miR-206 and targeting YY1

Biomedicine & Pharmacotherapy 124 (2020) 109887

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Long noncoding RNA HOTAIR promotes medulloblastoma growth, migration and invasion by sponging miR-1/miR-206 and targeting YY1

T

Jiantao Zhanga, Nan Lib, Jia Fub, Wenli Zhoub,* a b

Branch of the First Hospital of Jilin University, The Department of Colorectal and Anal Surgery, China The First Hospital of Jilin University, The Department of Neonatology, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Medulloblastoma Long non-coding RNA (LncRNA) HOTAIR microRNA (miRNA) Tumorigenesis YY1 miR-1/miR-206

Purpose: Long non-coding RNA (LncRNA) HOX transcript antisense RNA (HOTAIR) and Yin Yang 1 (YY1) are reported to be involved in tumorigenesis. However, the effect and molecular mechanism of HOTAIR on YY1 expression remains poorly understood. The study aimed to investigate the functions and molecular mechanism of LncRNA HOTAIR in medulloblastoma progression. Methods: qPCR was performed to detect HOTAIR and YY1 mRNA in tissues and cells, as well as that of miR-1 and miR-206 expression levels. Western blot assay was used to test YY1 and EMT-related biomarkers’ protein levels. Cell proliferation was tested with CCK-8 assay and colony formation assay. Migration and invasion abilities were tested with Transwell migration and invasion assays. Tumor growth was tested with an in vivo animal study. Cell apoptosis was tested with an Annexin V-FITC/PI kit. Luciferase assay was used to test the luciferase intensity of YY1 and HOTAIR. RNA pull down assay was used to detect the combination between HOTAIR and miR-1/miR206. Results: In this study, we found that HOTAIR and YY1 were up-regulated in medulloblastoma tissues and cell lines, and HOTAIR increased YY1 expression. The molecular mechanism demonstrated that HOTAIR negatively regulated miR-1 and miR-206 expression, which can directly target YY1 in medulloblastoma cells. Moreover, HOTAIR increased YY1 expression through binding to miR-1 and miR-206. The functional experiments showed that HOTAIR knockdown suppressed medulloblastoma cell proliferation, tumor growth, migration and invasion, and promoted cell apoptosis via the modulation of the miR-1/miR-206-YY1 axis, as well as epithelial to mesenchymal transition (EMT). Conclusion: These data indicate that HOTAIR promotes medulloblastoma progression via acting as a competing endogenous RNA (ceRNA) to regulate YY1 expression through binding to miR-1 and miR-206.

1. Introduction Medulloblastoma is the most common malignant brain cancer of childhood in the posterior fossa of the brain with frequent metastasis [1,2]. Despite the beneficial treatment of medulloblastoma, including surgery, cranioradiotherapy and chemotherapy, pediatric patients suffer from poor 5-year survival rate [3]. Therefore, it is crucial to explore novel biomarkers involved in the medulloblastoma tumorigenesis and progression, which may facilitate to develop novel therapeutic strategies for patients with medulloblastoma. MicroRNAs (miRNAs) are a class of endogenous small non-coding RNA molecules that can act as important post-transcriptional regulators of gene expression through complete or incomplete base complementary pairing with target mRNA 3′untranslated region (3′UTR),

⁎

leading to target mRNA cleavage or translational repression [4]. Accumulating evidence indicates that miRNAs play crucial roles in diverse biological processes, including cell proliferation, apoptosis, and differentiation [5,6]. Moreover, miRNAs function as oncogenes or tumor suppressors in tumor development and progression [7]. Several studies have shown that miRNAs are involved in medulloblastoma cell proliferation and metastasis process. For example, miR-10b is upregulated in medulloblastoma and promotes cell proliferation and inhibits cell apoptosis through the modulation of BCL2 [8]. MiR-495 may serve as a prognostic biomarker of medulloblastoma through the regulation of GFI1 [9]. The loss of miR-34a can contribute to medulloblatomagenesis, implying that miR-34a delivery of miR-34a in tumors could supply a beneficial therapeutic strategy [10]. MiR-206 suppresses medulloblastoma cell proliferation and migration via negatively regulating LIM

Corresponding author at: The first hospital of Jilin university, the department of neonatology, 130000 China. E-mail address: [email protected] (W. Zhou).

https://doi.org/10.1016/j.biopha.2020.109887 Received 15 October 2019; Received in revised form 7 January 2020; Accepted 10 January 2020 0753-3322/ © 2020 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 124 (2020) 109887

J. Zhang, et al.

CTGTCTGTGAGTGCC3′. MiR-1 reverse transcription primer: 5’CTCAA CTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTACATACT3′. miR-1 forward: 5’ACACTCCAGGTGGGTGGAATGT3′; reverse: 5’CTCAACTGGTG TCGTGGAG3′. MiR-206 reverse transcript primer: 5’CTCAGCGGCTGT CGTGGACTGCGCGCTGCCGCTGAGCCACACAC3′. miR-206 forward: 5’ GGCGGTGGAATGTAAGGAAG3′; reverse: 5’GGCTGTCGTGGACTGCG3′. U6 forward: 5’CTCGCTTCGGCAGCACA3′; reverse: 5’AACGCTTCACGA ATTTGCGT3′.

