Aquaporin expression and localization in the rabbit eye

Experimental Eye Research 147 (2016) 20e30

Contents lists available at ScienceDirect

Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer

Research article

Aquaporin expression and localization in the rabbit eye Barbara Bogner a, Falk Schroedl a, b, Andrea Trost a, Alexandra Kaser-Eichberger a, Christian Runge a, Clemens Strohmaier a, Karolina A. Motloch a, Daniela Bruckner a, Cornelia Hauser-Kronberger c, Hans Christian Bauer d, Herbert A. Reitsamer a, * a

University Clinic of Ophthalmology and Optometry, Research Program for Experimental Ophthalmology and Glaucoma Research, Paracelsus Medical University/SALK, Salzburg, Austria b Department of Anatomy, Paracelsus Medical University, Salzburg, Austria c Department of Pathology, Paracelsus Medical University, Salzburg, Austria d Department of Tendon-and Bone Regeneration, Paracelsus Medical University, Salzburg, Austria

a r t i c l e i n f o

a b s t r a c t

Article history: Received 22 January 2016 Received in revised form 15 April 2016 Accepted in revised form 18 April 2016 Available online 21 April 2016

Aquaporins (AQPs) are important for ocular homeostasis and function. While AQP expression has been investigated in ocular tissues of human, mouse, rat and dog, comprehensive data in rabbits are missing. As rabbits are frequently used model organisms in ophthalmic research, the aim of this study was to analyze mRNA expression and to localize AQPs in the rabbit eye. The results were compared with the data published for other species. In cross sections of New Zealand White rabbit eyes AQP0 to AQP5 were labeled by immunohistology and analyzed by confocal microscopy. Immunohistological findings were compared to mRNA expression levels, which were analyzed by quantitative reverse transcription real time polymerase chain reaction (qRT-PCR). The primers used were homologous against conserved regions of AQPs. In the rabbit eye, AQP0 protein expression was restricted to the lens, while AQP1 was present in the cornea, the chamber angle, the iris, the ciliary body, the retina and, to a lower extent, in optic nerve vessels. AQP3 and AQP5 showed immunopositivity in the cornea. AQP3 was also present in the conjunctiva, which could not be confirmed for AQP5. However, at a low level AQP5 was also traceable in the lens. AQP4 protein was detected in the ciliary non-pigmented epithelium (NPE), the retina, optic nerve astrocytes and extraocular muscle fibers. For most tissues the qRT-PCR data confirmed the immunohistology results and vice versa. Although species differences exist, the AQP protein expression pattern in the rabbit eye shows that, especially in the anterior section, the AQP distribution is very similar to human, mouse, rat and dog. Depending on the ocular regions investigated in rabbit, different protein and mRNA expression results were obtained. This might be caused by complex gene regulatory mechanisms, post-translational protein modifications or technical limitations. However, in conclusion the data suggest that the rabbit is a useful in-vivo model to study AQP function and the effects of direct and indirect intervention strategies to investigate e. g. mechanisms for intraocular pressure modulation or cornea transparency regulation. © 2016 Elsevier Ltd. All rights reserved.

Keywords: Aquaporin expression Eye Rabbit AQP0 AQP1 AQP2 AQP3 AQP4 AQP5

1. Introduction

Abbreviations: AB, antibody; AQP, aquaporin; bs, bovine; CTCA, cell-to-fiber cell adhesion protein; cm, ciliary muscle; CDS, coding sequence; en, endothelium; ep, epithelium; F, forward; GL, ganglion cell layer; GAPDH, Glycerinaldehyd-3phosphat-Dehydrogenase; hu, human; INL, inner nuclear layer; IPL, inner plexiform layer; lf, lens fiber; ms, mouse; mf, muscle fiber; NFL, nerve fiber layer; NPE, non-pigmented epithelium; ONL, outer nuclear layer; OPL, outer plexiform layer; qRT-PCR, quantitative reverse transcription real time polymerase chain reaction; rb, rabbit; rt, rat; R, reverse; st, stroma. * Corresponding author. E-mail address: [email protected] (H.A. Reitsamer). http://dx.doi.org/10.1016/j.exer.2016.04.013 0014-4835/© 2016 Elsevier Ltd. All rights reserved.

Aquaporins (AQPs) are water channels regulating the fluid transport across membranes and other physiological processes in various tissues (Verkman, 2008). They are small integral membrane proteins organized as homologous tetramers and are ubiquitously expressed in animals, plants and lower organisms. In mammals 13 members (AQP0 to AQP12) have been identified. Of these AQP0, AQP1, AQP2, AQP4, AQP5, AQP6 and AQP8 are classical selective water channels, whereas AQP1 also has been associated with increased CO2 permeability of membranes (Kaldenhoff et al., 2014),

