Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis)

G Model

ARTICLE IN PRESS

ANIREP 5189 1–22

Animal Reproduction Science xxx (2015) xxx–xxx 1

Contents lists available at ScienceDirect

Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci

Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis)

2

3

4

5

Q1

6 7

Jai Singh a , A. Paul a , N. Thakur a , V.P. Yadav a , R.P. Panda a , S.K. Bhure b , M. Sarkar a,∗ a

8

b

9

Physiology & Climatology, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh 243122, India Biochemistry Section, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh 243122, India

10

11

a r t i c l e

i n f o

a b s t r a c t

12 13 14 15 16 17

Article history: Received 28 November 2014 Received in revised form 15 April 2015 Accepted 17 April 2015 Available online xxx

18

24

Keywords: Buffalo Ovarian follicle IGF IGFBP Growth factor

25

1. Introduction

19 20 21 22 23

The present study aimed to determine the expression of insulin like growth factor (IGF) genes in the bubaline ovarian follicles and modulatory role of IGF-I on progesterone production from granulosa cells (GC) of pre-ovulatory follicle in vitro. According to size, follicles were classified into four groups: GI (small), GII (medium), GIII (large) and GIV (preovulatory). All IGF genes were expressed in both GC and theca interna (TI) cells. The relative expression of IGF-I and IGF receptor I (IGFR-I) genes increased with follicle size and was greatest in the pre-ovulatory follicle (P < 0.05). Expression of IGF-II and IGFR-II genes was minimal in GC but was readily detected in TI cells. In TI cells, the gene expression was greater in medium and large as compared to small and pre-ovulatory follicles. The expression of all binding protein (IGFBP) genes was detected in both GC and TI cells. Expression of IGFBP-3 gene increased with follicle size and was greatest in pre-ovulatory follicles (P < 0.05). The expression of IGFBP-2 and IGFBP-4 was less in pre-ovulatory follicles but expression of IGFBP-5 and IGFBP-6 genes were greater at this stage. The GC culture was conducted for three time durations and with three doses of IGF-I. Expression of steroidogenic genes (StAR, CYP11A1, HSD3B) and progesterone concentration were increased in a dose and time dependent fashion. The present study, therefore, provided evidence of an autocrine/paracrine role of IGFs in follicular development and a stimulatory role of IGF1 in steroid production in GC of preovulatory follicles in the bubaline species. © 2015 Published by Elsevier B.V.

Q2 26 27 28

Anoestrus is one of the major causes of infertility in buffalo (Das and Khan, 2010). Ovarian cycles of mammals are characterized by alternating patterns of cellular

∗ Corresponding author. Tel.: +91 0581 2310455; fax: +91 0581 2301327. E-mail address: [email protected] (M. Sarkar).

proliferation and differentiation that leads to follicular development as well as the development and regression of the corpus luteum. Although the classic reproductive hormones i.e. pituitary-derived gonadotropins, FSH and LH, are primary regulators of follicular growth and oocyte maturation, the recent research regarding various growth factors has provided evidence for the roles of many other reproductive hormones. These growth factors have a major role in the ovary in a paracrine/autocrine manner. Follicular cells, primarily the GC and TI cells as well as the

http://dx.doi.org/10.1016/j.anireprosci.2015.04.006 0378-4320/© 2015 Published by Elsevier B.V.

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

29 30 31 32 33 34 35 36 37 38

G Model ANIREP 5189 1–22

2 39Q3 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

oocytes are the site of synthesis and/or action of a number of locally-released factors that promote the complex regulation of follicular development (Hwa et al., 1999). These local factors include insulin-like growth factor (IGF), vascular endothelial growth factor (VEGF), and fibroblast growth factor (FGF). Angiopoietin is, among the factors of the IGF family of protein hormones that is thought to have an important role especially in recruitment, growth and above all in the acquiring of dominance by the pre-antral follicle in a variety of animal species. The insulin like growth factors (IGF) are single chain polypeptides with structural homology to proinsulin and consists of IGF-I (70 amino acids), IGF-2 (67 amino acids), IGF receptors (IGFR-I, IGFR-II) and family of binding proteins (IGFBP1-6) (Hwa et al., 1999). After binding of peptides, IGF-I and IGF-II, to its binding sites on IGFR-I, the intrinsic tyrosine kinase pathway is activated which leads to the essential biological role of IGF proteins. The type 2 IGF receptor (IGFR-II) and a family of high affinity IGF binding proteins (IGFBPs) modulate the bioavailability of IGF-I and IGF-II to bind to the IGFR-I receptors. IGF binding proteins (IGFBPs) are present within the ovary and bind with IGFs decreasing concentrations of bioactive IGFs. The IGFBP 1–6 proteins share a common domain organization consisting of cysteine-rich N and C terminal domains connected by a flexible linker region. The IGF binding sites are located on both the N and C domains and both are required for wild type affinity (Hwa et al., 1999; Carrick et al., 2001). The amount of mRNA for all six IGFBPs in follicles has distinct patterns and these IGFBPs have distinct functions in cattle (Schams et al., 2002) and anoestrous sheep (Hastie et al., 2004). All the components of IGF proteins function together to regulate the important biological outcomes in follicles such as cellular growth, proliferation, differentiation, survival against apoptosis and migration (Khandwala et al., 2000). The presence of IGF-1 increases the gonadotropin responsiveness of the follicle and stimulates progesterone (Schams et al., 2001) and oestradiol secretion from GC of cattle in vitro. For production of progesterone from cholesterol in the ovary, there is involvement of the steroidogenic acute regulatory protein (StAR), cholesterol side-chain cleavage enzyme complex, P450scc, or cytochrome P450 11A1 (CYP11A1), and 3␤-hydroxysteroid dehydrogenase (3␤-HSD) enzymes. Granulosa cells of cattle treated with IGF-I had an increase in mRNA for CYP11A and 3␤-HSD in in vitro studies (Mani et al., 2010) and IGF-I enhanced amounts of StAR mRNA accumulation in cultured GC of pigs (Balasubramanian et al., 1997). Findings in studies of GC of cattle that differentiate into luteal cells established that IGF1 is sufficient to enhance amounts of StAR mRNA (Mamluk et al., 1999). With increased gene expression and enzyme activity of P450scc and 3␤-hydroxysteroid dehydrogenase (HSD) in response to IGF-I stimulation in rats, there is an enhanced IGF activity (Magoffin and Weitsman, 1993). A thorough understanding about the endocrine, autocrine/paracrine growth factors that control follicular growth and development can provide insights for improving the reproductive efficiency in buffalo. Hence, the aim of the present study was to evaluate the gene expression and localization of proteins of the IGF

family in follicles in various stages of development that were collected from buffalo ovaries and to evaluate the modulatory role of IGF-I in progesterone production and secretion from cultured buffalo GC of pre-ovulatory follicles.

