Long non-coding RNA OR3A4 promotes proliferation and migration in breast cancer

Biomedicine & Pharmacotherapy 96 (2017) 426–433

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Original article

Long non-coding RNA OR3A4 promotes proliferation and migration in breast cancer Genxiang Liu, Xingchi Hu, Guangjun Zhou

MARK

⁎

Department of Orthopaedics, The Fourth Affiliated Hospital of Nantong University, Yancheng, 224005, People’s Republic of China

A R T I C L E I N F O

A B S T R A C T

Keywords: LncRNA OR3A4 Breast cancer Proliferation Metastasis EMT

More and more researches have shown the vital functions of long non-coding RNAs (LncRNAs) in modulating the biological progresses in tumorigenesis. OR3A4 is such a type of lncRNA. The long non-coding RNA (lncRNA) OR3A4 has recently been exposed to be exceptionally expressed and referred to the development of several cancers. Nevertheless, the biological function and clinical significance of OR3A4 in the carcinogenesis of breast cancer (BC) are still blurry. Therefore, we carried out the following study to make sure the underlying functions of OR3A4 in breast cancer. In this article, by means of qRT-PCR assay, we found that OR3A4 was over-expressed in human breast cancer tissues and cell lines and associated with clinicopathological characteristics. In addition, we also found that the silence of OR3A4 suppressed the proliferation of breast cancer cells by influencing cell cycle and apoptosis, and repressed the cell metastasis via EMT, which was contrary to the results in cells transfected with pcDNA-OR3A4. And all the functions of OR3A4 in breast cancer were realized in the transcriptional level according to the subcellular fractionation location assay. Thus, based upon all of the data above, our study might provide a better understanding of the pathogenesis of breast cancer and implied that OR3A4 might be a potent prognostic and therapeutic target in breast cancer.

1. Introduction Breast cancer (BC) is one of the malignant tumors rooting from breast tissues and is the commonest cancer in women worldwide [1,2], and about 1,676,600 new cases of breast cancer have been affirmed, while 51,900 patients have died of BC [3]. Recently, the mortality rate of BC has greatly attenuated thanks to the benign development of early diagnosis, radical surgery and adjuvant therapy [4–6]. For all this, the five-year survival rate of BC patients is still dismal [7,8]. It has been reported that many triggers take major responsibility for the chemotherapy resistance of BC [9]. However, the molecular regulatory mechanism of BC is very complicated, which needs to be further explored. Among the human genome, only about 1–2% of genes can encode proteins [10], while the rest encodes a large amount of non-coding RNAs (ncRNAs) [11]. LncRNAs are one of the types of RNA molecules that have more than 200 nucleotides and cannot be encoded into proteins [12]. It has been shown that lncRNAs are connected with various biological processes, such as development [13], apoptosis [14,15], proliferation and differentiation [16], and carcinogenesis [17–19]. Researches have also found that lncRNAs are dysregulated in multiple cancers, including breast cancer [20], lung cancer [21], hepatocellular

⁎

carcinoma [22], and gastric cancer [23]. Hence, lncRNAs are regarded as potent biomarkers and may result in a new treatment epoch for various cancers [24,25]. LncRNA OR3A4, abbreviated from lncRNA olfactory receptor, family 3, subfamily A, member 4, has been demonstrated to function as an oncogene in gastric cancer, promoting the metastasis, angiogenesis and tumorigenesis in GC [26]. However, the detailed role of OR3A4 in breast cancer is still unmasked. In this paper, we studied OR3A4, a kind of LncRNA, which probably played a crucial role in BC. The process about the selection of OR3A4 was similar to that in the article written by Guo et al. [26]. Expression of OR3A4 was detected in primary BC tissues and cell lines through qRT-PCR. It was found that OR3A4 was over-expressed in BC tissues, compared with that in the corresponding normal tissues. In general, our data indicated that OR3A4 was a brand-new tumor inducer, and might be a remarkable biomarker of diagnosis and a therapeutic target in BC. 2. Methods and materials 2.1. Tissue collection We were provided with 65 pairs of breast cancer tissues and matched adjacent normal tissue samples, which were acquired from

Corresponding author. E-mail address: [email protected] (G. Zhou).

http://dx.doi.org/10.1016/j.biopha.2017.10.011 Received 21 August 2017; Received in revised form 18 September 2017; Accepted 2 October 2017 0753-3322/ © 2017 Published by Elsevier Masson SAS.

