- Email: [email protected]
MicroRNA-29a promotes smooth muscle cell differentiation from stem cells by targeting YY1
Stem Cell Research 17 (2016) 277–284
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
MicroRNA-29a promotes smooth muscle cell differentiation from stem cells by targeting YY1 Min Jin a,1, Yutao Wu b,1, Yanwei Wang c,1, Danqing Yu a, Mei Yang b, Feng Yang b, Chun Feng a, Ting Chen b,⁎ a b c
Division of Reproductive Medicine & Infertility, The Second Affiliated Hospital, School of Medicine, Zhejiang University, 88#, Jiefang Rd., Hangzhou, Zhejiang 310009, PR China Department of Cardiology, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, PR China Department of Cardiology, Ningbo Medical Treatment Center Lihuili Hospital, Ningbo 315000, PR China
a r t i c l e
i n f o
Article history: Received 23 January 2016 Received in revised form 22 July 2016 Accepted 30 July 2016 Available online 02 August 2016
a b s t r a c t MicroRNA-29a (miR-29a) has been extensively studied in tumor biology and fibrotic diseases, but little is known about its functional roles in vascular smooth muscle cell (VSMC) differentiation from embryonic stem cells (ESCs). Using well-established VSMC differentiation models, we have observed that miR-29a induces VSMC differentiation from mouse ESCs by negatively regulating YY1, a transcription factor that inhibits muscle cell differentiation and muscle-specific gene expression. Moreover, gene expression levels of three VSMC specific transcriptional factors were up-regulated by miR-29a over-expression, but down-regulated by miR-29a inhibition or YY1 over-expression. Taken together, our data demonstrate that miR-29a and its target gene, YY1, play a regulatory role in VSMC differentiation from ESCs in vitro and in vivo. © 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction Smooth muscle cells (SMCs) form the walls of blood vessels, providing the healthy vessel with its structure and contributing to the formation and progression of atherosclerotic plaques. Alterations in the normal structure or function of the differentiated VSMCs play a major role in a number of diseases, including atherosclerosis, cancer, and hypertension (Owens et al., 2004). A better understanding of the mechanisms and molecular regulation of VSMC differentiation is needed for both prevention and treatment of these diseases. Stem cells are long-lived cells with a remarkable capability of both self-renewal and differentiation into multiple specialized cell types (Weissman, 2000). ESCs are pluripotent stem cells derived from the inner cell mass of a blastocyst (Thomson et al., 1998). Several in vitro models have been well established to understand the regulation of VSMC differentiation, but the underlying molecular mechanisms have not been fully clarified (Xie et al., 2011). MicroRNAs (miRs) are small non-coding RNAs (~ 22 nucleotides) that bind to complementary sites of their target mRNAs and inhibit their translation (Hutvagner et al., 2001; Rossi, 2005). They are diverse in sequence and expression patterns (Ambros, 2001). In recent studies,
⁎ Corresponding author. E-mail address: [email protected] (T. Chen). 1 Min Jin, Yutao Wu and Yanwei Wang contributed equally to this work.
miRs have been suggested to play a major role in regulating gene expression in most organisms and have been implicated in regulating the self-renewal and differentiation program of stem cells (Ivey et al., 2008; Martinez and Gregory, 2010). Emerging evidence clearly suggests that miRs play a broad role in multiple aspects of endothelial biology, and have been proven to be critical in mediating endothelial cell (EC) differentiation (Zhou et al., 2014). Previous studies have shown that miRs can affect VSMC biology, including phenotypic switching, proliferation, and migration. Especially, miR-143/miR-145, miR-21, and miR133 have been reported to play a role in VSMC differentiation (Robinson and Baker, 2012). MicroRNA-29a (miR-29a) has been extensively investigated in different fields. Roberta et al. reported that miR-29a is significantly associated with hypertrophy and fibrosis, suggesting that miR-29a can be a potential biomarker for hypertrophic cardiomyopathy (Roncarati et al., 2014). MiR-29a also functions as a negative regulator of collagen gene expression. Maintaining miR-29a expression would have beneficial effects in fibrotic diseases (van Rooij et al., 2008). As an important regulator of the inflammatory response, miR-29a regulates scavenger receptor expression by targeting lipoprotein lipase (Chen et al., 2011). In addition, miR-29a has been implicated in malignancies (Pekarsky and Croce, 2010) and found to be highly expressed in the endothelium (Poliseno et al., 2006). However, little is known about the functional involvement of miR-29a in VSMC biology. In the current study, we aimed to investigate the biologic activity of miR-29a in VSMC differentiation from ESCs and have uncovered a novel
http://dx.doi.org/10.1016/j.scr.2016.07.011 1873-5061/© 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
278
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
mechanism that miR-29a regulates VSMC differentiation via suppression of a transcription factor, YY1.
2. Materials and methods 2.1. Materials Antibodies against YY1 (66281-1-Ig), α smooth muscle actin (SMαA, 60255-1-Ig), were purchased from Proteintech, USA. Antibody against Smooth Muscle Myosin Heavy Chain (SM-MHC, AHP1117) was from AbD Serotec. Antibodies against SM22α (SM22, Ab14106) and h1-calponin (Calponin, Ab46794) were from Abcam, UK. Antibodies against GAPDH were from Sigma. All secondary antibodies were from Santa Cruz Biotech.
2.2. Cell culture and differentiation Detailed protocols for mouse embryonic stem (ES) (ES-D3 cell line, CRL-1934; ATCC, Manassas, VA) cell culture and VSMC differentiation were described in our previous studies (Pepe et al., 2010; Wang et al., 2012; Xiao et al., 2011; Xiao et al., 2007; Zheng et al., 2013). Briefly, ESCs were dispersed on gelatin (Sigma) coated flasks and cultured in ES culture medium (CM) that included knockout Dulbecco's Modified Essential Medium (DMEM, Gibco), 10% Embryomax Foetal Bovine Serum (FBS, Gibco), 10 ng/ml Leukaemia Inhibitor Factor (LIF, Millipore), 0.1 mM 2-mercaptoethanol (2-ME, Sigma), 100 U/ml penicillin and 100 μg/ml streptomycin (Life technologies) and 2 mM Glutamine (Sigma). Cells were split every 3 days in a ratio of 1:4. For VSMC differentiation, undifferentiated ES cells were seeded on mouse collagen IV (5 μg/ml, Corning) coated flasks or plates in differentiation medium (DM) that contains α-minimal essential medium (aMEM, Gibco) supplemented with 10% FBS, 0.05 mM 2-ME, 100 U/ml penicillin, 100 μg/ml streptomycin, and 2 mM glutamine. DM was refreshed every day after the second day of differentiation. The cells were cultured in DM for 4–8 days before harvested and for further analysis.
2.4. Real-time quantitative PCR (RT-qPCR) for mRNA and microRNAs Real-time quantitative PCR (RT-qPCR) was performed as previously described (Chen et al., 2011; Zhang et al., 2010). Briefly, total RNA containing miRs was extracted from cells using Trizol according to the manufacturer's instructions. Total and miR-specific cDNA synthesis was performed with Prime Script RT Master Mix Perfect Real Time kit (DRR036A, Takara, China) and miRNA RT-PCR Kit (RR716, Takara, China), respectively. The RT-qPCR reaction was run on an ABI Prism 7500 system following the instructions provided in the Takara premix Ex Taq II kit (DRR820A, Takara, China) or miRNA RT-PCR Kit (RR716, Takara, China). The primer sequences for VSMC differentiation genes (SMA, SM22, SMMHC, Calponin) and related transcription factors (SRF, MYO, MEF-2C) were the same as used in our previous study (Yu et al., 2015; Zhao et al., 2015a; Zheng et al., 2013). All the primer sequence are shown in Table 1 and synthesized by Sangon, China. Relative mRNA or miR expression levels were defined as the ratio of the target gene expression level or miR expression level to 18S or U6 snRNA expression level, respectively, with that of the control sample set as 1.0.
2.5. MicroRNA and plasmid transfection Either miR-29a inhibitor or miR-29a precursor (Pre-miR-29a) and miRNA negative controls were transfected into 4-day differentiating ES cells using Lipofectamine 3000 (Thermo Fisher Scientific), in accordance with the manufacturer's protocol. Transfected cells were cultured for 48–96 h in the DM to allow VSMC differentiation. All miRNAs inhibitors or precursors and respective negative controls were purchased from BAIAO. Control (pCMV6-Entry) or a YY1 overexpression plasmid (pCMV6-Entry-YY1, Origene) were transfected into differentiating ES cells using Lipofectamine 3000 according to the manufacturer's instructions. MiRNA (pre-miR-29a or miR negative control) and plasmid (pCMV6-Entry or pCMV6-Entry-YY1) co-transfection experiments were performed using jetPRIME® (Polyplus, SA).
2.6. Luciferase reporter assay 2.3. Western blot analysis Cells were harvested and lysed in lysis buffer (RIPA, Beyotime Institute of Biotechnology) supplemented with protease inhibitors (PMSF, Aladdin). Equal amounts of protein (40 μg) were resolved by SDS-PAGE with 5%–12% Tris-Glycine gel (Invitrogen) and subjected to standard western blot analysis (Zheng et al., 2013). The results were subjected to densitometric analysis with Image J software. To ensure equal protein loading, GAPDH protein was used as an internal control. The relative protein expression level was defined as the ratio of target protein expression level to GAPDH expression level with that of the control sample set as 1.0.
For the luciferase reporter assays, ES cells (6 × 104 per well) were seeded into collagen-coated 12-well plates and cultured in DM 96 h later, cells were transfected with the luciferase reporter plasmids (pGL3-SRF-Luc, pGL3-MEF-2c-Luc or pGL3-Myocd-Luc generated in our previous study (Huang et al., 2013), 0.33 μg/well) and pre-miR29a, or miR negative control (100 nM) using jetPRIME® (Polyplus). A Renilla reporter plasmid (0.1 μg/well, Promega) was included in all transfection assays as an internal control. Luciferase and Renilla activity assays were analyzed 48 h after transfection. Relative luciferase unit (RLU) was defined as the ratio of luciferase activity to Renilla activity with that of control set as 1.0.
