 nM and a Bmax of 16·5 ^ 2·3 pmol mg21 of protein (Fernandez-Durango et al.,
1990). In contrast to the detailed knowledge on glucagon receptor mRNA expression in the tissues listed above, no information on the spatial distribution of the glucagon receptor in the retina is available. We have, therefore, studied the cellular localization and regulation of glucagon receptors at the mRNA level in the chick retina, using in situ hybridization. To make this study possible, the chicken glucagon receptor message was partly sequenced and amino acid composition of the chicken glucagon receptor was compared with that of the human, rat and mouse receptors. Recently, it was attempted to establish a mouse model for myopia (Schaeffel and Burkhardt, 2002; Schaeffel et al., 2004). Because the mouse genome was largely sequenced, the mouse would be an attractive model to study the biochemical and genetic basis of myopia. Until now, only a few studies addressed the question whether or not glucagon is also present in the mammalian retina. While one study failed to detect glucagonergic neurons in the rat retina (Tornqvist and Ehinger, 1983), another group detected glucagon-immunoreactive cells in the ganglion cell layer and inner nuclear layer in mouse and rat retina (Das et al., 1985). In an attempt to resolve these conflicting observations, we examined preproglucagon and glucagon receptor mRNA expression in the mouse retina and blood, using polymerase chain reaction.
2. Material and methods Animals. White leghorn chickens were obtained from a local hatchery one day after hatching and raised under a 12/12 hr light/dark cycle. Black wildtype mice (C57BL/6JIco) were obtained from Charles River Laboratories, Sulzfeld, Germany. The use of animals was in accordance with the guidelines established by the University of Tu¨bingen Animal Care Committee and the German Council on Animal care and was carried out in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Tissue preparation and experimental procedure. Animals were killed by an overdose of ether and immediately enucleated. The chickens were 9–14 days old whereas the mice were aged from 36 to 70 days. Chicken eyes were cut with a razor blade perpendicular to the anterior–posterior axis, approximately 1 mm posterior to the ora serrata. The anterior segment of the eye was discarded and the eyecups were processed for in situ hybridization. Six chicks were intravitreally injected every second day with 2·5 nmol of the glucagon agonist Lys17,18,Glu21-glucagon into one eye and water into the contralateral eye. It is already known that this concentration of the agonist inhibits lens-induced myopia development completely. After 6 days, receptor expression in both eyes was compared using in situ hybridization technique. Mouse eyes were cut out at the optic nerve head with a pair of scissors. The retina was carefully removed from the posterior segment, separated and immediately cooled in
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
liquid nitrogen. Moreover, control tissues (liver, small intestine) were carefully separated, cooled and stored at 2 808C until RNA extraction. Whole blood was collected after decapitation directly into a tube containing Trizol (Invitrogen, Carlsbad, CA, USA). RNA isolation and reverse transcription polymerase chain reaction (RT-PCR). Total RNA from the different tissues was extracted using the RNAeasy Mini Kit (Quiagen, Hilden, Germany). The whole blood sample was homogenized by passing it several times through a syringe and RNA was isolated according to the instructions for RNA isolation using Trizol. All samples were digested with DNase-I (Boehringer Mannheim, Mannheim, Germany). First strand cDNA was synthesized from 500 ng RNA, using an oligo d(T) primed 25 ml reaction mixture and MMLV reverse transcriptase according to standard procedures. The PCR amplifications were performed using 2 ml of the first strand cDNA in a final volume of 25 ml, 1 U AmpliTaq polymerase (glucagon receptor chick, wobbled primers) or 1 U TaqGold, a final MgCl2 concentration of 2·5 mM and a final primer concentration of 0·4 mM . The reaction was amplified through 40 cycles, each consisting of 30 s at 948C, 45 s at 538C (glucagon receptor chick, wobbled primers) or 568C (glucagon receptor and preproglucagon, mouse) or 578C (glucagon receptor chick, specific primers), respectively, and 45 s at 728C. The specific forward and reverse primers for the mouse glucagon and glucagon receptor amplification were as follows: preproglucagon (mouse) forward: ATAATGCTGGTGCAAGGCAG, Preproglucagon (mouse) reverse: GTCCCTTCAGCATGTCTCTCAA (product length: 271 bp). Glucagon receptor (mouse) forward: CATGCAGTACGGCATCATAG, glucagon receptor (mouse) reverse: CAGGAAGACAGGAATACGCAG (product length: 251 bp). Primers for glucagon amplification were complementary to sense nucleotide þ 135 to þ 154 of the 50 untranslated region and antisense nucleotides þ 406 to þ 385 of the mouse preproglucagon coding sequence (EMBL: AF276754) and primers for glucagon receptor amplification were complementary to sense nucleotide þ 827 to þ 846 and antisense þ 1076 to þ 1056 of the liver glucagon receptor coding sequence (EMBL: BC031885). Sequencing of the chick glucagon receptor. Conserved regions in the mouse (EMBL: BC031885) and human glucagon receptor sequence (EMBL: HS03469) were identified and degenerated primers were constructed that amplified a sequence of 962 bp. Glucagon receptor (chick) forward primer was CAAC/TATC/TTCCTGCCCCTGGTA and reverse primer CAGTAGAGA/G/CACA/GGCC/TACCAGC. The resultant PCR product of the expected size (according to the mouse and human glucagon receptor sequence) was cut out and automatic sequence analysis was performed. According to the obtained chicken glucagon receptor sequence new specific primers were designed (glucagon receptor forward: ACATCCACATGAACCTCTTCG; glucagon receptor reverse: TAGTCCGTGTAGCGCATCTG, product length 502 bp).
323
Probe preparation for in situ hybridization studies. Antisense and sense digoxigenin (Dig)-labelled riboprobes of the chicken glucagon receptor were prepared as follows. Total RNA was isolated from retinal tissue, transcribed into cDNA and afterwards amplified using ACATCCACATGAACCTCTTCG as the forward primer and TAGTCAGTGTAGCGCATCTG as the reverse primer. The resulting PCR product with a length of 502 bp was subcloned into a pCR4 TOPO cloning vector (Invitrogen, Carlsbad, California) according to the manufacturer’s instructions. The correct insertion was verified by automatic sequencing. One microgram of plasmid DNA containing the cDNA insert was linearized by restriction enzyme digestion using either Not I or Dra I (MBI Fermentas, St.Leon-Rot, Germany). Digoxigenin –UTP-labelled sense and antisense riboprobes were generated by in vitro transcription of linearized plasmids with a kit (DIG RNA labelling Kit, Roche Molecular Biochemicals, Mannheim, Germany). In situ hybridization studies. For in situ hybridization, kidney and eyecups were fixed at 48C for 20 min in 4% paraformaldehyde (PFA) þ 3% sucrose, washed three times with phosphate buffer (PB; 0·1 M , pH 7·4), and cryoprotected by immersion in 30% sucrose in PB overnight at 48C. Eyecups were then embedded in cryomatrix (TissueTek, Leica, Nussloch, Germany) and frozen. Radial sections (10 mm) were cut on a cryostat. Air-dried sections were treated with 0·3 mg ml21 proteinase K at 378C for 8 min. After being washed with DEPC water for two times, the sections were postfixed at room temperature for 15 min in 4% paraformaldehyde and washed again with DEPC water. In a humid chamber, sections were prehybridized in prehybridization solution (0·2% SDS, 1% BSA, 5 £ SSC) at 558C for 20 min. Hybridization was performed overnight at 558C in a humid box with hydrolyzed digoxigenin-labelled riboprobes for the chick glucagon receptor (60 ng/well) in the hybridization solution (Amersham, Buckinghamshire, UK). Posthybridization washing steps were performed two times for 30 min each in 0·1 £ SSC at 558C. After a 10-min wash in Tris–buffered saline (TBS; 0·15 M NaCl and 0·1 M Tris–HCl, pH 7·5) at room temperature the slices were incubated for 30 min with blocking solution (5% blocking reagent in 0·1 M maleic acid, 0·15 M NaCl, pH 7·5, Roche Molecular Biochemicals). Drained slices were incubated with alkaline-phosphataseconjugated anti-digoxigenin antibody (1:500, in 5% blocking solution, 0·15% Triton-X-100 in TBS) for 45 min at 378C and washed afterwards two times for 15 min each in TBS at room temperature. After 10 min incubation in AP buffer (0·1 M Tris–HCl, pH 9·5, 1 mM MgCl2, 10% tretramisole-hydrochloride, Fluka) to block endogenous phosphatases, the sections were developed in coloring solution in a humidified chamber in the dark (120 mg nitroblue tetrazoliumchloride, 60 mg 5-bromo-4-chloro-3-indolyl phosphate in 1 ml AP buffer) for 4–24 hr at 48C. Color reaction was stopped with stop buffer (0·1 M Tris–HCl, pH 7·5 and 0·01 M EDTA) and slices were covered with sorbitol (Merck, Darmstadt, Germany).