and SH3 protein 1 [11]. These data indicate that miRNAs exert crucial roles in medulloblastoma and research focus on miRNAs may be a novel area. Long non-coding RNAs (LncRNAs) are a family of RNAs more than 200 nucleotides in length and are reported to be involved in diverse biological processes, including cell proliferation, migration, invasion and apoptosis [12]. A large scale of studies demonstrate that LncRNAs function through several mechanisms, including serving as transcriptional regulators, post-transcriptional regulators, and epigenetic modification [13–16]. Emerging evidence indicate that LncRNAs act as a competing endogenous RNAs (ceRNA) to participate in tumorigenesis through serving as a sponge of miRNAs. For example, LncRNA NEAT1 promotes lung adenocarcinoma development via acting as sponge of miR-193a-3p [17]. LncRNA KCNQ10T1 enhances tongue cancer cell proliferation and cisplatin resistance through modulating miR-211-5p, acting as an oncogene [18]. LncRNA HOTAIR contributes to esophageal squamous cell carcinoma progression via the miR-125 and miR-143/ HKI axis [19]. Previous studies have found that the critical effects of LncRNAs in medulloblastoma development and progression. These LncRNAs include Linc-NeD125 [20], CRNDE [21]. LncRNA HOTAIR is reported to be highly expressed in medulloblastoma, but the roles of HOTAIR in medulloblastoma tumorigenesis and the mechanism are poorly elucidated [22]. In the current study, we indicated that LncRNA HOTAIR was highly expressed in medulloblastoma tissues and cell lines. We then validated that HOTAIR mediated medulloblastoma phenotypes through the miR1/miR-206-YY1 axis, acting as a ceRNA of YY1.

2.4. Western blot assay Cells were harvested and lysed by RIPA lysis buffer for 30 min on ice. The lysed samples were separated on a 10 % SDS-PAGE gel and transferred to the PVDF membrane. The following primary antibodies were used: rabbit polyclonal to YY1 (Abcam, 1:1000), rabbit polyclonal to E-cadherin (Abcam, 1:1000), rabbit polyclonal to Vimentin (Abcam, 1:1000), rabbit polyclonal to fibronectin (Abcam, 1:1000). Horseradish peroxidase-conjugated goat anti-rabbit IgG was used as the secondary antibody (Abcam, 1:5000). The bands were visualized by ECL western blotting substrate (Solarbio, China). GAPDH was used as an internal control. 2.5. CCK-8 assay Cell proliferation was analyzed using cell counting kit 8 (CCK-8) according to the manufacturer’s protocols. Briefly, cells were seeded into 96-well plates at a density of 3000 cells per well and incubated for another 24 h. CCK-8 was added into the medium for 1 h, and cell absorbance was then measured by a spectrometer at 450 nm (OD450 nm).

2. Materials and methods 2.1. Human tissue samples

2.6. Cell apoptosis assay Ten primary pediatric medulloblastoma samples were obtained from the branch of the first hospital of Jilin university in accord with the human research protection guidelines. All samples were consent by the patients’ parents. Five normal cerebellar samples were obtained from non-malignant brain autopsies at the branch of the first hospital of Jilin university. All samples were stored at −80 °C for the following detection.

Cell apoptosis was measured using Annexin V-FITC/PI kit according to the manufacturer’s protocols. Annexin V-FITC (+) and PI (−) represented apoptotic cells. Annexin V-FITC (+) and PI (+) represented dead cells or late apoptotic cells. 2.7. Colony formation assay

2.2. Cell lines and transfection

Cells were seeded into 12-well plates at a density of 200 cells/well. The medium was refreshed every three days for approximately 12 days. The colonies were washed, fixed and stained by crystal violet, and were taken pictures and counted.

Human medulloblastoma cells, Daoy, D283 med and D341, were acquired from American Type Culture Collection (ATCC, Manassas, VA), and were cultured in ATCC-formulated Eagle’s Minimum Essential Medium, supplemented with 10 % fetal bovine serum (FBS) and 1 % PS (100 U/ml penicillin and 100 μg/ml streptomycin). The cells were maintained in a humidified atmosphere with 5 % CO2 at 37 °C. Cell transfection was performed by Lipofectamine™ 2000 reagent according to the manufacturer’s guidelines.

2.8. Cell migration and invasion assays The transfected cells (2.5*104 cells) were seeded into the upper chamber of the Transwell insert in 200 μl serum-free medium. The lower chamber was incubated with 10 % FBS-containing medium. After the cells migrated for approximately 20 h, the cells that did not migrate into the membrane were scraped by cotton tips. The migratory cells were fixed and stained, and finally imaged and counted under a microscope. For the cell invasion assay, the upper chamber was pre-coated with Matrigel (BD Bioscience).

2.3. RNA isolation and quantitative real-time PCR (qPCR) Total RNA from tissues or cells was extracted using TriZol reagent (Qiagen) according to the manufacturer’s protocols. RNA concentration was measured using NanoDrop ND-2000 and 500 ng of RNA was used for reverse transcription by the SuperScript IV Reverse Transcriptase (Thermo Fisher). The qPCR was performed using SYBR-Green PCR Master Mix kit on an ABI-7300 Real-time PCR System. GAPDH was used as an internal control to normalize target gene expression. U6 snRNA was used as an internal control to normalize miRNA expression. The primers used for reverse transcription and PCR were listed as followed: GAPDH forward: 5’GGAGCGAGATCCCTCCAAAAT3′; reverse: 5’GGCT GTTGTCATACTTCTCATGG3′. YY1 forward: 5’AAGAGCGGCAAGAAGA GTTAC3′; reverse: 5’CAACCACTGTCTCATGGTCAATA3′. HOTAIR forward: 5’GGTAGAAAAAGCAACCACGAAGC3′; reverse: 5’ACATAAACCT