100 101 102 103 104

2. Materials and methods

105

2.1. Follicles isolation and preparation of samples

106

Ovaries were collected from slaughtered buffalo cows (at a local abattoir) and were transported on ice within 10–20 min after slaughter to the laboratory. The stage of the oestrous cycle was defined by macroscopic observation of the ovaries as described previously by Sarkar et al. (2010). Healthy well vascularized follicles having a transparent follicular wall and fluid ≥3 mm in diameter were obtained. Follicles were dissected from ovarian stroma. The surrounding tissue (theca externa) was carefully removed with forceps under a stereo microscope as previously described (Babitha et al., 2013). The surface diameter was determined and according to the size, the follicles were classified into four groups: GI (Small, 4–6 mm), GII (medium, 7–9 mm), GIII (large, 10–13 mm) and GIV (preovulatory, <14 mm) (Sarkar et al., 2010). Ovaries (n = 40), each with visible follicles, were used to dissect 10 follicles each per group for RNA extraction, western blotting and immuno-histochemistry studies. After follicle isolation and classification, follicles were washed with physiological saline solution. Different samples were obtained from follicles groups according to the following: (a) some intact follicles were fixed with 10% neutral buffer formalin (NBF) and maintained for immuno-histochemical studies, and (b) some follicles were used to obtain follicular fluid, GC and TI cells. Follicular fluid was aspirated and stored at −20 ◦ C until determination of progesterone and 17␤-oestradiol. Only follicles with progesterone below 100 ng/ml in FF were used for the evaluation so as to exclude atretic follicles (Babitha et al., 2013). Oestradiol was assayed in the FF to ensure the steroidgenic activity of follicles. After aspiration of the FF, the follicular tissues were manipulated to obtain the GC and TI cells. The GC and TI cells include: (i) intact GC and TI cells. Some follicles were bisected and the inside wall was gently scraped and flushed with Ringer’s solution to separate the GC and the remaining follicle wall after GC separation from the TI. The GC and TI cells isolated from each follicle group were transferred into separate tubes and labeled. The GC in the flushing solution were centrifuged at 3000 × g for 10 min at 4 ◦ C. The TI cells and GC pellets were separately snap-frozen in liquid nitrogen and stored at −80 ◦ C until RNA and protein isolation. (ii) Triturated GC and TI cells. Some GC and TI cells were triturated separately and preserved in liquid nitrogen to obtain total proteins required for conducting western blotting as subsequently described. 2.2. The GC from preovulatory follicles for culturing The GC were collected from pre-ovulatory follicles, prepared, cultured and further incubated with treatments IGF-I (5, 10 and 100 ng/ml media) added to serum

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151

152

153 154 155

G Model

ARTICLE IN PRESS

ANIREP 5189 1–22

J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

3

Table 1 Gene transcript, primer sequence (5 –3 ) and resulting fragment size. Gene

Sequence of nucleotide(5 –3 )

Efficiency (%)

Amplicon length (bp)

EMBL

IGF1

For: GGACCCGAGACCCTCTGCGGG Rev: GGCCGACTTGGCGGGCTTG For: TATGCTGCTTACCGCCCCAG Rev: ACATCCCTCTCGGACTTGGC For: CACCTCCCAGCCTAAGCAAA Rev: TGCCATGCCATCTGCAAT For: ACGGCAACCTGTATAACC Rev: TGAGATGACCTTGGACTTG For: CTGCATGACCACGCCCAGCGATGAG Rev: ATGGGCAGGTCCTCACTGGACTCG For: CAAGCATGGCCTGTACAACCT Rev: CCACGCTGCCCGTTCA For: CGCCTGCGCCCTTACC Rev: TTCTTCCGACTCACTGCCATT For: GGCCCATCTCTGAGCAATCA Rev: TGCCGATCCCTTTCTCCAT For: CCCAACTGTGACCGCAAAG Rev: TCCACGCACCAGCAGATG For: AAGGAGAGTAAGCCCCAAGCA Rev: TGTTGGTCTCTGCGGTTCAC For: CTGCGTGGATTAACCAGGTTCG Rev: CCAGCTCTTGGTCGCTGTAGAG For: GGATCATCTGCCTGTTGGTGGA Rev: GTGGATGACCACTGAGGTGC For: AGTTCGAGGGATCCTACCCAGA Rev: AGCCATCACCTCCGTGTTCAG For: AGTTCGCCATGGATGATGA Rev: TGCCGGAGCCGTTGT For: GCGATACTCACTCTTCTACTTTCGA Rev: TCGTACCAGGAAATGAGCTTGAC

109.3

210

NM 001077828.1

109.4

215

NM 174087.3

96.5

59

XM 002696504.1

104

140

NM 174352.2

100a

147

NM 174554.2

102.5

57

NM 174555.1

103.2

57

NM 174556.1

98.2

67

NM 174557.3

93.4

86

NM 001105327.1

94.1

62

NM 001040495.1

100a

84

NM 174189.2

100a

191

NM 174343.2

a

100

146

NM 176644.2

104.4

54

NM 173979.3

94.7

82

U85042.1

IGF2 IGF1R IGF2R IGFBP1 IGFBP2 IGFBP3 IGFBP4 IGFBP5 IGFBP6 STAR ␤-HSD P450SCC Beta actin GAPDH a

156 157 158 159 160 161 162 163

164

165 166 167 168 169 170 171 172 173 174 175

176

177 178 179 180

Efficiency assume to be 100%, standard curve not shown.

containing DMEM/F12 media (at three different concentrations) in triplicate for three time durations of 24, 48 and 72 h before RNA was harvested. At the end of the specific time durations, the spent culture media from each well was collected and stored at −20 ◦ C until progesterone assays were conducted, and the harvested cells were used for mRNA isolation for determining amounts of StAR, CYP11A1 and 3␤-HSD. 2.3. Hormone estimation Concentrations of progesterone and oestradiol in the FF and progesterone in spent culture media of GC (collected from preovulatory follicles) culture were estimated by progesterone125 I RIA kit (IM1188) and oestradiol125 I RIA kit (A21854) supplied by Immunotech, Czech Republic as per manufacturer’s instructions. The measurable range was 0.05–50 ng/ml for progesterone and 6–5000 pg/ml for oestradiol. The FF was diluted accordingly with PBS. The intra- and inter-assay coefficients of variations were 6.5% and 7.2% for progesterone and 12.1% and 11.2% for oestradiol, respectively. 2.4. Primers The primers for IGF Family were designed using the Fast PCR (version: 6.2.73) software. Primer sequences for StAR, HSD, CYP11A1 were used as described previously. The details of the primers used are shown in Table 1.

2.5. Quantitative RT-PCR analysis Total RNA was isolated from GC and TI cells (collected from 10 follicles per group) of all four follicular groups and cultured GC by TRIzol reagent (Invitrogen) according to manufacturer’s instructions. The RNA was treated with Dnase 1 (Invitrogen) to remove any possible DNA contamination. The integrity of total RNA was evaluated on 1.0% agarose gel using 1× TBE as electrophoresis buffer. Total RNA was of an acceptable yield in all the samples. The bands of 28 s RNA and 18 s RNA reflected the intactness of extracted total RNA. The purity and concentration of total RNA was checked using nanodrop. Isolated RNA samples were free from the protein contamination as the OD 260:OD 280 values were more than 1.8. The concentrations of the RNA samples were in the range of 200–2000 ng/␮l. Constant amounts of 1 ␮g of total RNA from follicles (n = 10/group) were reverse transcribed using iScriptTM Select cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) and oligo-dT18 primer at 42 ◦ C for 90 min. The resulting complimentary DNAs (cDNAs) were used in quantitative RT-PCR (qRT-PCR) reactions. The qRT-PCR for each cDNA and the housekeeping genes ␤-actin and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was performed in duplicate using KAPA SYBR FAST qPCR Kit Master Mix (2X) Universal in an Agilent Strata gene MX3005P Real-Time qPCR System instrument (Stratagene) as per manufacturers’ instructions. Briefly, PCR templates containing 0.5 ␮l reverse-transcribed total RNA were added to 0.25 ␮l forward primer (0.2 mM), 0.25 ␮l reverse primer

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

181

182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209

G Model ANIREP 5189 1–22

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

4

236

(0.2 mM) and 5 ␮l of KAPA SYBR FAST Master Mix (2X) Universal, to a final volume of 10 ␮l and were subjected to general real-time PCR protocol for all investigated factors. The following general real-time PCR protocol was employed for all investigated factors: [denaturation for 3 s at 95 ◦ C, 40 cycles of a three segmented amplification and quantification program; annealing for 20 s at the primer specific temperature (58 ◦ C for IGFBP-1, ␤-actin and 60 ◦ C for IGF-I, IGF-II, IGF-IR, IGF-IIR, IGFBP-2, IGFBP-3, IGFBP-4, IGFBP-5, IGFBP-6, StAR, 3␤-HSD, P450scc, GAPGH); elongation for 15 s at 72 ◦ C], a melting step by slow heating from 61 to 95 ◦ C with a rate of 0.58 ◦ C/s and continuous fluorescence measurement, and a final cooling to 4 ◦ C. After the process ended, cycle threshold (Ct) values and amplification plot for all determined factors were acquired using the ‘SYBR green (with dissociation curve)’ method of the real-time machine (MxPro3005P Stratagene, Agilent Technologies, Waldbronn, Germany). Real-time PCR effciencies were determined by amplification of a standardized dilution series, and slopes were obtained. The specificity of desired products was documented using analysis of melting temperature, and a high-resolution gel electrophoresis to verify that transcripts were of exact molecular size and further confirmed by sequence analysis. A negative control PCR sample containing all components except template was included for each sample to assess the formation of primer dimer.