324
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
Histology. To compare the abundance of glucagon amacrine cells with the amount of glucagon receptor mRNA expressing cells, frozen sections of the chicken retina were stained with a monoclonal mouse anti-glucagon antibody (1:400) specific for the N-terminus of glucagon (Gordon Ohning, University of California, CA, USA). The second antibody solution contained 1:500 oregon green conjugated goat-anti mouse IgG. The method was already described in detail by Bitzer and Schaeffel (2002).
3. Results 3.1. Partial sequencing of the chicken glucagon receptor To obtain partial glucagon receptor sequence information, degenerate oligonucleotide primers were used that amplified a conserved region of the receptor. A 962 bp long sequence was obtained (123glucrez) and aligned with known partial glucagon receptor mRNA sequences which
Fig. 1. Glucagon receptor sequence alignment (Gallus domesticus). Known partial chicken glucagon receptor mRNA sequences (EMBL: bm426498, EMBL: bm427538) were aligned with the newly obtained chick glucagon receptor sequence (123glurez). The resultant alignment length was 1377 bp.
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
all coded for the 50 end of the chicken glucagon receptor. The resultant alignment length was 1377 bp (Fig. 1). Sequence analysis located the start codon ATG at position 225 –228 of the aligned sequence. Homologies at the cDNA level between the chicken and human (EMBL: HS03469) or mouse glucagon receptor (EMBL: BC031885) were 79·4 or 75·6%, respectively (BESTFIT; HUSAR, Heidelberg, Germany).
3.2. Homology of the chicken glucagon receptor protein sequence with the human and mouse glucagon receptor The obtained glucagon receptor sequence alignment was translated into the corresponding amino acid sequence. The coding region of the sequence from basepair 229 to 1377 corresponded to 385 amino acids. The already known human or mouse glucagon receptor is 477 bp (SP: P47871) or 485 bp (PIR: JC4264) long, respectively. This indicates that about 80% of the receptor sequence are known. Comparing amino acid composition of the chicken and human glucagon receptor showed that 72·7% of the amino acids were identical and 83·6% were homologous, if conservative substitutions were included (Fig. 2). The chicken and mouse receptor were 72·8% identical and 84·5% homologous. Putative transmembrane domains according to Ngan et al. (1999) are shown in boxes.
325
3.3. Localization of the glucagon receptor in the chick retina In situ hybridization studies were performed to localize the mRNA of the chicken glucagon receptor in retinal cells. First of all, chicken kidney tissue was studied as a positive control. Intense staining in the renal medulla can be seen using the antisense Digoxigenin probe (Fig. 3(D)), whereas the sense probe revealed only faint background staining (Fig. 3(E)). Recently, glucagon receptor mRNA was detected in the rat proximal tubule, as well as in the thick ascending limb and collecting duct. Specific binding of glucagon occurred in both the renal cortex and medulla (Marks et al., 2003). In the retina of 2– 3-weeks-old chicks, about 50% of the cells in the ganglion cell layer showed glucagon receptor mRNA expression (Fig. 3(A)). The ganglion cell layer in the chick consists of displaced amacrine cells as well as of ganglion cells. Since the ganglion cells were not selectively marked and could not be reliably distinguished from displaced amacrine cells, the labelled cells may belong to either type. Moreover, an intense staining in the inner nuclear layer can be seen, especially at the border towards the inner plexiform layer. Again, up to 50% of the cells in the inner nuclear layer were stained, most of them presumably amacrine cells and bipolar cells. In the outer nuclear layer where the photoreceptor somata are located, only a few cells were labelled. These cells probably represent more than one type of photoreceptors, since chicken photoreceptors are quite
Fig. 2. Comparison of the amino acid sequence of the first 385 amino acids of the glucagon receptor of the chick (top) and its human orthologue (SP: P47871). The boxes represent the putative transmembrane domains (TMD). Comparison revealed that 72·7% of the amino acids were identical.
326
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
Fig. 3. In situ hybridization with digoxigenin-labelled glucagon receptor riboprobes and immunohistochemical localization of glucagonergic amacrine cells. Radial sections of chick retinas at the age of 2–3 weeks. (A) Antisense riboprobe of chicken glucagon receptor-labelled cells in the ganglion cell layer (GCL, arrow) and the inner nuclear layer (INL, arrow). Some cells in the outer nuclear layer (ONL) were stained also. (B) Glucagon receptor sense control in the chicken retina. (C) Amacrine cells labelled for glucagon. (D) Intense staining of glucagon receptor mRNA can be seen in the renal medulla of the chicken kidney using the antisense riboprobe. (E) Glucagon receptor sense control in the chicken kidney. A scale bar, representing 200 mm, is included in each picture.
neatly stratified according to type. Comparing the numbers of glucagon receptor expressing cells (Fig. 3(A)) and glucagon cells (Fig. 3(C)) revealed that although only a small (about 1%) proportion of the amacrine cells are glucagonergic, many cells contain the glucagon receptor mRNA, and are therefore likely to express the glucagon receptor. 3.4. Modulation of retinal glucagon receptor mRNA expression Since the density of glucagon receptors on the cell surface determines the sensitivity of the tissue to glucagon, we have studied the regulation of glucagon receptor mRNA by applying the glucagon agonist Lys17,18, Glu21-glucagon to the retina. This agonist, as well as the treatment protocol was previously shown to inhibit myopia development completely (Feldkaemper and Schaeffel, 2002). A representative example showing the effect of the agonist on receptor mRNA levels is presented in Fig. 4. In situ hybridization studies showed that, in 5 of 6 treated animals, the glucagon agonist (Fig. 4(C)) induced an almost complete down-regulation of the glucagon receptor mRNA. This down-regulation was observed in all cell types.
3.5. Glucagon and glucagon receptor mRNA expression in the mouse retina It is known that glucagon is expressed in several tissues in the mouse, including liver and intestine (Burcelin et al., 1995; Yamato et al., 1997). Until now, immunohistochemical detection of glucagon in the mouse retina failed. We were unable to obtain any staining with the three different antibodies that were available (1. anti-glucagon, mouse monoclonal antibody, Gordon Ohning, University of California Los Angeles, Los Angeles, CA; 2. anti-glucagon, goat polyclonal antibody, Santa Cruz, CA, USA; 3. antiglucagon, mouse monoclonal antibody, Sigma Aldrich). The failure to detect glucagon-immunoreactive cells may be either due to the specificity of the antibodies or, more likely, due to the sub-threshold concentrations of glucagon in the retina. We therefore investigated preproglucagon and glucagon receptor expression using PCR which is much more sensitive. Glucagon, similar to many biologically active peptides and neuropeptides, is initially synthesized as a larger precursor that is cleaved by tissue specific endoproteases. The mouse preproglucagon gene consists of glucagon, glucagon-like peptide I and glucagon-like peptide II. The primers that we used amplified the sequence coding for glucagon and part of the sequence coding for
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
327
4. Discussion
Fig. 4. Effect of the glucagon agonist Lys17,18,Glu21-glucagon on glucagon receptor expression in the retina. Chicks were intravitreally injected every second day with 2·5 nmol of the glucagon agonist into one eyes and with water into the contralateral eye. After 6 days, the glucagon receptor expression in both eyes was compared using in situ hybridization technique ðn ¼ 6Þ: (A) Glucagon receptor expression after injection of water, antisense probe. (B) Same section as in (A) labelled with the sense probe. (C) Glucagon receptor expression after injection of the glucagon antagonist. (D) Same section as in (C) labelled with the sense probe. A scale bar, representing 100 mm, is included in each picture.
glucagon-like peptide I. In 36– 70-days-old mice, preproglucagon mRNA was detected in the lens, retina, small intestine and liver (Fig. 5(A)). The bands showed the expected size and the authenticity of the PCR products in the retina and liver was confirmed by DNA sequencing. In the whole blood sample, preproglucagon mRNA content was below the detection limit. Moreover, the water control (no template control) and the controls in which no reverse transcriptase was added (results not shown) displayed no preproglucagon mRNA expression. Glucagon receptor transcripts were detected in retina, small intestine, liver and whole blood but not in lens and water control (Fig. 5(B)).