2.9. An animal xenograft study 6-8 weeks old female nude mice were used for the tumor formation study according to the Institutional Committee of the first hospital of Jilin university hospital. Briefly, 107 Daoy cells suspended in PBS that were stably transfected with sh-HOTAIR, or miR-1 agomir, or miR-206 agomir were subcutaneously injected into the flank of nude mice. The tumor volume was measured using the following formula: V = 1/2 (length * width2). 2

Biomedicine & Pharmacotherapy 124 (2020) 109887

J. Zhang, et al.

3.3. HOTAIR negatively modulates miR-1 and miR-206 which also target YY1 in medulloblastoma cells

2.10. Plasmid construct and luciferase assay YY1 3′UTR or HOTAIR containing miR-1/miR-206 binding site was PCR-amplified and cloned downstream of a luciferase reporter gene in a pmirGLO vector. Mutations within the binding site were generated using QuickChangeXL Site-directed Mutagenesis kit (Stratagene) according to the manufacturer’s protocols. MiRNA mimics, miRNA agomirs, miRNA inhibitors, HOTAIR shRNA, or controls were purchased from Genepharma. For the luciferase reporter assay, the cells were co-transfected with miRNA mimics and wild type or mutant luciferase construct. After 48 h transfection, cells were harvested and subjected to luciferase assay using the Dual-luciferase reporter System (Promega).

Considering that LncRNA act as a molecular sponge of miRNAs in cancers, we speculated that HOTIAR might increase YY1 expression through the modulation of miRNAs. Using the prediction algorithms StarBase 2.0, we found that there existed potential binding sites between HOTAIR and miR-1 and miR-206 (these two miRNAs share same seed sequence) (Fig. 3A). Then we detected the effect of HOTAIR on miR-1 and miR-206 by qPCR. The data indicated that HOTAIR knockdown increased miR-1 and miR-206 expression, while HOTAIR suppressed miR-1 and miR-206 levels (Fig. 3B). Moreover, luciferase assay showed that miR-1 and miR-206 inhibited the luciferase intensity controlled by HOTAIR, while the inhibitory effect disappeared when the binding sites between miRNAs and HOTAIR were mutated (Fig. 3C). Finally, we found that miR-1 and miR-206 were downregulated in medulloblastoma cells, opposite to that of HOTAIR (Fig. 3D). Finally, we performed RNA pull-down assay to confirm the interaction between HOTAIR and miR-1/206. As shown in Fig. 3E, the data indicated that HOTAIR was more enriched in miR-1 and miR-206 than that in mutant miR-1 or mutant miR-206 with broken HOTAIR binding site. These data demonstrated that HOTAIR negatively target miR-1 and miR-206 in medulloblastoma. On the other hand, we found that miR-1 and miR-206 had potential binding site with YY1 3′UTR (Fig. 4A). As shown in Fig. 4B and C, miR1 and miR-206 suppressed YY1 mRNA and protein levels in Daoy and D283 med cells compared to control group. The results shown in Fig. 4D suggested that miR-1 and miR-206 suppressed YY1 luciferase intensity, while HOTAIR knockdown abrogated the inhibitory effect of miR-1 and miR-206 on YY1. However, when the binding sites between miR-1/miR-206 and HOTAIR were mutated, mutant HOTAIR did not affect YY1 intensity. Overall, the data indicate that HOTAIR modulates YY1 expression via binding to miR-1/miR-206.

2.11. Establishment of stable cells lines Daoy cells that stably expressed HOTAIR shRNA were generated by transfecting lentivirus overexpressing HOTAIR shRNA, followed by selection with puromycin. The stable cell lines were validated using qPCR assay to analyze HOTAIR expression. 2.12. RNA pull-down assay The Pierce™ Magnetic RNA-Protein Pull-Down Kit was used perform RNA pull-down assay according to the manufacturer’s protocol. Briefly, Daoy or D283 cells were transfected with 3′end biotinylated miR-1/206 or mutant miR-1/206 or controls using Pierce™ RNA 3′ End Desthiobiotinylation Kit, followed by incubation with streptavidincoated magnetic heads at 24 h post transfection. The level of HOTAIR in the bound fraction was then determined by qPCR. 2.13. Statistical analysis Data were expressed as mean + standard deviation (SD) from three independent experiments and one representative data was shown. The differences between two groups were analyzed by two-tailed student’s t-test, while differences among three or more groups were analyzed using One-way ANOVA. A p value < 0.05 was considered statistically significant.

3.4. HOTAIR/miR-1 or miR-206/YY1 axis modulates medulloblastoma cell proliferation and promotes apoptosis Considering that miR-1/miR-206 was a target of HOTAIR in medulloblastoma cells, we tried to validate whether the potential ceRNA mechanism among LncRNA HOTAIR, miR-1/miR-206 and their target YY1 do exist. Firstly, we performed rescue experiments to observe the roles of HOTAIR/miR-1 or miR-206 in cell growth. As shown in Fig. 5A, the data from CCK-8 assay indicated that HOTAIR or YY1 knockdown suppressed cell viability in Daoy and D283 cells, while inhibition of miR-1 or miR-206 abrogated the inhibitory roles of HOTAIR knockdown in cell viability. We also found that YY1 overexpression restored the cell viability inhibited by HOTAIR knockdown (Fig. 5A). Furthermore, knockdown of HOTAIR or YY1 reduced the cell colony formation of Daoy and D283 cells. However, miR-1/miR-206 inhibition or YY1 overexpression can rescue the colony-forming ability inhibited by HOTAIR knockdown (Fig. 5B). Results from apoptosis assay indicated that HOTAIR or YY1 silencing promoted cell apoptosis, while inhibition of miR-1/miR-206 or overexpressing abolished the increased apoptosis induced by HOTAIR knockdown or YY1 (Fig. 5C). Finally, we detected the effect of HOTAIR on tumor growth through subcutaneous injection of cells into nude mice. The in vivo study demonstrated that the xenograft formed HOTAIR shRNA-treated cells had a smaller volume than the control group. Similarly, miR-1 and miR-206 also inhibited the tumor growth, compared to control group (Fig. 5D).