237

2.6. Antibodies and growth factors

210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235

252

Western blotting and Immuno-histochemistry were performed using goat polyclonal IGF-I (AF791, Lot # EIN04), goat polyclonal IGF-II (AF792, Lot # EGD03), goat polyclonal IGFR-I (AF-305-NA, Lot # VL0611041) goat polyclonal IGFRII (AF2447, Lot # VSI0311051) R&D systems (USA), goat polyclonal IGFBP2 (C-18:sc-6001, Lot # C0210), rabbit polyclonal IGFBP3 (H-98:sc-9028, Lot # 12910), goat polyclonal IGFBP4 (C-20:sc-6005, Lot # C0810), goat polyclonal IGFBP5 (C-18:sc-6006, Lot # C0210) rabbit polyclonal IGFBP6 (H-70:sc-13094 Lot # K0304), monoclonal anti human ␤-actin (sc-81178), mouse anti-goat IgG-HRP (sc2354, Lot # G0910), goat anti-rabbit IgG-HRP (sc-2004, Lot # B1711), mouse anti-goat IgG FITC (sc-53800, Lot # J1310), goat anti-rabbit IgG FITC (sc-2012, Lot # I1010) from Santa Cruz Biotechnology, CA2.7.

253

2.7. Western blot

238 239 240 241 242 243 244 245 246 247 248 249 250 251

254 255 256 257 258 259 260 261 262 263 264 265 266

To obtain total proteins, liquid nitrogen triturated follicular tissues (GC and TI) of different groups were suspended in Tissue-PE LBTM (G Biosciences, St. Louis, MO, USA) buffer and HaltTM protease inhibitor cocktail (Thermo Scientific), homogenized and centrifuged at 14,000 × g. The supernatant containing mostly the total soluble protein was estimated using Bradford protein assay. Further, the supernatant was diluted in sodium dodecyl sulfate (SDS) sample buffer (final concentration to 60 mM Tris, pH 6.8, 2% SDS, 100 mM dithiothreitol and 10% glycerol), followed by boiling for 5 min. The protein samples (100 ␮g from GC and TI from each follicle from each group) were subjected to 12–14% SDS-polyacrylamide gel electrophoresis, electro

transferred onto polyvinylidene difluoride (PVDF) membrane and blocked with 3% bovine serum albumin (BSA) before incubation with primary antibodies, viz. anti-IGF-I at a 1:1000 dilution, anti-IGF-II at a 1:1000 dilution, antiIGFR-I at a 1:1000 dilution, anti-IGFR-II at a 1:1000dilution, anti-IGFBP2 at a 1:1000 dilution, anti-IGFBP3 at a 1:500 dilution, anti-IGFBP4 at a 1:500 dilution, anti-IGFBP5 at a 1:500 dilution, anti-IGFBP6 at a 1:500 dilution and anti-␤ actin at a 1:500 dilution overnight at 4 ◦ C. After incubation, the membrane was washed thrice with PBS-T (PBS + 0.01% Tween 20) for 5 min each then respective secondary antibody conjugated with horse radish peroxidase was added and incubated at 37 ◦ C for 1 h. After washing three or four times in PBS-Tween 20 solution, the positive signals were detected by incubating the membrane using 0.06% 3,3 diaminobenzidine tetrahydrochloride (DAB, Genei) in 1X PBS (pH 7.4) containing 0.06% H2 O2 for 10–15 min. The bands were visualized under white light and recorded on a gel documentation system (DNR-BioImaging system (Minibus Pro). Densitometry of the immunospecific bands was performed using ImageJ 1.43 U software (National Institute of Health, Bethesda, Maryland). The experiment was replicated thrice for each protein. 2.8. Immuno-histochemistry The follicles fixed with 10% neutral buffer formalin (NBF) were dehydrated through a series of graded alcohols, paraffin-embedded, serial sectioned (5 ␮m), mounted on Mayer’s albumin coated slides and dried at 37 ◦ C overnight. Deparaffnization was performed in xylene, followed by rehydration in a series of graded alcohols at room temperature, epitope retrieval in sodium citrate buffer (10 mM sodium citrate, pH 6.0, 0.05% Tween-20), rinsing and blocking with 5% BSA for 2 h at 37 ◦ C. Subsequently tissue sections were probed with anti IGF-I at a 1:100 dilution, anti-IGF-II at a 1:100 dilution, anti-IGFR-I at a 1:100 dilution and anti-IGFR-II at a 1:100 dilution and anti-IGFBP2 at a 1:50 dilution, anti-IGFBP3 at a 1:50 dilution, anti-IGFBP4 at a 1: 50 dilution, anti-IGFBP5 at a 1:50 dilution, antiIGFBP6 at a 1:50 dilution. Primary antibodies were detected by CFL-488 conjugated with goat anti-mouse or mouse anti goat secondary antibodies. The slides were rinsed and DAPI (0.4 ␮g/ml in PBS) was applied to stain the nuclei of the cells in the follicle sections. The control slides were processed under similar conditions except for the omission of the primary antibody and addition of isotype IgG. Fluorescently stained sections were mounted with antifade mounting media (MP Biomedicals) and images were captured using Axio Observer Z1 (Carl Zeiss Micro Imaging GmbH, Germany) microscope. 2.9. GC culture and treatments Ovaries were washed properly with physiological saline solution and GC were collected from pre ovulatory follicles separately by aspiration of FF using a needle (18 gauge) and syringe (plastic, 10 ml). Aspirants were transferred to a 60-mm dish, under sterile conditions, containing 0.1% solution of PBS, and all cumulus oocyte complexes were recovered. The remaining cells and fluids were

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289

290

291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315

316

317 318 319 320 321 322 323

G Model ANIREP 5189 1–22

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

centrifuged in 15-ml conical tubes at 300 × g for 5 min, and the GC pellet was re-suspended in 10 ml of 1X PBS prior to a second centrifugation. Finally, GC were re326 suspended and washed in culture medium with DMEM/F12 327 media (supplemented with 10% FBS, antibiotic, antimy328 cotic). The number of viable cells was determined using 329 trypan blue exclusion. Then the cells were centrifuged, 330 Q4 re-suspended and plated out at 1.5 × 105 viable cells per 331 well in a 24-well plate (total volume: 1 ml containing 10% 332 Fetal Bovine Serum (Sigma) and Antibiotic & Antimycotic 333 solution (penicillin-G 100 U/ml, streptomycin 100 ␮g/ml, 334 amphotericin 0.25 ␮g/ml (SV30079.01; Hyclone, Thermo 335 Scientific) in a humidified CO2 (5%) incubator at 38.5 ◦ C. 336 The seeded cells were cultured at 37 ◦ C for 48 h in a 5% CO2 337 atmosphere until they attain around 70% confluency and 338 then cells were washed with DMEM/F12 media to remove 339 unattached cells and any remaining tissue debris. Cells 340 were further incubated with treatments IGF-I (5, 10 and 341 100 ng/ml media) added to serum containing DMEM/F12 342 media (at three different concentrations) in triplicate for 343 three time durations viz. 24, 48 and 72 h before RNA was 344 harvested. At the end of the specific time durations, the 345 spent culture media from each well was collected and 346 stored at −20 ◦ C until the time progesterone assays were 347 conducted, and the harvested cells were used for mRNA 348 isolation for expression of StAR, CYP11A1 and 3␤-HSD. All 349 experiments were repeated three times in triplicate main350 taining controls. 351 324 325

352

2.10. Statistical analyses

361

All experimental data are shown as mean ± SEM. Efficiency-corrected relative quantification of mRNA was obtained by Pfaffl method (Pfaffl, 2001). The statistical significance of differences in relative amounts of mRNA and protein of examined factors across follicles of different stages of growth during the oestrous cycle was assessed using SPSS.17 by one-way ANOVA followed by Duncan as a multiple comparison test. Differences were considered significant if P < 0.05.