Fig. 5. Analysis of preproglucagon expression (A) and glucagon receptor expression (B) by RT-PCR in lens, retina, small intestine, liver and whole blood of mice. Preproglucagon was expressed in lens, retina, intestine and liver whereas glucagon receptor was expressed in retina, intestine, liver and whole blood. Water was used as non-template control (NT-control).
In the present study, sequencing of the chicken glucagon receptor and sequence comparison to its human and mouse counterpart revealed a high degree of conservation and a similar structural composition of the protein in these species. Until now, a number of residues that are involved in ligand binding and receptor activation, such as Ser-80, Gln-142 and especially Asp-64 are already known for the human glucagon receptor (Ngan et al., 1999). The amino acids Asp-64 and Ser-80 are also conserved in the chick glucagon receptor, suggesting that they are crucial to the binding of glucagon to mediate changes in cAMP. In the chick, glutamine at position 142 is replaced by lysine. The present report was aimed at adding more information on the glucagon downstream signal-transduction cascade. As already mentioned in Section 1, glucagon may act as a stop signal for eye growth at least in the chick. Identification of the retinal cells that respond to glucagon is important for understanding the signalling pathways involved. On RNA in situ hybridization, we observed glucagon receptor mRNA in about 50% of the cells in the ganglion cell layer but it has to be kept in mind that in situ hybridization histochemistry is no quantitative method. Ehrlich (1981) investigated the regional specialization of the chick retina as revealed by the size and density of neurons in the ganglion cell layer. On the basis of both morphological criteria and survival after ganglion cell axotomy, they found smaller cells with uniform density of about 4·000 cells mm22 across the entire retina which comprise 30 –35% of the total number of cells in the ganglion cell layer. The author suggested that these cells were displaced amacrine cells. In the present study, we cannot assess which cell type expresses the receptor although the major fraction of labelled cells were probably ganglion cells, making up 65 –70% of the total population in the ganglion cell layer. Moreover, a large number of cells in the inner nuclear layer, especially at the border towards the inner plexiform layer and some cells in the outer nuclear layer showed glucagon receptor mRNA expression. Although only a small proportion (about 1%) of the amacrine cells are glucagonergic, glucagon may have a large influence on retinal processing, since the glucagon receptor mRNA is widely distributed. Since so many cells showed glucagon receptor expression, glucagon may exert a broad range of actions in metabolism and signal transduction. However, it cannot be proven that the glucagon receptor mRNA is also translated into protein. Unfortunately, no antibodies are available that are known to recognize the chicken glucagon receptor directly. Prior studies that dealt with the regulation of rat glucagon receptor expression (Yoo-Warren et al., 1994) suggested that the major regulation in hepatic glucagon receptor expression in vivo occurs at the posttranscriptional level. Further studies are necessary to investigate whether the chick retinal glucagon receptor is regulated in a similar fashion. Recently, real-time PCR studies (Buck et al., 2004) have shown glucagon
328
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
and glucagon receptor expression in the chick retina and choroid. Interestingly, the amount of glucagon receptor mRNA was about 6 –8-fold higher in the RPE cells compared to the retina. Since the RPE cells of the chick contain a high amount of melanin and have therefore a high optical density, glucagon receptor mRNA could not be studied using the Digoxigenin-labelled probes. The extracellular concentrations of agonists or antagonists that bind to receptors can regulate the density of functional receptors (Abrahamsen et al., 1995). Although much has been learned about the mechanisms of short-term desensitization, inducing changes in GPCR within seconds to minutes after stimulation by agonists, considerably less is known about the biochemical mechanisms that regulate GPCR activity upon sustained agonist exposure. Long-term regulation of GPCRs or ‘down-regulation’ is thought to be important in the process of physiological adaptation that is induced by endogenous ligands. Desensitation is also an important issue in the clinics, when exogenously administered drugs are used in a chronic or repeated manner (Tsao and von Zastrow, 2001). The most common mechanism to adjust sensitivity is the control of the rate of receptor protein degradation. In addition, a decreased rate of receptor mRNA synthesis and an increased rate of receptor mRNA degradation have also been observed (Goin and Nathanson, 2002). For glucagon it has already been shown that there is a dosedependent decrease glucagon receptor mRNA expression in hepatocytes (Abrahamsen et al., 1995). This sort of negative feedback regulation was confirmed in the present study on the retinal level. After exogenous exposure of the retina to the agonist Lys17,18,Glu21-glucagon, the number of cells that expressed glucagon receptor mRNA and the intensity of the staining decreased quite dramatically. The mouse would be an attractive model to study the biochemical and genetic basis of myopia and preliminary studies, trying to induce myopia by visual deprivation showed some promise (Schaeffel et al., 2004). However, until now, only a few studies have addressed the question as to whether glucagon is also present in the mammalian retina. While one study failed to detect glucagon neurons in the retina of rat, rabbit, cat, pig, or cow (Tornqvist and Ehinger, 1983), others (Das et al., 1985) detected glucagonergic cells in the ganglion cell layer and inner nuclear layer, including Muller cells, both in mouse and rat. The results of the latter study are debatable, because glucagon was detected in virtually all neurons in the inner retina. Moreover, the authors only stated that preabsorption of the antibody with glucagon blocked the staining but data were not presented. Since we also could not find glucagon-immunoreactive cells in the mouse retina, using three different antibodies, we studied preproglucagon and glucagon receptor expression in the retina using the more sensitive polymerase chain reaction. Both transcripts were detected. In addition, preproglucagon was also found in the lens, even though no glucagon receptor expression could be shown. Preproglucagon mRNA could not be detected in the blood. The observation that
preproglucagon and glucagon receptor mRNA were both found in the retina may indicate that low amounts of glucagon are, in fact, produced in the retina itself. They may still have an important function in neuromodulation and/or metabolism of retinal cells despite the low levels. On the other hand, since we showed preproglucagon expression, it is also possible that glucagon-like peptide I and/or glucagonlike peptide II are expressed in the mouse and chicken retina and that their receptors may mediate the effects of glucagonrelated peptides on eye growth. Especially in the mammalian retina, it is possible that yet another neuromodulator has taken over the role of glucagon in myopia development. The localization of glucagon and glucagon-like peptides and their receptor mRNAs in the mouse retina, as well as their possible functional role in the mouse animal model will therefore be further investigated in the future.
Acknowledgements This study was supported by the German Research Council (SFB 430, TP C1).
