LPA1 receptor-deficient mice have phenotypic changes observed in psychiatric disease

Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

www.elsevier.com/locate/ymcne

LPA1 receptor-deficient mice have phenotypic changes observed in psychiatric disease S.M. Harrison,d,1 C. Reavill,a,1 G. Brown,e J.T. Brown,b J.E. Cluderay,a B. Crook,b C.H. Davies,b L.A. Dawson,a E. Grau,d C. Heidbreder,a P. Hemmati,a G. Hervieu,b A. Howarth,d Z.A. Hughes,a A.J. Hunter,b J. Latcham,c S. Pickering,d P. Pugh,b D.C. Rogers,b C.S. Shilliam,a and P.R. Maycoxa,* a

Psychiatry Centre of Excellence for Drug Discovery, GlaxoSmithKline, Harlow, Essex, UK Neurology & Gastro-Intestinal Centre of Excellence for Drug Discovery, GlaxoSmithKline, Harlow, Essex, UK c Laboratory Animal Sciences, GlaxoSmithKline, Harlow, Essex, UK d Comparative Genomics, GlaxoSmithKline, Harlow, Essex, UK e Respiratory Inflammation Respiratory Pathogens Centre of Excellence for Drug Discovery, GlaxoSmithKline, Stevenage, UK b

Received 12 May 2003; revised 5 August 2003; accepted 2 September 2003

Abstract Several psychiatric diseases, including schizophrenia, are thought to have a developmental aetiology, but to date no clear link has been made between psychiatric disease and a specific developmental process. LPA1 is a Gi-coupled seven transmembrane receptor with high affinity for lysophosphatidic acid. Although LPA1 is expressed in several peripheral tissues, in the nervous system it shows relatively restricted temporal expression to neuroepithelia during CNS development and to myelinating glia in the adult. We report the detailed neurological and behavioural analysis of mice homozygous for a targeted deletion at the lpa1 locus. Our observations reveal a marked deficit in prepulse inhibition, widespread changes in the levels and turnover of the neurotransmitter 5-HT, a brain region-specific alteration in levels of amino acids, and a craniofacial dysmorphism in these mice. We suggest that the loss of LPA1 receptor generates defects resembling those found in psychiatric disease. © 2003 Elsevier Inc. All rights reserved.

Introduction LPA1 is one of four cognate seven transmembrane receptors [LPA1, LPA2, and LPA3 (Yang et al., 2002; formerly EDG2, EDG3, and EDG7, respectively) and p2y9 (Noguchi et al., 2003)] for the bioactive phospholipid, lysophosphatidic acid (LPA). LPA is also an agonist at the nuclear hormone receptor PPAR␥ (McIntyre et al., 2003). LPA1 is a Gi-coupled receptor originally identified in immortalised cortical neuroblasts and subsequently shown to have a temporally and spatially restricted expression pattern in the developing and adult * Corresponding author. Schizophrenia and Bipolar Disorder Research, Psychiatry CEDD, GlaxoSmithKline, Third Ave., Harlow, Essex CM19 5AW. Fax: ⫹44-1279-875389. E-mail address: [email protected] (P.R. Maycox). 1 These authors contributed equally to this study. 1044-7431/$ – see front matter © 2003 Elsevier Inc. All rights reserved. doi:10.1016/j.men.2003.09.001

brain (Hecht et al., 1996; An et al., 1997). LPA1 first appears in the ventricular zone of the embryonic cerebral cortex at E12 and is expressed in neuroepithelial layers until shortly before birth (Allard et al., 1998). Expression reemerges in myelinating glia of the postnatal nervous system and follows the pattern of myelination in the early postnatal brain (Allard et al., 1998; Handford et al., 2001). The role of LPA1 remains unclear although the embryonic expression profile would clearly suggest that it is associated with neurogenesis or neuroblast migration during development. In addition, recent in vitro studies have shown that LPA1 mediates morphological changes in neuroblasts (Contos et al., 2000; Fukushima et al., 2000) although more definitive data showing any in vivo effect on cell number or cell migration are lacking. Our interest in understanding the role of this receptor was stimulated by emerging hypotheses regarding the developmen-