362

3. Results

363

3.1. Gene expression analysis

353 354 355 356 357 358 359 360

364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379

The follicles of Group I were taken as a calibrator sample to obtain relative amounts of mRNA. The ␤-actin and GAPDH were utilized as housekeeping genes. The relative amount mRNA in separated follicle tissue for the IGF-I ligand is presented for both GC and TI cells in Fig. 1a and b. These relative amounts were found to be least in follicles of Group I (P < 0.05) and increased thereafter in GC with follicle size. For the TI relative mRNA amounts were comparable in follicles of Groups II–IV and greater in these groups than in the follicles of Group I. The relative amount of IGF-II mRNA in GC was similar for all groups of follicles (Fig. 1c). In TI (Fig. 1d), relative amount of IGF-II mRNA was greater in follicles of Groups II and III but there were no significant differences between follicles of Groups I and IV. The relative amounts of IGFR-I in GC increased with follicular size and were greater (P < 0.05) in pre-ovulatory

5

follicles (Fig. 1e). For TI, the greatest relative amounts of IFGR-I mRNA were in follicles of Group III (Fig. 1f). The relative amounts of IGFR-II (Fig. 1g) mRNA in GC were comparable in follicles from all groups, while for TI there were greater relative amounts of IGFR-II mRNA in larger follicles. There were detectable amounts of all binding proteins in both GC and TI cells at all stages of follicular development as depicted in Fig. 2. The relative amounts of IGFBP-1, 2 mRNA in GC was greater (P < 0.05) in the second and third stages as compared to the first and fourth stages of follicular development (Fig. 2a and c). While in TI, relative amounts of IGFBP-1 mRNA were greater (P < 0.05) in the second stage of follicular development (Fig. 2b), however, relative amounts of IGFBP-2 mRNA were greatest in the third stage of follicular development (Fig. 2d). The relative amounts of IGFBP-3 mRNA was increased in GC with stage of follicular development and was greatest (P < 0.05) in preovulatory follicles, while for TI, there were greater relative amounts (P < 0.05) in the second stage of follicular development and thereafter there was a decrease with minimal amounts of IGFBP-3 mRNA in pre-ovulatory follicles (Fig. 2e and f). The relative amount of IGFBP-4 mRNA in GC was similar to that for IGFBP-1 mRNA in TI cells whereas relative amounts in TI were of a similar pattern as for IGFBP-2. The relative amount of IGFBP-5 mRNA in GC increased and was significantly greater in follicles of Groups III and IV compared with Group-II but for TI relative amounts of mRNA were greater in large follicles (Fig. 2i and j). The relative amount of IGFBP-6 mRNA in GC was less in Group I and was comparable in Groups II, III and IV follicle whereas for the TI, relative amounts were greater in large follicles (Fig. 2k and l). 3.2. Western blot analysis Protein expression of all the factors taken under investigation was observed in a regulated manner in different stages of follicular development and was validated by western blot. The molecular weight of IGF-I, IGF-II, IGF-IR, IGF-IIR, IGFBP-1, IGFBP-2, IGFBP-3, IGFBP-4, IGFBP-5 and IGFBP-6 were found to be ∼17 kDa, ∼19 kDa, ∼155 kDa, ∼275 kDa, 29 kDa, ∼34 kDa, ∼31 kDa, ∼27 kDa, ∼30 kDa, ∼25 kDa, respectively. ␤-Actin was used as an internal control. The relative amount of protein of ligands, receptors and binding proteins followed the similar trend as relative amounts of mRNA (Fig. 4). 3.3. Immuno-histochemical localization of proteins The immuno-flouresence of the IGF proteins was detected in both GC and TI cells and immuno-reactivities were in varying relative amounts with stage of follicular development (Fig. 5). The immuno-flouresence of IGF-I and IGFR-I proteins was in preovulatory follicles, IGF-II and IGFR-II was more intense in TI and immunoreactivity of these proteins were greater during the stages preceding the preovulatory stage of follicular development. The immuno-reactivity of IGFBP-1 was detected to a greater extent in the second stage of follicular development. The immuno-flouresence of IGFBP-3, 5, 6 was greatest in the preovulatory follicle and there were lesser

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411

412

413 414 415 416 417 418 419 420 421 422 423

424

425 426 427 428 429 430 431 432 433 434 435 436

G Model

ARTICLE IN PRESS

ANIREP 5189 1–22

J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

6

a Relative expression

IGF-I mRNA

a 3

b bc

2

c

Relative expression

3

4

1

IGF-I mRNA in TI

b

IGF-I mRNA in GC

0

IGF-I mRNA

a 2

a

a

b 1

0 controll

7-9

10-13

>14

<0.5

0.5-5

5.40

>180

Follicle diameter (mm) Estradiol (ng/ml)

controll

7-9

10-13

>14

0.5-5 5-40 Follicle classes

<0.5

>180

Follicle diameter (mm) Estradiol (ng/ml)

Follicle classes

IGF-II mRNA in GC

c

d a

2

a

a a

b

1

IGF-II mRNA in TI 3

IGF-II mRNA

Relative expression

Relative expression

3

IGF2 mRNA a

a

2

b 1

b

0 controll

<.5

7-9

follicle diameter (mm) >180 Estradiol(ng/ml)

10-13

>14

0.5-5 5-40 follicle classes

controll

<0.5

IGFR-I mRNA

5.0

ab b

2.5

b

>14

>180

3

Relative expression

a

10-13

Follicle diameter (mm) Estradiol (ng/ml)

IGFR-I mRNA in TI

f

7.5

7-9

0.5-5 5-40 Follicle classes

IGFR-I mRNA in GC

e Relative expression

0

IGFR-I mRNA

a 2

b b b 1

0.0 control

<0.5

7-9

10-13

>14

0.5-5 5-40 Follicle classes

>180

Follicle diameter (mm)

0 controll

Estradiol (ng/ml)

<0.5

7-9

0.5-5

10-13

5-40

>14 Follicle diameter ( mm) >180 Estradiol (ng/ml)

Follicle classes

g

IGFR-II mRNA in GC

h IGFR-II mRNA

2

a

a

a 1

0 controll

<0.5

7-9

10-13

0.5-5 5-40 Follicle classes

>14 Follicle diameter (mm) >180 Estradiol (ng/ml)

IGFR-II mRNA in TI a

4

a

Relative expression

Relative expression

3

IGFR-II mRNA 3

b

b

2

b 1

0 controll

<0.5

7-9

10-13

0.5-5

5-40

>14 Follicle diameter (mm) >180 Estradiol (ng/ml)

Follicle classes Fig. 1. Relative amounts of IGF-I, IGF-II and IGF-IR, IGF-IIR m-RNA, in GC and TI cells during different stages of follicular development; IGF-I mRNA (a, b), IGF-II mRNA (c, d), IGF-IR mRNA (e, f), IGF-IIR (g, h), one Group-I follicle served as the control. All the values are shown as mean ± SEM. Different superscripts denote differences in values (P < 0.05).