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30

AQP6 with anion transport (e.g. nitrate) (Ikeda et al., 2002) and AQP8 with the transfer of H2O2, a member of reactive oxygen species (ROS) (Bienert et al., 2007). A further functional family, referred to as aquaglyceroporins, consists of AQP3, AQP7, AQP9 and AQP10 additionally regulating the transport of small solutes like glycerol, ammonia or lactate. AQP11 and AQP12 belong to the supergene family of the AQPs, therefore called superaquaporins. However, their function is not fully understood yet (Ishibashi et al., 2009; Verkman, 2003; Verkman et al., 2008). Apart from adequate nutrient and oxygen supply, vision depends on sufficient movement of water between and within ocular structures and different AQP-subtypes are abundantly expressed throughout the eye (Stamer et al., 2008). Changes of AQP expression and accordingly AQP-facilitated physiological mechanisms in the eye are described to be linked to different ocular diseases (Schey et al., 2014). Various studies exist about the distribution and localization of AQP0 to AQP5 in human (Hamann et al., 1998), mouse and rat (Hamann et al., 1998; Patil et al., 1997) as well as canine (Karasawa et al., 2011) eyes. Although rabbits are commonly used in ocular research to investigate e. g. (1) ocular hypertension and glaucomatous changes (ElGohary and Elshazly, 2015; Lu et al., 2014), (2) pharmacological effects on IOP, blood flow or aqueous humor dynamics (Bogner et al., 2014; Reitsamer et al., 2009; Reitsamer and Kiel, 2002) or (3) new refractive surgery procedures (Mohamed-Noriega et al., 2014; Trost et al., 2013), reports on AQP expression in the rabbit eye are few (Oen et al., 2006; Varadaraj et al., 2005) and no comprehensive study exists. Therefore, the present study sought to systemically analyze the expression pattern of the classical water channels AQP0, AQP1, AQP2, AQP4 and AQP5 (exclusively selective for water) including the aquaglyceroporin AQP3 in rabbit ocular tissues using immunohistological and molecular biological methods. 2. Methods All animal procedures were approved by the Institutional Animal Care and Use Committee and conducted in accordance with the Association for Research in Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision Research. For tissue collection New Zealand White rabbits were anesthetized with ketamine:xylacine (7:1) and euthanized with an overdose of pentobarbital sodium (Fagron GmbH&Co, Barsbüttel, Germany). The eyes were enucleated and the whole bulb was fixed in 4% PFA for 30 min, before it was opened sagittally and fixed for another 1.5 h. Then the eyes were rinsed in phosphate buffer over night and soaked in 15% sucrose-phosphate-buffer solution. To freeze the tissue, it was immersed in Richard-Allan Scientific® NEG50 frozen section medium (Thermo Scientific, VWR, Austria), frozen at
60  C to
80  C in liquid nitrogen cooled methyl-butane and stored at
20  C. 2.1. Immunohistochemistry 12 mm cross-sections were cut using a cryostat (Mikrom HM 550, Thermo Scientific, Germany). The tissue sections were permeabilized and blocked with 0.05 M TBS containing 1% BSA, 0.1% Triton-X100 and normal serum (species-matched, depending on the origin of the secondary antibody (AB)) for 1 h at RT. Primary AB incubation (Table 1) was performed over night at RT. Alexa 488- or Alexa 555-conjugated secondary AB (1:1000; Life Technologies, Germany) diluted in 0.05 M TBS containing 1% BSA and 0.1% TritonX100 were applied for 1 h at RT. Nuclei were counterstained with 40 ,6-diamidino-2-phenylindole (DAPI) (1:2000; Merck, Austria). Between each incubation step and after DAPI application, washing steps of 3  5 min were performed. The slides were mounted in

21

Table 1 ABs used for immunohistochemistry diluted in 0.05 M TBS containing 1% BSA and 0.1% Triton-X100. The ABs were selected on available immunohistochemistry and Western blot data and were tested on human tissues (samples were taken in accordance to the principles of the Declaration of Helsinki and the regulations of the local ethical committee) and corresponding rabbit tissues. The immunohistochemistry of human tissues resulted in reliable immunopositivity confirming available data of other AB clones (http://www.proteinatlas.org; April 2016) and matched to the immunopositivity detected in rabbit tissues. Primary antibody (clone)

Dilution

Company

Mouse-anti-AQP0 IgG (B-11) Mouse-anti-AQP1 IgG (B-11) Goat-anti-AQP2 IgG (C-17) Goat-anti-AQP3 IgG (C-18) Goat-anti-AQP4 IgG (C-19) Goat-anti-AQP5 IgG (C-19)

1:200 1:200 1:100 1:100 1:200 1:100

SCBT, SCBT, SCBT, SCBT, SCBT, SCBT,

Inc.; Inc.; Inc.; Inc.; Inc.; Inc.;

USA USA. USA USA USA USA

TBS-Glycerin (1:1; pH 8.6) and analyzed by confocal microscopy (LSM 710, Zeiss, Germany). Negative controls were performed with omission of the primary AB and showed no immunoreactivity. 2.2. qRT-PCR Freshly enucleated eyes (n ¼ 3) were dissected and homogenized in Tri-Reagent (Sigma-Aldrich, Austria) using a tissue tearor. After centrifugation the aqueous phase containing total RNA was transferred onto RNA isolation columns of a High Pure RNA Tissue Kit (Roche Applied Sciences, Germany) and was processed according to the manufacturer's protocol including the elimination of genomic DNA by DNase digestion. For tissues with high fat or protein (e. g. retina and the ocular muscle) an additional centrifugation step at 4  C was performed after homogenization to remove insoluble material. The isolated total RNA was quantified by spectrophotometry (Nanophotometer P300, Implen, Germany). The optical density ratio A260/A280 was between 1.8 and 2.1. RNA gels were used to visualize the quality of mRNA. To obtain cDNA, equal amounts of total RNA (1 mg) were used for reverse transcriptase reaction, which was performed with the iScript cDNA Synthesis Kit (Biorad, Germany) based on the provided standard protocol. As not all AQP sequences are published for rabbit, the oligoprimers (VBC Biotech, Austria) used for qRT-PCR were designed based on highly homologous regions of the coding sequences (CDS) of mouse (mus musculus), human (homo sapiens), rat (rattus norvegicus) and, if available, cattle (bos taurus) and rabbit (oryctolagus cuniculus) (Table 2; NCBI-Ensemble database (Benson et al., 2010; Sayers et al., 2010)). A two-step PCR protocol followed by melt curve analysis using SsoFast™ EvaGreen® Supermix (Biorad, Germany) was performed using the real time PCR detection system CFX96 (Biorad, Germany). The protocol included an initial denaturation step (3 min 95  C), 50 cycles of 10 s denaturation at 95  C and 15 s annealing and extension at 60  C followed by a melt gradient from 65  C to 95  C (increments 0.5  C) for melt curve analysis. The specificity of the PCR products was verified by length analysis using a 1% agarose gel. The RT-PCR data of AQPs were normalized to the expression of the reference gene GAPDH. Relative gene expression was calculated using the analysis mode of the Bio-Rad CFX Manger 3.0 software (Biorad, Germany). The algorithms are based on the methods of Livak et al. (1995), Pfaffl, (2001) and Vandesompele et al. (2002). The results are presented as relative normalized expression (mean ± s.e.m). 3. Results 3.1. Expression pattern of AQP0 AQP0 was abundantly detected in the lens fibers by

22

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30

Table 2 PCR primers designed using highly homologous regions of the CDS of different species. Accession numbers (NCBI Reference Sequence), sequences and product length are summarized. The target specificity of the primers was verified by sequencing the PCR products of rabbit cDNAs. CDS coding sequence, F forward, R reverse. Gene (CDS)

Accession number

Primer sequence (50 e 30 )