S.M. Harrison et al. / Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

1171

Fig. 1. Disruption of the lpa1 gene by homologous recombination. (A) Diagram of targeting construct and targeting strategy. Shaded boxes represent numbered exons; the black box indicates the first 51 bp of exon 3 present in the targeting construct. Translation initiation codons for mrec and LPA1 proteins are indicated. Intron size is not to scale. The 5⬘ and 3⬘ arms of homology are ⬃4.2-kb BglII/HpaII and ⬃3.5-kb XbaI/EcoRI restriction fragments, respectively. The relative positions of the diagnostic BamHI restriction fragments and 5⬘ external 1.5-kb AccI restriction fragment probe (hatched box) are indicated, although these have not been accurately mapped. Homologous recombination results in the replacement of all but the first 51 base pairs of exon 3 with the IRES lacZ/neomycin resistance cassette. (B) Representative example of Southern blot from wild type (⫹/⫹), heterozygote (⫹/⫺), and homozygous mutant (⫺/⫺) mouse tail DNA cleaved with BamHI and hybridised with the 32P-labelled AccI probe. The ⬃17-kb wild-type locus-specific band and ⬃9-kb targeted locus-specific band are indicated. (C) Wild-type (⫹/⫹), heterozygote (⫹/⫺), and homozygous mutant (⫺/⫺) mouse tail DNA genotyped by multiplex PCR. Products for the wild-type locus (224 bp) and targeted locus (170 bp) are indicated.

tal aetiology of several psychiatric diseases. In the case of schizophrenia, for example, the age of disease onset strongly suggests a developmental process (Bilder, 2001). In addition, several developmentally regulated genes have been associated with the disease, e.g., Neuregulin 1 (Stefansson et al., 2002), GSK3-␤ (Kozlovsky et al., 2002), and Reelin (Tueting et al., 1999). In an attempt to further understand the role of LPA1, we generated receptor-null mutants. We now report the detailed molecular, physiological, neurochemical, and behavioural phenotypes of mice homozygous for a targeted deletion at the lpa1 locus.

Results Targeted deletion of lpa1 We have used homologous recombination in embryonic stem (ES) cells to generate a targeted mutation in the lpa1 gene.

Homologous recombination results in the loss of all of exon 3 except the first 51 base pairs (and therefore the majority of the coding region of the lpa1 gene-derived transcripts), and replacement with an IRESlacZ expression/neomycin resistance cassette (Fig. 1A). Both Southern analysis (Fig. 1B) and polymerase chain reaction (Fig. 1C) confirmed successful targeting of the locus. Germline chimeras were crossed onto C57B1/6J females to generate heterozygotes, which were intercrossed giving rise to N1F1 offspring homozygous for the lpa1-targeted mutation (lpa1(⫺/⫺) mice). N1F0 heterozygotes were successively backcrossed to C57B1/6J females through to N6 when an intercross was set up to generate the study population. Litters always occurred in a sub-Mendelian ratio (average litter numbers: lpa1(⫺/⫺) 1, lpa1(⫹/⫺) 4, lpa1(⫹/⫹) 2, n ⫽ 7). Most homozygote death occurred perinatally with some postnatal death (see also Contos et al., 2000). The latter could be minimised by careful animal monitoring and, in particular, by preventing overgrowth of the incisors, which if unattended

1172

S.M. Harrison et al. / Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

Fig. 2. Expression of LPA1 mRNA in lpa1(⫺/⫺), lpa1(⫺/⫹), and wild-type mice. Plots are derived from mean values of three independent RT-PCRs of each cDNA. Copies detected refer to copies per nanogram of reverse-transcribed RNA. The brain sample refers to remaining brain tissue after removing the cerebellum, cortex, and hippocampus.

inhibited the ability of the animal to feed. Quantitative analysis of LPA1 mRNA confirmed the absence of transcripts in the CNS and peripheral tissues of the lpa1(⫺/⫺) mice (Fig. 2). Analysis of the other LPA/S1P receptor family members (LPA2, LPA3, and S1P1-5) revealed no changes in normal expression in the same regions (not shown).

scopic analysis of optic nerve, corpus callosum, and sciatic nerve revealed no obvious structural differences between the lpa1(⫺/⫺) mice and wild-type littermates (data not shown). Despite the lack of gross neuroanatomical change in the adult lpa1(⫺/⫺) mice, we were interested to examine whether any functionally relevant phenotypes were induced by the null allelle.