Table 1 Primer sets used in the present study. Gene names
Forward (5′–3′)
Reverse (5′–3′)
GenBank accession numbers
18s rRNA U6 snRNA miR-29a SMαA SM22α h1-Calponin SM-myh11 YY1 SRF Myocd MEF-2C
AAACGGCTACCACATCCAG GATGACACGCAAATTCGTG CGGACTGATTTCTTTTGGTGTTCAG TCCTGACGCTGAAGTATCCGAT GAT ATG GCA GCA GTG CAG AG GGT CCT GCC TAC GGC TTG TC AAG CAG CCA GCA TCA AGG AG GTGGTTGAAGAGCAGATCATTGG CCTACCAGGTGTCGGAATCTGA TCAATGAGAAGATCGCTCTCCG AAGCCAAATCTCCTCCCCCTAT
CCTCCAATGGATCCTCGTTA miRNA universal reverse primer (Invitrogen, A11193-051) miRNA universal reverse primer (Invitrogen, A11193-051) GGCCACACGAAGCTCGTTATAG AGT TGG CTG TCT GTG AAG TC TCG CAA AGA ATG ATC CCG TC AGC TCT GCC ATG TCC TCC AC GTGCAGCCTTTATGAGGGCAA TCTGGATTGTGGAGGTGGTACC GTCATCCTCAAAGGCGAATGC TGATTCACTGATGGCATCGTGT
NR_003278.3 NR_003027.2 MIMAT0004631 NM_007392.3 NM_011526.5 NM_009922 NM_013607 NM_009537.3 NM_020493.2 NM_145136.4 NM_001170537.1
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
2.7. VSMC differentiation in vitro All animal protocols were reviewed and approved by the Zhejiang University Animal Care and Use Committee. All methods were carried out in accordance with the approved guidelines. Control (miR negative control) or miR-29a overexpressing (pre-miR-29a) ES cells labeled with green fluorescence, PKH67 (Sigma), were induced to differentiate into VSMCs in vivo as described in our previous studies (Huang et al., 2013; Xiao et al., 2012; Yu et al., 2015; Zhao et al., 2015b). Briefly, miR negative control or miR-29a overexpressing ES cells (106 cells in 50 μl) were mixed with 50 μl of Matrigel™ (Becton Dickinson Labware) at 4 °C, and subcutaneously injected into C57BL/6J mice. After 10–13 days, mice were euthanized and the implants (Matrigel™ plugs) were harvested and frozen in liquid nitrogen for future using. Part of each Matrigel™ plug was sectioned for detection of cell markers and the remained was lysed and extracted for total RNA or protein to examine the expression levels of the indicated markers, respectively. 2.8. Fluorescent immunochemistry For immunofluorescent staining, sections were cut at 8 μm for optimum cutting of temperature compound–embedded Matrigel™ implants, every 40 μm along the longitudinal axis of Matrigel™ plugs and numbered. Certain numbered sections (for instance, sections 5, 15 and 25) were subjected to immunohistological analyses with respective antibodies. Briefly, frozen sections were air-dried for at least 30 min, followed by fixation in cold acetone for 15 min. The sections were then rinsed in PBS and blocked with 5% BSA in PBS (Gibco) for 1 h at room temperature in a humid chamber. The incubation with primary antibodies (SM-MHC, SMA) or IgG controls diluted in blocking buffer was performed in a cold room (4 °C) overnight. Following incubation with appropriate FITC or TRITC conjugated secondary antibodies, sections were then incubated with DAPI (1:1000, Sigma) for 5 min. Images were assessed with an Axioplan 2 imaging microscope with PlanNEOFLUAR 20×, NA 0.5, objective lenses, AxioCam camera, and Axiovision software (all Carl Zeiss MicroImaging, Inc.) at room temperature. Photoshop software (Adobe) was used to analyze the acquired images.
279
The percentage of PKH67-labeled SM-MHC positive cells per field were counted by two well-trained independent investigators blinded to the treatments, from four random high power fields (200×) in each section, three sections from each implant and four implants for each group. 2.9. Statistical analysis Data were expressed as mean ± SEM and analyzed using a twotailed student's t-test for two-group comparison or one-way ANOVA followed by Tukey's HSD multiple comparison post-hoc test for comparing different groups. A value of p b 0.05 was considered as statistically significant. 3. Result 3.1. miR-29a mediates VSMC differentiation from ESCs in vitro To induce VSMC differentiation, ES cells were reseeded into 6-well plate coated with collagen IV and cultured in VSMC differentiation medium for 2 to 8 days. Consistently, gene expression levels of VSMC specific markers including smooth muscle α-actin (SMαA) (Fig. 1A), SM22 (Fig. 1B), and smooth muscle myosin heavy chain (SM-MHC) (Fig. 1C) were significantly upregulated during differentiation. Importantly, miR-29a expression was induced from day 2 of differentiation, and peaked at day 4 of differentiation (Fig. 1D), suggesting a role of miR29a in VSMC differentiation. Loss-of-function and gain-of-function experiments were used to investigate whether miR-29a was necessary for VSMC differentiation. Gain-of-function experiments using miR-29a precursor (pre-miR-29a) were performed in differentiating ES cells. Data showed both gene and protein levels (Fig. 2A and B) of three out of four differentiation specific markers (SMαA, SM22, and SM-MHC) were significantly increased by miR-29a overexpression. We also observed an increase in h1-calponin mRNA induced by miR-29a over-expression, yet it was not statistically significant. On the other hand, data from the loss-of-function experiments by using miR-29a inhibitor revealed that miR-29a knockdown significantly inhibited the gene and protein expression of SMαA,
Fig. 1. microRNA29a (miR-29a) was upregulated during mouse embryonic stem cells (ESC) differentiation towards vascular smooth muscle cells (VSMCs). Cells were cultured in 6-well plates coated with collagen IV and cultured in VSMC differentiation medium (DM) for the indicated times. Total RNA including miRs were harvested and subjected to RT-qPCR analyses with primers specific for smooth muscle α-actin (SMαA) (A), SM22 (B), smooth muscle myosin heavy chain (SM-MHC) (C) and miR-29a (D). Day 0 samples were undifferentiated ES cells and served as negative controls. The data presented here are the mean ± SEM of 3 independent experiments. #p b 0.01, *p b 0.05.
280
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
Fig. 2. miR-29a promotes VSMC differentiation from ESCs. (A and B) miR-29a overexpression significantly increases VSMC marker gene expression levels. Day 3–4 differentiating ESCs were transfected with pre-miR-29a or miR negative control and cultured in VSMC DM for 48–72 h. (C and D) miR-29a inhibition decreases VSMC marker expression levels. Day 3–4 differentiating ESCs were transfected with miR-29a inhibitor or miR negative control and cultured in VSMC DM for 48 h. Total RNAs and proteins were harvested and subjected to RTqPCR (A and C) and western blot (B and D) analyses, respectively. The data presented here are representative (left panel in B and D) or mean ± S.E.M. of 4 independent experiments. *p b 0.05, #p b 0.01.
SM22, and h1-calponin (Fig. 2C and D). Moreover, although not statistically significant, a decrease in SM-MHC protein level was observed in the cells transfected with miR-29a inhibitor, suggesting a role of miR29a in VSMC differentiation from stem cells in vitro.
of miR-29a (Fig. 4A). The result confirms that YY1 is negatively regulated by miR-29a during VSMC differentiation from ESCs. 3.4. YY1 functions as a negative regulator of VSMC differentiation and restoration of YY1 impairs miR-29a-promoted VSMC differentiation
3.2. miR-29a is likely to promote VSMC differentiation in vivo To investigate whether or not miR-29a can promote VSMC differentiation in vivo, Matrigel™ mixed with control or miR-29a overexpressing ESCs was injected subcutaneously into the mouse. Immunofluorescent analyses (Fig. 3A and B) showed that more SM-MHC-positive cells were presented in the Matrigel™ plugs implanted with miR-29a overexpressing ESCs, although no significant difference was observed between the two groups. Moreover, data from RT-qPCR (Fig. 3C) and western blotting (Fig. 3D) analysis revealed that overexpression of miR-29a increased both the gene and protein levels of smooth muscle differentiation specific markers in vivo. Taken together, these data suggest a regulatory role of miR-29a in VSMC differentiation from stem cells both in vitro and in vivo.
To investigate the potential role of YY1 in VSMC differentiation, we over-expressed YY1 in the differentiating ESCs. YY1 overexpression significantly downregulated mRNA and protein expression of VSMC markers (Fig. 5A and B), suggesting that YY1 is a negative modulator of VSMC differentiation. To further study the functional involvement of YY1 in miR-29a-mediated VSMC differentiation, miR-29a and YY1 were co-transfected in the differentiating ESCs. Data from RT-qPCR (Fig. 5C) and western blot (Fig. 5D and E) analyses revealed that restoration of YY1 expression in the presence of miR-29a over-expression almost abolished VSMC specific gene upregulation, suggesting that miR29a-mediated VSMC differentiation is largely dependent on the repression of YY1.