Product length

AQP0

NM_008600.4 (ms) NM_012064.3 (hu) NM_001105719.1 (rt) NM_173937.1 (bs) NM_007472.2 (ms) NM_198098.2 (hu) NM_012778.1 (rt) NM_174702.3 (bs) XM_002713737.1 (rb) NM_009699.3 (ms) NM_000486.5 (hu) NM_012909.2 (rt) NM_001101199.1 (bs) NM_016689.2 (ms) NM_004925.3 (hu) NM_031703.1 (rt) NM_001079794.1 (bs) XM_002708029.1 (rb) NM_009700.2 (ms) NM_001650.4 (hu) NM_012825.3 (rt) NM_009701.4 (ms) NM_001651.2 (hu) NM_012779.1 (rt) NM_001191160.1 (bs) XM_002711097.2 (rb)

F - CAGCTGTCCGAGGAAACCTAGC R - GGCCATTCCGCCTCTCGTC

138 bp

F - ACCACTGGATCTTCTGGGTGG R - CATCTCCACCCTGGAGTTGA

176 bp

F - CTGGGCCACCTCCTTGGGATC R - CCACCAGGGGTCCGATCCA

124 bp

F - ACATCCGCTACCGGCTGCT R - GCCAGGTTGATGGTGAGGAA

139 bp

F - AGGCGGTGGGGTAAGTGTGGA R - CACCCCAGTTTATGGTGGATCCC

160 bp

F - TACGTGGCAGCCCAGCTGGTG R - AGATGCAGAGGGCCAGCTGGAA

172 bp

AQP1

AQP2

AQP3

AQP4

AQP5

immunohistochemistry (Fig. 1A) and consistent with that, high AQP0 mRNA expression was measured in the lens (Fig. 1B). Neither the lens epithelium nor the cornea, conjunctiva, iris, ciliary body, chamber angle, retina or optic nerve showed AQP0 immunopositivity. Apart for the ciliary body, where small amounts of AQP0 mRNA were measured, the mRNA data match with the immunohistochemistry data.

3.2. Expression pattern of AQP1 AQP1 immunopositivity was detected in the corneal stroma and corneal endothelium (Fig. 2A), which is consistent with the positive AQP1-mRNA expression levels in the cornea (Fig. 2G). In 7 out of 10 eyes, AQP1 was present in cells of the chamber angle (Fig. 2B). In the ciliary body AQP1 protein was found at the basal side of the non-pigmented epithelial NPE cells facing the aqueous humor (Fig. 2D). In the iris (Fig. 2C) and the optic nerve (Fig. 2F) the immunofluorescent AQP1 signal was present in vessels. In the retina a clear APQ1-positive signal was found in the outer plexiform layer (OPL) of the retina (Fig. 2E). According to these results AQP1mRNA was detected in the ciliary body, iris, retina and optic nerve (Fig. 2G). Although the qRT-PCR results suggest that AQP1 is present in the choroid, conjunctiva and ocular muscle, protein expression could not be detected by immunohistology in these tissues.

3.4. Expression pattern of AQP3 In the cornea a strong immunopositive signal was detectable in the basal cells of the epithelium (Fig. 3A), which was also present in the stratified squamous epithelium of the conjunctiva (Fig. 3B). The level of AQP3 mRNA expression (Fig. 3D) in the cornea and the conjunctiva matched with the immunohistology data. AQP3 mRNA expression was also detected in the retina, which could be partially (four of eight samples) confirmed by protein expression in the photoreceptor layer (Fig. 3C). In the choroid AQP3 was detected on mRNA (Fig. 3D) and protein level in choroidal vessels (Fig. 3C). 3.5. Expression pattern of AQP4 Using immunohistochemistry, AQP4 was localized in the NPE of the ciliary epithelium, the retina, the optic nerve and in extraocular muscle fibers (Fig. 4AeD), but not in the cornea and the conjunctiva. In the ciliary body AQP4 was restricted to the NPE (Fig. 4A) and in the retina to the nerve fiber layer (NFL, Fig. 4B). Protein expression results match with the mRNA expression analysis in case of the optic nerve, the ocular muscle and the retina (Fig. 4E). Due to the relatively high Cq-value of AQP4 in the ciliary body (Cq ¼ 31.34 ± 0.07), compared to other ocular tissue the relative AQP4 mRNA expression in the ciliary body is almost close to zero (Fig. 4E), even though a clear immunopositive signal is present in the NPE in the posterior part of the ciliary body. 3.6. Expression pattern of AQP5

3.3. Expression pattern of AQP2 AQP2 mRNA expression was not detectable in any of the investigated ocular samples. Nevertheless, in the stroma of the ciliary body and the choroid immunopositive signals were found. To exclude technical problems with the antibody or the PCR primers, both have been tested and validated in renal tissues samples of the rabbit (data not shown).

AQP5 immunopositivity was detectable in the corneal epithelium (Fig. 5A) and to a lower extent in lens fiber cells (Fig. 5B), which is in accordance with the AQP5 mRNA expression data (Fig. 5D). Although the relative mRNA level expression would indicate also the presence of AQP5 protein in the conjunctiva (Fig. 5D), no specific immunofluorescence signal was detectable (Fig. 5C). In addition, no distinct immunopositivity for AQP5 was observed in the iris, ciliary body, retina, choroid and optic nerve,

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30

23

2011). Although the rabbit is a common model for ocular research (physiological and pathophysiological investigations, surgical procedure establishment, drug delivery and pharmacokinetic studies) and AQP data from other species indicate the involvement of AQPs in processes like IOP modulation, the literature about AQP expression and localization in rabbits is sparse. Studying the dry eye syndrome, Ding et al. ( 2011a, b) reported altered AQP4 and AQP5 expression in the lacrimal gland of pregnant rabbits. Kumari et al. (2012) described the presence of AQP5 in total membrane protein homogenates of the rabbit lens and cornea. Varadaraj et al. (2005) investigated the AQP-mediated water permeability in the rabbit lens and described immunopositivity for AQP0 in lens fiber cells. However, systematic analysis of AQP topography and distribution in rabbit ocular tissues is missing. In Table 3 the distribution of AQP0 to AQP5 in the rabbit eye, systematically investigated by immunohistochemistry, is summarized. Interspecies comparisons and the correlation of immunohistochemistry and mRNA expression data in rabbit tissues are discussed in the following paragraphs.

4.1. AQP0 AQP0, also known as major intrinsic protein (MIP), is the most abundant protein in the lens fiber cells and serves as water channel essential for maintaining lens transparency and homeostasis and as a structural fiber cell-to-fiber cell adhesion (CTCA) protein that might be involved in accommodation (Sindhu Kumari et al., 2015). In the rabbit eye AQP0 is abundantly present in the lens fiber cells, but not in the lens epithelium or in other ocular tissues. Earlier results of AQP0 protein expression in human (Broekhuyse and Kuhlmann, 1980), mouse (Kumari et al., 2011; Varadaraj et al., 2005), rat (Fitzgerald et al., 1983), calf (Broekhuyse et al., 1979) and dog (Karasawa et al., 2011) eyes support this finding, which is also confirmed by the extraordinarily high levels of AQP0 mRNA.