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model

ARTICLE IN PRESS

ANIREP 5189 1–22

J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

a

b IGFBP-1 mRNA in TI

IGFBP-1 mRNA in GC Relative expression

IGFBP-1 mRNA

a 3

a 2

b b

1

0 controll

7-9

<0.5

Relative expression

4

4

2

b

b b

1

controll

7-9

10-13

0.5-5 5-40 Follicle classes

<0.5

>14

>180

Follicle diameter (mm) Estradiol (ng/ml)

d IGFBP-2 mRNA in TI

IGFBP-2 mRNA in GC 4

IGFBP-2 mRNA

a

Relative exppression

Relative expression

3

ab

2

b b

1

0 controll

<0.5

7-9

10-13

0.5-5

5.40

>14

IGFBP-2 mRNA

a 3

2

b b

b

1

0

Follicle diameter (mm)

controll

>180 Estradiol (ng/ml)

7-9

0.5-5

<0.5

Follicle classes

10-13

>14 Follicle diameter (mm) >180 Estradiol (ng/ml)

5-40

Follicle classes

e

f IGFBP-3 mRNA in TI

IGFBP-3 mRNA in GC

a

Relative expression

3

a

IGFBP-3 mRNA

b

2

bc c

1

0 controll

7-9

IGFBP-3 mRNA b b

1

c

0

>14 Follicle diameter (mm) >180 Estradiol (ng/ml)

10-13

0.5-5 5-40 Follicle classes

<0.5

Relative expression

2

controll

<0.5

7-9

10-13

>14

0.5-5 5-40 Follicle classes

>180

Follicle diameter (mm) Estradiol (ng/ml)

h

g IGFBP-4 mRNA in GC

IGFBP-4 mRNA in TI

a

4

2

IGFBP-4 mRNA

3

b

b

2

c

0 controll

<0.5

7-9

10.13

0.5-5 5-40 Follicle classes

>14

Follcle diameter (mm) >180 Estradiol (ng/ml)

Relative expression

Relative expression

IGFBP-1 mRNA

a 3

0

>14 Follicle diameter (mm) >180 Estradiol (ng/ml)

10-13

0.5-5 5-40 Follicle classses

c

1

7

1

a

b

IGFBP-4 mRNA

b c

0 controll

<0.5

7-9

10-13

0.5-5 5-40 Follicle classes

>14

>180

Follicle diameter (mm) Estradiol (ng/ml)

Fig. 2. Relative amounts of mRNA for insulin-like growth factor binding in GC and TI cells during different stages of follicular development; IGFBP-1 (a, b), IGFBP-2 (c, d), IGFBP-3 (e, f), IGFBP-4 (g, h), IGFBP-5 (i, j), IGFBP-6 (k), one Group-I follicle served as the control. All the values are shown as the mean ± SEM. Different superscripts denote different values (P < 0.05).

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model

ARTICLE IN PRESS

ANIREP 5189 1–22

J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

8

j

i IGFBP-5 mRNA in GC a

Relative expression

Relative expression

5

IGFBP-5 mRNA

4

a

b

3

IGFBP-5 mRNA in TI 3

2

b 1

IGFBP-5 mRNA a

2

1

0

0 controll

7-9

10-13

0.5-5 5-40 Follicle classes

<0.5

controll

Follicle diameter (mm) >180 Estradiol (ng/ml) >14

<0.5

l

k

Relative expression

IGFBP-6 mRNA a

2

ab 1

ab

b

0 controll

<0.5

7-9

10-13

0.5-5 5-40 Follicle classes)

7-9

10-13

0.5-5 5-40 Follicle classes

>14

>180

a

IGFBP-6 mRNA

3

b 2

1

c

c

0

Follicle diameter (mm) Estradiol (ng/ml) >180

Follicle diameter (mm) Estradiol (ng/ml)

IGFBP-6 mRNA in TI 4

IGFBP-6 mRNA in GC 3

Relative expression

b

b b

>14

controll

<0.5

7-9

0.5-5

10-13

>14

5-40

>180

Follicle diameter (mm) Estradiol (ng/ml)

Follicle classes Fig. 2. (Continued). 437 438

439 440

441 442

relative amounts of IGFBP-2 and -4 at this stage of follicle development. 3.4. Effect of treatment with IGF-I on secretion of progesterone Progesterone concentration from cultured GC with all three doses of IGF-I (5, 10, 100 ng/ml) increased in a time

and dose dependent manner (Fig. 3a). A significant increase in progesterone secretion was observed between 48 and 72 h at all three doses, but at 24 and 48 h there was no significant increase in progesterone secretion at with the larger doses. There was also an increase in relative amounts of StAR, CYP11A1, and 3␤-HSD gene expression with IGFI treatment and greatest amounts were detected with the dose of 100 ng/ml of IGF-1 at 72 h culture (Fig. 3b–d).

Fig. 3. Relative quantification of (a) StAR, (b) P450scc and (c) 3␤-HSD mRNA in GC of preovulatory follicles with no exogenous factor (control), IGF-I (5, 10 and 100 ng/ml) for 24, 48 and 72 h (d) P4 after 24, 48 and 72 h in culture in the absence (IGF-I) or presence of various doses (5, 10 and 100 ng) of IGF-I. Lines represent the mean ± SEM. Different superscripts indicate differences (P < 0.05).

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

443 444 445 446 447 448 449 450

G Model ANIREP 5189 1–22

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

9

Fig. 4. Patterns for IGF proteins at different stages of follicle development as validated by western blots. The greatest relative amounts of protein for IGF-I and its receptor IGF-IR were detected at the preovulatory follicular stage. Protein for IGF-II and its receptor, IGF-IIR, were detected in both GC and TI cells, but greatest amounts were observed in Group II and III follicles. Binding proteins (IGFBP-3, IGFBP-5 and IGFBP-6) were detected in large amounts at the preovulatory stage of follicular development while amounts of IGFBP-2 and -4 were basal at this stage of follicular development. Amounts of IGFBP-1were basal. ␤-Actin served as the reference protein. 451

452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474

4. Discussion The results of the present study clearly demonstrate that the genes for the IGF proteins (ligands, receptor and binding proteins) are expressed within GC and TI of all follicular stages of water buffalo. Furthermore, the results provided evidence for a cell-specific pattern of IGF protein gene expression which depends on the different stages of follicular development. In present study, that the mRNA for IGF-I was present in both GC and TI cells at all stages of follicular development in water buffalo. Inconsistent with findings in cattle (Schams et al., 2002), there was mRNA for IGF-I in GC of water buffalo with greater amounts in the dominant follicle and findings for gene expression in TI were consistent with the findings in the previous study with cattle. The mRNA for IGF-II in GC had no clear regulatory changes and these findings were similar to an earlier study in cattle (Schams et al., 2002). Observations in the present study were similar to the findings in the previous study conducted with cattle in which relative amounts of IGF-I increased during final stages of development of dominant follicles (Adashi et al., 1997; Wandji et al., 1998). In another study in sheep, the relative amounts of IGF-I mRNA were basal and consistent throughout the oestrous cycle (Hastie et al., 2004).

Basal relative amounts of IGF-I have also been observed in TI cells of women’s follicles (El-Roeiy et al., 1993). Results of the present study for relative amounts of mRNA were also consistent with the gene expression patterns of proteins as validated by western blot and immunohistochemistry analyses. The immuno-reactivity of IGF-I and IGF-II were observed in cytoplasm of both GC and TI cells. The intensity of immuno-fluorescence and number of GC and TI cells with IGF-I increased with follicular development and was maximum in preovulatory follicles. There have been similar observations previously in follicles of cattle (Schams et al., 2002). Increased IGF-I gene expression as follicular size advances provides evidence for its role in follicular development and maturation. The receptors IGFR-I and IGFR-II mediate actions of ligands IGF-I and IGF-II while IGFR-II is thought to be a clearance molecule for IGF-I (Liu et al., 1993). In the present study, IGFR-I gene expression increased with follicular size in GC and was greater in pre-ovulatory follicles but expression the IGFR-I gene in the TI was relatively less. There have been similar previous observations in cattle (Schams et al., 2002; Armstrong et al., 2000) and sheep (Hastie et al., 2004). IGFR-I has also been detected in human ovarian cells (Poretsky et al., 1985). In humans, the peptides and mRNA of IGFR-I were present in GC from the early stage of

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499

G Model ANIREP 5189 1–22

10

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

Fig. 5. (A) Immuno-histochemical localization of IGF-I in the B. bubalis follicles. Relative amounts of immuno-reactivity associated with IGF-I at different