Biomedicine & Pharmacotherapy 96 (2017) 426–433

G. Liu et al.

abilities of BC cells. For the migration assay, we seeded 200 mL of treated MDA-MB-468 and MCF-7 cells (5 × 105) with serum-free medium in the top 24-well Transwell chamber (8-μm pore; Corning, Painted Post, NY, USA) of the inserts, and then added 600 μL of complete medium to the lower chamber. After 24 h of incubation, we fixed the migratory cells, stained them in 0.1% of crystal violet solution, and counted them under a confocal microscope. For the invasion assay, we measured the invasive cells with Transwell Matrigel (BD Biosciences, San Diego, CA, USA). We pre-coated Matrigel (BD Biosciences, San Diego, CA, USA) onto the upper chambers. Other experimental processes were similar to that in the migration assay.

patients in Department of Orthopaedics, The Fourth Affiliated Hospital of Nantong University, Yancheng, People’s Republic of China. We promised that all of these patients had not undergone any radiotherapy or chemotherapy before the surgery. We divided all of the tissues into equal size and made them frozen in liquid nitrogen immediately after surgery until RNA extraction. At the same time, we collected the clinicopathological characteristics of these patients. We offered informed consents to all patients. The Ethical Committee of The Fourth Affiliated Hospital of Nantong University for Clinical Research approved the protocol of this study. 2.2. Cell culture

2.6. Flow cytometric analysis We purchased three breast cell lines (MDA-MB-231, MDAMB-468, MCF-7) and one normal breast cell line (MCF-10A) from Chinese Academy of Sciences (Shanghai, China). We cultured MDA-MB-231 cells in F15 medium (Hyclone, Logan, UT, USA), MDA-MB-468, MCF-7 cells in DMEM medium (Hyclone, Logan, UT, USA) and MCF-10A cells in F12/DMEM 1:1 medium (Hyclone, Logan, UT, USA). We cultured all cells with 10% of fetal bovine serum (FBS) (Gibco, Grand Island, NY, USA) and 1% of penicillin/streptomycin at 37 °C with 5% CO2.

For the cell cycle assay, we obtained the treated MDA-MB-468 and MCF-7 cells and washed them with PBS for three times, then fixed them with 80% of ethanol, subsequently incubated them with RNase A (0.25 mg/ml, Sigma) for 30 min at 37 °C, and then with 20 μg/ml propidium iodide (KeyGen, Nanjing, China) for 20 min at room temperature. With the help of a FACSCalibur Flow Cytometer (BD Biosciences, San Jose, CA, USA), we analyzed the cell cycle by using flow cytometry. The experiments were carried out in triplicate. For the cell apoptosis assay, we measured the extent of apoptosis with the Annexin V/7-AAD Apoptosis Detection Kit (Southern Biotechnology, Birmingham, Al, USA) in accordance with the manufacturer’s instructions. Then we digested and centrifuged cells (1 × 106 cells/mL), and washed them with cold PBS twice, and re-suspended them in 100 μL of 1 × binding buffer. Then, they were double stained with Annexin V and 7-AAD and incubated at room temperature in the dark for 15 min. At last, we analyzed the stained cells by using flow cytometry (BD Biosciences) with the help of a FACSCalibur Flow Cytometer (BD Biosciences, San Jose, CA, USA). The experiments were performed in triplicate.

2.3. SiRNA transfection We transfected cell lines with siRNA (si-OR3A4 or Control) (2 μg/ ml) by means of Lip2000 (Invitrogen Carlsbad, CA, USA), basing on the manufacturer’s instructions. The siRNAs were acquired from GenePharma (GenePharma, Shanghai, China). The sequences of siRNAs were listed as follows: si-OR3A4-vector-F: CCTGGATCCGGAACUCAGG GAAUGAUUCAGUUGU; si-OR3A4-vector-R: CCTAAGCTTACAACUGAA UCAUUCCCUGAGUUCC. 2.4. MTT assay We sealed cells in 96-well plates with 200 μL medium and set three replicated wells in each group. We measured cell proliferation by using a MTT assay (Sigma-Aldrich, St. Louis, MO, USA), according to the manufacturer’s instructions. Before analysis, we put 20 μL of MTT (2.5 mg/ml) into each well and incubated them for 4 h at 37 °C. Then we removed the medium, and solubilized the cells in 150 μL of dimethylsulfoxide for analysis at 490 nm on a microplate spectrophotometer (Thermo Scientific, Waltham, MA, USA).