References Abrahamsen, N., Lundgren, K., Nishimura, E., 1995. Regulation of glucagon receptor mRNA in cultured primary rat hepatocytes by glucose and cAMP. J. Biol. Chem. 270, 15853–15857. Bitzer, M., Schaeffel, F., 2002. Defocus-induced changes in ZENK expression in the chicken retina. Invest. Ophthalmol. Vis. Sci 43, 246 –252. Buck, C., Schaeffel, F., Simon, P., Feldkaemper, M., 2004. Effects of positive and negative lens treatment on retinal and choroidal glucagon and glucagon receptor mRNA levels in the chicken. Invest. Ophthalmol. Vis. Sci. 45, 402–409. Burcelin, R., Li, J., Charron, M.J., 1995. Cloning and sequence analysis of the murine glucagon receptor-encoding gene. Gene 164, 305– 310. Das, A., Pansky, B., Budd, G.C., 1985. Glucagon-like immunoreactivity in mouse and rat retina. Neurosci. Lett. 60, 215– 218. Ehrlich, D., 1981. Regional specialization of the chick retina as revealed by the size and density of neurons in the ganglion cell layer. J. Comp. Neurol. 195, 643–657. Feldkaemper, M.P., Schaeffel, F., 2002. Evidence for a potential role of glucagon during eye growth regulation in chicks. Vis. Neurosci. 19, 755 –766. Feldkaemper, M.P., Wang, H.Y., Schaeffel, F., 2000. Changes in retinal and choroidal gene expression during development of refractive errors in chicks. Invest. Ophthalmol. Vis. Sci. 41, 1623–1628. Fernandez-Durango, R., Sanchez, D., Fernandez-Cruz, A., 1990. Identification of glucagon receptors in rat retina. J. Neurochem. 54, 1233–1237. Fischer, A.J., McGuire, J.J., Schaeffel, F., Stell, W.K., 1999. Light- and focus-dependent expression of the transcription factor ZENK in the chick retina. Nat. Neurosci. 2, 706–712. Fischer, A.J., Seltner, R.L., Poon, J., Stell, W.K., 1998. Immunocytochemical characterization of quisqualic acid- and N-methyl-D -aspartate-induced excitotoxicity in the retina of chicks. J. Comp. Neurol. 393, 1 –15. Goin, J.C., Nathanson, N.M., 2002. Subtype-specific regulation of the expression and function of muscarinic acetylcholine
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329 receptors in embryonic chicken retinal cells. J. Neurochem. 83, 964–972. Hansen, L.H., Gromada, J., Bouchelouche, P., Whitmore, T., Jelinek, L., Kindsvogel, W., Nishimura, E., 1998. Glucagon-mediated Ca2 þ signaling in BHK cells expressing cloned human glucagon receptors. Am. J. Physiol 274, C1552–C1562. Jelinek, L.J., Lok, S., Rosenberg, G.B., Smith, R.A., Grant, F.J., Biggs, S., Bensch, P.A., Kuijper, J.L., Sheppard, P.O., Sprecher, C.A., 1993. Expression cloning and signaling properties of the rat glucagon receptor. Science 259, 1614–1616. Jiang, Y., Cypess, A.M., Muse, E.D., Wu, C.R., Unson, C.G., Merrifield, R.B., Sakmar, T.P., 2001. Glucagon receptor activates extracellular signal-regulated protein kinase 1/2 via cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. USA 98, 10102–10107. Lencses, K.A., Ahn, J.M., Hurby, V.J., Stell, W.K., 2000. Glucagon amacrine cells prevent deprivation myopia in chick. Soc. Neurosci. Abstr. 26, 665. Marks, J., Debnam, E.S., Dashwood, M.R., Srai, S.K., Unwin, R.J., 2003. Detection of glucagon receptor mRNA in the rat proximal tubule: potential role for glucagon in the control of renal glucose transport. Clin. Sci. 104, 253–258. Mayo, K.E., Miller, L.J., Bataille, D., Dalle, S., Goke, B., Thorens, B., Drucker, D.J., 2003. International union of pharmacology. XXXV. The glucagon receptor family. Pharmacol. Rev. 55, 167– 194. Morawska, D., Sieklucka-Dziuba, M., Kleinrok, Z., 1998. Central action of glucagon. Pol. J. Pharmacol. 50, 125– 133. Navarro, I., Leibush, B., Moon, T.W., Plisetskaya, E.M., Banos, N., Mendez, E., Planas, J.V., Gutierrez, J., 1999. Insulin, insulin-like growth factor-I (IGF-I) and glucagon: the evolution of their receptors. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 122, 137 –153. Ngan, E.S., Chow, L.S., Tse, D.L., Du, X., Wei, Y., Mojsov, S., Chow, B.K., 1999. Functional studies of a glucagon receptor isolated from frog Rana tigrina rugulosa: implications on the molecular evolution of glucagon receptors in vertebrates. FEBS Lett. 457, 499–504.
329
Saskai, H., Tominaga, M., Marubashi, S., Katagiri, T., 1985. Glucagon as a neurotransmitter. Biomed. Res. Suppl. 6, 91– 100. Schaeffel, F., Burkhardt, E., 2002. Measurement of refractive state and deprivation myopia in a black wildtype mouse. Invest. Ophthalmol. Vis. Sci. 43, abstract #182. Schaeffel, T., Burkhardt, E., Howland, H., Williams, R.W., 2004. Measurement of refractive state and deprivation myopia in two strains of mice. Optom. Vis. Sci 81, 99–110. Stell, W.K., Lencses, K., Ahn, J.M., Hruby, V.J., 2000. Glucagonsynthesizing amacrine cells mediate chor-oidal compensation for plus-defocus in the chick eye. Eur. J. Neurosci. 12, 487. Svoboda, M., Tastenoy, M., Vertongen, P., Robberecht, P., 1994. Relative quantitative analysis of glucagon receptor mRNA in rat tissues. Mol. Cell. Endocrinol. 105, 131– 137. Tornqvist, K., Ehinger, B., 1983. Glucagon immunoreactive neurons in the retina of different species. Graefes Arch. Clin. Exp. Ophthalmol. 220, 1–5. Tsao, P.I., von Zastrow, M., 2001. Diversity and specificity in the regulated endocytic membrane trafficking of G-protein-coupled receptors. Pharmacol. Ther. 89, 139 –147. Wakelam, M.J., Murphy, G.J., Hruby, V.J., Houslay, M.D., 1986. Activation of two signal-transduction systems in hepatocytes by glucagon. Nature 323, 68–71. Yamato, E., Ikegami, H., Takekawa, K., Fujisawa, T., Nakagawa, Y., Hamada, Y., Ueda, H., Ogihara, T., 1997. Tissue-specific and glucosedependent expression of receptor genes for glucagon and glucagon-like peptide-1 (GLP-1). Horm. Metab. Res. 29, 56– 59. Yoo-Warren, H., Willse, A.G., Hancock, N., Hull, J., McCaleb, M., Livingston, J.N., 1994. Regulation of rat glucagon receptor expression. Biochem. Biophys. Res. Commun. 205, 347–353. Zhu, X., Feldkaemper, M.P., Winawer, J.A., Park, T., Wallman, J., 1994. What ocular components underlie the inhibition of myopia or hyperopia by glucagon or by its antagonist? Invest. Ophthalmol. Vis. Sci. 42, 318.
Localization and regulation of glucagon receptors in the chick eye and preproglucagon and glucagon receptor expression in the mouse eye Marita P. Feldkaemper*, Eva Burkhardt, Frank Schaeffel Section of Neurobiology of the Eye, University Eye Hospital Tuebingen, Calwerstraße 7/1, 72076 Tuebingen, Germany Received 18 September 2003; accepted in revised form 6 April 2004 Available online 20 July 2004
Abstract Myopia is a condition in which the eye is too long for the focal length of cornea and lens. Analysis of the messengers that are released by the retina to control axial eye growth in the animal model of the chicken revealed that glucagon-immunoreactive amacrine cells are involved in the retinal image processing that controls the growth of the sclera. It was found that the amount of retinal glucagon mRNA increased during treatment with positive lenses and pharmacological studies supported the idea that glucagon may act as a stop signal for eye growth. Glucagon exerts its regulatory effects by binding to a single type of glucagon receptor. In this study, we have sequenced the chicken glucagon receptor and compared its DNA and amino acid sequence with the human and mouse homologues. After sequencing about 80% of the receptor, we found a homology between 79·4 and 75·6% on cDNA level. At the protein level, about 73% of the amino acids were identical. Moreover, the cellular localization and regulation of the glucagon receptor in the chick retina was studied. In situ hybridization studies showed that many cells in the ganglion cell layer and inner nuclear layer, and some cells in the outer nuclear layer, express the receptor mRNA. Injection of the glucagon agonist Lys17,18,Glu21-glucagon induced a down-regulation of glucagon receptor mRNA content. Since the mouse would be an attractive mammalian model to study the biochemical and genetic basis of myopia, and because recent studies have demonstrated that form deprivation myopia can be induced, the expression of preproglucagon and glucagon receptor genes were also studied in the mouse retina and were found to be expressed. q 2004 Elsevier Ltd. All rights reserved. Keywords: animal; myopia/metabolism; chickens/anatomy and histology; retina/cytology; eye/growth and development/metabolism
1. Introduction Using animal models, it was shown that ocular growth is precisely regulated by visual experience. If emmetropic animals wear negative or positive spectacle lenses, their eyes respond with enhanced or reduced axial growth, respectively, and thereby compensate for the imposed refractive errors. This lens compensation is largely independent of higher cortical processing or accommodation. A local biochemical mechanism within the retina is involved in compensation. Previous studies have shown that glucagonergic ZENKimmunoreactive amacrine cells respond to defocus in the retinal image and even to its sign (Fischer et al., 1999; Bitzer and Schaeffel, 2002). The glucagonergic cells show a sign of * Corresponding author. Dr Marita P. Feldkaemper, Section of Neurobiology of the Eye, University Eye Hospital Tuebingen, Calwerstraße 7/1, 72076 Tuebingen, Germany. E-mail address: [email protected] (M.P. Feldkaemper). 0014-4835/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. DOI:10.1016/j.exer.2004.04.009