3.3. Target gene, YY1, is negatively regulated by miR-29a
3.5. miR-29a mediates VSMC differentiation through modulation of VSMC transcription factors
By utilizing the TargetScan program (http://www.targetscan.org), we have observed that miR-29a has complementary sequences to YY1's 3′UTR mRNA. All miR-29 family members have been previously predicted to hybridize to an evolutionarily conserved site within the YY1 3′UTR among vertebrate species (Wang et al., 2008). Moreover, miR-29 can specifically interact with the 3′UTR of YY1 mRNA to inhibit its translation (Wang et al., 2011). Therefore, we examined whether or not miR-29a modulates YY1 during VSMC differentiation from ESCs. Consistent with previous findings, our data revealed that YY1 gene (Fig. 4C) and protein (Fig. 4D and E) levels were significantly upregulated by inhibition of miR-29a (Fig. 4B), whereas its protein expression level (Fig. 4D and E) was significantly downregulated by overexpression
Serum response factor (SRF), myocyte-specific enhancer factor 2c (MEF-2C) and myocardin (Myocd) are well-known transcription factors for VSMC gene regulation. Particularly, SRF and its co-activator, Myocardin, interact with the SRF binding element (CArG box) within the promoter of SMC genes and the interaction regulates transcriptional activation of SMC genes (Miano, 2003). Therefore, we investigated if miR-29a modulates these three transcription factors during VSMC differentiation from ESCs. Our data showed that gene expression levels of all three transcription factors were significantly upregulated by miR-29a overexpression (Fig. 6A), whereas inhibition of miR-29a significantly down-regulates their expression levels except for MEF2C (Fig. 6B). Such a notion has been further recapitulated by luciferase
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
281
Fig. 3. miR-29a promotes VSMCs differentiation in vivo. Matrigel™ mixed with ESCs transfected with miR negative control or pre-miR-29a was injected subcutaneously into mouse and harvested for further experiments. (A and B) Matrigel™ plugs with ESCs transfected with pre-miR-29a showed more SMαA/SM-MHC positive cells. Matrigel™ plugs were sectioned and subjected to immunofluorescence staining using antibodies against SMαA/SM-MHC (Blue is DAPI, Red is SMαA/SM-MHC). (C and D) VSMC marker gene expressions within Matrigel™ implants. Total RNA and protein samples were extracted and subjected to RT-qPCR (C) and western blot (D) analyses. The data presented here are representative or mean ± S.E.M of 3 repeats at least. *p b 0.05, #p b 0.01.
activity assays with SRF, MEF-2C and Myocd gene promoter reporters. Data shown in Fig. 6D revealed that the miR-29a overexpression significantly increased gene promoter activities of SRF and Myocd, but not the MEF2C, indicating that miR-29a upregulated transcriptional activity of SRF and Myocd genes. Interestingly, a previous study has suggested a potential interplay between YY1 and SRF in transcriptional regulation of SM-MHC and SM22 genes (Itoh et al., 2001). Indeed, our results showed that YY1 negatively regulated SRF, MEF-2C and Myocd gene expression (Fig. 6C). Taken together, the above data have suggested that miR-29a promotes VSMC differentiation from ESCs through targeting and suppressing the transcription factor, YY1. As YY1 inhibits VSMC differentiation and gene expression of VSMC specific transcription factors, SRF and Myocd, the miR-29a dependent suppression of YY1, in turn, activates VSMC differentiation. 4. Discussion Alteration in the normal structure or function of differentiated VSMCs plays a major role in a number of diseases, including atherosclerosis, hypertension, and cancer. The underlying molecular mechanisms of VSMC differentiation remain to be elucidated. Accumulating evidence has demonstrated that the gene regulatory program of VSMC differentiation from pluripotent stem cells is orchestrated by a coordinated molecular network with various signaling pathways and molecules involved, such as mechanical forces, contractile agonists, extracellular matrix components (laminin and type I and IV collagen), Matrix Metalloproteinases (Chen et al., 2013), neuronal factors, reactive oxygen species (Zhou et al., 2013), endothelial SMC interactions, thrombin, TGF family, notch family (Tang et al., 2010), and miRs. Although all of
these factors have been shown to promote expression of at least some VSMC marker genes in cultured cell systems (Owens et al., 2004; Xie et al., 2011), our understanding of the molecular mechanisms underlying VSMC differentiation from ESCs is still far from complete. In this study, we revealed an important role of miR-29a in regulating VSMC specific gene expression and VSMC differentiation from ESCs in vitro and in vivo. We presented the first evidence to support a functional role of YY1 in VSMC differentiation and VSMC specific gene regulation. We also provided the evidence to support that the identified target gene of miR-29a, YY1, functions as an important VSMC differentiation gene repressor during VSMC differentiation from stem cells. miR-29a has been extensively studied in different fields. miR-29a has been reported to be associated with cardiac hypertrophy and fibrosis (Roncarati et al., 2014), and functions as a negative regulator of extracellular matrix remodeling (van Rooij et al., 2008). We have previously reported that miR-29a can also act as an important regulator of the inflammatory response (Chen et al., 2011). In the current study, using miRNA gain/loss-of-function analyses and a well-established in vitro VSMC differentiation model, we confirmed a regulatory role for miR-29a in VSMC differentiation from ESCs. An important role of miR29a in VSMC differentiation has been further confirmed in our wellestablished in vivo VSMC differentiation model with Matrigel™ implantation. One of the new findings in the current study is that we have identified YY1 as the target gene of miR-29a during VSMC differentiation from ESCs. YY1 (also known as Yin Yang1, NF-E1, UCRBP and CF1), a ubiquitous and dual-function GLI-Kruppel zinc finger transcription factor, was first identified on the basis of its capacity to negatively regulate the adeno-associated virus P5 promoter (Shi et al., 1991). Recent studies
282
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
Fig. 4. YY1 is negatively regulated by miR-29a during ESC differentiation. (A) miR-29a over-expression with pre-miR-29a in differentiating ESCs; (B) miR-29a inhibition with miR29a inhibitor in differentiating ESCs. (C–E) YY1 is adversely modulated by miR-29a during SMC differentiation from ESCs. Day 3 differentiating ESCs were transfected with pre-miR-29a (A), miR29a inhibitor (B), or respective miR negative controls, and cultured for further 48 h. Total RNA and protein were harvested and subjected to RT-qPCR (A–C) and western blot (D–E) analyses, respectively. The data presented here are representative (D) or mean ± S.E.M. of 3 independent experiments. #p b 0.01, *p b 0.05.
have suggested that YY1 functions as a transcription co-factor independent of its DNA binding activity (Deng et al., 2010). It has been reported that YY1 is an important inhibitor of muscle cell differentiation and
expression of muscle-specific genes (Ellis et al., 2002). Another study has reported that VSMC phenotype is also regulated by the YY1 (Favot et al., 2005), yet the potential interplay between YY1 and VSMC biology
Fig. 5. YY1 acts as a VSMC differentiation repressor and re-activation of YY1 impairs the promotive effects of miR-29a on VSMC differentiation. (A and B) YY1 inhibits VSMC differentiation from ESCs. Day 3–4 differentiating ES cells were transfected with control (pCMV6-Entry) or YY1 over-expression plasmid (pCMV6-Entry-YY1), and cultured in VSMC DM for another 48 h. Total RNA and protein were harvested and subjected to RT-qPCR (A) and western blot (B) analyses, respectively. The data presented here are representative (Left in B) or mean ± S.E.M. of three independent experiments. #p b 0.01, *p b 0.05. (C–E) YY1 re-activation abolished VSMC gene expression induced by miR-29a. Day 3–4 differentiating ESCs were co-transfected with pre-miR-29a, YY1 over-expression (pCMV6-Entry-YY1) plasmids, and/or respective controls (miR negative control or pCMV6-Entry), and cultured in VSMC DM for 48 h further. Total RNA and protein were harvested and subjected to RT-qPCR (C) and western blot (D–E) analyses, respectively. The data presented here are representative (Left in B and D) or mean ± S.E.M. of three independent experiments. *p b 0.05 (versus double negative controls); #p b 0.05 (pCMV6-Entry-YY1 versus pCMV6-Entry in the presence of pre-miR-29a).
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
283
Fig. 6. Modulation of VSMC differentiation related transcription factors (TF) by miR29a and YY1. (A and B) Gene expression levels of serum response factor (SRF), myocardin (Myocd) and myocyte-specific enhancer factor 2c (MEF2C) were significantly upregulated by miR-29a overexpression (A), but dramatically down-regulated by miR-29a inhibition (B) and YY1 overexpression (C), respectively. Day 3–4 differentiating ESCs were transfected with pre-miR-29a (A), miR-29a inhibitor (B), pCMV6-Entry-YY1 (C), or respective controls (miR negative control or pCMV6-Entry), and cultured in VSMC DM for 48 h further. Total RNA was harvested and subjected to RT-qPCR analyses with indicated primers. The data presented here are mean ± SEM of 3 independent experiments. #p b 0.05, *p b 0.01 (vs control). (D) Promoter activities of SRF, Myocd and MEF2C genes were enhanced by miR-29a. Day 3–4 differentiating ESCs were transfected with the indicated luciferase reporter plasmids [pGL3-SRF-Luc (SRF), pGL3-MEF2c-Luc (MEF2C), or pGL3-Myocd-Luc (Myocd)] (0.25 μg/well, 24well plate) and miR negative control or pre-miR-29a (25 pmol/well). Renilla plasmid (20 ng/well) was included as a control. Luciferase activity assays were detected 48–72 h after transfection. The data presented here are mean ± SEM of 3 independent experiments. #p b 0.05, *p b 0.01 (vs control).
is still unclear and needs further investigation (Aikawa, 2007). In the current study, we have observed that YY1 is negatively regulated by miR-29a, and re-activation of YY1 impairs VSMC gene activation induced by miR-29a over-expression, supporting an important role of YY1 in miR-29a-mediated VSMC differentiation from ESCs.
5. Conclusion In the current study, we reported a novel function of miR-29a in VSMC differentiation from stem cells in vitro and in vivo, and provided comprehensive evidence to support that YY1 is a genuine mRNA target
Fig. 7. Regulatory role of miR-29a in VSMC differentiation. MiR-29a targets YY1, de-suppressing its negative regulation of transcription factors (SRF, MEF-2C, Myocd), resulting in the VSMC differentiation from stem cells both in vivo and in vitro.