2.7. RNA extraction and qRT-PCR analysis We extracted Total RNAs from cells and tissues with RNAiso Plus (TAKARA, Dalian, China) and Trizol LS Reagent (TAKARA, Dalian, China) separately. Basing on the manufacturer’s protocol, we conducted cDNA synthesis by means of the PrimeScript™ RT reagent Kit (TAKARA, Dalian, China). We used SYBR Premix Ex Taq (TaKaRa, Dalian, China) and ABI StepOnePlus Real-time PCR system (Applied Biosystems, Foster City, CA, USA) to determine qRT-PCR reactions. The housekeeping gene (GAPDH) levels were used as controls. The mean cycle threshold value (Ct) of each sample was normalized to the Ct value of GAPDH to calculate gene expression values. The primers were listed as follows:

2.5. Cell migration and invasion assays We performed transwell assays to assess the invasive and migratory

Fig. 1. OR3A4 is up-regulated in BC tissues and cell lines. A. The expression of OR3A4 in BC tissues and in the adjacent normal tissues, detected by qRT-PCR. B. The expression of OR3A4 in three BC cell lines (MDA-MB-231, MDA-MB-468, MCF-7) and in one normal breast cell line (MCF-10A), measured by qRT-PCR. Error bars represented the mean ± SD of at least three independent experiments. *P < 0.5, **P < 0.01 vs. control group.

427

Biomedicine & Pharmacotherapy 96 (2017) 426–433

G. Liu et al.

Fig. 2. Kaplan-Meier method analysis (log-rank test) was carried out to determine the relationship between OR3A4 expression level and overall survival in patients with BC (P = 0.000).

included phenylmethylsulfonyl fluoride (PMSF) (Beyotime Biotechnology, Beijing, China) on ice. Equal amounts of proteins (50 μg protein per lane) were split by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% of denaturing gel and transferred to PVDF membranes (Millipore, Billerica, MA, USA). The immunoblots were blocked with 5% of skim milk in tris buffered saline (TBS)-Tween20 (0.05%, v/v) for 1 h at room temperature. We used TBST to wash these membranes. Then we made use of the primary

OR3A4-F: ACTGCTAGTGGAAGACAGCC, OR3A4-R: GTTTCCATAAGG ATGGCCGC; GAPDH-F: GGACCTGACCTGCCGTCTAG, GAPDH-R: GTAGCCCAGGATGCCCTTGA. 2.8. Subcellular fractionation location The separation of nuclear and cytosolic fractions was performed by using the PARIS Kit (Life Technologies) according to the manufacturer’s instructions.

Table 2 Multivariate analysis of prognostic parameters in patients with breast cancer by Cox regression analysis.

2.9. Western blot analysis We got the total proteins in cells by using RIPA buffer which

Variable

Category

P-value

HR

Table 1 Correlation between OR3A4 Expression and Clinical Features. (n = 65).