defocus specific up-regulation of the transcription factor ZENK with positive lenses, and down-regulation with negative lenses already after 30 min of treatment. Until now, only little information about the role of glucagon in retinal signal processing is available and neither the upstream regulatory pathways nor the downstream signal-transduction cascades are known. Apart from its well documented role as a key regulator of synthesis and mobilization of glucose in the liver and thereby as a counter regulatory hormone, opposing the actions of insulin, it has been shown to act as a neurotransmitter or neuromodulator in the central nervous system (Saskai et al., 1985; Morawska et al., 1998). Pharmacological experiments were in line with the hypothesis that glucagon may act as an eye growth inhibiting signal since intravitreal injection of glucagon agonists completely inhibited both lens-induced myopia development (Feldkaemper and Schaeffel, 2002) and form deprivation myopia (Lencses et al., 2000; Stell et al., 2000) in a dosedependent manner. Moreover, intravitreal injection of glucagon completely suppressed choroidal thinning that
322
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
normally occurs if negative lenses or diffusers are worn (Zhu et al., 2001). Recently, it was also found that the glucagon mRNA content is regulated in a bi-directional way, depending on the sign of imposed defocus. This result supports the idea that glucagon may act as a stop-and-go signal for eye growth. There was evidence of a transient increase in glucagon receptor mRNA levels in lens-treated eyes after both negative or positive lens wear (Feldkaemper et al., 2000; Buck et al., 2004). Another finding that is in line of a potential role of glucagon in the control of refractive errors was that intravitreal quisqualate injection resulted in the destruction of various different amacrine cell types but that deprivation myopia could still be induced. Among the retinal cells that appeared almost unaffected by the treatment were amacrine cells immunoreactive for glucagon (Fischer et al., 1998). Therefore, it seems likely that the glucagon cells are involved in the visual regulation of ocular growth and that glucagon may act as a stop signal for axial eye elongation. The present study was performed to obtain more information on the glucagon downstream signalling cascade. Glucagon exerts its regulatory effects by binding to the glucagon receptor which is closely related to the glucagonlike peptide-1, secretin, vasoactive intestinal peptide, and gastric inhibitory polypeptide receptors, and which belongs to the superfamily of G-protein coupled receptors (GPCR) (Jelinek et al., 1993). Binding of glucagon to the receptor leads to a rapid and long-lasting action. Stimulation of the glucagon receptor modulates adenylate cyclase and initiates the production of cAMP. The glucagon receptor activates extracellular signal-regulated protein kinase 1/2 via cAMPdependent protein kinase (Jiang et al., 2001). In addition, glucagon can exert its effects on signalling pathways via cAMP-independent interactions leading to stimulation of phospholipase C and release of Ca2þ from IP3-sensitive intracellular Ca2þ stores (Hansen et al., 1998; Navarro et al., 1999; Mayo et al., 2003), consistent with earlier descriptions of dual glucagon signalling pathways in hepatocytes (Wakelam et al., 1986). High levels of glucagon receptor mRNA were found in rat and mouse liver and kidney (Burcelin et al., 1995; Yamato et al., 1997) and, to a lesser extent, in heart, adipose tissue, spleen, pancreatic islets, ovary and thymus stomach, small intestine, adrenal glands, pancreas, thyroid, and skeletal muscle (Svoboda et al., 1994; Hansen et al., 1998). The presence of glucagon receptor mRNA in tissues known to be responsive to glucagon suggests that these effects are mediated by specific glucagon receptors. The detection of glucagon receptor mRNA in the spleen, thymus, thyroid, adrenal gland, ovary and skeletal muscle, all tissues where glucagon was is not expected to act suggests that there may be novel functions of glucagon that have yet to be analysed. Previous studies demonstrated the existence of two classes of binding sites: a high-affinity class with a KD of 7 ^ 0·8 nM and a Bmax of 2·3 ^ 0·2 pmol mg21 of protein and a lowaffinity class with a KD of 84·4 ^ 2·5 nM and a Bmax of 16·5 ^ 2·3 pmol mg21 of protein (Fernandez-Durango et al.,
1990). In contrast to the detailed knowledge on glucagon receptor mRNA expression in the tissues listed above, no information on the spatial distribution of the glucagon receptor in the retina is available. We have, therefore, studied the cellular localization and regulation of glucagon receptors at the mRNA level in the chick retina, using in situ hybridization. To make this study possible, the chicken glucagon receptor message was partly sequenced and amino acid composition of the chicken glucagon receptor was compared with that of the human, rat and mouse receptors. Recently, it was attempted to establish a mouse model for myopia (Schaeffel and Burkhardt, 2002; Schaeffel et al., 2004). Because the mouse genome was largely sequenced, the mouse would be an attractive model to study the biochemical and genetic basis of myopia. Until now, only a few studies addressed the question whether or not glucagon is also present in the mammalian retina. While one study failed to detect glucagonergic neurons in the rat retina (Tornqvist and Ehinger, 1983), another group detected glucagon-immunoreactive cells in the ganglion cell layer and inner nuclear layer in mouse and rat retina (Das et al., 1985). In an attempt to resolve these conflicting observations, we examined preproglucagon and glucagon receptor mRNA expression in the mouse retina and blood, using polymerase chain reaction.
2. Material and methods Animals. White leghorn chickens were obtained from a local hatchery one day after hatching and raised under a 12/12 hr light/dark cycle. Black wildtype mice (C57BL/6JIco) were obtained from Charles River Laboratories, Sulzfeld, Germany. The use of animals was in accordance with the guidelines established by the University of Tu¨bingen Animal Care Committee and the German Council on Animal care and was carried out in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Tissue preparation and experimental procedure. Animals were killed by an overdose of ether and immediately enucleated. The chickens were 9–14 days old whereas the mice were aged from 36 to 70 days. Chicken eyes were cut with a razor blade perpendicular to the anterior–posterior axis, approximately 1 mm posterior to the ora serrata. The anterior segment of the eye was discarded and the eyecups were processed for in situ hybridization. Six chicks were intravitreally injected every second day with 2·5 nmol of the glucagon agonist Lys17,18,Glu21-glucagon into one eye and water into the contralateral eye. It is already known that this concentration of the agonist inhibits lens-induced myopia development completely. After 6 days, receptor expression in both eyes was compared using in situ hybridization technique. Mouse eyes were cut out at the optic nerve head with a pair of scissors. The retina was carefully removed from the posterior segment, separated and immediately cooled in
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
liquid nitrogen. Moreover, control tissues (liver, small intestine) were carefully separated, cooled and stored at 2 808C until RNA extraction. Whole blood was collected after decapitation directly into a tube containing Trizol (Invitrogen, Carlsbad, CA, USA). RNA isolation and reverse transcription polymerase chain reaction (RT-PCR). Total RNA from the different tissues was extracted using the RNAeasy Mini Kit (Quiagen, Hilden, Germany). The whole blood sample was homogenized by passing it several times through a syringe and RNA was isolated according to the instructions for RNA isolation using Trizol. All samples were digested with DNase-I (Boehringer Mannheim, Mannheim, Germany). First strand cDNA was synthesized from 500 ng RNA, using an oligo d(T) primed 25 ml reaction mixture and MMLV reverse transcriptase according to standard procedures. The PCR amplifications were performed using 2 ml of the first strand cDNA in a final volume of 25 ml, 1 U AmpliTaq polymerase (glucagon receptor chick, wobbled primers) or 1 U TaqGold, a final MgCl2 concentration of 2·5 mM and a final primer concentration of 0·4 mM . The reaction was amplified through 40 cycles, each consisting of 30 s at 948C, 45 s at 538C (glucagon receptor chick, wobbled primers) or 568C (glucagon receptor and preproglucagon, mouse) or 578C (glucagon receptor chick, specific primers), respectively, and 45 s at 728C. The specific forward and reverse primers for the mouse glucagon and glucagon receptor amplification were as follows: preproglucagon (mouse) forward: ATAATGCTGGTGCAAGGCAG, Preproglucagon (mouse) reverse: GTCCCTTCAGCATGTCTCTCAA (product length: 271 bp). Glucagon receptor (mouse) forward: CATGCAGTACGGCATCATAG, glucagon receptor (mouse) reverse: CAGGAAGACAGGAATACGCAG (product length: 251 bp). Primers for glucagon amplification were complementary to sense nucleotide þ 135 to þ 154 of the 50 untranslated region and antisense nucleotides þ 406 to þ 385 of the mouse preproglucagon coding sequence (EMBL: AF276754) and primers for glucagon receptor amplification were complementary to sense nucleotide þ 827 to þ 846 and antisense þ 1076 to þ 1056 of the liver glucagon receptor coding sequence (EMBL: BC031885). Sequencing of the chick glucagon receptor. Conserved regions in the mouse (EMBL: BC031885) and human glucagon receptor sequence (EMBL: HS03469) were identified and degenerated primers were constructed that amplified a sequence of 962 bp. Glucagon receptor (chick) forward primer was CAAC/TATC/TTCCTGCCCCTGGTA and reverse primer CAGTAGAGA/G/CACA/GGCC/TACCAGC. The resultant PCR product of the expected size (according to the mouse and human glucagon receptor sequence) was cut out and automatic sequence analysis was performed. According to the obtained chicken glucagon receptor sequence new specific primers were designed (glucagon receptor forward: ACATCCACATGAACCTCTTCG; glucagon receptor reverse: TAGTCCGTGTAGCGCATCTG, product length 502 bp).