284
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
of miR-29a during VSMC differentiation. Moreover, our data suggest that YY1 is a negative regulator of VSMC related transcription factors (SRF, Myocd, and MEF-2C), and repression of YY1 by miR-29a is the underlying mechanism of miR-29a-mediated VSMC differentiation from ESCs (Fig. 7). Conflict of interest disclosure None. Author contributions Ting Chen and Min Jin. designed research; Yutao Wu, Yanwei Wang, Yanwei Wang, Mei Yang, Feng Yang, Jing Wang, Dongdong Jian performed research; Chun Feng analyzed data; and Ting Chen wrote the paper. Acknowledgments We are grateful to the supports from Zhejiang Provincial Natural Science Foundation of China under Grant No. LQ14H020001, National Natural Science Foundation of China (No. 81400205/H0203 91339102, 81570249, 81270001; 81400224; 91539103, 81270180), Project of Medical Science Research Foundation from Health Department of Zhejiang Province (2015KYA090 201598277, 2016141482). References Aikawa, M., 2007. The balance of power: the law of Yin and Yang in smooth muscle cell fate. Is YY1 a vascular protector? Circ. Res. 101, 111–113. Ambros, V., 2001. microRNAs: tiny regulators with great potential. Cell 107, 823–826. Chen, Q., Jin, M., Yang, F., Zhu, J., Xiao, Q., Zhang, L., 2013. Matrix metalloproteinases: inflammatory regulators of cell behaviors in vascular formation and remodeling. Mediat. Inflamm. 2013, 928315. Chen, T., Li, Z., Tu, J., Zhu, W., Ge, J., Zheng, X., Yang, L., Pan, X., Yan, H., Zhu, J., 2011. MicroRNA-29a regulates pro-inflammatory cytokine secretion and scavenger receptor expression by targeting LPL in oxLDL-stimulated dendritic cells. FEBS Lett. 585, 657–663. Deng, Z., Cao, P., Wan, M.M., Sui, G., 2010. Yin Yang 1: a multifaceted protein beyond a transcription factor. Transcription 1, 81–84. Ellis, P.D., Martin, K.M., Rickman, C., Metcalfe, J.C., Kemp, P.R., 2002. Increased actin polymerization reduces the inhibition of serum response factor activity by Yin Yang 1. Biochem. J. 364, 547–554. Favot, L., Hall, S.M., Haworth, S.G., Kemp, P.R., 2005. Cytoplasmic YY1 is associated with increased smooth muscle-specific gene expression: implications for neonatal pulmonary hypertension. Am. J. Pathol. 167, 1497–1509. Huang, Y., Lin, L., Yu, X., Wen, G., Pu, X., Zhao, H., Fang, C., Zhu, J., Ye, S., Zhang, L., et al., 2013. Functional involvements of heterogeneous nuclear ribonucleoprotein A1 in smooth muscle differentiation from stem cells in vitro and in vivo. Stem Cells 31, 906–917. Hutvagner, G., McLachlan, J., Pasquinelli, A.E., Balint, E., Tuschl, T., Zamore, P.D., 2001. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293, 834–838. Itoh, S., Katoh, Y., Konishi, H., Takaya, N., Kimura, T., Periasamy, M., Yamaguchi, H., 2001. Nitric oxide regulates smooth-muscle-specific myosin heavy chain gene expression at the transcriptional level-possible role of SRF and YY1 through CArG element. J. Mol. Cell. Cardiol. 33, 95–107. Ivey, K.N., Muth, A., Arnold, J., King, F.W., Yeh, R.F., Fish, J.E., Hsiao, E.C., Schwartz, R.J., Conklin, B.R., Bernstein, H.S., et al., 2008. MicroRNA regulation of cell lineages in mouse and human embryonic stem cells. Cell Stem Cell 2, 219–229. Martinez, N.J., Gregory, R.I., 2010. MicroRNA gene regulatory pathways in the establishment and maintenance of ESC identity. Cell Stem Cell 7, 31–35. Miano, J.M., 2003. Serum response factor: toggling between disparate programs of gene expression. J. Mol. Cell. Cardiol. 35, 577–593. Owens, G.K., Kumar, M.S., Wamhoff, B.R., 2004. Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol. Rev. 84, 767–801. Pekarsky, Y., Croce, C.M., 2010. Is miR-29 an oncogene or tumor suppressor in CLL? Oncotarget 1, 224–227.
Pepe, A.E., Xiao, Q., Zampetaki, A., Zhang, Z., Kobayashi, A., Hu, Y., Xu, Q., 2010. Crucial role of nrf3 in smooth muscle cell differentiation from stem cells. Circ. Res. 106, 870–879. Poliseno, L., Tuccoli, A., Mariani, L., Evangelista, M., Citti, L., Woods, K., Mercatanti, A., Hammond, S., Rainaldi, G., 2006. MicroRNAs modulate the angiogenic properties of HUVECs. Blood 108, 3068–3071. Robinson, H.C., Baker, A.H., 2012. How do microRNAs affect vascular smooth muscle cell biology? Curr. Opin. Lipidol. 23, 405–411. Roncarati, R., Viviani Anselmi, C., Losi, M.A., Papa, L., Cavarretta, E., Da Costa Martins, P., Contaldi, C., Saccani Jotti, G., Franzone, A., Galastri, L., et al., 2014. Circulating miR29a, among other up-regulated microRNAs, is the only biomarker for both hypertrophy and fibrosis in patients with hypertrophic cardiomyopathy. J. Am. Coll. Cardiol. 63, 920–927. Rossi, J.J., 2005. RNAi and the P-body connection. Nat. Cell Biol. 7, 643–644. Shi, Y., Seto, E., Chang, L.S., Shenk, T., 1991. Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell 67, 377–388. Tang, Y., Urs, S., Boucher, J., Bernaiche, T., Venkatesh, D., Spicer, D.B., Vary, C.P., Liaw, L., 2010. Notch and transforming growth factor-beta (TGFbeta) signaling pathways cooperatively regulate vascular smooth muscle cell differentiation. J. Biol. Chem. 285, 17556–17563. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., Jones, J.M., 1998. Embryonic stem cell lines derived from human blastocysts. Science 282, 1145–1147. van Rooij, E., Sutherland, L.B., Thatcher, J.E., DiMaio, J.M., Naseem, R.H., Marshall, W.S., Hill, J.A., Olson, E.N., 2008. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. Proc. Natl. Acad. Sci. U. S. A. 105, 13027–13032. Wang, G., Xiao, Q., Luo, Z., Ye, S., Xu, Q., 2012. Functional impact of heterogeneous nuclear ribonucleoprotein A2/B1 in smooth muscle differentiation from stem cells and embryonic arteriogenesis. J. Biol. Chem. 287, 2896–2906. Wang, H., Garzon, R., Sun, H., Ladner, K.J., Singh, R., Dahlman, J., Cheng, A., Hall, B.M., Qualman, S.J., Chandler, D.S., et al., 2008. NF-kappaB-YY1-miR-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma. Cancer Cell 14, 369–381. Wang, X.H., Hu, Z., Klein, J.D., Zhang, L., Fang, F., Mitch, W.E., 2011. Decreased miR-29 suppresses myogenesis in CKD. J. Am. Soc. Nephrol. 22, 2068–2076. Weissman, I.L., 2000. Translating stem and progenitor cell biology to the clinic: barriers and opportunities. Science 287, 1442–1446. Xiao, Q., Pepe, A.E., Wang, G., Luo, Z., Zhang, L., Zeng, L., Zhang, Z., Hu, Y., Ye, S., Xu, Q., 2012. Nrf3-Pla2g7 interaction plays an essential role in smooth muscle differentiation from stem cells. Arterioscler. Thromb. Vasc. Biol. 32, 730–744. Xiao, Q., Wang, G., Yin, X., Luo, Z., Margariti, A., Zeng, L., Mayr, M., Ye, S., Xu, Q., 2011. Chromobox protein homolog 3 is essential for stem cell differentiation to smooth muscles in vitro and in embryonic arteriogenesis. Arterioscler. Thromb. Vasc. Biol. 31, 1842–1852. Xiao, Q., Zeng, L., Zhang, Z., Hu, Y., Xu, Q., 2007. Stem cell-derived Sca-1+ progenitors differentiate into smooth muscle cells, which is mediated by collagen IV-integrin alpha1/beta1/alphav and PDGF receptor pathways. Am. J. Physiol. Cell Physiol. 292, C342–C352. Xie, C., Ritchie, R.P., Huang, H., Zhang, J., Chen, Y.E., 2011. Smooth muscle cell differentiation in vitro: models and underlying molecular mechanisms. Arterioscler. Thromb. Vasc. Biol. 31, 1485–1494. Yu, X., Zhang, L., Wen, G., Zhao, H., Luong, L.A., Chen, Q., Huang, Y., Zhu, J., Ye, S., Xu, Q., et al., 2015. Upregulated sirtuin 1 by miRNA-34a is required for smooth muscle cell differentiation from pluripotent stem cells. Cell Death Differ. 22, 1170–1180. Zhang, L., Jin, M., Margariti, A., Wang, G., Luo, Z., Zampetaki, A., Zeng, L., Ye, S., Zhu, J., Xiao, Q., 2010. Sp1-dependent activation of HDAC7 is required for platelet-derived growth factor-BB-induced smooth muscle cell differentiation from stem cells. J. Biol. Chem. 285, 38463–38472. Zhao, H., Wen, G., Huang, Y., Yu, X., Chen, Q., Afzal, T.A., Luong le, A., Zhu, J., Shu, Y., Zhang, L., et al., 2015a. MicroRNA-22 regulates smooth muscle cell differentiation from stem cells by targeting methyl CpG-binding protein 2. Arterioscler. Thromb. Vasc. Biol. 35, 918–929. Zhao, H., Wen, G., Huang, Y., Yu, X., Chen, Q., Afzal, T.A., Luong le, A., Zhu, J., Ye, S., Zhang, L., et al., 2015b. MicroRNA-22 regulates smooth muscle cell differentiation from stem cells by targeting methyl CpG-binding protein 2. Arterioscler. Thromb. Vasc. Biol. 35, 918–929. Zheng, X., Wu, Y., Zhu, L., Chen, Q., Zhou, Y., Yan, H., Chen, T., Xiao, Q., Zhu, J., Zhang, L., 2013. Angiotensin II promotes differentiation of mouse embryonic stem cells to smooth muscle cells through PI3-kinase signaling pathway and NF-kappaB. Differentiation; research in biological diversity 85, 41–54. Zhou, Y., Yan, H., Guo, M., Zhu, J., Xiao, Q., Zhang, L., 2013. Reactive oxygen species in vascular formation and development. Oxidative Med. Cell. Longev. 2013, 374963. Zhou, Y., Yang, F., Chen, T., Wu, Y., Yang, M., Zhu, J., Zhang, L., 2014. An updated view on the differentiation of stem cells into endothelial cells. Sci. China Life Sci. 57, 763–773.