95.0% CIs Lower

upper

Age Variable

OR3A4 Expression

≦50 > 50

0.620

1.200

0.584

2.463

0.482

1.259

0.663

2.391

0.816

1.092

0.519

2.301

Lymph node status Negative Positive

0.812

1.088

0.545

2.170

Differentiation grade I-II III-IV

0.999

1.000

0.513

1.951

Negative Positive

0.032*

0.469

0.235

0.937

0.730

0.877

0.417

1.845

0.816

0.926

0.482

1.778

I-II III

0.367

0.702

0.326

1.513

Low High

0.007*

0.338

0.153

0.745

P-value

low

high

Age ≦50 > 50

15 17

13 20

0.620

Menopausal status Premenopausal Postmenopausal

18 14

13 20

0.218

Tumor Size ≦2 cm > 2 cm

20 12

19 14

0.801

Lymph node status Negative Positive

20 12

11 22

0.026*

*

Menopausal status Premenopausal Postmenopausal Tumor Size ≦2 cm > 2 cm

ER status

Differentiation grade I-II III

11 21

20 13

0.048

ER status Negative Positive

21 11

16 17

0.213

Negative Positive

PR status Negative Positive

18 14

13 20

0.218

HER-2/neu status Negative Positive

HER-2/neu status Negative Positive

22 10

12 21

0.013*

10 23

*

TNM stage I-II III

20 12

– PR status

TNM stage

OR3A4 level 0.013

Proportional hazards method analysis showed a positive, independent prognostic importance of OR3A4 expression (P = 0.007). * P < 0.05 was considered statistically significant.

Low/high by the sample median. Pearson χ2 test. * P < 0.05 was considered statistically significant.

428

Biomedicine & Pharmacotherapy 96 (2017) 426–433

G. Liu et al.

compared with the matched adjacent normal tissues (Fig. 1A). Additionally, the expression levels of OR3A4 in BC cell lines (MDA-MB231, MDA-MB-468, MCF-7) were compared with that in the normal breast cell line (MCF-10A), which indicated that the expression levels of OR3A4 were up-regulated in the BC cell lines (Fig. 1B). Among the above BC cell lines, MDA-MB-468 and MCF-7 cell lines showed the relatively highest expression levels, therefore, such two cell lines were used for the next experiments.

antibodies to explore the membranes at 4 °C overnight. Subsequently, we utilized the corresponding secondary antibody to incubate the membranes for 1 h at room temperature. Finally, the immunoblots were then disclosed and detected with an enhanced chemiluminescence Western blotting detection system (Bio-Rad, Hercules, CA, USA). 2.10. Statistical analysis We repeated each experiment at least three times. Data were represented as mean ± SD. We took advantage of a two-tailed Student’s t-test to compare the continuous variables between two groups. Oneway ANOVA with Tukey, Dunnett post tests or two-way ANOVA was used when three or more groups were compared. p < 0.05 was considered to be a significant difference. All the statistical analyses were performed with GraphPad Prism 6.0 (GraphPad, San Diego, CA, USA).

3.2. A close relationship between up-regulated expression of OR3A4 and poor prognosis in patients with BC Kaplan-Meier method analysis (log-rank test) was performed to define the correlation of OR3A4 expression level with the overall survival situation in patients with BC (Fig. 2). Obviously, the expression level of OR3A4 was found to be connected with lymph node status, differentiation grade, HER-2/neu status, and TNM stage (Table 1). Cox regression analysis exposed that highly expressed OR3A4 was an independently prognostic factor, in addition to ER status (Table 2). These results demonstrated that OR3A4 played a significant role in BC and might be regarded as a specific biomarker for poor prognosis.

3. Results 3.1. OR3A4 is up-regulated in BC tissues and cell lines To figure out the biological progress of OR3A4, we performed qRTPCR to determine the expression level of OR3A4 in BC tissues. Distinctly, the expression level of OR3A4 was up-regulated in BC tissues

Fig. 3. Down-regulation of OR3A4 represses the proliferation of BC cells via variations in cell cycle and apoptosis. A. qRT-PCR detected the expression of OR3A4 transfected with siOR3A4 in two BC cell lines (MDA-MB-468, MCF-7). B. MTT assay analyzed the effect of the interference of OR3A4 on BC cells proliferation. C. The colony-formation assay investigated the clonogenic survival in BC cells transfected with si-OR3A4. D-E. Flow cytometry analyses demonstrated the effect of down-regulation of OR3A4 on BC cells cycle and apoptosis. F. Subcellular fractionation location assay was designed to determine the location of OR3A4. Error bars represented the mean ± SD of at least three independent experiments. *p < 0.05, **p < 0.01 vs. control group.

429

Biomedicine & Pharmacotherapy 96 (2017) 426–433

G. Liu et al.

Fig. 4. Interference of OR3A4 inhibits the metastasis and EMT progress in BC cells. A–B. The transwell assays confirmed the repressive role of down-regulated OR3A4 on the migration and invasion of BC cells. C. The qRT-PCR and western blot assays verified the inhibition of interference of OR3A4 on EMT transformation. Error bars represented the mean ± SD of at least three independent experiments. *P < 0.5, **p < 0.01 vs. control group.

in Fig. 3F that the level of OR3A4 was obviously higher in nucleus than in cytosol, implicating that OR3A4 exerted its role in breast cancer possibly at the transcriptional level.