Fig. 1. AQP0 expression in the rabbit eye. (A) AQP0 immunopositivity in the lens fibers, but not in the lens epithelium. (B) AQP0 mRNA expression determined by qRT-PCR normalized to GAPDH. en endothelium, lf lens fiber.

although low levels of mRNA expression were present in these tissues (Fig. 5D). In Table 3 the immunohistochemistry results for APQ0 to AQP5 are summarized. 4. Discussion Fluid dynamics within the eye are essential for the clarity of the lens and the transparency of the cornea, but also for signal transduction in the retina and regulation of aqueous humor production and outflow (IOP regulation) (Verkman, 2003). In addition, it has been reported that AQP deficiencies in the eye are associated with congenital cataract (Berry et al., 2000; Francis et al., 2000; Varadaraj et al., 2008), impaired corneal transparency (Thiagarajah and Verkman, 2002), retinal dysfunctions (Li et al., 2002) as well as IOP changes (Zhang et al., 2002). These findings are based on genetic studies of inherited diseases (Kenney et al., 2004) and investigations in knock-out mice lacking specific AQPs (Li et al., 2002; Thiagarajah and Verkman, 2002; Verkman et al., 2000; Zhang et al., 2002). Different studies describe protein and mRNA expression in human (Hamann et al., 1998), murine (Li et al., 2002), rat (Hamann et al., 1998; Patil et al., 1997) and canine eyes (Karasawa et al.,

4.2. AQP1 AQP1, formerly referred to as channel-forming integral membrane protein of 28 kDa (CHIP), enables transmembrane water flow throughout the body and is supposed to be involved in e. g. secretion of water into the aqueous humor and cerebrospinal fluid as well as elimination of water from the cornea and the lens (Nielsen et al., 1993b). In the rabbit eye, it is localized in the corneal endothelium, corneal stromal keratinocytes, the TM, vessels of the iris, the NPE of the ciliary body, the outer plexiform layer (OPL) of the retina and the optic nerve. Apart from subtle differences at the cellular level, AQP1 expression in the anterior part of rat (Nielsen et al., 1993b), human (Hamann et al., 1998; Stamer et al., 1994; Tran et al., 2014) and dog (Karasawa et al., 2011; Nautscher et al., 2015) eyes is similar. However, the location in the posterior part of the eye is species-dependent. The rat retina revealed AQP1 labeling in the outer nuclear layer (ONL) (Hamann et al., 1998). In murine retina AQP1 is expressed from the OPL to the photoreceptor segments (Iandiev et al., 2005), whereas in rabbit the AQP1 is limited to the OPL. No AQP1 immunopositivity was found in the retina of the dog (Karasawa et al., 2011). Stamer et al. (2003) described AQP1 expression in human retinal pigment epithelia. Varadaraj et al. (2005) reported that in the lens of mouse, frog, rat and rabbit AQP1 was exclusively expressed in the lens epithelium, complementary to AQP0. The mRNA expression results obtained by RT-PCR reflect that AQP1 is generally an ubiquitously expressed water channel.

24

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30

Fig. 2. AQP1 expression in the rabbit eye. (A) In the cornea immunoreactivity for AQP1 is detectable in the endothelium and the stroma, but not in the epithelium. (B) AQP1 is present in the chamber angle (7 out of 10 eyes). (C) AQP1 is expressed in iridal vessels. (D) In the ciliary body the NPE (arrows) is immunopositive for AQP1. (E) In the retina AQP1 positive structures were detected in the OPL. (F) AQP1 protein is also present in vessels of the optic nerve. (G) AQP1 mRNA expression determined by qRT-PCR normalized to GAPDH. en endothelium, st stroma, ep epithelium, cm ciliary muscle, NFL nerve fiber layer, GL ganglion cell layer, IPL inner plexiform layer, INL inner nuclear layer, OPL outer plexiform layer, ONL outer nuclear layer.

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30

25

Fig. 3. Immunolocalization of AQP3 in the rabbit eye. (A) In the corneal epithelium AQP3 immunopositivity is present mainly in basal cell layers. (B) AQP3 is also detectable in the epithelial cells of the conjunctiva. (C) In the retina rods and cones show a positive AQP3-signal and weak immunopositivity is observed in choroidal vessel walls (arrowheads). (D) AQP3 mRNA expression determined by qRT-PCR normalized to GAPDH. en endothelium, st stroma, ep epithelium, cm ciliary muscle, NFL nerve fiber layer, GL ganglion cell layer, IPL inner plexiform layer, INL inner nuclear layer, OPL outer plexiform layer, ONL outer nuclear layer.

4.3. AQP2

4.4. AQP3

AQP2 is modulated by vasopressin (Knepper and Inoue, 1997) and regulates water- and electrolyte balance via the renal collecting ducts (Nielsen et al., 1993a). AQP2 mRNA analysis in ocular tissues did not show the presence of AQP2, although the primers amplified AQP2 mRNA using rabbit kidney total RNA as positive control. The AQP2 antibody used in the present study detected immunopositive cells in renal rabbit tissue and immunopositive signals in the ciliary body and choroidal stroma, whereas the latter are hard to interpret. As no AQP2 expression is reported in ocular tissues of other species (Hollborn et al., 2011; Patil et al., 1997; Stamer et al., 2008; Verkman et al., 2008) and AQP2 mRNA was not detected in isolated ciliary body and choroid, we assume that the immunopositive structures seen in the rabbit eye are more artificial than specific. However, Ortak et al. (2013) reported increasing AQP2-immunopositivity in the aging rat retina, which was not detectable in the adult rabbit retina in the present study.