Anatomy of lpa1(⫺/⫺) mice

Neurochemical analysis of lpa1(⫺/⫺) mouse brain regions

The lpa1(⫺/⫺) mice develop a striking craniofacial phenotype that is apparent during the second postnatal week (not shown; see Contos et al., 2000). They have a shortened eye-to-nose tip length and the eyes are wider apart. The lpa1(⫺/⫺) mice are 10 –15% shorter than WT littermates and have a lower body mass throughout postnatal development and in the adult in agreement with Contos et al. (2000). A specific polyclonal antibody was generated against a C-terminal peptide in LPA1. The antibody detected a single polypeptide by western analysis at the predicted molecular weight of 40 – 42 kDa (Fig. 3; see also Fukushima et al., 1998). The signal was competed by the immunizing peptide and was absent when the primary antibody was omitted (Fig. 3). No signal was detected in extracts from lpa1(⫺/⫺) mice brain (not shown). Immunohistochemical studies of adult animals confirmed the absence of the receptor from structurally normal central white matter tracts (Fig. 4A and D). Electron micro-

In the first series of experiments, we measured the levels of 5-HT, dopamine, 5-HT metabolites, dopamine metabo-

Fig. 3. Western analysis of brain extracts with anti LPA1 antibody. Lanes 1, 4, and 7, mouse brain extract; lanes 2, 5, and 8, rat brain extract; lanes 3, 6, and 9, human cerebral cortex extract. Lanes 1–3, anti-LPA1 antibody at 1:1000 dilution; lanes 4 – 6, antibody competition with immunisation peptide at 0.5 mg/ml; lanes 7–9, omission of primary antibody.

S.M. Harrison et al. / Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

lites, and amino acids in five major brain regions of the lpa1(⫺/⫺) mice (Tables 1a and 1b). There was a significant decrease in 5-HT turnover in lpa1(⫺/⫺) mice compared with wild-type (WT) in frontal cortex (F1,10 ⫽ 22.517; P ⫽ 0.0015), hippocampus (F1,10 ⫽ 10.923; P ⫽ 0.0079), hypothalamus (F1,7 ⫽ 14.828; P ⫽ 0.0063), and nucleus accumbens (F1,10 ⫽ 14.092; P ⫽ 0.0038) with a trend toward a slight decrease in the cerebellum (not shown). This corresponded to a significant decrease in the levels of 5-HIAA in lpa1(⫺/⫺) mice compared with WT in these regions: frontal cortex (F1,8 ⫽ 14.258; P ⫽ 0.0054), hippocampus (F1,10 ⫽ 10.855; P ⫽ 0.0088), hypothalamus (F1,7 ⫽ 6.417; P ⫽ 0.0391), nucleus accumbens (F1,10 ⫽ 6.490; P ⫽ 0.0290). There was also a significant but small increase in the levels of dopamine (F1,9 ⫽ 6.169; P ⫽ 0.0348) in lpa1(⫺/⫺) mice compared with WT in the striatum only. In addition, amino acid levels were also evaluated from the same brain regions. No significant changes were observed in

1173

the majority of regions examined with the exception of the hippocampus and frontal cortex (Table 1b). In the frontal cortex significant changes were seen in aspartate and serine. More profound changes, however, were observed in the hippocampus where the levels of a large number of amino acids were reduced with respect to wild-type mice. The highly specific nature of this general decrease in amino acid levels suggests that the lpa1 mutation resulted in either some level of cellular atrophy or developmental decreases in cell number/ size within the hippocampus. Electrophysiological studies in lpa1(⫺/⫺) hippocampus To analyse the nature of the hippocampal changes further, hippocampal slices were prepared from lpa1(⫺/⫺) mice. Extracellular fEPSPs in stratum radiatum of area CA1 were of equivalent size to lpa1(⫹/⫹) littermates, across a range of stimulus intensities (Fig. 5A and B). Paired pulse facilitation within this pathway was also identical in both groups of