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
MicroRNA-29a promotes smooth muscle cell differentiation from stem cells by targeting YY1 Min Jin a,1, Yutao Wu b,1, Yanwei Wang c,1, Danqing Yu a, Mei Yang b, Feng Yang b, Chun Feng a, Ting Chen b,⁎ a b c
Division of Reproductive Medicine & Infertility, The Second Affiliated Hospital, School of Medicine, Zhejiang University, 88#, Jiefang Rd., Hangzhou, Zhejiang 310009, PR China Department of Cardiology, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, PR China Department of Cardiology, Ningbo Medical Treatment Center Lihuili Hospital, Ningbo 315000, PR China
a r t i c l e
i n f o
Article history: Received 23 January 2016 Received in revised form 22 July 2016 Accepted 30 July 2016 Available online 02 August 2016
a b s t r a c t MicroRNA-29a (miR-29a) has been extensively studied in tumor biology and fibrotic diseases, but little is known about its functional roles in vascular smooth muscle cell (VSMC) differentiation from embryonic stem cells (ESCs). Using well-established VSMC differentiation models, we have observed that miR-29a induces VSMC differentiation from mouse ESCs by negatively regulating YY1, a transcription factor that inhibits muscle cell differentiation and muscle-specific gene expression. Moreover, gene expression levels of three VSMC specific transcriptional factors were up-regulated by miR-29a over-expression, but down-regulated by miR-29a inhibition or YY1 over-expression. Taken together, our data demonstrate that miR-29a and its target gene, YY1, play a regulatory role in VSMC differentiation from ESCs in vitro and in vivo. © 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction Smooth muscle cells (SMCs) form the walls of blood vessels, providing the healthy vessel with its structure and contributing to the formation and progression of atherosclerotic plaques. Alterations in the normal structure or function of the differentiated VSMCs play a major role in a number of diseases, including atherosclerosis, cancer, and hypertension (Owens et al., 2004). A better understanding of the mechanisms and molecular regulation of VSMC differentiation is needed for both prevention and treatment of these diseases. Stem cells are long-lived cells with a remarkable capability of both self-renewal and differentiation into multiple specialized cell types (Weissman, 2000). ESCs are pluripotent stem cells derived from the inner cell mass of a blastocyst (Thomson et al., 1998). Several in vitro models have been well established to understand the regulation of VSMC differentiation, but the underlying molecular mechanisms have not been fully clarified (Xie et al., 2011). MicroRNAs (miRs) are small non-coding RNAs (~ 22 nucleotides) that bind to complementary sites of their target mRNAs and inhibit their translation (Hutvagner et al., 2001; Rossi, 2005). They are diverse in sequence and expression patterns (Ambros, 2001). In recent studies,
⁎ Corresponding author. E-mail address: [email protected] (T. Chen). 1 Min Jin, Yutao Wu and Yanwei Wang contributed equally to this work.
miRs have been suggested to play a major role in regulating gene expression in most organisms and have been implicated in regulating the self-renewal and differentiation program of stem cells (Ivey et al., 2008; Martinez and Gregory, 2010). Emerging evidence clearly suggests that miRs play a broad role in multiple aspects of endothelial biology, and have been proven to be critical in mediating endothelial cell (EC) differentiation (Zhou et al., 2014). Previous studies have shown that miRs can affect VSMC biology, including phenotypic switching, proliferation, and migration. Especially, miR-143/miR-145, miR-21, and miR133 have been reported to play a role in VSMC differentiation (Robinson and Baker, 2012). MicroRNA-29a (miR-29a) has been extensively investigated in different fields. Roberta et al. reported that miR-29a is significantly associated with hypertrophy and fibrosis, suggesting that miR-29a can be a potential biomarker for hypertrophic cardiomyopathy (Roncarati et al., 2014). MiR-29a also functions as a negative regulator of collagen gene expression. Maintaining miR-29a expression would have beneficial effects in fibrotic diseases (van Rooij et al., 2008). As an important regulator of the inflammatory response, miR-29a regulates scavenger receptor expression by targeting lipoprotein lipase (Chen et al., 2011). In addition, miR-29a has been implicated in malignancies (Pekarsky and Croce, 2010) and found to be highly expressed in the endothelium (Poliseno et al., 2006). However, little is known about the functional involvement of miR-29a in VSMC biology. In the current study, we aimed to investigate the biologic activity of miR-29a in VSMC differentiation from ESCs and have uncovered a novel
http://dx.doi.org/10.1016/j.scr.2016.07.011 1873-5061/© 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
278
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
mechanism that miR-29a regulates VSMC differentiation via suppression of a transcription factor, YY1.
2. Materials and methods 2.1. Materials Antibodies against YY1 (66281-1-Ig), α smooth muscle actin (SMαA, 60255-1-Ig), were purchased from Proteintech, USA. Antibody against Smooth Muscle Myosin Heavy Chain (SM-MHC, AHP1117) was from AbD Serotec. Antibodies against SM22α (SM22, Ab14106) and h1-calponin (Calponin, Ab46794) were from Abcam, UK. Antibodies against GAPDH were from Sigma. All secondary antibodies were from Santa Cruz Biotech.
2.2. Cell culture and differentiation Detailed protocols for mouse embryonic stem (ES) (ES-D3 cell line, CRL-1934; ATCC, Manassas, VA) cell culture and VSMC differentiation were described in our previous studies (Pepe et al., 2010; Wang et al., 2012; Xiao et al., 2011; Xiao et al., 2007; Zheng et al., 2013). Briefly, ESCs were dispersed on gelatin (Sigma) coated flasks and cultured in ES culture medium (CM) that included knockout Dulbecco's Modified Essential Medium (DMEM, Gibco), 10% Embryomax Foetal Bovine Serum (FBS, Gibco), 10 ng/ml Leukaemia Inhibitor Factor (LIF, Millipore), 0.1 mM 2-mercaptoethanol (2-ME, Sigma), 100 U/ml penicillin and 100 μg/ml streptomycin (Life technologies) and 2 mM Glutamine (Sigma). Cells were split every 3 days in a ratio of 1:4. For VSMC differentiation, undifferentiated ES cells were seeded on mouse collagen IV (5 μg/ml, Corning) coated flasks or plates in differentiation medium (DM) that contains α-minimal essential medium (aMEM, Gibco) supplemented with 10% FBS, 0.05 mM 2-ME, 100 U/ml penicillin, 100 μg/ml streptomycin, and 2 mM glutamine. DM was refreshed every day after the second day of differentiation. The cells were cultured in DM for 4–8 days before harvested and for further analysis.
2.4. Real-time quantitative PCR (RT-qPCR) for mRNA and microRNAs Real-time quantitative PCR (RT-qPCR) was performed as previously described (Chen et al., 2011; Zhang et al., 2010). Briefly, total RNA containing miRs was extracted from cells using Trizol according to the manufacturer's instructions. Total and miR-specific cDNA synthesis was performed with Prime Script RT Master Mix Perfect Real Time kit (DRR036A, Takara, China) and miRNA RT-PCR Kit (RR716, Takara, China), respectively. The RT-qPCR reaction was run on an ABI Prism 7500 system following the instructions provided in the Takara premix Ex Taq II kit (DRR820A, Takara, China) or miRNA RT-PCR Kit (RR716, Takara, China). The primer sequences for VSMC differentiation genes (SMA, SM22, SMMHC, Calponin) and related transcription factors (SRF, MYO, MEF-2C) were the same as used in our previous study (Yu et al., 2015; Zhao et al., 2015a; Zheng et al., 2013). All the primer sequence are shown in Table 1 and synthesized by Sangon, China. Relative mRNA or miR expression levels were defined as the ratio of the target gene expression level or miR expression level to 18S or U6 snRNA expression level, respectively, with that of the control sample set as 1.0.
2.5. MicroRNA and plasmid transfection Either miR-29a inhibitor or miR-29a precursor (Pre-miR-29a) and miRNA negative controls were transfected into 4-day differentiating ES cells using Lipofectamine 3000 (Thermo Fisher Scientific), in accordance with the manufacturer's protocol. Transfected cells were cultured for 48–96 h in the DM to allow VSMC differentiation. All miRNAs inhibitors or precursors and respective negative controls were purchased from BAIAO. Control (pCMV6-Entry) or a YY1 overexpression plasmid (pCMV6-Entry-YY1, Origene) were transfected into differentiating ES cells using Lipofectamine 3000 according to the manufacturer's instructions. MiRNA (pre-miR-29a or miR negative control) and plasmid (pCMV6-Entry or pCMV6-Entry-YY1) co-transfection experiments were performed using jetPRIME® (Polyplus, SA).
2.6. Luciferase reporter assay 2.3. Western blot analysis Cells were harvested and lysed in lysis buffer (RIPA, Beyotime Institute of Biotechnology) supplemented with protease inhibitors (PMSF, Aladdin). Equal amounts of protein (40 μg) were resolved by SDS-PAGE with 5%–12% Tris-Glycine gel (Invitrogen) and subjected to standard western blot analysis (Zheng et al., 2013). The results were subjected to densitometric analysis with Image J software. To ensure equal protein loading, GAPDH protein was used as an internal control. The relative protein expression level was defined as the ratio of target protein expression level to GAPDH expression level with that of the control sample set as 1.0.
For the luciferase reporter assays, ES cells (6 × 104 per well) were seeded into collagen-coated 12-well plates and cultured in DM 96 h later, cells were transfected with the luciferase reporter plasmids (pGL3-SRF-Luc, pGL3-MEF-2c-Luc or pGL3-Myocd-Luc generated in our previous study (Huang et al., 2013), 0.33 μg/well) and pre-miR29a, or miR negative control (100 nM) using jetPRIME® (Polyplus). A Renilla reporter plasmid (0.1 μg/well, Promega) was included in all transfection assays as an internal control. Luciferase and Renilla activity assays were analyzed 48 h after transfection. Relative luciferase unit (RLU) was defined as the ratio of luciferase activity to Renilla activity with that of control set as 1.0.