323
Probe preparation for in situ hybridization studies. Antisense and sense digoxigenin (Dig)-labelled riboprobes of the chicken glucagon receptor were prepared as follows. Total RNA was isolated from retinal tissue, transcribed into cDNA and afterwards amplified using ACATCCACATGAACCTCTTCG as the forward primer and TAGTCAGTGTAGCGCATCTG as the reverse primer. The resulting PCR product with a length of 502 bp was subcloned into a pCR4 TOPO cloning vector (Invitrogen, Carlsbad, California) according to the manufacturer’s instructions. The correct insertion was verified by automatic sequencing. One microgram of plasmid DNA containing the cDNA insert was linearized by restriction enzyme digestion using either Not I or Dra I (MBI Fermentas, St.Leon-Rot, Germany). Digoxigenin –UTP-labelled sense and antisense riboprobes were generated by in vitro transcription of linearized plasmids with a kit (DIG RNA labelling Kit, Roche Molecular Biochemicals, Mannheim, Germany). In situ hybridization studies. For in situ hybridization, kidney and eyecups were fixed at 48C for 20 min in 4% paraformaldehyde (PFA) þ 3% sucrose, washed three times with phosphate buffer (PB; 0·1 M , pH 7·4), and cryoprotected by immersion in 30% sucrose in PB overnight at 48C. Eyecups were then embedded in cryomatrix (TissueTek, Leica, Nussloch, Germany) and frozen. Radial sections (10 mm) were cut on a cryostat. Air-dried sections were treated with 0·3 mg ml21 proteinase K at 378C for 8 min. After being washed with DEPC water for two times, the sections were postfixed at room temperature for 15 min in 4% paraformaldehyde and washed again with DEPC water. In a humid chamber, sections were prehybridized in prehybridization solution (0·2% SDS, 1% BSA, 5 £ SSC) at 558C for 20 min. Hybridization was performed overnight at 558C in a humid box with hydrolyzed digoxigenin-labelled riboprobes for the chick glucagon receptor (60 ng/well) in the hybridization solution (Amersham, Buckinghamshire, UK). Posthybridization washing steps were performed two times for 30 min each in 0·1 £ SSC at 558C. After a 10-min wash in Tris–buffered saline (TBS; 0·15 M NaCl and 0·1 M Tris–HCl, pH 7·5) at room temperature the slices were incubated for 30 min with blocking solution (5% blocking reagent in 0·1 M maleic acid, 0·15 M NaCl, pH 7·5, Roche Molecular Biochemicals). Drained slices were incubated with alkaline-phosphataseconjugated anti-digoxigenin antibody (1:500, in 5% blocking solution, 0·15% Triton-X-100 in TBS) for 45 min at 378C and washed afterwards two times for 15 min each in TBS at room temperature. After 10 min incubation in AP buffer (0·1 M Tris–HCl, pH 9·5, 1 mM MgCl2, 10% tretramisole-hydrochloride, Fluka) to block endogenous phosphatases, the sections were developed in coloring solution in a humidified chamber in the dark (120 mg nitroblue tetrazoliumchloride, 60 mg 5-bromo-4-chloro-3-indolyl phosphate in 1 ml AP buffer) for 4–24 hr at 48C. Color reaction was stopped with stop buffer (0·1 M Tris–HCl, pH 7·5 and 0·01 M EDTA) and slices were covered with sorbitol (Merck, Darmstadt, Germany).
324
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
Histology. To compare the abundance of glucagon amacrine cells with the amount of glucagon receptor mRNA expressing cells, frozen sections of the chicken retina were stained with a monoclonal mouse anti-glucagon antibody (1:400) specific for the N-terminus of glucagon (Gordon Ohning, University of California, CA, USA). The second antibody solution contained 1:500 oregon green conjugated goat-anti mouse IgG. The method was already described in detail by Bitzer and Schaeffel (2002).
3. Results 3.1. Partial sequencing of the chicken glucagon receptor To obtain partial glucagon receptor sequence information, degenerate oligonucleotide primers were used that amplified a conserved region of the receptor. A 962 bp long sequence was obtained (123glucrez) and aligned with known partial glucagon receptor mRNA sequences which
Fig. 1. Glucagon receptor sequence alignment (Gallus domesticus). Known partial chicken glucagon receptor mRNA sequences (EMBL: bm426498, EMBL: bm427538) were aligned with the newly obtained chick glucagon receptor sequence (123glurez). The resultant alignment length was 1377 bp.
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
all coded for the 50 end of the chicken glucagon receptor. The resultant alignment length was 1377 bp (Fig. 1). Sequence analysis located the start codon ATG at position 225 –228 of the aligned sequence. Homologies at the cDNA level between the chicken and human (EMBL: HS03469) or mouse glucagon receptor (EMBL: BC031885) were 79·4 or 75·6%, respectively (BESTFIT; HUSAR, Heidelberg, Germany).
3.2. Homology of the chicken glucagon receptor protein sequence with the human and mouse glucagon receptor The obtained glucagon receptor sequence alignment was translated into the corresponding amino acid sequence. The coding region of the sequence from basepair 229 to 1377 corresponded to 385 amino acids. The already known human or mouse glucagon receptor is 477 bp (SP: P47871) or 485 bp (PIR: JC4264) long, respectively. This indicates that about 80% of the receptor sequence are known. Comparing amino acid composition of the chicken and human glucagon receptor showed that 72·7% of the amino acids were identical and 83·6% were homologous, if conservative substitutions were included (Fig. 2). The chicken and mouse receptor were 72·8% identical and 84·5% homologous. Putative transmembrane domains according to Ngan et al. (1999) are shown in boxes.
325
3.3. Localization of the glucagon receptor in the chick retina In situ hybridization studies were performed to localize the mRNA of the chicken glucagon receptor in retinal cells. First of all, chicken kidney tissue was studied as a positive control. Intense staining in the renal medulla can be seen using the antisense Digoxigenin probe (Fig. 3(D)), whereas the sense probe revealed only faint background staining (Fig. 3(E)). Recently, glucagon receptor mRNA was detected in the rat proximal tubule, as well as in the thick ascending limb and collecting duct. Specific binding of glucagon occurred in both the renal cortex and medulla (Marks et al., 2003). In the retina of 2– 3-weeks-old chicks, about 50% of the cells in the ganglion cell layer showed glucagon receptor mRNA expression (Fig. 3(A)). The ganglion cell layer in the chick consists of displaced amacrine cells as well as of ganglion cells. Since the ganglion cells were not selectively marked and could not be reliably distinguished from displaced amacrine cells, the labelled cells may belong to either type. Moreover, an intense staining in the inner nuclear layer can be seen, especially at the border towards the inner plexiform layer. Again, up to 50% of the cells in the inner nuclear layer were stained, most of them presumably amacrine cells and bipolar cells. In the outer nuclear layer where the photoreceptor somata are located, only a few cells were labelled. These cells probably represent more than one type of photoreceptors, since chicken photoreceptors are quite
Fig. 2. Comparison of the amino acid sequence of the first 385 amino acids of the glucagon receptor of the chick (top) and its human orthologue (SP: P47871). The boxes represent the putative transmembrane domains (TMD). Comparison revealed that 72·7% of the amino acids were identical.
326
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
Fig. 3. In situ hybridization with digoxigenin-labelled glucagon receptor riboprobes and immunohistochemical localization of glucagonergic amacrine cells. Radial sections of chick retinas at the age of 2–3 weeks. (A) Antisense riboprobe of chicken glucagon receptor-labelled cells in the ganglion cell layer (GCL, arrow) and the inner nuclear layer (INL, arrow). Some cells in the outer nuclear layer (ONL) were stained also. (B) Glucagon receptor sense control in the chicken retina. (C) Amacrine cells labelled for glucagon. (D) Intense staining of glucagon receptor mRNA can be seen in the renal medulla of the chicken kidney using the antisense riboprobe. (E) Glucagon receptor sense control in the chicken kidney. A scale bar, representing 200 mm, is included in each picture.
neatly stratified according to type. Comparing the numbers of glucagon receptor expressing cells (Fig. 3(A)) and glucagon cells (Fig. 3(C)) revealed that although only a small (about 1%) proportion of the amacrine cells are glucagonergic, many cells contain the glucagon receptor mRNA, and are therefore likely to express the glucagon receptor. 3.4. Modulation of retinal glucagon receptor mRNA expression Since the density of glucagon receptors on the cell surface determines the sensitivity of the tissue to glucagon, we have studied the regulation of glucagon receptor mRNA by applying the glucagon agonist Lys17,18, Glu21-glucagon to the retina. This agonist, as well as the treatment protocol was previously shown to inhibit myopia development completely (Feldkaemper and Schaeffel, 2002). A representative example showing the effect of the agonist on receptor mRNA levels is presented in Fig. 4. In situ hybridization studies showed that, in 5 of 6 treated animals, the glucagon agonist (Fig. 4(C)) induced an almost complete down-regulation of the glucagon receptor mRNA. This down-regulation was observed in all cell types.