Fig. 4. LPA1-like immunoreactivity is present in major white matter tracts of lpa1 wild-type mouse but not the lpa1(⫺/⫺) mouse brain. Immunohistochemistry was performed using an affinity-purified antibody raised against a peptide sequence within the C-terminal portion of the mouse LPA1 protein. In wild-type mice, immunoreactivity was observed in white matter tracts such as corpus callosum (A) and anterior commisure (C). This immunoreactivity was absent in lpa1(⫺/⫺) mice (B and D). Scale bars: 80 ␮m. Abbreviations: aca, anterior commisure; cc, corpus callosum; CPu, caudate putamen; LV, lateral ventricle.

1174

S.M. Harrison et al. / Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

Table 1a Ex vivo neurochemical phenotyping of lpa1(⫺/⫺) mice compared to wild-type littermatesa Amine

Brain region FC

Hipp

KO 5-HIAA 5-HT DA 5-HIAA/5-HT Dopac/DA HVA/DA Dopac/HVA

216.8 ⫾ 10.33 2 631.1 ⫾ 6.006 142.4 ⫾ 119.1 0.344 ⫾ 0.018c2 1.236 ⫾ 0.338 2.244 ⫾ 0.814 0.686 ⫾ 0.096 c

Hypo

WT

KO

268.4 ⫾ 12.66 608.9 ⫾ 19.14 22.42 ⫾ 5.618 0.441 ⫾ 0.014 1.914 ⫾ 0.230 4.328 ⫾ 0.668 0.457 ⫾ 0.034

421.5 ⫾ 42.17 2 487.0 ⫾ 44.41 15.08 ⫾ 4.333 0.876 ⫾ 0.057c2 1.973 ⫾ 0.745 1.620 ⫾ 0.382 1.187 ⫾ 0.199 c

NAC

WT

KO

599.3 ⫾ 33.67 542.9 ⫾ 20.37 25.40 ⫾ 15.40 1.103 ⫾ 0.038 2.171 ⫾ 0.494 2.618 ⫾ 0.613 0.852 ⫾ 0.058

431.0 ⫾ 38.63 2 953.4 ⫾ 69.35 351.6 ⫾ 18.13 0.541 ⫾ 0.060c2 0.274 ⫾ 0.022 0.267 ⫾ 0.044 1.049 ⫾ 0.104 b

Striatum

WT

KO

606.6 ⫾ 62.60 964.0 ⫾ 77.95 420.9 ⫾ 55.40 0.627 ⫾ 0.033 0.276 ⫾ 0.022 0.302 ⫾ 0.030 0.931 ⫾ 0.053

279.2 ⫾ 49.95 2 720.6 ⫾ 60.25 4833.3 ⫾ 697.4 0.371 ⫾ 0.054c2 0.137 ⫾ 0.012 0.125 ⫾ 0.016 1.199 ⫾ 0.177 b

WT

KO

WT

417.1 ⫾ 20.83 679.3 ⫾ 56.89 5876.0 ⫾ 670.8 0.628 ⫾ 0.042 0.115 ⫾ 0.017 0.144 ⫾ 0.010 0.803 ⫾ 0.115

69.42 ⫾ 22.04 242.1 ⫾ 52.98 9880.0 ⫾ 139.0b1 0.782 ⫾ 0.518 0.155 ⫾ 0.008 0.413 ⫾ 0.236 0.897 ⫾ 0.081

65.79 ⫾ 10.18 272.5 ⫾ 35.64 9324.9 ⫾ 167.2 0.249 ⫾ 0.027 0.164 ⫾ 0.005 0.157 ⫾ 0.010 1.059 ⫾ 0.064b

a

Neurochemical indices were assessed in the frontal cortex (FC), hippocampus (HIPP), hypothalamus (HYPO), nucleus accumbens (NAC), and dorsal striatum. Data are mean ⫾ SEM. b P ⬍ 0.050, c P ⬍ 0.010, d P ⬍ 0.001, indicate significant changes in lpa1(⫺/⫺) mice vs. wild-type mice.