AQP3, also known as glycerol intrinsic protein (GLIP) (Frigeri et al., 1995a), is supposed to be involved in skin moisture, skin regeneration, urine concentration and tumor progression (reviewed in (Ishibashi et al., 2009)). In-vivo and in-vitro studies in AQP3
/
mice and corneal epithelial cells indicate that AQP3 mediates water and glycerol transport and provide evidence for its involvement in cell migration and proliferation (Levin and Verkman, 2006). In the rabbit eye the corneal epithelium and stratified epithelium of the conjunctiva are immunopositive for AQP3, which is in accordance with expression patterns in the rat, human, mouse and canine cornea and conjunctiva (Frigeri et al., 1995b; Hamann et al., 1998; Karasawa et al., 2011; Levin and Verkman, 2006; Yu et al., 2012). The mRNA expression levels indicate as well that AQP3 is expressed abundantly in the rabbit cornea and in the conjunctiva. Additionally, the retina and choroid show AQP3 mRNA expression and weak immunopositivity in rod

26

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30

Fig. 4. Immunolocalization of AQP4 in the rabbit eye. (A) AQP4 is immunopositive in the NPE (arrows) of the ciliary body, (B) the NFL of the retina, (C) the astrocytes of the optic nerve and (D) the extraocular muscle fibers. (E) AQP4 mRNA expression determined by qRT-PCR normalized to GAPDH. The mRNA expression level in the ciliary body compared to the other tissues is low, but clearly above the detection limit. NFL nerve fiber layer, GL ganglion cell layer, IPL inner plexiform layer, INL inner nuclear layer, mf muscle fiber, OPL outer plexiform layer, ONL outer nuclear layer.

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30

27

Fig. 5. Immunolocalization of AQP5 in the rabbit eye. (A) AQP5 immunopositivity is detectable in the upper epithelial layers of the cornea. (B) Low levels of AQP5 are also present in the lens fibers. (C) No immunopositivity of AQP5 is observed in the conjunctiva. (D) AQP5 mRNA expression determined by qRT-PCR normalized to GAPDH. en endothelium, st stroma, ep epithelium, lf lens fiber.

Table 3 Localization of AQP immunopositivity in the rabbit eye. In total, 8 to 11 eyes were investigated. If not indicated otherwise, n represents the number of investigated eyes according to the specified ocular tissue structures. The lens and the optic nerve were not present in every eye preparation. Tissue

Structures/Cell type

IHC

n

Conjunctiva Cornea

squamous stratified epithelium epithelium stroma (keratinocytes) endothelium small vessels NPE lens fiber cells TM nerve fiber layer horizontal cell layer photoreceptors astrocytes vessels muscle fibers

AQP3 AQP3, AQP5 AQP1 AQP1 AQP1 AQP1, AQP4 AQP0, AQP5 AQP1 AQP4 AQP1 AQP3 AQP4 AQP1 AQP4

8 8, 11 11 11 11 11, 8 7, 7 7a 8 8 4b 8 7 8

Iris Ciliary body Lens Chamber angle Retina

Optic nerve Extraocular muscle a b

Out of 10 eyes. Out of 8 eyes.

and cones and choroidal vessels, respectively. Hollborn et al. (2011) reported also the presence of AQP3 mRNA in retinas of the streptozotocin diabetic rat model and age-matched controls.

4.5. AQP4 AQP4 is a mercurial insensitive water channel (MIWC) and is reported to influence aqueous humor production (Stamer et al., 2008; Zhang et al., 2002). In the anterior section of the rabbit eye, AQP4 immunopositivity is present in the ciliary NPE, which is also described for human eyes (Hamann et al., 1998; Tran et al., 2014). In addition, AQP4 mRNA expression in the ciliary body is reported for rat (Patil et al., 1997) and canine (Karasawa et al., 2011) eyes. Our data of mRNA analyses of rabbit ciliary body preparations show the same for rabbits. Due to the location of AQP4 in the retina and the optic nerve, AQP4 might be involved in signal transduction (Verkman, 2003). In mice and rats AQP4 immunolabeling is reported in Müller glial cells showing immunopositive structures from the ganglion cell layer to the outer plexiform layer and the inner limiting membrane to the outer limiting membrane,

28

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30

respectively (Li et al., 2002; Nagelhus et al., 1998). Furthermore, these studies describe the AQP4-labeling of fibrous astrocytes in the optic nerve. In the rabbit retina AQP4 expression is present in the nerve fiber layer (NFL). Additionally, the optic nerve is immunopositive for AQP4 and in line with the studies mentioned before the morphology of the immunopositive cells in the rabbit optic nerve resembles the morphology of astrocytes. In the present study, also sarcolemma-associated AQP4 immunopositivity was observed in extraocular muscle fibers, which is also described for skeletal muscles being important for fast fluid shifts during skeletal muscle activity (Frigeri et al., 2004). 4.6. AQP5 Conform to the results reported for other species, in rabbit AQP5 is expressed in the corneal epithelium (Hamann et al., 1998; Nautscher et al., 2015; Verkman, 2003; Verkman et al., 2008) and in lens fiber cells (Grey et al., 2013; Kumari et al., 2012). Grey et al. (2013) performed spatial expression analysis of AQP5 in the lens by microdissecting human, mouse, rat and bovine lenses in outer cortex, inner cortex and lens core for Western blotting. They detected a reduction of AQP5 expression from cortical to core fiber cells in all species. Furthermore, Kumari et al. (2012) described AQP5 expression in lens epithelial cells of WT mice, which can be also confirmed for rabbit epithelial lens cells in the present study. Although the qRT-PCR data of the rabbit tissue would suggest AQP5 protein expression, the conjunctiva of the rabbit does not show immunopositivity for AQP5, which is consistent with Levin and Verkman (Levin and Verkman, 2004), who did not detect AQP5 immunopositivity in the conjunctiva of WT mice. In rats Funaki et al. (1998) observed AQP5 in the corneal epithelium and the lacrimal gland, but not in the conjunctiva either. In contrast, in dog Karasawa et al. (2011) showed AQP5 in the conjunctiva by immunohistology and RT-PCR. Oen et al. (2006) investigated mammalian conjunctivas including rabbit, and reported AQP5 expression by Western Blot analysis. However, the clone of AQP5 antibody used in the present study did not show immunopositivity in the rabbit conjunctiva. 4.7. Technical considerations e Correlation of mRNA and protein expression results The results for mRNA and the corresponding protein expression correlated only partly. For AQP0 extremely low mRNA levels were present in samples of the cornea, iris, choroid and conjunctiva and higher levels in the ciliary body, although no AQP0 immunopositivity could be detected in these structures. The same discrepancy was found for AQP1 mRNA levels in the conjunctiva and the optic nerve. AQP3 mRNA correlated well with the immunohistology results in the cornea and the conjunctiva. In contrast, AQP4 mRNA levels in the ciliary body and the retina were low, although the NPE and the nerve fiber layer were clearly immunopositive for AQP4. The mRNA expression pattern of AQP5 and the results of immunohistology correlated well for the cornea and the lens, but not for the conjunctiva. These discrepancies can be most likely explained by the work of Gry et al. (2009). They investigated the correlation of mRNA expression profiles using two different microarrays and immunohistological methods. They found that only about one third of the gene products correlate with the data obtained by antibodies from the Human Protein Atlas initiative. They concluded that differences in RNA and protein expression pattern do not necessarily mean that antibodies do not work properly, as complex gene regulatory mechanisms and post-translational protein modifications may account for these differences. Nevertheless, high correlations of