3.5. Glucagon and glucagon receptor mRNA expression in the mouse retina It is known that glucagon is expressed in several tissues in the mouse, including liver and intestine (Burcelin et al., 1995; Yamato et al., 1997). Until now, immunohistochemical detection of glucagon in the mouse retina failed. We were unable to obtain any staining with the three different antibodies that were available (1. anti-glucagon, mouse monoclonal antibody, Gordon Ohning, University of California Los Angeles, Los Angeles, CA; 2. anti-glucagon, goat polyclonal antibody, Santa Cruz, CA, USA; 3. antiglucagon, mouse monoclonal antibody, Sigma Aldrich). The failure to detect glucagon-immunoreactive cells may be either due to the specificity of the antibodies or, more likely, due to the sub-threshold concentrations of glucagon in the retina. We therefore investigated preproglucagon and glucagon receptor expression using PCR which is much more sensitive. Glucagon, similar to many biologically active peptides and neuropeptides, is initially synthesized as a larger precursor that is cleaved by tissue specific endoproteases. The mouse preproglucagon gene consists of glucagon, glucagon-like peptide I and glucagon-like peptide II. The primers that we used amplified the sequence coding for glucagon and part of the sequence coding for
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
327
4. Discussion
Fig. 4. Effect of the glucagon agonist Lys17,18,Glu21-glucagon on glucagon receptor expression in the retina. Chicks were intravitreally injected every second day with 2·5 nmol of the glucagon agonist into one eyes and with water into the contralateral eye. After 6 days, the glucagon receptor expression in both eyes was compared using in situ hybridization technique ðn ¼ 6Þ: (A) Glucagon receptor expression after injection of water, antisense probe. (B) Same section as in (A) labelled with the sense probe. (C) Glucagon receptor expression after injection of the glucagon antagonist. (D) Same section as in (C) labelled with the sense probe. A scale bar, representing 100 mm, is included in each picture.
glucagon-like peptide I. In 36– 70-days-old mice, preproglucagon mRNA was detected in the lens, retina, small intestine and liver (Fig. 5(A)). The bands showed the expected size and the authenticity of the PCR products in the retina and liver was confirmed by DNA sequencing. In the whole blood sample, preproglucagon mRNA content was below the detection limit. Moreover, the water control (no template control) and the controls in which no reverse transcriptase was added (results not shown) displayed no preproglucagon mRNA expression. Glucagon receptor transcripts were detected in retina, small intestine, liver and whole blood but not in lens and water control (Fig. 5(B)).
Fig. 5. Analysis of preproglucagon expression (A) and glucagon receptor expression (B) by RT-PCR in lens, retina, small intestine, liver and whole blood of mice. Preproglucagon was expressed in lens, retina, intestine and liver whereas glucagon receptor was expressed in retina, intestine, liver and whole blood. Water was used as non-template control (NT-control).
In the present study, sequencing of the chicken glucagon receptor and sequence comparison to its human and mouse counterpart revealed a high degree of conservation and a similar structural composition of the protein in these species. Until now, a number of residues that are involved in ligand binding and receptor activation, such as Ser-80, Gln-142 and especially Asp-64 are already known for the human glucagon receptor (Ngan et al., 1999). The amino acids Asp-64 and Ser-80 are also conserved in the chick glucagon receptor, suggesting that they are crucial to the binding of glucagon to mediate changes in cAMP. In the chick, glutamine at position 142 is replaced by lysine. The present report was aimed at adding more information on the glucagon downstream signal-transduction cascade. As already mentioned in Section 1, glucagon may act as a stop signal for eye growth at least in the chick. Identification of the retinal cells that respond to glucagon is important for understanding the signalling pathways involved. On RNA in situ hybridization, we observed glucagon receptor mRNA in about 50% of the cells in the ganglion cell layer but it has to be kept in mind that in situ hybridization histochemistry is no quantitative method. Ehrlich (1981) investigated the regional specialization of the chick retina as revealed by the size and density of neurons in the ganglion cell layer. On the basis of both morphological criteria and survival after ganglion cell axotomy, they found smaller cells with uniform density of about 4·000 cells mm22 across the entire retina which comprise 30 –35% of the total number of cells in the ganglion cell layer. The author suggested that these cells were displaced amacrine cells. In the present study, we cannot assess which cell type expresses the receptor although the major fraction of labelled cells were probably ganglion cells, making up 65 –70% of the total population in the ganglion cell layer. Moreover, a large number of cells in the inner nuclear layer, especially at the border towards the inner plexiform layer and some cells in the outer nuclear layer showed glucagon receptor mRNA expression. Although only a small proportion (about 1%) of the amacrine cells are glucagonergic, glucagon may have a large influence on retinal processing, since the glucagon receptor mRNA is widely distributed. Since so many cells showed glucagon receptor expression, glucagon may exert a broad range of actions in metabolism and signal transduction. However, it cannot be proven that the glucagon receptor mRNA is also translated into protein. Unfortunately, no antibodies are available that are known to recognize the chicken glucagon receptor directly. Prior studies that dealt with the regulation of rat glucagon receptor expression (Yoo-Warren et al., 1994) suggested that the major regulation in hepatic glucagon receptor expression in vivo occurs at the posttranscriptional level. Further studies are necessary to investigate whether the chick retinal glucagon receptor is regulated in a similar fashion. Recently, real-time PCR studies (Buck et al., 2004) have shown glucagon
328
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329
and glucagon receptor expression in the chick retina and choroid. Interestingly, the amount of glucagon receptor mRNA was about 6 –8-fold higher in the RPE cells compared to the retina. Since the RPE cells of the chick contain a high amount of melanin and have therefore a high optical density, glucagon receptor mRNA could not be studied using the Digoxigenin-labelled probes. The extracellular concentrations of agonists or antagonists that bind to receptors can regulate the density of functional receptors (Abrahamsen et al., 1995). Although much has been learned about the mechanisms of short-term desensitization, inducing changes in GPCR within seconds to minutes after stimulation by agonists, considerably less is known about the biochemical mechanisms that regulate GPCR activity upon sustained agonist exposure. Long-term regulation of GPCRs or ‘down-regulation’ is thought to be important in the process of physiological adaptation that is induced by endogenous ligands. Desensitation is also an important issue in the clinics, when exogenously administered drugs are used in a chronic or repeated manner (Tsao and von Zastrow, 2001). The most common mechanism to adjust sensitivity is the control of the rate of receptor protein degradation. In addition, a decreased rate of receptor mRNA synthesis and an increased rate of receptor mRNA degradation have also been observed (Goin and Nathanson, 2002). For glucagon it has already been shown that there is a dosedependent decrease glucagon receptor mRNA expression in hepatocytes (Abrahamsen et al., 1995). This sort of negative feedback regulation was confirmed in the present study on the retinal level. After exogenous exposure of the retina to the agonist Lys17,18,Glu21-glucagon, the number of cells that expressed glucagon receptor mRNA and the intensity of the staining decreased quite dramatically. The mouse would be an attractive model to study the biochemical and genetic basis of myopia and preliminary studies, trying to induce myopia by visual deprivation showed some promise (Schaeffel et al., 2004). However, until now, only a few studies have addressed the question as to whether glucagon is also present in the mammalian retina. While one study failed to detect glucagon neurons in the retina of rat, rabbit, cat, pig, or cow (Tornqvist and Ehinger, 1983), others (Das et al., 1985) detected glucagonergic cells in the ganglion cell layer and inner nuclear layer, including Muller cells, both in mouse and rat. The results of the latter study are debatable, because glucagon was detected in virtually all neurons in the inner retina. Moreover, the authors only stated that preabsorption of the antibody with glucagon blocked the staining but data were not presented. Since we also could not find glucagon-immunoreactive cells in the mouse retina, using three different antibodies, we studied preproglucagon and glucagon receptor expression in the retina using the more sensitive polymerase chain reaction. Both transcripts were detected. In addition, preproglucagon was also found in the lens, even though no glucagon receptor expression could be shown. Preproglucagon mRNA could not be detected in the blood. The observation that
preproglucagon and glucagon receptor mRNA were both found in the retina may indicate that low amounts of glucagon are, in fact, produced in the retina itself. They may still have an important function in neuromodulation and/or metabolism of retinal cells despite the low levels. On the other hand, since we showed preproglucagon expression, it is also possible that glucagon-like peptide I and/or glucagonlike peptide II are expressed in the mouse and chicken retina and that their receptors may mediate the effects of glucagonrelated peptides on eye growth. Especially in the mammalian retina, it is possible that yet another neuromodulator has taken over the role of glucagon in myopia development. The localization of glucagon and glucagon-like peptides and their receptor mRNAs in the mouse retina, as well as their possible functional role in the mouse animal model will therefore be further investigated in the future.