3.3. Down-regulation of OR3A4 represses the proliferation of BC cells via variations in cell cycle and apoptosis In order to regulate the expression level of OR3A4 in BC cells, siOR3A4 vector was transfected into MDA-MB-468 and MCF-7 cells. qRTPCR analysis was conducted at 48 h after transfection, which showed us the down-regulated OR3A4 in both cell lines (Fig. 3A). To evaluate the biological role of OR3A4 in BC, we, at first, studied the effect of the silence of OR3A4 on cell proliferation through MTT assay. The assay manifested that the cell growth was clearly impaired in MDA-MB-468 and MCF-7 cells transfected with si-OR3A4 (Fig. 3B). Consistent with the consequence in MTT assay, the results in the colony-formation assay indicated that clonogenic survival rate was decreased after OR3A4 was interfered in MDA-MB-468 and MCF-7 cells, compared with that in the negative control (Fig. 3C). To further verify the results above, flow cytometry analysis of cell cycle was carried out, which demonstrated that the down-regulation of OR3A4 increased the proportion of cells in G0/G1 phase but decreased the proportion of cells in S phase compared to that in the negative control (Fig. 3D). Later, the flow cytometry analysis was performed to examine the effect of the low expression of OR3A4 on apoptosis changes. BC cells were transiently transfected with si-OR3A4 vector for 48 h, and very soon were stained with Annexin V/ PI. Compared with the negative control, the data exhibited an increased number of Annexin V+ (total apoptosis), Annexin V+/PI- (early apoptosis), and Annexin V+/PI+ (late apoptosis) cells after the interference of OR3A4 (Fig. 3E). All of the findings above suggested that OR3A4 could induce the proliferation of BC cells through influencing cell cycle and apoptosis. For a further determination about the mechanism of OR3A4 in regulating cell cycle and apoptosis, we examined the level of OR3A4 in nucleus versus cytosol by qRT-PCR. It was found

3.4. Interference of OR3A4 inhibits the metastasis and EMT progress in BC cells In order to make clear whether the OR3A4 expression was relevant to the development of BC, the in vitro transwell assay was operated. As illuminated in Fig. 4A and Fig. 4B, the down-regulation of OR3A4 cut down the migratory and invasive cell numbers in MDA-MB-468 and MCF-7 cells compared with that in the negative control, which revealed that BC cell lines showed remarkably different abilities in metastasis and invasion related to OR3A4 expression level. To further verify whether the weakened metastatic ability of BC cells caused by silenced OR3A4 was correlated with EMT process, the qRT-PCR and western blot assays were operated to detect the expression levels of the epithelial protein marker (E-cadherin) and the mesenchymal marker (N-cadherin) in BC cell lines (MDA-MB-468 and MCF-7), both of which were transfected with si-OR3A4. As a result, E-cadherin expression was dramatically up-regulated compared with the negative control, while N-cadherin expression was greatly down-regulated compared with the negative control (Fig. 4C). These data accounted for that OR3A4 contributed a lot to the metastasis of BC cells possibly partly via affecting EMT development. 3.5. Strengthened OR3A4 accelerates cell proliferation by affecting cell cycle and apoptosis in breast cancer For a further understanding about the role of 0R3A4 in breast 430

Biomedicine & Pharmacotherapy 96 (2017) 426–433

G. Liu et al.

Fig. 5. Strengthened OR3A4 accelerates cell proliferation by affecting cell cycle and apoptosis in breast cancer. A. The transfection efficiency of the overexpression of OR3A4 was examined in BC cells. B–C. MTT and colony formation assays were applied to analyze the effect of up-regulated OR3A4 on cell proliferation. D–E. The flow cytometry analyses were employed to detect how highly expressed OR3A4 affected cell cycle and apoptosis. Error bars represented the mean ± SD of at least three independent experiments. *P < 0.5, **p < 0.01 vs. control group.

the proliferation, metastasis and invasion, cause cell cycle arrest and induce apoptosis in breast cancer in transcriptional level.