mRNA and protein expression might support the specificity of antibodies. Another aspect to be considered is that immunohistology facilitates localizing specific protein expression in positive cells and structures in small defined tissue sections, whereas the isolation of mRNA from whole mount tissues comprises a multitude of cells that are positive and/or negative for the protein of interest. The inclusion of both, cells expressing and cells lacking a protein of interest, might cause a dilution effect of the concentration of a specific mRNA product, which can cause both a distortion of an expression level or a reduction of the product below the detection limit. Thus, if mRNA is present only in a single cell layer like e. g. AQP4 in NPE of the ciliary body, the chance to properly detect mRNA of a comparatively low concentrated specific protein in the lysate of the whole ciliary body including all layers is rather low. On the other hand, e. g. low levels of AQP4 mRNA are present in the choroid and the conjunctiva without showing immunopositivity for the protein, which most likely can be attributed to the high sensitivity of the PCR methodology. In general, RT-PCR is a highly sensitive method with high reproducibility, especially in lysates of homogenous cell populations or tissues with homogenous expression of a specific gene. Therefore, divergent results of immunohistochemistry and RT-PCR may be caused by either (1) complex gene regulatory or post-translational modifications, (2) dilution effects of specific mRNA products in a tissue homogenate with low, nonhomogenous mRNA/protein expression or simply by (3) the higher sensitivity of the RT-PCR method. Techniques like fine dissection of layers, i. e. isolating tissue sheets when applicable, or laser capture microscopy to isolate regions of interests (ROIs) or even single cells could be used to overcome dilution effects. 4.8. Conclusion This study demonstrates that AQP0, AQP1, AQP3, AQP4 and AQP5 are present in the rabbit eye showing a non-overlapping or complementary expression pattern, which is conform to published expression patterns in other species like human, mouse, rat and dog. Although species differences exists in the eye, the anterior section including the cornea, lens, ciliary body and the conventional outflow tract show similar distribution patterns among different species. Therefore, we conclude that the rabbit is a useful in-vivo model to study the physiological and pathophysiological functions of AQPs involved in e.g. intraocular pressure modulation or corneal transparency regulation. Especially studying mechanisms for targeting specific AQP homologues or indirect effectors of AQPs as well as signaling pathways modulating AQP function is of interest for developing therapeutic strategies. Acknowledgement This work was supported by: Doc-fFORTE-22966 (Austrian Academy of Sciences), Lotte Schwarz Endowment for Experimental Ophthalmology and Glaucoma Research at Paracelsus Medical University, Fuchs Stiftung, Adele Rabensteiner Stiftung and an institutional Grant from the University Eye Clinic Salzburg. In addition, we highly acknowledge the outstanding and continuous support of the Experimental Ophthalmology Laboratory by Prof. Günther Grabner, MD. Moreover, we thank Mag. Karin Weikinger and Dorothea Haunschmidt for their great technical support. References Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Sayers, E.W., 2010. GenBank. Nucleic Acids Res. 38, D46eD51. Berry, V., Francis, P., Kaushal, S., Moore, A., Bhattacharya, S., 2000. Missense