Q5 stages of follicular development were determined using FITC staining. Amounts of protein for IGF-I are merged with DAPI counterstain (blue), indicating the nuclei of all cells in the sections. Representative pictures showing immuno-reactivity against IGF-I (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. IGF-I was localized in both GC and TI cells but predominantly more immuno-reactivity was observed in GC of the preovulatory follicle. Scale bar: 20 ␮m. (B) Immuno-histochemical localization of IGF-II in B. bubalis follicles. Immuno-reactivity associated with IGF-II in different stages of follicle development was determined using FITC staining. Staining of IGF-II is merged with DAPI counterstain (blue), indicating the nuclei of all cells in the sections. Representative pictures showing immuno-reactivity against IGF-II (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. IGF-II was evident to a greater extent in TI and immuno-reactivity associated with IFG-II was greater before the preovulatory stage of follicular development. Scale bar: 20 ␮m. (C) Immuno-histochemical localization of IGF-IR in B. bubalis follicles. Immuno-reactivity associated with IGF-IR at different stages of follicle development was stained with FITC. Staining of IGF-IR is merged with DAPI counterstain (blue), indicating the nuclei of all cells in the sections. Representative pictures showing immuno-reactivity associated

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model ANIREP 5189 1–22

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531

follicular development to the most advanced stages (ElRoeiy et al., 1993; Zhou and Bondy, 1993). Localization of IGFR-I in the present study with water buffalo agrees with the findings in a previous study with cattle (Khandwala et al., 2000). The presence of both ligands and receptors in cytoplasm of GC and TI cells in the present study provides evidence for an autocrine and paracrine role in follicular development and maturation of water buffalo. The main physiological regulators of ovarian follicle survival are the gonadotropins, but the IGF-I modulates the activity of gonadotropins when FSH concentrations are basal providing support for the dominant follicle to continue to grow (Ginther et al., 1996, 2001) and reach the preovulatory stage because IGF-I functions to enhance the responsiveness to FSH (Austin et al., 2001; Ginther et al., 2003). In the presence of FSH, IGF-I increases LH receptor synthesis in GC (Tsuchiya et al., 1999) which leads to terminal differentiation of GC and withdrawal from cell cycle and results in cells that are resistant to apoptosis. In a previous study, it was demonstrated that treatment with IGF-I in GC cultures resulted in a decreased expression of the gene for the pro-apoptotic factor, BAX, and an increased expression of the gene for the anti-apoptotic factor, PCNA, and production of VEGF by the cultured GC of pre-ovulatory follicles of water buffalo (Babitha et al., 1993). From these previous findings, it can be inferred that IGF-I has a cyto-protective/anti-apoptotic effect and stimulates VEGF production in GC of bubaline pre-ovulatory follicles, which contributes to the extensive capillary proliferation associated with the increase in size, selection, and maturation of the pre-ovulatory follicles and may facilitate follicle maturation by enhancing the supply of nutrients,

11

hormones, and other essential blood-borne signals to the follicle. Gonadotropin-stimulated proliferation and differentiation of ovarian GC and TI cells are augmented by the IGF proteins. The bioactivity of IGF proteins is controlled by the association with the family of six IGFBPs (Clemmons, 1993). All IGFBPs were present in the GC and TI at all stages of follicular development and the specific gene expression was confirmed by use of western blot and immuno-histochemistry techniques in the present study. There was a basal expression of the IGFBP-1 gene in both GC and TI cells but expression was the inverse to IGF-I in GC which may facilitate an increased mitogenic activity of IGF-I and help in proliferation of cells during follicular development. Expression of the IGFBP-2 gene in TI cells was greater immediately preceding the preovulatory stage of follicular development in the present study. The expression of IGFBP-2 gene was less in the preovulatory follicular stage in both GC and TI cells in the present study, which might be due to the greater expression of the IGF-I gene in the preovulatory follicles, which is associated with increased sensitivity to FSH and leads to increased production of proteases and results in a decreased production of IGFBP-2 (Armstrong et al., 1996). In contrast to these findings in the present study, the expression of IGFBP-2 gene occurred in both GC and TI cells of cattle (Schams et al., 2002). Expression of IGFBP-3 gene in GC increased with follicular size and was greater in preovulatory follicles of the present study indicating its stimulatory role in follicular development and this may be associated with an increase in the bioavailability of IGF-I, which is a secondary regulator and has been reported to function to increase blood

with the IGF-IR protein (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. IGFR-I was localized in both GC and TI cells but predominantly more immuno-reactivity was observed in GC of preovulatory follicles. Scale bar: 20 ␮m. (D) Immuno-histochemical localization of IGF-IIR in B. bubalis follicle. Immuno-reactivity associated with IGF-IIR was used to evaluate amounts of this protein at different stages of follicle development with staining occurring with FITC. The IGF-IIR staining is merged with DAPI counterstain (blue), indicating the nuclei of all cells in the sections. There are representative pictures showing immuno-reactivity against IGF-IIR (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. The IGF-IIR was localized predominantly in cytoplasm of TI cells before the preovulatory follicular stage. Scale bar: 20 ␮m. (E) Immuno-histochemical localization of IGFBP-1 in B. bubalis follicles. Immuno-reactivity of IGFBP-1 in different stages of follicle development was stained with FITC. The IGFBP-1staining is merged with DAPI counterstain (blue), indicating the nuclei of all cells in the sections. Representative pictures showing immuno-reactivity associated with IGFBP-1 (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. The immuno-fluorescence associated with IGFBP-1 was observed in both GC and TI cells with lesser immuno-reactivity being evident at the preovulatory stage. Scale bar: 20 ␮m. (F) Immuno-histochemical localization of IGFBP-2 in B. bubalis follicles. Immuno-reactivity associated with IGFBP-2 at different stages of follicle development was localized by using FITC stain. Staining of IGFBP-2 is merged with DAPI counterstain (blue) indicating the nuclei of all cells in the sections. Representative pictures showing immuno-reactivity associated with IGFBP-2 (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. IGFBP-2 was localized in both GC and TI cells with a low intensity of staining. Scale bar: 20 ␮m. (G) Immuno-histochemical localization of IGFBP-3 in B. bubalis follicles. Immuno-reactivity associated with IGFBP-3 at different stages of follicle development was localized using FITC stain. Staining of IGFBP-3 is merged with DAPI counterstain (blue) indicating the nuclei of all cells in the sections. Representative pictures showing immuno-reactivity associated IGFBP-3 (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. IGFBP-3 was localized predominantly in the cytoplasm of preovulatory follicular cells. Scale bar: 20 ␮m. (H) Immuno-histochemical localization of IGFBP-4 in B. bubalis follicles. Immuno-reactivity associated with IGFBP-4 at different stages of follicle development was localized by FITC staining. The staining for IGFBP-4 is merged with DAPI counterstain (blue) indicating the nuclei of all cells in the sections. Representative pictures showing immuno-reactivity associated with IGFBP-4 (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. IGFBP-4 was localized predominantly in the cytoplasm of TI cells before the preovulatory follicular stage. Scale bar: 20 ␮m. (I) Immuno-histochemical localization of IGFBP-5 in B. bubalis follicles. Immuno-reactivity associated with IGFBP-5 in different stages of follicle development was localized with FITC staining. The staining of IGFBP-5 is merged with DAPI counterstain (blue) indicating the nuclei of all cells in the sections. Representative pictures showing immuno-reactivity associated with IGFBP-5 (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. IGFBP-5 was localized predominantly in cytoplasm of follicles from Group III. Scale bar: 20 ␮m. (J) Immuno-histochemical localization of IGFBP-6 in B. bubalis follicles. Immuno-reactivity associated with IGFBP-6 at different stages of follicle development was localized with FITC staining. The staining of IGFBP-5 is merged with DAPI counterstain (blue) indicating the nuclei of all cells in the sections. Representative pictures indicating the immuno-reactivity associated with IGFBP-6 (a: Group-I, b: Group-II, c: Group-II, d: Group-IV, e: negative control). Control sections had no primary antibody applied. The Immuno-fluorescence associated with IGFBP-6 was minimal in GC while predominantly more immuno-reactivity was detected in TI cells of follicles from the Group III of the study. Scale bar: 20 ␮m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563