cancer, the two breast cancer cells MDA-MB-468 and MCF-7 were transfected with pcDNA-OR3A4 vectors. It was found that the expression of OR3A4 was markedly up-regulated after the overexpression of OR3A4, compared to the negative control (Fig. 5A). Moreover, with the up-regulation of OR3A4, the cell proliferation number became much more compared with the negative control (Fig. 5B–C). What was matched with the cell proliferation was that cells in G0/G1 phase were much fewer than that in S phase in breast cancer cells when the expression of OR3A4 was fortified (Fig. 5D). Meanwhile, the apoptosis rate was lower in cells transfected with pcDNA-OR3A4 than that in the negative control (Fig. 5E). Together with the conclusion in the knockdown assays for OR3A4, such findings above further affirmed that OR3A4 affected cell proliferation by regulating cell cycle and apoptosis.

4. Discussion As the commonest cancer for women, which has a low 5-year survival rate in patients with malignant differentiation, the research in BC is badly in need to perfect early diagnosis and treatment for the female [27]. Non-coding RNAs (ncRNAs) have been supposed to be a mechanism which probably motivates BC process and may serve as a novel and effective therapeutic target in BC [28]. LncRNAs, belonging to these ncRNAs, play various roles in cancer progresses [29,30], and have appeared to be a new spotlight in early diagnosis and molecular targeted therapy [31]. For now, the relationship between lncRNA OR3A4 and BC remains obscure. In this study, our results suggested that OR3A4 was up-regulated in BC tissues and cell lines compared with that in the adjacent normal tissues and cell lines. Moreover, the interference of OR3A4 resulted in a series of changes in biological behaviors, including proliferation suppression, cell cycle arrest, increasing apoptosis, decreasing invasion and migration. Moreover, the overexpression of OR3A4 accelerated proliferation, cell cycle progression, migration and invasion, but lessened the apoptotic rate. What’s more, it was affirmed that all of these phenomena occurred in transcriptional level. These facts explained that OR3A4 significantly impaired the normal life activities of BC cells, and that OR3A4 might serve as a tumor inducer. Despite

3.6. Intensified OR3A4 facilitates migration and invasion through modulating EMT process Subsequently, transwell assays were employed to determine the effect of the overexpression of OR3A4 on the migratory and invasive abilities of breast cancer cells. As illustrated in Fig. 6A–B, intensified OR3A4 outstandingly increased the number of migratory and invasive cells compared with the negative control. In the meantime, the protein level of the marker for the epithelial cell (E-cadherin) was weakened, while that of the marker for the mesenchymal cell (N-cadherin) was enriched (Fig. 6C). Totally, these findings implied that lncRNA OR3A4 could promote 431