3. Results 3.1. LncRNA HOTAIR and YY1 are upregulated in medulloblastoma We first detected the expression levels of HOTIAR and YY1 in 5 normal cerebellum tissue samples and 10 medulloblastoma tissues. The results from Fig. 1A showed that HOTAIR expression was higher in medulloblastoma tissues than normal samples. YY1 was upregulated in medulloblastoma tissues, compared to normal samples. In line with the data from medulloblastoma tissues, we found that HOTAIR and YY1 were overexpressed in medulloblastoma cell lines, D341, D283 and Daoy, compared to normal cerebellum (Fig. 1B). 3.2. HOTAIR increases YY1 expression in medulloblastoma cells Furthermore, we aimed to investigate the effect of HOTAIR on YY1 expression in Daoy and D283 med cells. First, the knockdown of HOTAIR by transient transfection with HOTAIR siRNA or HOTAIR overexpression by transient transfection with HOTAIR-overexpressing plasmid was confirmed by qPCR in these cells (Fig. 2A). As shown in Fig. 2B, HOTAIR knockdown reduced YY1 expression compared to control group, while HOTAIR increased YY1 expression. In accord with qPCR data, Western blot assays showed that HOTAIR knockdown suppressed YY1 protein level, while HOTAIR resulted in opposite effect (Fig. 2C).

3.5. HOTAIR/miR-1 or miR-206/YY1 axis modulates cell migration and invasion Metastasis is a main characteristics of medulloblastoma, and we aimed to detect the effect of HOTAIR on cell migration and invasion. As shown in Fig. 5E and F, we found that silencing HOTAIR or YY1 3

Biomedicine & Pharmacotherapy 124 (2020) 109887

J. Zhang, et al.

Fig. 1. HOTAIR and YY1 are up-regulated in medulloblastoma tissues and cell lines. (A) qPCR was performed to analyze HOTAIR and YY1 mRNA levels in 5 normal cerebellum and 10 pediatric medulloblastoma patients’ samples. (B) HOTAIR and YY1 mRNA levels were measured by qPCR assay in normal cerebellum and medulloblastoma cell lines. *P < 0.05.

4. Discussion

suppressed Daoy and D283 cell migration and invasion, compared to control group. However, inhibition of miR-1 and miR-206 or overexpression of YY1 can ameliorate the inhibitory effect of HOTAIR knockdown on cell migration and invasion. We finally examined the EMT-related proteins in HOTAIR siRNA treated cells. The data showed that knockdown of HOTAIR increased E-cadherin expression (a biomarker of epithelial cells), and reduced the expression levels of Vimentin, α-SMA and Fibronectin (biomarkers of mesenchymal cells). However, YY1 overexpression reduced E-cadherin expression, and enhanced the expression levels of Vimentin, α-SMA and Fibronectin. In addition, miR-1 or miR-206 overexpression had similar effect to that of HOTAIR on EMT traits (Fig. 5G). The data imply that HOTAIR/miR-1 or miR-206/YY1 axis may influence medulloblastoma metastasis.

Accumulating evidence indicates that HOTAIR is involved in cancer development. For instance, HOTAIR is upregulated in gastric cancer and promotes cell proliferation, cell cycle and migration through miR217 [23]. HOTAIR can promote oral squamous cell carcinoma metastasis and EMT, invasion as we as tumorigenesis in xenograft model [24]. HOTAIR knockdown suppresses HCC cell viability and tumor growth via miR-218/Bim-1 axis [25]. HOTAIR increases cancer invasiveness and metastasis via PRC2 [26]. In line with the findings in the previous studies, our data demonstrated that HOTAIR was upregulated in medulloblastoma tissues and cell lines, and knockdown of HOTAIR suppressed cell viability, colony formation ability, migration and Fig. 2. HOTAIR upregulates YY1 expression are in medulloblastoma cell lines. (A) HOTAIR level was analyzed by qPCR in Daoy and D283 cells transfected with HOTAIR shRNA or HOTAIR-overexpression plasmid or controls. (B) YY1 mRNA level was analyzed by qPCR in Daoy and D283 cells transfected with HOTAIR shRNA or HOTAIR-overexpression plasmid or controls. (C)YY1 protein level was analyzed by Western Blot in Daoy and D283 cells transfected with HOTAIR shRNA or HOTAIR-overexpression plasmid or controls. *P < 0.05. **P < 0.01.

4

Biomedicine & Pharmacotherapy 124 (2020) 109887

J. Zhang, et al.

Fig. 3. HOTAIR directly modulates miR-1/miR-206 expression in medulloblastoma cell lines. (A)The alignment between HOTAIR and miR-1/miR-206. (B) The effect of HOTAIR on miR-1/miR-206 expression levels was analyzed by qPCR in Daoy and D283 cells that were transfected with HOTAIR shRNA or HOTAIR-overexpression plasmid. (C) Luciferase assay was performed to investigate the effect of miR-1/miR-206 on HOTAIR luciferase intensity. The cells were co-transfected with miR-1/ miR-206 and HOTAIR WT or mutant HOTAIR, together with controls. (D) qPCR was carried out to examine miR-1/miR-206 expression levels in medullobalstoma cell lines. (E) RNA pull down assay was used to confirm the combination between HOTAIR and miR-1 and miR-206 in medulloblastoma cells. *P < 0.05. **P < 0.01.