Table 1b Ex vivo neurochemical phenotyping of lpa1(⫺/⫺) mice compared to wild-type littermatesa Amino acid

Arg Asp GABA Gln Glu Leu

Brain region FC

Amino acid

Hipp

KO

WT

KO

WT

53.296 ⫾ 1.655 11.406 ⫾ 2.755c2 30.641 ⫾ 1.438 46.665 ⫾ 2.403 124.09 ⫾ 6.518 2.446 ⫾ 0.342

67.118 ⫾ 6.090 21.686 ⫾ 1.675 32.636 ⫾ 1.862 52.245 ⫾ 4.846 139.25 ⫾ 8.294 3.254 ⫾ 0.347

1.574 ⫾ 0.249 2 0.188 ⫾ 0.015b2 1.203 ⫾ 0.149b2 1.586 ⫾ 0.180c2 2.946 ⫾ 0.190 1.003 ⫾ 0.153b1 c

3.916 ⫾ 0.577 0.288 ⫾ 0.035 2.256 ⫾ 0.402 3.012 ⫾ 0.370 3.430 ⫾ 0.180 0.561 ⫾ 0.131

Meth Phen Ser Tau Thr Tyr

Brain region FC

Hipp

KO

WT

KO

WT

0.283 ⫾ 0.021 2.972 ⫾ 0.391 3.225 ⫾ 0.167b2 308.56 ⫾ 13.295 13.023 ⫾ 0.510 11.528 ⫾ 0.364

0.444 ⫾ 0.068 4.167 ⫾ 0.391 3.810 ⫾ 0.168 314.27 ⫾ 18.588 14.888 ⫾ 0.971 13.466 ⫾ 1.228

0.051 ⫾ 0.005 0.075 ⫾ 0.009c2 0.099 ⫾ 0.011 8.982 ⫾ 1.082c2 0.383 ⫾ 0.052b2 0.518 ⫾ 0.067c2

0.058 ⫾ 0.004 0.178 ⫾ 0.032 0.137 ⫾ 0.016 21.820 ⫾ 3.705 0.725 ⫾ 0.128 0.985 ⫾ 0.134

a Neurochemical indices (Arg, arginine; Asp, aspartate; Gln, glutamine; Glu, glutamate; Leu, leucine; Meth, methionine; Ser, serine; Tau, taurine; Thr, threonine; Tyr, tyrosine) are shown for the frontal cortex (FC) and hippocampus (Hipp). b P ⬍ 0.05, c P ⬍ 0.01, indicate significant changes in lpa1(⫺/⫺) mice vs their wild-type counterparts.

animals (Fig. 5C). In addition, analysis of mono-, bi-, and trisynaptic conduction by stimulating the perforant, mossy fiber, and Schaffer collateral commissural pathways while recording in area CA1 revealed no significant difference in latency to response between lpa1(⫺/⫺) and lpa1(⫹/⫹) slices (Fig. 5D). Thus, despite the significant changes in amino acid levels observed in the hippocampus, the targeted mutation of the lpa1 gene does not lead to gross abnormalities of hippocampal synaptic function and may represent more subtle alterations in cellular metabolism and/or size/number of cell types within the hippocampal formation and cortex (Harrison, 1999; Harrison and Eastwood, 2001).

4.11; P ⫽ 0.020]. Analysis of the data for the single sexes revealed that male lpa1(⫺/⫺) exhibit significantly less PPI than their WT littermates at 90 dB/4 kHz [P ⫽ 0.0399], 90 dB/12 kHz [P ⫽ 0.0362], 90 dB/20 kHz [P ⫽ 0.0018]. Female lpa1(⫺/⫺) mice showed significantly less PPI than their WT littermates at 80 dB/12 kHz [P ⫽ 0.0056], 80 dB/20 kHz [P ⫽ 0.0001], 90 dB/12 kHz [P ⫽ 0.0083], 90 dB/20 kHz [P ⫽ 0.0001]. The lpa1-targeted mutation had no effect on startle response (data not shown) and therefore the PPI deficit was unlikely to have been caused by a direct effect in the startle reflex circuit.