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30 mutations in MIP underlie autosomal dominant ‘polymorphic’ and lamellar cataracts linked to 12q. Nat. Genet. 25, 15e17. Bienert, G.P., Moller, A.L., Kristiansen, K.A., Schulz, A., Moller, I.M., Schjoerring, J.K., Jahn, T.P., 2007. Specific aquaporins facilitate the diffusion of hydrogen peroxide across membranes. J. Biol. Chem. 282, 1183e1192. Bogner, B., Runge, C., Strohmaier, C., Trost, A., Tockner, B., Kiel, J.W., Schroedl, F., Reitsamer, H.A., 2014. The effect of vasopressin on ciliary blood flow and aqueous flow. Investig. Ophthalmol. Vis. Sci. 55, 396e403. Broekhuyse, R.M., Kuhlmann, E.D., 1980. Lens membranes XI. Some properties of human lens main intrinsic protein (MIP) and its enzymatic conversion into a 22 000 dalton polypeptide. Exp. Eye Res. 30, 305e310. Broekhuyse, R.M., Kuhlmann, E.D., Winkens, H.J., 1979. Lens membranes VII. MIP is an immunologically specific component of lens fiber membranes and is identical with 26K band protein. Exp. Eye Res. 29, 303e313. Ding, C., Lu, M., Huang, J., 2011a. Changes of the ocular surface and aquaporins in the lacrimal glands of rabbits during pregnancy. Mol. Vis. 17, 2847e2855. Ding, C., Nandoskar, P., Lu, M., Thomas, P., Trousdale, M.D., Wang, Y., 2011b. Changes of aquaporins in the lacrimal glands of a rabbit model of Sjogren's syndrome. Curr. Eye Res. 36, 571e578. ElGohary, A.A., Elshazly, L.H., 2015. Photopic negative response in diagnosis of glaucoma: an experimental study in glaucomatous rabbit model. Int. J. Ophthalmol. 8, 459e464. Fitzgerald, P.G., Bok, D., Horwitz, J., 1983. Immunocytochemical localization of the main intrinsic polypeptide (MIP) in ultrathin frozen sections of rat lens. J. Cell Biol. 97, 1491e1499. Francis, P., Berry, V., Bhattacharya, S., Moore, A., 2000. Congenital progressive polymorphic cataract caused by a mutation in the major intrinsic protein of the lens, MIP (AQP0). Br. J. Ophthalmol. 84, 1376e1379. Frigeri, A., Gropper, M.A., Turck, C.W., Verkman, A.S., 1995a. Immunolocalization of the mercurial-insensitive water channel and glycerol intrinsic protein in epithelial cell plasma membranes. Proc. Natl. Acad. Sci. U. S. A. 92, 4328e4331. Frigeri, A., Gropper, M.A., Umenishi, F., Kawashima, M., Brown, D., Verkman, A.S., 1995b. Localization of MIWC and GLIP water channel homologs in neuromuscular, epithelial and glandular tissues. J. Cell Sci. 108 (Pt 9), 2993e3002. Frigeri, A., Nicchia, G.P., Balena, R., Nico, B., Svelto, M., 2004. Aquaporins in skeletal muscle: reassessment of the functional role of aquaporin-4. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 18, 905e907. Funaki, H., Yamamoto, T., Koyama, Y., Kondo, D., Yaoita, E., Kawasaki, K., Kobayashi, H., Sawaguchi, S., Abe, H., Kihara, I., 1998. Localization and expression of AQP5 in cornea, serous salivary glands, and pulmonary epithelial cells. Am. J. Physiol. 275, C1151eC1157. Grey, A.C., Walker, K.L., Petrova, R.S., Han, J., Wilmarth, P.A., David, L.L., Donaldson, P.J., Schey, K.L., 2013. Verification and spatial localization of aquaporin-5 in the ocular lens. Exp. Eye Res. 108, 94e102. Gry, M., Rimini, R., Stromberg, S., Asplund, A., Ponten, F., Uhlen, M., Nilsson, P., 2009. Correlations between RNA and protein expression profiles in 23 human cell lines. BMC Genomics 10, 365. Hamann, S., Zeuthen, T., La Cour, M., Nagelhus, E.A., Ottersen, O.P., Agre, P., Nielsen, S., 1998. Aquaporins in complex tissues: distribution of aquaporins 1-5 in human and rat eye. Am. J. Physiol. 274, C1332eC1345. Hollborn, M., Dukic-Stefanovic, S., Pannicke, T., Ulbricht, E., Reichenbach, A., Wiedemann, P., Bringmann, A., Kohen, L., 2011. Expression of aquaporins in the retina of diabetic rats. Curr. Eye Res. 36, 850e856. Iandiev, I., Pannicke, T., Reichel, M.B., Wiedemann, P., Reichenbach, A., Bringmann, A., 2005. Expression of aquaporin-1 immunoreactivity by photoreceptor cells in the mouse retina. Neurosci. Lett. 388, 96e99. Ikeda, M., Beitz, E., Kozono, D., Guggino, W.B., Agre, P., Yasui, M., 2002. Characterization of aquaporin-6 as a nitrate channel in mammalian cells. Requirement of pore-lining residue threonine 63. J. Biol. Chem. 277, 39873e39879. Ishibashi, K., Hara, S., Kondo, S., 2009. Aquaporin water channels in mammals. Clin. Exp. Nephrol. 13, 107e117. Kaldenhoff, R., Kai, L., Uehlein, N., 2014. Aquaporins and membrane diffusion of CO2 in living organisms. Biochim. Biophys. Acta 1840, 1592e1595. Karasawa, K., Tanaka, A., Jung, K., Matsuda, A., Okamoto, N., Oida, K., Ohmori, K., Matsuda, H., 2011. Patterns of aquaporin expression in the canine eye. Vet. J. 190, e72e77. Kenney, M.C., Atilano, S.R., Zorapapel, N., Holguin, B., Gaster, R.N., Ljubimov, A.V., 2004. Altered expression of aquaporins in bullous keratopathy and Fuchs' dystrophy corneas. J. Histochem. Cytochem. Off. J. Histochem. Soc. 52, 1341e1350. Knepper, M.A., Inoue, T., 1997. Regulation of aquaporin-2 water channel trafficking by vasopressin. Curr. Opin. Cell Biol. 9, 560e564. Kumari, S.S., Eswaramoorthy, S., Mathias, R.T., Varadaraj, K., 2011. Unique and analogous functions of aquaporin 0 for fiber cell architecture and ocular lens transparency. Biochim. Biophys. Acta 1812, 1089e1097. Kumari, S.S., Varadaraj, M., Yerramilli, V.S., Menon, A.G., Varadaraj, K., 2012. Spatial expression of aquaporin 5 in mammalian cornea and lens, and regulation of its localization by phosphokinase A. Mol. Vis. 18, 957e967. Levin, M.H., Verkman, A.S., 2004. Aquaporin-dependent water permeation at the mouse ocular surface: in vivo microfluorimetric measurements in cornea and conjunctiva. Investig. Ophthalmol. Vis. Sci. 45, 4423e4432. Levin, M.H., Verkman, A.S., 2006. Aquaporin-3-dependent cell migration and proliferation during corneal re-epithelialization. Investig. Ophthalmol. Vis. Sci. 47, 4365e4372. Li, J., Patil, R.V., Verkman, A.S., 2002. Mildly abnormal retinal function in transgenic