Biomedicine & Pharmacotherapy 96 (2017) 426–433

G. Liu et al.

Fig. 6. Intensified OR3A4 facilitates migration and invasion through modulating EMT process. A–B. Transwell assays were designed to measure the effect of over-expressed OR3A4 on cell migration and invasion. C. Western blot was used to determine how the up-regulation of OR3A4 influenced EMT process. Error bars represented the mean ± SD of at least three independent experiments. *P < 0.5, **p < 0.01 vs. control group. [5] T.J. Molloy, L.A. Devriese, H.H. Helgason, A.J. Bosma, M. Hauptmann, E.E. Voest, J.H. Schellens, L.J. van't Veer, A multimarker QPCR-based platform for the detection of circulating tumour cells in patients with early-stage breast cancer, Br. J. Cancer 104 (12) (2011) 1913–1919. [6] E. Gerasimova, B. Audit, S.G. Roux, A. Khalil, O. Gileva, F. Argoul, O. Naimark, A. Arneodo, Wavelet-based multifractal analysis of dynamic infrared thermograms to assist in early breast cancer diagnosis, Front. Physiol. 5 (2014) 176. [7] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144 (5) (2011) 646–674. [8] J. Chou, B. Wang, T. Zheng, X. Li, L. Zheng, J. Hu, Y. Zhang, Y. Xing, T. Xi, MALAT1 induced migration and invasion of human breast cancer cells by competitively binding miR-1 with cdc42, Biochem. Biophys. Res. Commun. 472 (1) (2016) 262–269. [9] C.J. Johnson, R. Graff, P. Moran, C. Cariou, S. Bordeaux, Breast cancer stage, surgery, and survival statistics for idaho's national Breast and cervical cancer early detection program population, 2004–2012, Prev. Chronic Dis. 12 (2015) E36. [10] S. Djebali, C.A. Davis, A. Merkel, A. Dobin, T. Lassmann, A. Mortazavi, A. Tanzer, J. Lagarde, W. Lin, F. Schlesinger, et al., Landscape of transcription in human cells, Nature 489 (7414) (2012) 101–108. [11] M. Furuno, K.C. Pang, N. Ninomiya, S. Fukuda, M.C. Frith, C. Bult, C. Kai, J. Kawai, P. Carninci, Y. Hayashizaki, et al., Clusters of internally primed transcripts reveal novel long noncoding RNAs, PLoS Genet. 2 (4) (2006) e37. [12] C. Wahlestedt, Targeting long non-coding RNA to therapeutically upregulate gene expression, Nat. Rev. Drug Discov. 12 (6) (2013) 433–446. [13] M. Eissmann, T. Gutschner, M. Hammerle, S. Gunther, M. Caudron-Herger, M. Gross, P. Schirmacher, K. Rippe, T. Braun, M. Zornig, et al., Loss of the abundant nuclear non-coding RNA MALAT1 is compatible with life and development, RNA Biol. 9 (8) (2012) 1076–1087. [14] M.N. Rossi, F. Antonangeli, LncRNAs: new players in apoptosis control, Int. J. Cell Biol. 2014 (2014) 473857. [15] C. DeOcesano-Pereira, M.S. Amaral, K.S. Parreira, A.C. Ayupe, J.F. Jacysyn, G.P. Amarante-Mendes, E.M. Reis, S. Verjovski-Almeida, Retraction: long noncoding RNA INXS is a critical mediator of BCL-XS induced apoptosis, Nucleic Acids Res. 44 (19) (2016) 9518. [16] G.K. Pandey, S. Mitra, S. Subhash, F. Hertwig, M. Kanduri, K. Mishra, S. Fransson, A. Ganeshram, T. Mondal, S. Bandaru, et al., The risk-associated long noncoding RNA NBAT-1 controls neuroblastoma progression by regulating cell proliferation and neuronal differentiation, Cancer Cell 26 (5) (2014) 722–737. [17] J.R. Prensner, A.M. Chinnaiyan, The emergence of lncRNAs in cancer biology, Cancer Discov. 1 (5) (2011) 391–407. [18] I. Ulitsky, D.P. Bartel, lincRNAs: genomics, evolution, and mechanisms, Cell 154 (1) (2013) 26–46. [19] M. Huarte, M. Guttman, D. Feldser, M. Garber, M.J. Koziol, D. Kenzelmann-Broz, A.M. Khalil, O. Zuk, I. Amit, M. Rabani, et al, A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response, Cell 142 (3)

OR3A4 induced migratory and invasive phenotype of BC cells, the underlying mechanism was still unclear. In the above text, we illuminated that OR3A4 promoted tumorigenesis through manipulating EMT process. EMT is a critical step towards cancer metastasis, and a biological process in which the epithelial cells lose their polarity and undergo transition into a mesenchymal phenotype [32]. Our study showed that OR3A4 accelerated cell migration and invasion, which were possibly connected with the loss of Ecadherin expression. Generally speaking, OR3A4 was up-regulated in BC tissues and cell lines, and was referred to poor prognosis. Additionally, its interference inhibited dramatically cell proliferation, cell cycle and apoptosis, and suppressed cell migration and invasion, which was contrary to the data in the overexpression experiments. Anyhow, further researches are still necessary to clarify the underlying molecular mechanism of BC. Disclosure The authors declare no conflicts of interest. Acknowledgement The authors convey their appreciations to all members participating in this study. References [1] M.S. Donepudi, K. Kondapalli, S.J. Amos, P. Venkanteshan, Breast cancer statistics and markers, J. Cancer Res. Ther. 10 (3) (2014) 506–511. [2] C. DeSantis, J. Ma, L. Bryan, A. Jemal, Breast cancer statistics, 2013, CA: Cancer J. Clin. 64 (1) (2014) 52–62. [3] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA: Cancer J. Clin. 65 (2) (2015) 87–108. [4] M. Ahmed, I.T. Rubio, J.M. Klaase, M. Douek, Surgical treatment of nonpalpable primary invasive and in situ breast cancer, Nat. Rev. Clin. Oncol. 12 (11) (2015) 645–663.