Fig. 4. YY1 is a direct target of miR-1 and miR206. (A) Alignment between YY1 and miR-1 or miR-206. The bases in red color represented the mutated sites. (B–C) YY1 mRNA and protein levels were examined by qPCR and Western Blot in cells transfected with miR-1 or miR-206. (D) The cells were transfected with miR-1 or miR-206 and YY1 or mutant YY1 or together with wild type or mutant HOTAIR to investigate the YY1 luciferase intensity. *P < 0.05 (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

5

Biomedicine & Pharmacotherapy 124 (2020) 109887

J. Zhang, et al.

Fig. 5. HOTAIR-miR-1/miR-206-YY1 axis modulated medulloblastoma cell proliferation, apoptosis, migration and invasion. Day and D283 cells were transfected with HOTAIR shRNA or YY1 shRNA or HOTAIR shRNA and miR-1 or miR-206 inhibitor or HOTAIR shRNA and YY to perform the rescue experiments to detect the cell viability (A), colony formation ability (B) and apoptosis (C). (D) In vivo tumor assay was performed to test the tumor growth. The mice was inoculated with cells expressing miR-1 or miR-206 or HOTAIR shRNA, and tumor volume was calculated every week. The left graph showed the xenografts, and the right graph showed the tumor growth curve. *P < 0.05. **P < 0.01. (E–F) The above rescue experiments were performed to test the cell migration and invasion abilities. (G) The cells were transfected with HOTAIR shRNA or miR-1 or miR-206 or YY1 and subjected to Western Blot assay to investigate the protein levels of EMT related biomarkers, including E-cadherin, vimentin, fibronectin andand alpha-SMA. *P < 0.05.

6

Biomedicine & Pharmacotherapy 124 (2020) 109887

J. Zhang, et al.

Fig. 5. (continued)

7

Biomedicine & Pharmacotherapy 124 (2020) 109887

J. Zhang, et al.

potential therapeutic target of medulloblastoma treatment.

invasion, as well as promoted cell apoptosis. HOTAIR knockdown suppressed EMT by increasing E-cadherin and reducing Vimentin and Fibronectin. Moreover, HOTAIR knockdown inhibited tumor growth. These data suggest that HOTAIR contributes to medulloblastoma tumorigenesis. Competing endogenous RNAs (ceRNAs) have binding sites with a common set of miRNAs and crosstalk with each other by acting as a sponge of miRNA. The LncRNA-miRNA-mRNA formed a ceRNA network that participated in various cancers, including hepatocellular carcinoma [27], medulloblastoma [20] and lung adenocarcinoma [28]. In this study, HOTAIR negatively regulated miR-1 and miR-206 by directly competitively binding to miR-1 and miR-206. The functional experiments showed that HOTAIR knockdown suppressed cell proliferation, migration and invasion, as well as promoted cell apoptosis through acting as a sponge of miR-1/miR-206. In addition, HOTAIR can positively regulate the expression of YY1, which was a direct target of miR-1 or miR-206. MiR-1 and miR-206 are members of miR-1 family and these two miRNAs share common seed sequences. Emerging data indicate that miR-1 and miR-206 play important role in tumor development and progression. For example, miR-1 suppresses cell proliferation and promotes cell apoptosis by targeting Src in esophageal carcinoma [29]. HOTAIR promotes thyroid cancer growth, migration and invasion by targeting miR-1 [30]. MiR-1 suppresses EMT and tumorigenesis by targeting Slug in prostate cancer [31], functioning as a tumor suppressor. MiR-206 is downregulated in ovarian cancer tissues and cells and inhibits cell proliferation and metastasis via suppressing c-Met/ Akt/mTOR pathway [32]. MiR-206 suppresses HCC cell growth via targeting CDK9 [33]. MiR-206 suppresses medulloblastoma cell proliferation and migration via negatively regulating LIM and SH3 protein 1 [11]. Accordingly, we found that miR-1 and miR-206 were downregulated in medulloblastoma cells. Inhibition of miR-1/miR-206 can restore the cell proliferation, migration, invasion and EMT that were suppressed by HOTAIR knockdown. Moreover, miR-1 and miR-206 suppressed tumor growth in the in vivo study. Yin Yang 1 (YY1) is a ubiquitously expressed transcription factor and belongs to the GLI-Kruppel family of zinc finger protein. YY1 is reported to play important role in various types of tumors. YY1 can promote tumor cell proliferation and tumorigenesis through the regulation of pentose phosphate activity [34]. YY1 induces cell proliferation, migration and invasion in colon cancer and acts as a direct target of miR-215 [35]. YY1 can promote HCC tumorigenesis and inhibits apoptosis partially via NF-kB activation [36]. In gastric carcinoma, YY1 can contribute to cell growth, migration, invasion and tumorigenesis [37]. In accord with the previous data, our study showed that YY1 knockdown suppressed medulloblastoma cell proliferation, migration and invasion, as well as promoted cell apoptosis, while YY1 overexpression can restore the phenotypes that were inhibited by HOTAIR knockdown. Since YY1 is a transcription factor, it acts as a gene activator or repressor in gene regulation. YY1 can promote chemo-resistance of acute lymphoblastic leukemia by binding to MDR1 promoter, activating MDR1 transcription [38]. YY1 can mediate enhancer-protein interaction in gene regulation [39]. A previous study indicates that YY1 can activate PI3K-Akt pathway through promoting HOTAIR expression via binding to HOTAIR promoter in recurrent miscarriage [40]. In our study, we found that HOTAIR can increase YY1 expression. Thus, we propose that HOTAIR-YY1 feedback plays important role in medulloblastoma, which needs to be verified in future in our lab.