Behavioral analysis of lpa1(⫺/⫺) mice

Discussion

In most tests the lpa1(⫺/⫺) mice appeared normal but displayed a slight (⬍10%) decrease in locomotor activity (not shown) and a robust deficit in prepulse inhibition (PPI). Thus, as illustrated in Fig. 6A and B there were significant main effects of strain [F1,36 ⫽ 7.24; P ⫽ 0.011], prepulse dB [F1,36 ⫽ 35.85; P ⬍ 0.001] and of prepulse frequency [F2,72 ⫽ 44.02; P ⬍ 0.001] on PPI. There was no significant effect of sex [F1,36 ⫽ 0.01; P ⫽ 0.914]. There were also significant interactions between prepulse decibels and frequency [F2,72 ⫽ 3.33; P ⫽ 0.041], and between prepulse frequency and strain [F2,72 ⫽

While this study was in progress a similar mouse with a targeted deletion at the lpa1 locus was reported (Contos et al., 2000). The authors showed high neonatal lethality with impaired suckling and suggest that deficits in olfaction may underlie this phenotype. Furthermore, embryonic cerebral cortical neuroblasts derived from the lpa1(⫺/⫺) mice were no longer responsive to LPA in contrast to cells derived from wild-type littermates. Some Schwann cell apoptosis was also detected in the sciatic nerve. The focus of our study was different and the primary

S.M. Harrison et al. / Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

1175

Fig. 5. Baseline synaptic transmission in hippocampal slices prepared from lpa1(⫺/⫺) mice is normal. (A) A schematic diagram of a hippocampal slice showing the position of electrodes used to record field EPSPs in stratum radiatum of area CA1 in response to stimulation in the Schaffer collateral commissural fibres (S), mossy fibre pathway (M), and medial perforant pathway (P). (B) Pooled data showing the magnitude of the fEPSP slope evoked by single shock stimulation to the Schaffer collateral pathway over a range of stimulus intensities in wild-type (n ⫽ 9) and lpa1(⫺/⫺) (n ⫽ 10) slices. Each point represents the mean (⫾ SEM) of the fEPSP slope (normalised to slope of the maximum fEPSP) plotted against the mean (⫾ SEM) of the stimulus intensity (normalised to the stimulus strength required to elicit the maximum fEPSP). The inset graph illustrates the absolute maximum fEPSP slope values in the two populations of slices. (C) Superimposed example traces of fEPSPs recorded in stratum radiatum of area CA1 evoked by two consecutive stimuli (50-ms interstimulus interval) delivered to the Schaffer collateral, mossy fibre, and medial perforant pathways, in wild-type and lpa1(⫺/⫺) slices at an intensity sufficient to elicit a near half maximal fEPSP. The graph on the right shows the mean (⫾ SEM) latency from the second stimulus artefact (blanked for clarity) to the initial downward slope of the second fEPSP.

findings were unexpected. In addition to behavioral changes and widespread deficits in the 5-HT neurotransmitter system, we were initially surprised to observe an anatomically normal central and peripheral nervous system since LPA1 is expressed in neuroepithelia during development and in myelin in the adult. Although we cannot absolutely exclude any of the observed phenotype arising from the loss of LPA1 protein expression from myelin, none of our observations (anatomical or functional) support this (see also Ali et al., SFN Abstracts, 2001) and rather suggest that the phenotype described in the lpa1(⫺/⫺) mice occurs as a result of the developmental loss of LPA1. The gross anatomical defects observed in these animals (body length and craniofacial abnormality) are similar to those reported by Contos et al. (2000) and are most probably due to defects in bone development (unpublished observations). Contos et al. (2000) suggest that the suckling defect of the lpa1(⫺/⫺) mice was responsible for the high

neonatal lethality. While we did not analyse this aspect of the phenotype in depth, we observed that the mice develop incisor overgrowth, which has a major impact on survival due to an inability to feed and would contribute to postnatal death if unattended. In the context of the following discussion it is interesting that subtle dysmorphic craniofacial features have been noted in some cases of schizophrenia (Waddington et al., 1999) and, also, schizophrenic-like psychosis has been observed in velo-cardio-facial syndrome associated with a deletion on chromosome 22q11 (Murphy, 2002) (mouse lpa1 locus is not syntenic with human chromosome 22q). Prepulse inhibition (PPI) in animals and man is thought to reflect sensorimotor gating processes. PPI deficits are apparent in several nervous system disorders including schizophrenia (Braff et al., 1992) and recent studies have shown that mutations in certain genes such