432

Biomedicine & Pharmacotherapy 96 (2017) 426–433

G. Liu et al. (2010) 409–419. [20] Z. Xing, A. Lin, C. Li, K. Liang, S. Wang, Y. Liu, P.K. Park, L. Qin, Y. Wei, D.H. Hawke, et al, lncRNA directs cooperative epigenetic regulation downstream of chemokine signals, Cell 159 (5) (2014) 1110–1125. [21] T. Gutschner, M. Hammerle, M. Eissmann, J. Hsu, Y. Kim, G. Hung, A. Revenko, G. Arun, M. Stentrup, M. Gross, et al., The noncoding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells, Cancer Res. 73 (3) (2013) 1180–1189. [22] M. Cui, Z. Xiao, Y. Wang, M. Zheng, T. Song, X. Cai, B. Sun, L. Ye, X. Zhang, Long noncoding RNA HULC modulates abnormal lipid metabolism in hepatoma cells through an miR-9-mediated RXRA signaling pathway, Cancer Res. 75 (5) (2015) 846–857. [23] Y. Hu, J. Wang, J. Qian, X. Kong, J. Tang, Y. Wang, H. Chen, J. Hong, W. Zou, Y. Chen, et al., Long noncoding RNA GAPLINC regulates CD44-dependent cell invasiveness and associates with poor prognosis of gastric cancer, Cancer Res. 74 (23) (2014) 6890–6902. [24] F. Crea, A. Watahiki, L. Quagliata, H. Xue, L. Pikor, A. Parolia, Y. Wang, D. Lin, W.L. Lam, W.L. Farrar, et al., Identification of a long non-coding RNA as a novel biomarker and potential therapeutic target for metastatic prostate cancer, Oncotarget 5 (3) (2014) 764–774. [25] X. Shen, B. Xie, Z. Ma, W. Yu, W. Wang, D. Xu, X. Yan, B. Chen, L. Yu, J. Li, et al.,

[26]

[27] [28]

[29] [30] [31]

[32]

433

Identification of novel long non-coding RNAs in triple-negative breast cancer, Oncotarget 6 (25) (2015) 21730–21739. X. Guo, Z. Yang, Q. Zhi, D. Wang, L. Guo, G. Li, R. Miao, Y. Shi, Y. Kuang, Long noncoding RNA OR3A4 promotes metastasis and tumorigenicity in gastric cancer, Oncotarget 7 (21) (2016) 30276–30294. R. Siegel, D. Naishadham, A. Jemal, Cancer statistics, 2013, CA: Cancer J. Clin. 63 (1) (2013) 11–30. F.M. Lin, S. Kumar, J. Ren, S. Karami, S. Bahnassy, Y. Li, X. Zheng, J. Wang, T. Bawa-Khalfe, SUMOylation of HP1alpha supports association with ncRNA to define responsiveness of breast cancer cells to chemotherapy, Oncotarget 7 (21) (2016) 30336–30349. M.T. Qiu, J.W. Hu, R. Yin, L. Xu, Long noncoding RNA: an emerging paradigm of cancer research, Tumour Biol. 34 (2) (2013) 613–620. G. Eades, Y.S. Zhang, Q.L. Li, J.X. Xia, Y. Yao, Q. Zhou, Long non-coding RNAs in stem cells and cancer, World J. Clin. Oncol. 5 (2) (2014) 134–141. M. Cesana, D. Cacchiarelli, I. Legnini, T. Santini, O. Sthandier, M. Chinappi, A. Tramontano, I. Bozzoni, A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA, Cell 147 (2) (2011) 358–369. M. Xie, F.Q. Nie, M. Sun, R. Xia, Y.W. Liu, P. Zhou, W. De, X.H. Liu, Decreased long noncoding RNA SPRY4-IT1 contributing to gastric cancer cell metastasis partly via affecting epithelial-mesenchymal transition, J. Transl. Med. 13 (2015) 250.