Funding The study was supported by the Jilin province science and technology development plan (20050407-4). Ethics approval and consent to participate Animal experiments were approved by the Ethics Committee of the first hospital of Jilin University. Written informed consent was obtained from each individual participant. Authors’ contributions Jiantao Zhang and Nan Li performed the molecular studies. Jiantao Zhang and Jia Fu performed the animal experiments. Jiantao Zhang, Nan Li and Jia Fu provided experimental technical support and performed the statistical analysis. Wenli Zhou designed the study and helped to draft the manuscript. All authors read and approved the final manuscript. Declaration of Competing Interest The authors declare that there are no conflict of interests. Acknowledgement The authors would like to thank all the doctors of the department of colorectal and anal surgery, as well as the department of neonatology, the First Hospital of Jilin University, for providing all the necessary information required for this study. References [1] R.J. Young, Y. Khakoo, S. Yhu, S. Wolden, K.C. De Braganca, S.W. Gilheeney, I.J. Dunkel, Extraneural metastases of medulloblastoma: desmoplastic variants may have prolonged survival, Pediatr. Blood Cancer 62 (2015) 611–615. [2] R. Gao, R. Zhang, C. Zhang, Y. Liang, W. Tang, LncRNA LOXL1-AS1 promotes the proliferation and metastasis of medulloblastoma by activating the PI3K/AKT pathway, Anal. Cell. Pathol. 2018 (2018) 9275685. [3] D.T. Jones, N. Jager, M. Kool, T. Zichner, B. Hutter, M. Sultan, Y.J. Cho, T.J. Pugh, V. Hovestadt, A.M. Stutz, T. Rausch, H.J. Warnatz, M. Ryzhova, S. Bender, D. Sturm, S. Pleier, H. Cin, E. Pfaff, L. Sieber, A. Wittmann, M. Remke, H. Witt, S. Hutter, T. Tzaridis, J. Weischenfeldt, B. Raeder, M. Avci, V. Amstislavskiy, M. Zapatka, U.D. Weber, Q. Wang, B. Lasitschka, C.C. Bartholomae, M. Schmidt, C. von Kalle, V. Ast, C. Lawerenz, J. Eils, R. Kabbe, V. Benes, P. van Sluis, J. Koster, R. Volckmann, D. Shih, M.J. Betts, R.B. Russell, S. Coco, G.P. Tonini, U. Schuller, V. Hans, N. Graf, Y.J. Kim, C. Monoranu, W. Roggendorf, A. Unterberg, C. HeroldMende, T. Milde, A.E. Kulozik, A. von Deimling, O. Witt, E. Maass, J. Rossler, M. Ebinger, M.U. Schuhmann, M.C. Fruhwald, M. Hasselblatt, N. Jabado, S. Rutkowski, A.O. von Bueren, D. Williamson, S.C. Clifford, M.G. McCabe, V.P. Collins, S. Wolf, S. Wiemann, H. Lehrach, B. Brors, W. Scheurlen, J. Felsberg, G. Reifenberger, P.A. Northcott, M.D. Taylor, M. Meyerson, S.L. Pomeroy, M.L. Yaspo, J.O. Korbel, A. Korshunov, R. Eils, S.M. Pfister, P. Lichter, Dissecting the genomic complexity underlying medulloblastoma, Nature 488 (2012) 100–105. [4] D.P. Bartel, MicroRNAs: genomics, biogenesis, mechanism, and function, Cell 116 (2004) 281–297. [5] J.F. Chen, E.M. Mandel, J.M. Thomson, Q. Wu, T.E. Callis, S.M. Hammond, F.L. Conlon, D.Z. Wang, The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation, Nat. Genet. 38 (2006) 228–233. [6] I. Alvarez-Garcia, E.A. Miska, MicroRNA functions in animal development and human disease, Development (Cambridge, England) 132 (2005) 4653–4662. [7] H.W. Hwang, J.T. Mendell, MicroRNAs in cell proliferation, cell death, and tumorigenesis, Br. J. Cancer 27 (2006) 776–780. [8] R. Pal, S. Greene, microRNA-10b is overexpressed and critical for cell survival and proliferation in medulloblastoma, PLoS One 10 (2015) e0137845. [9] C. Wang, Z. Yun, T. Zhao, X. Liu, X. Ma, MiR-495 is a Predictive Biomarker that Downregulates GFI1 Expression in Medulloblastoma, Cell. Physiol. Biochem. 36 (2015) 1430–1439. [10] T. Thor, A. Kunkele, K.W. Pajtler, A.K. Wefers, H. Stephan, P. Mestdagh, L. Heukamp, W. Hartmann, J. Vandesompele, N. Sadowski, L. Becker, L. Garrett, S.M. Holter, M. Horsch, J. Calzada-Wack, T. Klein-Rodewald, I. Racz, A. Zimmer, J. Beckers, F. Neff, T. Klopstock, P. De Antonellis, M. Zollo, W. Wurst, H. Fuchs, V. Gailus-Durner, U. Schuller, M.H. de Angelis, A. Eggert, A. Schramm, J.H. Schulte,

5. Conclusion We demonstrated that HOTAIR can promote medulloblastoma cell growth, migration, invasion, EMT, as well as inhibite cell apoptosis through negatively regulating miR-1 and miR-206 and activating YY1 expression, which implied HOTIAR-miR-1/miR-206-YY1 axis may be a 8

Biomedicine & Pharmacotherapy 124 (2020) 109887

J. Zhang, et al.

[11]