Table 1 Primer sets used in the present study. Gene names
Forward (5′–3′)
Reverse (5′–3′)
GenBank accession numbers
18s rRNA U6 snRNA miR-29a SMαA SM22α h1-Calponin SM-myh11 YY1 SRF Myocd MEF-2C
AAACGGCTACCACATCCAG GATGACACGCAAATTCGTG CGGACTGATTTCTTTTGGTGTTCAG TCCTGACGCTGAAGTATCCGAT GAT ATG GCA GCA GTG CAG AG GGT CCT GCC TAC GGC TTG TC AAG CAG CCA GCA TCA AGG AG GTGGTTGAAGAGCAGATCATTGG CCTACCAGGTGTCGGAATCTGA TCAATGAGAAGATCGCTCTCCG AAGCCAAATCTCCTCCCCCTAT
CCTCCAATGGATCCTCGTTA miRNA universal reverse primer (Invitrogen, A11193-051) miRNA universal reverse primer (Invitrogen, A11193-051) GGCCACACGAAGCTCGTTATAG AGT TGG CTG TCT GTG AAG TC TCG CAA AGA ATG ATC CCG TC AGC TCT GCC ATG TCC TCC AC GTGCAGCCTTTATGAGGGCAA TCTGGATTGTGGAGGTGGTACC GTCATCCTCAAAGGCGAATGC TGATTCACTGATGGCATCGTGT
NR_003278.3 NR_003027.2 MIMAT0004631 NM_007392.3 NM_011526.5 NM_009922 NM_013607 NM_009537.3 NM_020493.2 NM_145136.4 NM_001170537.1
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
2.7. VSMC differentiation in vitro All animal protocols were reviewed and approved by the Zhejiang University Animal Care and Use Committee. All methods were carried out in accordance with the approved guidelines. Control (miR negative control) or miR-29a overexpressing (pre-miR-29a) ES cells labeled with green fluorescence, PKH67 (Sigma), were induced to differentiate into VSMCs in vivo as described in our previous studies (Huang et al., 2013; Xiao et al., 2012; Yu et al., 2015; Zhao et al., 2015b). Briefly, miR negative control or miR-29a overexpressing ES cells (106 cells in 50 μl) were mixed with 50 μl of Matrigel™ (Becton Dickinson Labware) at 4 °C, and subcutaneously injected into C57BL/6J mice. After 10–13 days, mice were euthanized and the implants (Matrigel™ plugs) were harvested and frozen in liquid nitrogen for future using. Part of each Matrigel™ plug was sectioned for detection of cell markers and the remained was lysed and extracted for total RNA or protein to examine the expression levels of the indicated markers, respectively. 2.8. Fluorescent immunochemistry For immunofluorescent staining, sections were cut at 8 μm for optimum cutting of temperature compound–embedded Matrigel™ implants, every 40 μm along the longitudinal axis of Matrigel™ plugs and numbered. Certain numbered sections (for instance, sections 5, 15 and 25) were subjected to immunohistological analyses with respective antibodies. Briefly, frozen sections were air-dried for at least 30 min, followed by fixation in cold acetone for 15 min. The sections were then rinsed in PBS and blocked with 5% BSA in PBS (Gibco) for 1 h at room temperature in a humid chamber. The incubation with primary antibodies (SM-MHC, SMA) or IgG controls diluted in blocking buffer was performed in a cold room (4 °C) overnight. Following incubation with appropriate FITC or TRITC conjugated secondary antibodies, sections were then incubated with DAPI (1:1000, Sigma) for 5 min. Images were assessed with an Axioplan 2 imaging microscope with PlanNEOFLUAR 20×, NA 0.5, objective lenses, AxioCam camera, and Axiovision software (all Carl Zeiss MicroImaging, Inc.) at room temperature. Photoshop software (Adobe) was used to analyze the acquired images.
279
The percentage of PKH67-labeled SM-MHC positive cells per field were counted by two well-trained independent investigators blinded to the treatments, from four random high power fields (200×) in each section, three sections from each implant and four implants for each group. 2.9. Statistical analysis Data were expressed as mean ± SEM and analyzed using a twotailed student's t-test for two-group comparison or one-way ANOVA followed by Tukey's HSD multiple comparison post-hoc test for comparing different groups. A value of p b 0.05 was considered as statistically significant. 3. Result 3.1. miR-29a mediates VSMC differentiation from ESCs in vitro To induce VSMC differentiation, ES cells were reseeded into 6-well plate coated with collagen IV and cultured in VSMC differentiation medium for 2 to 8 days. Consistently, gene expression levels of VSMC specific markers including smooth muscle α-actin (SMαA) (Fig. 1A), SM22 (Fig. 1B), and smooth muscle myosin heavy chain (SM-MHC) (Fig. 1C) were significantly upregulated during differentiation. Importantly, miR-29a expression was induced from day 2 of differentiation, and peaked at day 4 of differentiation (Fig. 1D), suggesting a role of miR29a in VSMC differentiation. Loss-of-function and gain-of-function experiments were used to investigate whether miR-29a was necessary for VSMC differentiation. Gain-of-function experiments using miR-29a precursor (pre-miR-29a) were performed in differentiating ES cells. Data showed both gene and protein levels (Fig. 2A and B) of three out of four differentiation specific markers (SMαA, SM22, and SM-MHC) were significantly increased by miR-29a overexpression. We also observed an increase in h1-calponin mRNA induced by miR-29a over-expression, yet it was not statistically significant. On the other hand, data from the loss-of-function experiments by using miR-29a inhibitor revealed that miR-29a knockdown significantly inhibited the gene and protein expression of SMαA,
Fig. 1. microRNA29a (miR-29a) was upregulated during mouse embryonic stem cells (ESC) differentiation towards vascular smooth muscle cells (VSMCs). Cells were cultured in 6-well plates coated with collagen IV and cultured in VSMC differentiation medium (DM) for the indicated times. Total RNA including miRs were harvested and subjected to RT-qPCR analyses with primers specific for smooth muscle α-actin (SMαA) (A), SM22 (B), smooth muscle myosin heavy chain (SM-MHC) (C) and miR-29a (D). Day 0 samples were undifferentiated ES cells and served as negative controls. The data presented here are the mean ± SEM of 3 independent experiments. #p b 0.01, *p b 0.05.
280
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
Fig. 2. miR-29a promotes VSMC differentiation from ESCs. (A and B) miR-29a overexpression significantly increases VSMC marker gene expression levels. Day 3–4 differentiating ESCs were transfected with pre-miR-29a or miR negative control and cultured in VSMC DM for 48–72 h. (C and D) miR-29a inhibition decreases VSMC marker expression levels. Day 3–4 differentiating ESCs were transfected with miR-29a inhibitor or miR negative control and cultured in VSMC DM for 48 h. Total RNAs and proteins were harvested and subjected to RTqPCR (A and C) and western blot (B and D) analyses, respectively. The data presented here are representative (left panel in B and D) or mean ± S.E.M. of 4 independent experiments. *p b 0.05, #p b 0.01.
SM22, and h1-calponin (Fig. 2C and D). Moreover, although not statistically significant, a decrease in SM-MHC protein level was observed in the cells transfected with miR-29a inhibitor, suggesting a role of miR29a in VSMC differentiation from stem cells in vitro.
of miR-29a (Fig. 4A). The result confirms that YY1 is negatively regulated by miR-29a during VSMC differentiation from ESCs. 3.4. YY1 functions as a negative regulator of VSMC differentiation and restoration of YY1 impairs miR-29a-promoted VSMC differentiation
3.2. miR-29a is likely to promote VSMC differentiation in vivo To investigate whether or not miR-29a can promote VSMC differentiation in vivo, Matrigel™ mixed with control or miR-29a overexpressing ESCs was injected subcutaneously into the mouse. Immunofluorescent analyses (Fig. 3A and B) showed that more SM-MHC-positive cells were presented in the Matrigel™ plugs implanted with miR-29a overexpressing ESCs, although no significant difference was observed between the two groups. Moreover, data from RT-qPCR (Fig. 3C) and western blotting (Fig. 3D) analysis revealed that overexpression of miR-29a increased both the gene and protein levels of smooth muscle differentiation specific markers in vivo. Taken together, these data suggest a regulatory role of miR-29a in VSMC differentiation from stem cells both in vitro and in vivo.
To investigate the potential role of YY1 in VSMC differentiation, we over-expressed YY1 in the differentiating ESCs. YY1 overexpression significantly downregulated mRNA and protein expression of VSMC markers (Fig. 5A and B), suggesting that YY1 is a negative modulator of VSMC differentiation. To further study the functional involvement of YY1 in miR-29a-mediated VSMC differentiation, miR-29a and YY1 were co-transfected in the differentiating ESCs. Data from RT-qPCR (Fig. 5C) and western blot (Fig. 5D and E) analyses revealed that restoration of YY1 expression in the presence of miR-29a over-expression almost abolished VSMC specific gene upregulation, suggesting that miR29a-mediated VSMC differentiation is largely dependent on the repression of YY1.