G Model ANIREP 5189 1–22

12

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

Fig. 5. (Continued)

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model ANIREP 5189 1–22

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

13

Fig. 5. (Continued)

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model ANIREP 5189 1–22

14

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

Fig. 5. (Continued)

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model ANIREP 5189 1–22

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

15

Fig. 5. (Continued)

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model ANIREP 5189 1–22

16

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

Fig. 5. (Continued)

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model ANIREP 5189 1–22

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

17

Fig. 5. (Continued)

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model ANIREP 5189 1–22

18

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

Fig. 5. (Continued)

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model ANIREP 5189 1–22

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

19

Fig. 5. (Continued)

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

G Model ANIREP 5189 1–22

20

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

Fig. 5. (Continued). 564 565 566 567 568 569

concentrations of IGFBP-3 in rodents (Rechler, 1993). Expression of the IGFBP-4 gene in the present study was basal in GC and TI cells of pre-ovulatory follicles but was greater in TI cells immediately preceding the pre-ovulatory stage indicating that IGFBP-4, produced by TI cells under the control of LH, is transported in association with IGFs to

the ECM surrounding the GC, where it functions as an extracellular storage site for IGF. The IGF binding to IGFBP-4 can occur in the GC through the activation/production of specific IGFBP-4 proteases (Besnard et al., 1996). The protease activity specifically cleaves IGFBPs into smaller fragments that result in a reduced affinity for IGFs and in turn

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

570 571 572 573 574 575

G Model ANIREP 5189 1–22

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636

potentiate IGF actions (Conover et al., 1993). The biological activity of IGFs in turn, increases the sensitivity of the GC to FSH, allowing the follicle to maintain responsiveness to FSH during the period when systemic FSH concentrations decrease (establishing this follicle as the dominant follicle; Conover et al., 1990). The variations in expression of IGFBP-3, -4, -5 and -6 genes in the TI especially during the final growth of follicles correlates with the consistently greater expression of the IGF-1 and IGF-2 genes during these same periods of follicular development. The relatively consistent amount of mRNA for these IGFBPs does not necessarily indicate there is a constant inhibition of the action of the IGFs. The inhibitory and stimulating effects of the IGFBPs on the action of the IGFs have been previously described (Jones and Clemmons, 1995). The action depends on factors such as cell surface association, ECM association, phosphorylation or proteolysis, which alter the affinity of IGFBPs for the respective ligands, and target cell actions. Proteolytic degradation of BPs in healthy follicles apparently has an important role and may increase availability of IGFs even when there is a consistent gene expression. An increase of proteolytic activity for IGFBP-2, -4 and -5 was observed in follicular fluid of maturing follicles of sheep (Besnard et al., 1996, 1997). IGF-I is a potent stimulator of cellular proliferation, differentiation and development, that regulates GC steroidogenesis and apoptosis during follicular development. Depending upon the species and stage of follicular growth, IGF-I functions at GC to enhance steroidogenesis either alone or together with FSH. The GC of cattle that are treated with IGF-I had an increase in steroid production, cell number and in relative amounts of mRNA for StAR, CYP11A1, and HSD3B1 (Mani et al., 2010). The most important role of IGF-I appears to be its ability to synergize with gonadotrophins and amplify the steroidogenic pathway (Balasubramanian et al., 1997; Adashi et al., 2006; Veldhuis et al., 1986; Urban et al., 1990). The increased expression of StAR, CYP11A1 and HSD3B genes and increased secretion of progesterone in stimulating GC of the preovulatory follicle with IGF-I treatment in the present study further confirms its stimulatory role on steroidogenesis in bubaline species. There have been similar observations in cattle (Schams et al., 1988, 2001; Spicer et al., 1993) and humans (Devoto et al., 1999) which also supports stimulatory role of IGF-I on steroid production. It can be concluded from the present study that IGFs function in an autocrine/paracrine manner to increase proliferation, differentiation and survivability of follicular cells in water buffalo. The greater expression of the IGF-I gene in preovulatory follicles stimulates the growth, development and attainment of dominance of this follicle. It has also been demonstrated in the present research that an increased secretion of progesterone from GC of preovulatory follicles of water buffalo treated with IGF-I also contributes to the growth, development and maturation of ovarian follicles. Findings in the present study will be helpful in the future for increasing reproductive efficiency of water buffalo by understanding the factors which regulate ovarian follicle development.

21

Conflict of interest The authors do not have any conflict of interest. Acknowledgements The authors are greatly thankful to Department of Biotechnology, New Delhi, India and Director, Indian Veterinary Research Institute, Izatnagar, India for funding of this work. References Adashi, E.Y., Resnick, C.E., Payne, D.W., Rosenfeld, R.G., Matsumoto, T., Hunter, M.K., Gargosky, S.E., Zhou, J., Bondy, C.A., 1997. The mouse intraovarian insulin-like growth factor I system: departures from the rat paradigm. Endocrinology 138, 3881–3890. Adashi, E.Y., Resnick, C.E., Brodie, A.M., Svoboda, M.E., Van Wky, J.J., 2006. Somatomedin-C mediated potentiation of follicle stimulating hormone induced aromatase activity of cultured rat granulosa cells. Endocrinology 117, 2313–2320. Armstrong, D.G., Gutierrez, C.G., Baxter, G., Glazyrin, A.L., Mann, G.E., Woad, K.J., Hogg, C.O., Webb, R., 2000. Expression of mRNA encoding IGF-I, IGF-II and type 1 IGF receptor in bovine ovarian follicles. J. Endocrinol. 165, 101–113. Armstrong, D.G., Hogg, C.O., Campbell, B.K., Webb, R., 1996. Insulin-like growth factor (IGF) binding protein production by primary cultures of ovine granulosa and theca cells; the effect of F-I, gonadotropin and follicle size. Biol. Reprod. 55, 1163–1171. Austin, E.J., Mihm, M., Evans, A.C.O., Knight, P.G., Ireland, J.L.H., Ireland, J.J., Roche, J.F., 2001. Alterations in intrafollicular regulatory factors and apoptosis during selection of follicles in the first follicular wave of the bovine estrous cycle. Biol. Reprod. 64, 839–848. Babitha, V., Panda, R.P., Yadav, V.P., Chouhan, V.S., Dangi, S.S., Khan, F.A., Singh, G., Bag, S., Sharma, G.T., Silvia, W.J., Sarkar, M., 2013. Amount of mRNA and localization of vascular endothelial growth factor and its receptors in the ovarian follicle during estrous cycle of water buffalo (Bubalis bubalis). Anim. Reprod. Sci. 137, 163–176. Babitha, V., Yadav, V.P., Chouhan, V.S., Hyder, I., Dangi, S.S., Gupta, M., Khan, F.A., Sharma, G.T., Sarkar, M., 1993. Luteinizing hormone, insulin like growth factor-1, and epidermal growth factor stimulate vascular endothelial growth factor production in cultured bubaline granulosa cells. Gen. Comp. Endocrinol. 198, 1–12. Balasubramanian, K., Lavoie, H.A., Garmey, J.C., Stocco, D.M., Veldhius, J.D., 1997. Regulation of porcine granulosa cell steroidogenic acute regulatory protein (StAR) by IGF1: synergism with FSH or protein kinase A agonist. Endocrinology 138, 433–439. Besnard, N., Pisselet, C., Monniaux, D., Locatelli, A., Benne, F., Gasser, F., Hatey, F., Monget, P., 1996. Expression of messenger ribonucleic acids of insulin-like growth factor binding protein-2, -4 and -5 in the ovine ovary: localization and changes during growth and atresia of antral follicles. Biol. Reprod. 55, 1356–1367. Besnard, N., Pisselet, C., Monniaux, D., Monget, P., 1997. Proteolytic activity degrading insulin-like growth factor-binding protein-2, -3, -4, and -5 in healthy growing and atretic follicles in the pig ovary. Biol. Reprod. 56, 1050–1058. Carrick, F.E., Forbes, B.E., Wallace, J.C., 2001. BIA core analysis of bovine insulin-like growth factor (IGF)-binding protein-2 identifies major IGF binding site determinants in both the amino- and carboxyl-terminal domains. J. Biol. Chem. 276, 2710–2712. Clemmons, D.R., 1993. IGF binding proteins and their functions. Mol. Reprod. Dev. 35, 368–375. Conover, C.A., Kiefer, M.C., Zapf, J., 1993. Posttranslational regulation of insulin-like growth factor binding protein-4 in normal and transformed human fibroblasts. J. Clin. Invest. 91, 1129–1137. Conover, C.A., Ronk, M., Lombana, F., Powell, D.R., 1990. Structural and biological characterization of bovine insulin-like growth factor binding protein-3. Endocrinology 127, 2795–2803. Das, G.K., Khan, F.A., 2010. Summer anoestrus in buffalo – a review. Reprod. Domest. Anim. 45, 483–494. Devoto, L., Christenson, L.K., McAllister, J.M., Makrigiannakis, A., Strauss, J.F., 1999. Insulin and insulin-like growth factor-I and- II modulate human granulosa–lutein cell steroidogenesis: enhancement of steroidogenic acute regulatory protein (StAR) expression. Mol. Hum. Reprod. 5, 1003–1010.