[12]

[13] [14]

[15] [16]

[17]

[18]

[19]

[20]

[21] [22]

[23]

[24]

[25]

[26]

MiR-34a deficiency accelerates medulloblastoma formation in vivo, Int. J. Cancer Suppl. 136 (2015) 2293–2303. X. Pan, Z. Wang, B. Wan, Z. Zheng, MicroRNA-206 inhibits the viability and migration of medulloblastoma cells by targeting LIM and SH3 protein 1, Exp. Ther. Med. 14 (2017) 3894–3900. J. Wu, W. Zhao, Z. Wang, X. Xiang, S. Zhang, L. Liu, Long non-coding RNA SNHG20 promotes the tumorigenesis of oral squamous cell carcinoma via targeting miR197/LIN28 axis, J. Cell. Mol. Med. 23 (2019) 680–688. T.R. Mercer, M.E. Dinger, J.S. Mattick, Long non-coding RNAs: insights into functions, Nat. Rev. Genet. 10 (2009) 155–159. M.G. Guenther, S.S. Levine, L.A. Boyer, R. Jaenisch, R.A. Young, A chromatin landmark and transcription initiation at most promoters in human cells, Cell Biochem. Biophys. 130 (2007) 77–88. Y. He, B. Vogelstein, V.E. Velculescu, N. Papadopoulos, K.W. Kinzler, The antisense transcriptomes of human cells, Science 322 (2008) 1855–1857. Z.R. Wu, L. Yan, Y.T. Liu, L. Cao, Y.H. Guo, Y. Zhang, H. Yao, L. Cai, H.B. Shang, W.W. Rui, G. Yang, X.B. Zhang, H. Tang, Y. Wang, J.Y. Huang, Y.X. Wei, W.G. Zhao, B. Su, Z.B. Wu, Inhibition of mTORC1 by lncRNA H19 via disrupting 4E-BP1/Raptor interaction in pituitary tumours, Nat. Commun. 9 (2018) 4624. D.D. Xiong, Z.Y. Li, L. Liang, R.Q. He, F.C. Ma, D.Z. Luo, X.H. Hu, G. Chen, The LncRNA NEAT1 Accelerates Lung Adenocarcinoma Deterioration and Binds to Mir193a-3p as a Competitive Endogenous RNA, Cell. Physiol. Biochem. 48 (2018) 905–918. S. Zhang, H. Ma, D. Zhang, S. Xie, W. Wang, Q. Li, Z. Lin, Y. Wang, LncRNA KCNQ1OT1 regulates proliferation and cisplatin resistance in tongue cancer via miR-211-5p mediated Ezrin/Fak/Src signaling, Cell Death Dis. 9 (2018) 742. J. Ma, Y. Fan, T. Feng, F. Chen, Z. Xu, S. Li, Q. Lin, X. He, W. Shi, Y. Liu, Z. Liu, B. Zhu, X. Cao, Correction: HOTAIR regulates HK2 expression by binding endogenous miR-125 and miR-143 in oesophageal squamous cell carcinoma progression, Oncotarget 9 (2018) 23843. P. Laneve, A. Po, A. Favia, I. Legnini, V. Alfano, J. Rea, V. Di Carlo, V. Bevilacqua, E. Miele, A. Mastronuzzi, A. Carai, F. Locatelli, I. Bozzoni, E. Ferretti, E. Caffarelli, The long noncoding RNA linc-NeD125 controls the expression of medulloblastoma driver genes by microRNA sponge activity, Oncotarget 8 (2017) 31003–31015. H. Song, L.M. Han, Q. Gao, Y. Sun, Long non-coding RNA CRNDE promotes tumor growth in medulloblastoma, Eur. Rev. Med. Pharmacol. Sci. 20 (2016) 2588–2597. M. Chakravadhanula, V.V. Ozols, C.N. Hampton, L. Zhou, D. Catchpoole, R.D. Bhardwaj, Expression of the HOX genes and HOTAIR in atypical teratoid rhabdoid tumors and other pediatric brain tumors, Cancer Genet. 207 (2014) 425–428. H. Wang, R. Qin, A. Guan, Y. Yao, Y. Huang, H. Jia, W. Huang, J. Gao, A.-O. h. o. o, HOTAIR enhanced paclitaxel and doxorubicin resistance in gastric cancer cells partly through inhibiting miR-217 expression, J. Cell. Biochem. 119 (2018) 7226–7234. M.Y. Lu, Y.W. Liao, P.Y. Chen, P.L. Hsieh, C.Y. Fang, C.Y. Wu, M.L. Yen, B.Y. Peng, D.P. Wang, H.C. Cheng, C.Z. Wu, Y.H. Shih, D.J. Wang, C.C. Yu, L.L. Tsai, Targeting LncRNA HOTAIR suppresses cancer stemness and metastasis in oral carcinomas stem cells through modulation of EMT, Oncotarget 8 (2017) 98542–98552. W.M. Fu, X. Zhu, W.M. Wang, Y.F. Lu, B.G. Hu, H. Wang, W.C. Liang, S.S. Wang, C.H. Ko, M.M. Waye, H.F. Kung, G. Li, J.F. Zhang, Hotair mediates hepatocarcinogenesis through suppressing miRNA-218 expression and activating P14 and P16 signaling, J. Hepatol. 63 (2015) 886–895. R.A. Gupta, N. Shah, K.C. Wang, J. Kim, H.M. Horlings, D.J. Wong, M.C. Tsai, T. Hung, P. Argani, J.L. Rinn, Y. Wang, P. Brzoska, B. Kong, R. Li, R.B. West, M.J. van de Vijver, S. Sukumar, H.Y. Chang, Long non-coding RNA HOTAIR