1176

S.M. Harrison et al. / Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

Fig. 6. Prepulse inhibition analysis in lpa1(⫺/⫺) mice. Mice were tested for prepulse inhibition at prepulse intensities of 80 (A) and 90 dB (B) and frequencies of 4, 12, and 20 kHz. After combining the data for sexes, lpa1(⫺/⫺) mutants showed less prepulse inhibition than their C57B1/6 littermates at prepulses of 80 dB/12 kHz [P ⫽ 0.0196], 80 dB/20 kHz [P ⫽ 0.0001], 90 dB/12 kHz [P ⫽ 0.0149], and 90 dB/20 kHz [P ⫽ 0.0002]. Analysis of the data for the single sexes showed that male lpa1(⫺/⫺) mice showed less prepulse inhibition than their C57B1/6 littermates at 90 dB/4 kHz [P ⫽ 0.0039], 90 dB/12 kHz [P ⫽ 0.0362], and 90 dB/20 kHz [P ⫽ 0.0018]. The female lpa1(⫺/⫺) showed significantly less prepulse inhibition than their C57B1/6 littermates at 80 dB/12 kHz [P ⫽ 0.0056], 80 dB/20 kHz [P ⫽ 0.0001], 90 dB/12 kHz [P ⫽ 0.0083], and 90 dB/20 kHz [P ⫽ 0.0001].

as those coding for proline dehydrogenase (Gogos et al., 1999) or reelin (Tueting et al., 1999) can produce deficits in this paradigm. The data reported here show that mutation of the gene coding for LPA1 also caused a deficit in PPI. The underlying changes that occur in behavioural, genetic, or pharmacological models of PPI are poorly understood, not least because the associated circuitry is complex and is thought to include serial and parallel inputs from frontal areas into a pontine startle circuit (Swerdlow et al., 2001). These inputs are subject to monoaminergic modulation (Fletcher et al., 2001, Kehne et al., 1996). Thus, it was interesting to observe in lpa1(⫺/⫺) mice a selective decrease in the 5-HIAA/5-HT ratio (a measure of 5-HT utilisation) in all brain regions analysed except the striatum and cerebellum. This decrease in ratio was primarily due to reduced 5-HIAA levels, a feature observed in schizophrenia and experimental paradigms of the disease. For example, low levels of 5-HIAA were detected in cerebrospinal fluid of pa-

tients displaying behavioural components frequently associated with schizophrenia (aggression, impulsivity, depression, or personality disorders; Depue and Spoont, 1986; Rydin et al., 1982; Asberg et al., 1976). Also, the reduction in 5-HIAA levels is opposite to that observed in the rat medial prefrontal cortex following treatment with antipsychotic drugs. Risperidone and amperozide (and to a lesser extent clozapine and ritanserin) cause elevation of 5-HIAA levels in this brain region with no effect in the striatum (Hertel et al., 1996). Furthermore, clozapine has been shown to elevate both 5-HT and 5-HIAA levels in plasma of schizophrenics (Durson et al., 2000). In addition, reduced 5-HT metabolism has been observed in nucleus accumbens, hippocampus, and prefrontal cortex of rats reared in isolation—a putative developmental model of schizophrenia (Wright et al., 1989; Bickerdike et al., 1993). Pharmacological studies report the effect of enhanced or reduced 5-HT neurotransmission and show that both are able to disrupt PPI (Fletcher et al., 2001, Kehne et al., 1996). Finally, the lpa1-targeted mutation resulted in significant decreases in levels of amino acids in the frontal cortex and hippocampus. Interestingly, rats reared in isolation also show a significant increase in responsiveness to both clozapine and olanzapine in terms of alanine, aspartate, GABA, glutamine, glutamate, histidine, and tyrosine levels in the medial prefrontal cortex (Heidbreder et al., 2000; Robbins et al., 1996). Altogether these findings further support the concept of a hypoactive amino acid system contributing to the aetiology of schizophrenia. In fact, decreased concentrations of glutamate and aspartate have been reported in the prefrontal cortex and hippocampus of schizophrenic patients (Tsai et al., 1995). Furthermore, the activity of N-acetylated alpha-linked acidic dipeptidase (NAALADase), which cleaves N-acetylaspartyl glutamate (NAAG) to N-acetyl aspartate (NAA) and glutamate, appears to be decreased in both the anterior cingulate cortex and hippocampus of schizophrenics (Callicott et al., 2000; Ende et al., 2000). The specific and widespread impact on the 5-HT neurotransmitter system suggests a developmental connection with LPA1-mediated signaling. It is possible that the loss of LPA1 impacts fate decisions for serotonergic neuronal precursors or compromises expression of molecular components that confer serotonergic phenotype. Together with the amino acid changes observed in the hippocampus, this may, at least in part, explain the observed PPI deficit. Thus, the lpa1(⫺/⫺) mouse provides a robust example connecting a developmentally expressed receptor with a phenotype with elements that occur in several psychiatric diseases but with significant similarity to schizophrenia. The impact of lpa1 deletion on the hippocampus is intriguing. Clearly no overt degeneration is apparent and electrophysiological properties of hippocampal neurons and synaptic communication appeared