3.3. Target gene, YY1, is negatively regulated by miR-29a
3.5. miR-29a mediates VSMC differentiation through modulation of VSMC transcription factors
By utilizing the TargetScan program (http://www.targetscan.org), we have observed that miR-29a has complementary sequences to YY1's 3′UTR mRNA. All miR-29 family members have been previously predicted to hybridize to an evolutionarily conserved site within the YY1 3′UTR among vertebrate species (Wang et al., 2008). Moreover, miR-29 can specifically interact with the 3′UTR of YY1 mRNA to inhibit its translation (Wang et al., 2011). Therefore, we examined whether or not miR-29a modulates YY1 during VSMC differentiation from ESCs. Consistent with previous findings, our data revealed that YY1 gene (Fig. 4C) and protein (Fig. 4D and E) levels were significantly upregulated by inhibition of miR-29a (Fig. 4B), whereas its protein expression level (Fig. 4D and E) was significantly downregulated by overexpression
Serum response factor (SRF), myocyte-specific enhancer factor 2c (MEF-2C) and myocardin (Myocd) are well-known transcription factors for VSMC gene regulation. Particularly, SRF and its co-activator, Myocardin, interact with the SRF binding element (CArG box) within the promoter of SMC genes and the interaction regulates transcriptional activation of SMC genes (Miano, 2003). Therefore, we investigated if miR-29a modulates these three transcription factors during VSMC differentiation from ESCs. Our data showed that gene expression levels of all three transcription factors were significantly upregulated by miR-29a overexpression (Fig. 6A), whereas inhibition of miR-29a significantly down-regulates their expression levels except for MEF2C (Fig. 6B). Such a notion has been further recapitulated by luciferase
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
281
Fig. 3. miR-29a promotes VSMCs differentiation in vivo. Matrigel™ mixed with ESCs transfected with miR negative control or pre-miR-29a was injected subcutaneously into mouse and harvested for further experiments. (A and B) Matrigel™ plugs with ESCs transfected with pre-miR-29a showed more SMαA/SM-MHC positive cells. Matrigel™ plugs were sectioned and subjected to immunofluorescence staining using antibodies against SMαA/SM-MHC (Blue is DAPI, Red is SMαA/SM-MHC). (C and D) VSMC marker gene expressions within Matrigel™ implants. Total RNA and protein samples were extracted and subjected to RT-qPCR (C) and western blot (D) analyses. The data presented here are representative or mean ± S.E.M of 3 repeats at least. *p b 0.05, #p b 0.01.
activity assays with SRF, MEF-2C and Myocd gene promoter reporters. Data shown in Fig. 6D revealed that the miR-29a overexpression significantly increased gene promoter activities of SRF and Myocd, but not the MEF2C, indicating that miR-29a upregulated transcriptional activity of SRF and Myocd genes. Interestingly, a previous study has suggested a potential interplay between YY1 and SRF in transcriptional regulation of SM-MHC and SM22 genes (Itoh et al., 2001). Indeed, our results showed that YY1 negatively regulated SRF, MEF-2C and Myocd gene expression (Fig. 6C). Taken together, the above data have suggested that miR-29a promotes VSMC differentiation from ESCs through targeting and suppressing the transcription factor, YY1. As YY1 inhibits VSMC differentiation and gene expression of VSMC specific transcription factors, SRF and Myocd, the miR-29a dependent suppression of YY1, in turn, activates VSMC differentiation. 4. Discussion Alteration in the normal structure or function of differentiated VSMCs plays a major role in a number of diseases, including atherosclerosis, hypertension, and cancer. The underlying molecular mechanisms of VSMC differentiation remain to be elucidated. Accumulating evidence has demonstrated that the gene regulatory program of VSMC differentiation from pluripotent stem cells is orchestrated by a coordinated molecular network with various signaling pathways and molecules involved, such as mechanical forces, contractile agonists, extracellular matrix components (laminin and type I and IV collagen), Matrix Metalloproteinases (Chen et al., 2013), neuronal factors, reactive oxygen species (Zhou et al., 2013), endothelial SMC interactions, thrombin, TGF family, notch family (Tang et al., 2010), and miRs. Although all of
these factors have been shown to promote expression of at least some VSMC marker genes in cultured cell systems (Owens et al., 2004; Xie et al., 2011), our understanding of the molecular mechanisms underlying VSMC differentiation from ESCs is still far from complete. In this study, we revealed an important role of miR-29a in regulating VSMC specific gene expression and VSMC differentiation from ESCs in vitro and in vivo. We presented the first evidence to support a functional role of YY1 in VSMC differentiation and VSMC specific gene regulation. We also provided the evidence to support that the identified target gene of miR-29a, YY1, functions as an important VSMC differentiation gene repressor during VSMC differentiation from stem cells. miR-29a has been extensively studied in different fields. miR-29a has been reported to be associated with cardiac hypertrophy and fibrosis (Roncarati et al., 2014), and functions as a negative regulator of extracellular matrix remodeling (van Rooij et al., 2008). We have previously reported that miR-29a can also act as an important regulator of the inflammatory response (Chen et al., 2011). In the current study, using miRNA gain/loss-of-function analyses and a well-established in vitro VSMC differentiation model, we confirmed a regulatory role for miR-29a in VSMC differentiation from ESCs. An important role of miR29a in VSMC differentiation has been further confirmed in our wellestablished in vivo VSMC differentiation model with Matrigel™ implantation. One of the new findings in the current study is that we have identified YY1 as the target gene of miR-29a during VSMC differentiation from ESCs. YY1 (also known as Yin Yang1, NF-E1, UCRBP and CF1), a ubiquitous and dual-function GLI-Kruppel zinc finger transcription factor, was first identified on the basis of its capacity to negatively regulate the adeno-associated virus P5 promoter (Shi et al., 1991). Recent studies
282
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
Fig. 4. YY1 is negatively regulated by miR-29a during ESC differentiation. (A) miR-29a over-expression with pre-miR-29a in differentiating ESCs; (B) miR-29a inhibition with miR29a inhibitor in differentiating ESCs. (C–E) YY1 is adversely modulated by miR-29a during SMC differentiation from ESCs. Day 3 differentiating ESCs were transfected with pre-miR-29a (A), miR29a inhibitor (B), or respective miR negative controls, and cultured for further 48 h. Total RNA and protein were harvested and subjected to RT-qPCR (A–C) and western blot (D–E) analyses, respectively. The data presented here are representative (D) or mean ± S.E.M. of 3 independent experiments. #p b 0.01, *p b 0.05.
have suggested that YY1 functions as a transcription co-factor independent of its DNA binding activity (Deng et al., 2010). It has been reported that YY1 is an important inhibitor of muscle cell differentiation and
expression of muscle-specific genes (Ellis et al., 2002). Another study has reported that VSMC phenotype is also regulated by the YY1 (Favot et al., 2005), yet the potential interplay between YY1 and VSMC biology
Fig. 5. YY1 acts as a VSMC differentiation repressor and re-activation of YY1 impairs the promotive effects of miR-29a on VSMC differentiation. (A and B) YY1 inhibits VSMC differentiation from ESCs. Day 3–4 differentiating ES cells were transfected with control (pCMV6-Entry) or YY1 over-expression plasmid (pCMV6-Entry-YY1), and cultured in VSMC DM for another 48 h. Total RNA and protein were harvested and subjected to RT-qPCR (A) and western blot (B) analyses, respectively. The data presented here are representative (Left in B) or mean ± S.E.M. of three independent experiments. #p b 0.01, *p b 0.05. (C–E) YY1 re-activation abolished VSMC gene expression induced by miR-29a. Day 3–4 differentiating ESCs were co-transfected with pre-miR-29a, YY1 over-expression (pCMV6-Entry-YY1) plasmids, and/or respective controls (miR negative control or pCMV6-Entry), and cultured in VSMC DM for 48 h further. Total RNA and protein were harvested and subjected to RT-qPCR (C) and western blot (D–E) analyses, respectively. The data presented here are representative (Left in B and D) or mean ± S.E.M. of three independent experiments. *p b 0.05 (versus double negative controls); #p b 0.05 (pCMV6-Entry-YY1 versus pCMV6-Entry in the presence of pre-miR-29a).
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
283
Fig. 6. Modulation of VSMC differentiation related transcription factors (TF) by miR29a and YY1. (A and B) Gene expression levels of serum response factor (SRF), myocardin (Myocd) and myocyte-specific enhancer factor 2c (MEF2C) were significantly upregulated by miR-29a overexpression (A), but dramatically down-regulated by miR-29a inhibition (B) and YY1 overexpression (C), respectively. Day 3–4 differentiating ESCs were transfected with pre-miR-29a (A), miR-29a inhibitor (B), pCMV6-Entry-YY1 (C), or respective controls (miR negative control or pCMV6-Entry), and cultured in VSMC DM for 48 h further. Total RNA was harvested and subjected to RT-qPCR analyses with indicated primers. The data presented here are mean ± SEM of 3 independent experiments. #p b 0.05, *p b 0.01 (vs control). (D) Promoter activities of SRF, Myocd and MEF2C genes were enhanced by miR-29a. Day 3–4 differentiating ESCs were transfected with the indicated luciferase reporter plasmids [pGL3-SRF-Luc (SRF), pGL3-MEF2c-Luc (MEF2C), or pGL3-Myocd-Luc (Myocd)] (0.25 μg/well, 24well plate) and miR negative control or pre-miR-29a (25 pmol/well). Renilla plasmid (20 ng/well) was included as a control. Luciferase activity assays were detected 48–72 h after transfection. The data presented here are mean ± SEM of 3 independent experiments. #p b 0.05, *p b 0.01 (vs control).
is still unclear and needs further investigation (Aikawa, 2007). In the current study, we have observed that YY1 is negatively regulated by miR-29a, and re-activation of YY1 impairs VSMC gene activation induced by miR-29a over-expression, supporting an important role of YY1 in miR-29a-mediated VSMC differentiation from ESCs.
5. Conclusion In the current study, we reported a novel function of miR-29a in VSMC differentiation from stem cells in vitro and in vivo, and provided comprehensive evidence to support that YY1 is a genuine mRNA target
Fig. 7. Regulatory role of miR-29a in VSMC differentiation. MiR-29a targets YY1, de-suppressing its negative regulation of transcription factors (SRF, MEF-2C, Myocd), resulting in the VSMC differentiation from stem cells both in vivo and in vitro.