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

9

reprograms chromatin state to promote cancer metastasis, Nature 464 (2010) 1071–1076. P. Lin, D.Y. Wen, Q. Li, Y. He, H. Yang, G. Chen, Genome-Wide Analysis of Prognostic lncRNAs, miRNAs, and mRNAs Forming a Competing Endogenous RNA Network in Hepatocellular Carcinoma, Cell. Physiol. Biochem. 48 (2018) 1953–1967. X. Tan, P. Banerjee, X. Liu, J. Yu, D.L. Gibbons, P. Wu, K.L. Scott, L. Diao, X. Zheng, J. Wang, A. Jalali, M. Suraokar, J. Fujimoto, C. Behrens, X. Liu, C.G. Liu, C.J. Creighton, I.I. Wistuba, J.M. Kurie, The epithelial-to-mesenchymal transition activator ZEB1 initiates a prometastatic competing endogenous RNA network, J. Clin. Invest. 128 (2018) 1267–1282. Z. Liao, X. Wang, H. Liang, A. Yu, U. Ur Rehman, Q. Fan, Y. Hu, C. Wang, Z. Zhou, T. Wang, A.-O. h. o. o, miR-1 suppresses the proliferation and promotes the apoptosis of esophageal carcinoma cells by targeting Src, Cancer Med. 6 (2017) 2957–2965. W. Di, Q. Li, W. Shen, H. Guo, S. Zhao, The long non-coding RNA HOTAIR promotes thyroid cancer cell growth, invasion and migration through the miR-1-CCND2 axis, Am. J. Cancer Res. 7 (2017) 1298–1309. Y.N. Liu, J.J. Yin, W. Abou-Kheir, P.G. Hynes, O.M. Casey, L. Fang, M. Yi, R.M. Stephens, V. Seng, H. Sheppard-Tillman, P. Martin, K. Kelly, MiR-1 and miR200 inhibit EMT via Slug-dependent and tumorigenesis via Slug-independent mechanisms, Oncogene 32 (2013) 296–306. C. Dai, Y. Xie, X. Zhuang, Z. Yuan, MiR-206 inhibits epithelial ovarian cancer cells growth and invasion via blocking c-Met/AKT/mTOR signaling pathway, Biomed. Pharmacother. 104 (2018) 763–770. C. Pang, G. Huang, K. Luo, Y. Dong, F. He, G. Du, M. Xiao, W. Cai, miR-206 inhibits the growth of hepatocellular carcinoma cells via targeting CDK9, Cancer Med. 6 (2017) 2398–2409. S. Wu, H. Wang, Y. Li, Y. Xie, C. Huang, H. Zhao, M. Miyagishi, V. Kasim, Transcription factor YY1 promotes cell proliferation by directly activating the pentose phosphate pathway, Cancer Res. 78 (2018) 4549–4562. Z. Chen, S. Han, W. Huang, J. Wu, Y. Liu, S. Cai, Y. He, S. Wu, W. Song, MicroRNA215 suppresses cell proliferation, migration and invasion of colon cancer by repressing Yin-Yang 1, Biochem. Biophys. Res. Commun. 479 (2016) 482–488. D.P. Tsang, W.K. Wu, W. Kang, Y.Y. Lee, F. Wu, Z. Yu, L. Xiong, A.W. Chan, J.H. Tong, W. Yang, M.S. Li, S.S. Lau, X. Li, S.D. Lee, Y. Yang, P.B. Lai, D.Y. Yu, G. Xu, K.W. Lo, M.T. Chan, H. Wang, T.L. Lee, J. Yu, N. Wong, K.Y. Yip, K.F. To, A.S. Cheng, Yin Yang 1-mediated epigenetic silencing of tumour-suppressive microRNAs activates nuclear factor-kappaB in hepatocellular carcinoma, J. Pathol. 238 (2016) 651–664. A.M. Wang, T.T. Huang, K.W. Hsu, K.H. Huang, W.L. Fang, M.H. Yang, S.S. Lo, C.W. Chi, J.J. Lin, T.S. Yeh, Yin Yang 1 is a target of microRNA-34 family and contributes to gastric carcinogenesis, Oncotarget 5 (2014) 5002–5016. G. Antonio-Andres, J. Rangel-Santiago, B. Tirado-Rodriguez, G.U. Martinez-Ruiz, M. Klunder-Klunder, M.I. Vega, B. Lopez-Martinez, E. Jimenez-Hernandez, J. Torres Nava, A. Medina-Sanson, S. Huerta-Yepez, Role of Yin Yang-1 (YY1) in the transcription regulation of the multi-drug resistance (MDR1) gene, Leuk. Lymphoma (2018) 1–11. A.S. Weintraub, C.H. Li, A.V. Zamudio, A.A. Sigova, N.M. Hannett, D.S. Day, B.J. Abraham, M.A. Cohen, B. Nabet, D.L. Buckley, Y.E. Guo, D. Hnisz, R. Jaenisch, J.E. Bradner, N.S. Gray, R.A. Young, YY1 is a structural regulator of enhancerpromoter loops, Cell (2017) 171. Y. Zhang, F. Jin, X.C. Li, F.J. Shen, X.L. Ma, F. Wu, S.M. Zhang, W.H. Zeng, X.R. Liu, J.X. Fan, Y. Lin, F.J. Tian, The YY1-HOTAIR-MMP2 signaling axis controls trophoblast invasion at the maternal-fetal interface, Mol. Ther. 25 (2017) 2394–2403.