29

mice without Muller cell aquaporin-4 water channels. Investig. Ophthalmol. Vis. Sci. 43, 573e579. Livak, K.J., Marmaro, J., Todd, J.A., 1995. Towards fully automated genome-wide polymorphism screening. Nat. Genet. 9, 341e342. Lu, D.W., Chen, Y.H., Chang, C.J., Chiang, C.H., Yao, H.Y., 2014. Nitric oxide levels in the aqueous humor vary in different ocular hypertension experimental models. Kaohsiung J. Med. Sci. 30, 593e598. Mohamed-Noriega, K., Riau, A.K., Lwin, N.C., Chaurasia, S.S., Tan, D.T., Mehta, J.S., 2014. Early corneal nerve damage and recovery following small incision lenticule extraction (SMILE) and laser in situ keratomileusis (LASIK). Investig. Ophthalmol. Vis. Sci. 55, 1823e1834. Nagelhus, E.A., Veruki, M.L., Torp, R., Haug, F.M., Laake, J.H., Nielsen, S., Agre, P., Ottersen, O.P., 1998. Aquaporin-4 water channel protein in the rat retina and optic nerve: polarized expression in Muller cells and fibrous astrocytes. J. Neurosci. Off. J. Soc. Neurosci. 18, 2506e2519. Nautscher, N., Bauer, A., Steffl, M., Amselgruber, W.M., 2015. Comparative morphological evaluation of domestic animal cornea. Veterinary Ophthalmol. 1e8. http://dx.doi.org/10.1111/vop.12298 [Epub ahead of print]. Nielsen, S., DiGiovanni, S.R., Christensen, E.I., Knepper, M.A., Harris, H.W., 1993a. Cellular and subcellular immunolocalization of vasopressin-regulated water channel in rat kidney. Proc. Natl. Acad. Sci. U. S. A. 90, 11663e11667. Nielsen, S., Smith, B.L., Christensen, E.I., Agre, P., 1993b. Distribution of the aquaporin CHIP in secretory and resorptive epithelia and capillary endothelia. Proc. Natl. Acad. Sci. U. S. A. 90, 7275e7279. Oen, H., Cheng, P., Turner, H.C., Alvarez, L.J., Candia, O.A., 2006. Identification and localization of aquaporin 5 in the mammalian conjunctival epithelium. Exp. eye Res. 83, 995e998. Ortak, H., Cayli, S., Ocakli, S., Sogut, E., Ekici, F., Tas, U., Demir, S., 2013. Age-related changes of aquaporin expression patterns in the postnatal rat retina. Acta Histochem. 115, 382e388. Patil, R.V., Saito, I., Yang, X., Wax, M.B., 1997. Expression of aquaporins in the rat ocular tissue. Exp. Eye Res. 64, 203e209. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 29, e45. Reitsamer, H.A., Bogner, B., Tockner, B., Kiel, J.W., 2009. Effects of dorzolamide on choroidal blood flow, ciliary blood flow, and aqueous production in rabbits. Investig. Ophthalmol. Vis. Sci. 50, 2301e2307. Reitsamer, H.A., Kiel, J.W., 2002. A rabbit model to study orbital venous pressure, intraocular pressure, and ocular hemodynamics simultaneously. Investig. Ophthalmol. Vis. Sci. 43, 3728e3734. Sayers, E.W., Barrett, T., Benson, D.A., Bolton, E., Bryant, S.H., Canese, K., Chetvernin, V., Church, D.M., Dicuccio, M., Federhen, S., Feolo, M., Geer, L.Y., Helmberg, W., Kapustin, Y., Landsman, D., Lipman, D.J., Lu, Z., Madden, T.L., Madej, T., Maglott, D.R., Marchler-Bauer, A., Miller, V., Mizrachi, I., Ostell, J., Panchenko, A., Pruitt, K.D., Schuler, G.D., Sequeira, E., Sherry, S.T., Shumway, M., Sirotkin, K., Slotta, D., Souvorov, A., Starchenko, G., Tatusova, T.A., Wagner, L., Wang, Y., John Wilbur, W., Yaschenko, E., Ye, J., 2010. Database resources of the national center for biotechnology information. Nucleic Acids Res. 38, D5eD16. Schey, K.L., Wang, Z., J, L.W., Qi, Y., 2014. Aquaporins in the eye: expression, function, and roles in ocular disease. Biochim. Biophys. Acta 1840, 1513e1523. Sindhu Kumari, S., Gupta, N., Shiels, A., FitzGerald, P.G., Menon, A.G., Mathias, R.T., Varadaraj, K., 2015. Role of Aquaporin 0 in lens biomechanics. Biochem. Biophys. Res. Commun. 462, 339e345. Stamer, W.D., Baetz, N.W., Yool, A.J., 2008. Ocular aquaporins and aqueous humor dynamics. In: Civan, M. (Ed.), The Eye's Aqueous Humor. Elsevier, Amsterdam, Boston, pp. 47e70. Heidelberg, London, New York, Oxford, Paris, San Diego, San Francisco, Singapore, Sydney, Tokyo. Stamer, W.D., Bok, D., Hu, J., Jaffe, G.J., McKay, B.S., 2003. Aquaporin-1 channels in human retinal pigment epithelium: role in transepithelial water movement. Investig. Ophthalmol. Vis. Sci. 44, 2803e2808. Stamer, W.D., Snyder, R.W., Smith, B.L., Agre, P., Regan, J.W., 1994. Localization of aquaporin CHIP in the human eye: implications in the pathogenesis of glaucoma and other disorders of ocular fluid balance. Investig. Ophthalmol. Vis. Sci. 35, 3867e3872. Thiagarajah, J.R., Verkman, A.S., 2002. Aquaporin deletion in mice reduces corneal water permeability and delays restoration of transparency after swelling. J. Biol. Chem. 277, 19139e19144. Tran, T.L., Bek, T., la Cour, M., Nielsen, S., Prause, J.U., Hamann, S., Heegaard, S., 2014. Altered aquaporin expression in glaucoma eyes. APMIS Acta Pathol., Microbiol. Immunol. Scand. 122, 772e780. Trost, A., Schrodl, F., Strohmaier, C., Bogner, B., Runge, C., Kaser-Eichberger, A., Krefft, K., Vogel, A., Linz, N., Freidank, S., Hilpert, A., Zimmermann, I., Grabner, G., Reitsamer, H.A., 2013. A new nanosecond UV laser at 355 nm: early results of corneal flap cutting in a rabbit model. Investig. Ophthalmol. Vis. Sci. 54, 7854e7864. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3. RESEARCH0034. Varadaraj, K., Kumari, S., Shiels, A., Mathias, R.T., 2005. Regulation of aquaporin water permeability in the lens. Investig. Ophthalmol. Vis. Sci. 46, 1393e1402. Varadaraj, K., Kumari, S.S., Patil, R., Wax, M.B., Mathias, R.T., 2008. Functional characterization of a human aquaporin 0 mutation that leads to a congenital dominant lens cataract. Exp. Eye Res. 87, 9e21. Verkman, A.S., 2003. Role of aquaporin water channels in eye function. Exp. Eye Res.

30

B. Bogner et al. / Experimental Eye Research 147 (2016) 20e30

76, 137e143. Verkman, A.S., 2008. Mammalian aquaporins: diverse physiological roles and potential clinical significance. Expert Rev. Mol. Med. 10, e13. Verkman, A.S., Ruiz-Ederra, J., Levin, M.H., 2008. Functions of aquaporins in the eye. Prog. Retin Eye Res. 27, 420e433. Verkman, A.S., Yang, B., Song, Y., Manley, G.T., Ma, T., 2000. Role of water channels in fluid transport studied by phenotype analysis of aquaporin knockout mice. Exp.

Physiol. 85, 233Se241S. Yu, D., Thelin, W.R., Randell, S.H., Boucher, R.C., 2012. Expression profiles of aquaporins in rat conjunctiva, cornea, lacrimal gland and Meibomian gland. Exp. Eye Res. 103, 22e32. Zhang, D., Vetrivel, L., Verkman, A.S., 2002. Aquaporin deletion in mice reduces intraocular pressure and aqueous fluid production. J. Gen. Physiol. 119, 561e569.