Acknowledgements This study was supported by the German Research Council (SFB 430, TP C1).
References Abrahamsen, N., Lundgren, K., Nishimura, E., 1995. Regulation of glucagon receptor mRNA in cultured primary rat hepatocytes by glucose and cAMP. J. Biol. Chem. 270, 15853–15857. Bitzer, M., Schaeffel, F., 2002. Defocus-induced changes in ZENK expression in the chicken retina. Invest. Ophthalmol. Vis. Sci 43, 246 –252. Buck, C., Schaeffel, F., Simon, P., Feldkaemper, M., 2004. Effects of positive and negative lens treatment on retinal and choroidal glucagon and glucagon receptor mRNA levels in the chicken. Invest. Ophthalmol. Vis. Sci. 45, 402–409. Burcelin, R., Li, J., Charron, M.J., 1995. Cloning and sequence analysis of the murine glucagon receptor-encoding gene. Gene 164, 305– 310. Das, A., Pansky, B., Budd, G.C., 1985. Glucagon-like immunoreactivity in mouse and rat retina. Neurosci. Lett. 60, 215– 218. Ehrlich, D., 1981. Regional specialization of the chick retina as revealed by the size and density of neurons in the ganglion cell layer. J. Comp. Neurol. 195, 643–657. Feldkaemper, M.P., Schaeffel, F., 2002. Evidence for a potential role of glucagon during eye growth regulation in chicks. Vis. Neurosci. 19, 755 –766. Feldkaemper, M.P., Wang, H.Y., Schaeffel, F., 2000. Changes in retinal and choroidal gene expression during development of refractive errors in chicks. Invest. Ophthalmol. Vis. Sci. 41, 1623–1628. Fernandez-Durango, R., Sanchez, D., Fernandez-Cruz, A., 1990. Identification of glucagon receptors in rat retina. J. Neurochem. 54, 1233–1237. Fischer, A.J., McGuire, J.J., Schaeffel, F., Stell, W.K., 1999. Light- and focus-dependent expression of the transcription factor ZENK in the chick retina. Nat. Neurosci. 2, 706–712. Fischer, A.J., Seltner, R.L., Poon, J., Stell, W.K., 1998. Immunocytochemical characterization of quisqualic acid- and N-methyl-D -aspartate-induced excitotoxicity in the retina of chicks. J. Comp. Neurol. 393, 1 –15. Goin, J.C., Nathanson, N.M., 2002. Subtype-specific regulation of the expression and function of muscarinic acetylcholine
M.P. Feldkaemper et al. / Experimental Eye Research 79 (2004) 321–329 receptors in embryonic chicken retinal cells. J. Neurochem. 83, 964–972. Hansen, L.H., Gromada, J., Bouchelouche, P., Whitmore, T., Jelinek, L., Kindsvogel, W., Nishimura, E., 1998. Glucagon-mediated Ca2 þ signaling in BHK cells expressing cloned human glucagon receptors. Am. J. Physiol 274, C1552–C1562. Jelinek, L.J., Lok, S., Rosenberg, G.B., Smith, R.A., Grant, F.J., Biggs, S., Bensch, P.A., Kuijper, J.L., Sheppard, P.O., Sprecher, C.A., 1993. Expression cloning and signaling properties of the rat glucagon receptor. Science 259, 1614–1616. Jiang, Y., Cypess, A.M., Muse, E.D., Wu, C.R., Unson, C.G., Merrifield, R.B., Sakmar, T.P., 2001. Glucagon receptor activates extracellular signal-regulated protein kinase 1/2 via cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. USA 98, 10102–10107. Lencses, K.A., Ahn, J.M., Hurby, V.J., Stell, W.K., 2000. Glucagon amacrine cells prevent deprivation myopia in chick. Soc. Neurosci. Abstr. 26, 665. Marks, J., Debnam, E.S., Dashwood, M.R., Srai, S.K., Unwin, R.J., 2003. Detection of glucagon receptor mRNA in the rat proximal tubule: potential role for glucagon in the control of renal glucose transport. Clin. Sci. 104, 253–258. Mayo, K.E., Miller, L.J., Bataille, D., Dalle, S., Goke, B., Thorens, B., Drucker, D.J., 2003. International union of pharmacology. XXXV. The glucagon receptor family. Pharmacol. Rev. 55, 167– 194. Morawska, D., Sieklucka-Dziuba, M., Kleinrok, Z., 1998. Central action of glucagon. Pol. J. Pharmacol. 50, 125– 133. Navarro, I., Leibush, B., Moon, T.W., Plisetskaya, E.M., Banos, N., Mendez, E., Planas, J.V., Gutierrez, J., 1999. Insulin, insulin-like growth factor-I (IGF-I) and glucagon: the evolution of their receptors. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 122, 137 –153. Ngan, E.S., Chow, L.S., Tse, D.L., Du, X., Wei, Y., Mojsov, S., Chow, B.K., 1999. Functional studies of a glucagon receptor isolated from frog Rana tigrina rugulosa: implications on the molecular evolution of glucagon receptors in vertebrates. FEBS Lett. 457, 499–504.
329
Saskai, H., Tominaga, M., Marubashi, S., Katagiri, T., 1985. Glucagon as a neurotransmitter. Biomed. Res. Suppl. 6, 91– 100. Schaeffel, F., Burkhardt, E., 2002. Measurement of refractive state and deprivation myopia in a black wildtype mouse. Invest. Ophthalmol. Vis. Sci. 43, abstract #182. Schaeffel, T., Burkhardt, E., Howland, H., Williams, R.W., 2004. Measurement of refractive state and deprivation myopia in two strains of mice. Optom. Vis. Sci 81, 99–110. Stell, W.K., Lencses, K., Ahn, J.M., Hruby, V.J., 2000. Glucagonsynthesizing amacrine cells mediate chor-oidal compensation for plus-defocus in the chick eye. Eur. J. Neurosci. 12, 487. Svoboda, M., Tastenoy, M., Vertongen, P., Robberecht, P., 1994. Relative quantitative analysis of glucagon receptor mRNA in rat tissues. Mol. Cell. Endocrinol. 105, 131– 137. Tornqvist, K., Ehinger, B., 1983. Glucagon immunoreactive neurons in the retina of different species. Graefes Arch. Clin. Exp. Ophthalmol. 220, 1–5. Tsao, P.I., von Zastrow, M., 2001. Diversity and specificity in the regulated endocytic membrane trafficking of G-protein-coupled receptors. Pharmacol. Ther. 89, 139 –147. Wakelam, M.J., Murphy, G.J., Hruby, V.J., Houslay, M.D., 1986. Activation of two signal-transduction systems in hepatocytes by glucagon. Nature 323, 68–71. Yamato, E., Ikegami, H., Takekawa, K., Fujisawa, T., Nakagawa, Y., Hamada, Y., Ueda, H., Ogihara, T., 1997. Tissue-specific and glucosedependent expression of receptor genes for glucagon and glucagon-like peptide-1 (GLP-1). Horm. Metab. Res. 29, 56– 59. Yoo-Warren, H., Willse, A.G., Hancock, N., Hull, J., McCaleb, M., Livingston, J.N., 1994. Regulation of rat glucagon receptor expression. Biochem. Biophys. Res. Commun. 205, 347–353. Zhu, X., Feldkaemper, M.P., Winawer, J.A., Park, T., Wallman, J., 1994. What ocular components underlie the inhibition of myopia or hyperopia by glucagon or by its antagonist? Invest. Ophthalmol. Vis. Sci. 42, 318.