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

637

638

639

640 641 642 643

644

645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706

G Model ANIREP 5189 1–22

22 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748

ARTICLE IN PRESS J. Singh et al. / Animal Reproduction Science xxx (2015) xxx–xxx

El-Roeiy, A., Chen, X., Roberts, V.J., Le Roith, D., Roberts, C.T., Yen, S.S.C., 1993. Expression of insulin-like growth factor-I (IGF-I) and IGF-II and the IGF-I, IGF-II, and insulin receptor genes and localization of the gene products in the human ovary. J. Clin. Endocrinol. Metab. 77, 1411–1418. Ginther, O.J., Beg, M.A., Bergfelt, D.R., Donadeu, F.X., Kot, K., 2001. Follicle selection in monovular species. Biol. Reprod. 65, 638–647. Ginther, O.J., Wiltbank, M.C., Fricke, P.M., Gibbons, J.R., Kot, K., 1996. Selection of the dominant follicle in cattle. Biol. Reprod. 55, 1187–1194. Ginther, O.J., Beg, M.A., Kot, K., Meira, C., Bergfelt, D.R., 2003. Associated and independent comparisons between the two largest follicles preceding follicle deviation in cattle. Biol. Reprod. 68, 524–529. Hastie, P.M., Onagbesan, O.M., Hareign, W., 2004. Co-expression of messenger ribonucleic acids encoding IGF-I, IGF-II; type I and II IGF receptors and IGF-binding proteins (IGFBP-1 to -6) during follicular development in the ovary of seasonally anoestrous ewes. Anim. Reprod. Sci. 84, 93–105. Hwa, V., Oh, Y., Rosenfeld, R.G., 1999. The insulin-like growth factorbinding protein (IGFBP) superfamily. Endocr. Rev. 20, 761–787. Jones, J.I., Clemmons, D.R., 1995. Insulin-like growth factors and their binding proteins: biological actions. Endocr. Rev. 16, 3–34. Khandwala, H.M., McCutcheon, I.E., Flyvbjerg, A., Friend, K.E., 2000. The effects of insulin-like growth factors on tumorigenesis and neoplastic growth. Endocr. Rev. 21, 215–244. Liu, J.P., Baker, J., Perkins, A.S., Robertson, E.J., Efstratiadis, A., 1993. Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75, 59–72. Magoffin, D.A., Weitsman, S.R., 1993. Insulin-like growth factor-I stimulates the expression of 3-beta-hydroxysteroid dehydrogenase messenger ribonucleic aci.d in ovarian theca interstitial cells. Biol. Reprod. 48, 1166–1173. Mamluk, R., Greber, Y., Meidan, R., 1999. Hormonal regulation of messenger ribonucleic acid expression for steroidogenic factor-1, steroidogenic acute regulatory protein, and cytochrome P450 sidechain cleavage in bovine luteal cells. Biol. Reprod. 60, 628–634. Mani, A.M., Fenwick, M.A., Cheng, Z., Sharma, M.K., Singh, D., Wathes, D.C., 2010. IGF1 induces up-regulation of steroidogenic and apoptotic regulatory genes via activation of phosphatidylinositol dependent kinase/AKT in bovine granulosa cells. Reproduction 139, 139–151. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, 2002–2007. Poretsky, L., Grigorescu, F., Seibel, M., Moses, A.C., Flier, J.S., 1985. Distribution and characterization of insulin and insulin-like growth factor-I

receptors in normal human ovary. J. Clin. Endocrinol. Metab. 61, 728–734. Rechler, M.M., 1993. Insulin-like growth factor binding proteins. Vitam. Horm. 46, 1–114. Sarkar, M., Schilffarth, S., Schams, D., Meyer, H.H., Berisha, B., 2010. The expression of leptin and its receptor during different physiological stages in the bovine ovary. Mol. Reprod. Dev. 77, 174–181. Schams, D., Berisha, B., Kosmann, M., Amselgruber, W.M., 2002. Expression and localization of IGF family members in bovine antral follicles during final growth and in luteal tissue during different stages of estrous cycle and pregnancy. Domest. Anim. Endocrinol. 22, 51–72. Schams, D., Koll, R., Li, C.H., 1988. Insulin-like growth factor-I stimulates oxytocin and progesterone production by bovine granulosa cells in culture. Endocrinology 116, 97–100. Schams, D., Kosmann, M., Berisha, B., Amselgruber, W.M., Miyamoto, A., 2001. Stimulatory and synergistic effects of luteinizing hormone and insulin like growth factor-1 on the secretion of vascular endothelial growth factor and progesterone of cultured bovine granulosa cells. Exp. Clin. Endocrinol. Diabetes 109, 155–162. Spicer, L.J., Alpizar, E., Echternkamp, S.E., 1993. Effects of insulin, insulinlike growth factor I, and gonadotropins on bovine granulosa cell proliferation, progesterone production, estradiol production, and (or) insulin-like growth factor I production in vitro. J. Anim. Sci. 71, 1232–1241. Tsuchiya, M., Minegishi, T., Kishi, H., Tano, M., Kameda, T., Hirakawa, T., 1999. Control of the expression of luteinizing hormone receptor by local factors in rat granulosa cells. Arch. Biochem. Biophys. 367, 185–192. Urban, R.J., Garmey, J.C., Shupnik, M.A., Veldhuis, J.D., 1990. Insulinlike growth factor type-I increase concentrations of mRNA encoding CYP450scc enzyme in primary cultures of porcine granulosa cells. Endocrinology 127, 2481–2488. Veldhuis, J.D., Rodges, R.J., Dee, A., Simpson, E.R., 1986. The insulin-like growth factor, somatomedin C, induces the synthesis of cholesterol side-chain cleavage cytochrome P450 and adrenodoxin in ovarian cells. J. Biol. Chem. 261, 2499–2502. Wandji, S.A., Wood, T.L., Crawford, J., Levison, S.W., Hammond, J.M., 1998. Expression of mouse ovarian insulin growth factor system components during follicular development and atresia. Endocrinology 139, 5205–5214. Zhou, J.A., Bondy, C., 1993. Anatomy of the human ovarian insulin-like growth-factor system. Biol. Reprod. 48, 467–482.

Please cite this article in press as: Singh, J., et al., Localization of IGF proteins in various stages of ovarian follicular development and modulatory role of IGF-I on granulosa cell steroid production in water buffalo (Bubalus bubalis). Anim. Reprod. Sci. (2015), http://dx.doi.org/10.1016/j.anireprosci.2015.04.006

749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790