284
M. Jin et al. / Stem Cell Research 17 (2016) 277–284
of miR-29a during VSMC differentiation. Moreover, our data suggest that YY1 is a negative regulator of VSMC related transcription factors (SRF, Myocd, and MEF-2C), and repression of YY1 by miR-29a is the underlying mechanism of miR-29a-mediated VSMC differentiation from ESCs (Fig. 7). Conflict of interest disclosure None. Author contributions Ting Chen and Min Jin. designed research; Yutao Wu, Yanwei Wang, Yanwei Wang, Mei Yang, Feng Yang, Jing Wang, Dongdong Jian performed research; Chun Feng analyzed data; and Ting Chen wrote the paper. Acknowledgments We are grateful to the supports from Zhejiang Provincial Natural Science Foundation of China under Grant No. LQ14H020001, National Natural Science Foundation of China (No. 81400205/H0203 91339102, 81570249, 81270001; 81400224; 91539103, 81270180), Project of Medical Science Research Foundation from Health Department of Zhejiang Province (2015KYA090 201598277, 2016141482). References Aikawa, M., 2007. The balance of power: the law of Yin and Yang in smooth muscle cell fate. Is YY1 a vascular protector? Circ. Res. 101, 111–113. Ambros, V., 2001. microRNAs: tiny regulators with great potential. Cell 107, 823–826. Chen, Q., Jin, M., Yang, F., Zhu, J., Xiao, Q., Zhang, L., 2013. Matrix metalloproteinases: inflammatory regulators of cell behaviors in vascular formation and remodeling. Mediat. Inflamm. 2013, 928315. Chen, T., Li, Z., Tu, J., Zhu, W., Ge, J., Zheng, X., Yang, L., Pan, X., Yan, H., Zhu, J., 2011. MicroRNA-29a regulates pro-inflammatory cytokine secretion and scavenger receptor expression by targeting LPL in oxLDL-stimulated dendritic cells. FEBS Lett. 585, 657–663. Deng, Z., Cao, P., Wan, M.M., Sui, G., 2010. Yin Yang 1: a multifaceted protein beyond a transcription factor. Transcription 1, 81–84. Ellis, P.D., Martin, K.M., Rickman, C., Metcalfe, J.C., Kemp, P.R., 2002. Increased actin polymerization reduces the inhibition of serum response factor activity by Yin Yang 1. Biochem. J. 364, 547–554. Favot, L., Hall, S.M., Haworth, S.G., Kemp, P.R., 2005. Cytoplasmic YY1 is associated with increased smooth muscle-specific gene expression: implications for neonatal pulmonary hypertension. Am. J. Pathol. 167, 1497–1509. Huang, Y., Lin, L., Yu, X., Wen, G., Pu, X., Zhao, H., Fang, C., Zhu, J., Ye, S., Zhang, L., et al., 2013. Functional involvements of heterogeneous nuclear ribonucleoprotein A1 in smooth muscle differentiation from stem cells in vitro and in vivo. Stem Cells 31, 906–917. Hutvagner, G., McLachlan, J., Pasquinelli, A.E., Balint, E., Tuschl, T., Zamore, P.D., 2001. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293, 834–838. Itoh, S., Katoh, Y., Konishi, H., Takaya, N., Kimura, T., Periasamy, M., Yamaguchi, H., 2001. Nitric oxide regulates smooth-muscle-specific myosin heavy chain gene expression at the transcriptional level-possible role of SRF and YY1 through CArG element. J. Mol. Cell. Cardiol. 33, 95–107. Ivey, K.N., Muth, A., Arnold, J., King, F.W., Yeh, R.F., Fish, J.E., Hsiao, E.C., Schwartz, R.J., Conklin, B.R., Bernstein, H.S., et al., 2008. MicroRNA regulation of cell lineages in mouse and human embryonic stem cells. Cell Stem Cell 2, 219–229. Martinez, N.J., Gregory, R.I., 2010. MicroRNA gene regulatory pathways in the establishment and maintenance of ESC identity. Cell Stem Cell 7, 31–35. Miano, J.M., 2003. Serum response factor: toggling between disparate programs of gene expression. J. Mol. Cell. Cardiol. 35, 577–593. Owens, G.K., Kumar, M.S., Wamhoff, B.R., 2004. Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol. Rev. 84, 767–801. Pekarsky, Y., Croce, C.M., 2010. Is miR-29 an oncogene or tumor suppressor in CLL? Oncotarget 1, 224–227.
Pepe, A.E., Xiao, Q., Zampetaki, A., Zhang, Z., Kobayashi, A., Hu, Y., Xu, Q., 2010. Crucial role of nrf3 in smooth muscle cell differentiation from stem cells. Circ. Res. 106, 870–879. Poliseno, L., Tuccoli, A., Mariani, L., Evangelista, M., Citti, L., Woods, K., Mercatanti, A., Hammond, S., Rainaldi, G., 2006. MicroRNAs modulate the angiogenic properties of HUVECs. Blood 108, 3068–3071. Robinson, H.C., Baker, A.H., 2012. How do microRNAs affect vascular smooth muscle cell biology? Curr. Opin. Lipidol. 23, 405–411. Roncarati, R., Viviani Anselmi, C., Losi, M.A., Papa, L., Cavarretta, E., Da Costa Martins, P., Contaldi, C., Saccani Jotti, G., Franzone, A., Galastri, L., et al., 2014. Circulating miR29a, among other up-regulated microRNAs, is the only biomarker for both hypertrophy and fibrosis in patients with hypertrophic cardiomyopathy. J. Am. Coll. Cardiol. 63, 920–927. Rossi, J.J., 2005. RNAi and the P-body connection. Nat. Cell Biol. 7, 643–644. Shi, Y., Seto, E., Chang, L.S., Shenk, T., 1991. Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell 67, 377–388. Tang, Y., Urs, S., Boucher, J., Bernaiche, T., Venkatesh, D., Spicer, D.B., Vary, C.P., Liaw, L., 2010. Notch and transforming growth factor-beta (TGFbeta) signaling pathways cooperatively regulate vascular smooth muscle cell differentiation. J. Biol. Chem. 285, 17556–17563. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., Jones, J.M., 1998. Embryonic stem cell lines derived from human blastocysts. Science 282, 1145–1147. van Rooij, E., Sutherland, L.B., Thatcher, J.E., DiMaio, J.M., Naseem, R.H., Marshall, W.S., Hill, J.A., Olson, E.N., 2008. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. Proc. Natl. Acad. Sci. U. S. A. 105, 13027–13032. Wang, G., Xiao, Q., Luo, Z., Ye, S., Xu, Q., 2012. Functional impact of heterogeneous nuclear ribonucleoprotein A2/B1 in smooth muscle differentiation from stem cells and embryonic arteriogenesis. J. Biol. Chem. 287, 2896–2906. Wang, H., Garzon, R., Sun, H., Ladner, K.J., Singh, R., Dahlman, J., Cheng, A., Hall, B.M., Qualman, S.J., Chandler, D.S., et al., 2008. NF-kappaB-YY1-miR-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma. Cancer Cell 14, 369–381. Wang, X.H., Hu, Z., Klein, J.D., Zhang, L., Fang, F., Mitch, W.E., 2011. Decreased miR-29 suppresses myogenesis in CKD. J. Am. Soc. Nephrol. 22, 2068–2076. Weissman, I.L., 2000. Translating stem and progenitor cell biology to the clinic: barriers and opportunities. Science 287, 1442–1446. Xiao, Q., Pepe, A.E., Wang, G., Luo, Z., Zhang, L., Zeng, L., Zhang, Z., Hu, Y., Ye, S., Xu, Q., 2012. Nrf3-Pla2g7 interaction plays an essential role in smooth muscle differentiation from stem cells. Arterioscler. Thromb. Vasc. Biol. 32, 730–744. Xiao, Q., Wang, G., Yin, X., Luo, Z., Margariti, A., Zeng, L., Mayr, M., Ye, S., Xu, Q., 2011. Chromobox protein homolog 3 is essential for stem cell differentiation to smooth muscles in vitro and in embryonic arteriogenesis. Arterioscler. Thromb. Vasc. Biol. 31, 1842–1852. Xiao, Q., Zeng, L., Zhang, Z., Hu, Y., Xu, Q., 2007. Stem cell-derived Sca-1+ progenitors differentiate into smooth muscle cells, which is mediated by collagen IV-integrin alpha1/beta1/alphav and PDGF receptor pathways. Am. J. Physiol. Cell Physiol. 292, C342–C352. Xie, C., Ritchie, R.P., Huang, H., Zhang, J., Chen, Y.E., 2011. Smooth muscle cell differentiation in vitro: models and underlying molecular mechanisms. Arterioscler. Thromb. Vasc. Biol. 31, 1485–1494. Yu, X., Zhang, L., Wen, G., Zhao, H., Luong, L.A., Chen, Q., Huang, Y., Zhu, J., Ye, S., Xu, Q., et al., 2015. Upregulated sirtuin 1 by miRNA-34a is required for smooth muscle cell differentiation from pluripotent stem cells. Cell Death Differ. 22, 1170–1180. Zhang, L., Jin, M., Margariti, A., Wang, G., Luo, Z., Zampetaki, A., Zeng, L., Ye, S., Zhu, J., Xiao, Q., 2010. Sp1-dependent activation of HDAC7 is required for platelet-derived growth factor-BB-induced smooth muscle cell differentiation from stem cells. J. Biol. Chem. 285, 38463–38472. Zhao, H., Wen, G., Huang, Y., Yu, X., Chen, Q., Afzal, T.A., Luong le, A., Zhu, J., Shu, Y., Zhang, L., et al., 2015a. MicroRNA-22 regulates smooth muscle cell differentiation from stem cells by targeting methyl CpG-binding protein 2. Arterioscler. Thromb. Vasc. Biol. 35, 918–929. Zhao, H., Wen, G., Huang, Y., Yu, X., Chen, Q., Afzal, T.A., Luong le, A., Zhu, J., Ye, S., Zhang, L., et al., 2015b. MicroRNA-22 regulates smooth muscle cell differentiation from stem cells by targeting methyl CpG-binding protein 2. Arterioscler. Thromb. Vasc. Biol. 35, 918–929. Zheng, X., Wu, Y., Zhu, L., Chen, Q., Zhou, Y., Yan, H., Chen, T., Xiao, Q., Zhu, J., Zhang, L., 2013. Angiotensin II promotes differentiation of mouse embryonic stem cells to smooth muscle cells through PI3-kinase signaling pathway and NF-kappaB. Differentiation; research in biological diversity 85, 41–54. Zhou, Y., Yan, H., Guo, M., Zhu, J., Xiao, Q., Zhang, L., 2013. Reactive oxygen species in vascular formation and development. Oxidative Med. Cell. Longev. 2013, 374963. Zhou, Y., Yang, F., Chen, T., Wu, Y., Yang, M., Zhu, J., Zhang, L., 2014. An updated view on the differentiation of stem cells into endothelial cells. Sci. China Life Sci. 57, 763–773.