S.M. Harrison et al. / Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

normal. This remains mechanistically unclear and is currently the focus of further studies.

Experimental methods Animals All experiments were conducted according to the requirements of the United Kingdom Animals (Scientific Procedures) Act (1986) and conformed to GlaxoSmithKline ethical standards. Antibody production, western analysis, and immunohistochemistry Antiserum was generated to a peptide (LAGVHSNDHSVV-amide) at the carboxy terminal of mouse LPA1 (aa 353–364) using the method described in Hervieu et al., 2001. This region shows 100% sequence similarity with rat and human LPA1. For western analysis, brain extracts were resolved by SDS-PAGE and transferred onto PVDF membranes (Pharmacia). The membrane was blocked with 5% low fat milk, 0.5% Tween 20 in PBS, and revealed using the anti-LPA1 antibody at 1:1000, followed by incubation with peroxidase-conjugated secondary antibody (Jackson Laboratories). Bound antibody was detected using the Enhanced ChemiLuminescence kit (Amersham). Immunohistochemistry was carried out using an avidin: biotin amplification technique as previously described (Hervieu et al., 2001). Quantitative mRNA analysis N5F1 lpa1(⫺/⫺), lpa1(⫹/⫺), and wild-type litter mates (two of each genotype) were euthanised by CO2 asphyxia. CNS and peripheral tissues were dissected from each mouse, snap-frozen in liquid nitrogen, and stored at ⫺80°C. The tissue samples were homogenised in 1 ml of TRIzol reagent (Life Technologies Ltd., UK) per 50 mg of tissue. Total RNA extraction and first strand cDNA synthesis were carried out as described previously (Harrison et al., 2001). Forward primer: 5⬘ CGAACAACAGTGCTTCTACAATGAG 3⬘; reverse primer: 5⬘ CTGTGTTCCATTCTGTGGCTAGATAT 3⬘; and Taqman probe: 5⬘ TCCCACTCCGGTTATAAAAGAAGGCGA 3⬘. Targeting of lpa1 gene and generation of mutant mice Gene targeting was performed in E14.1 ES cells by standard methods. For simultaneously knocking-in the lacZ reporter gene and targeted disruption of the lpa1 gene, homologous recombination was designed to result in the replacement of all but the first 51 bp of exon 3 of the lpa1 gene (and therefore almost all the coding regions of the LPA1 and mrec transcripts) with a cassette containing the lacZ gene preceded

1177

by an internal ribosome entry site. Downstream of this is a neomycin-resistance gene cassette. The arms of homology were cloned from a 129SVJ genomic BAC library. The 5⬘ arm is an approximately 4.2-kb BglII-HpaII restriction fragment, where the 5⬘ BglII site lies in intron 2 and the HpaII site lies in exon 3, 102 bp and 48 bp downstream of the LPA1 and mrec 1.3 translation initiation codons, respectively. The 3⬘ arm of homology is an approximately 3.5-kb XbaI/EcoRI restriction fragment from within intron 3. Homologous recombination in neomycin-resistant ES cells was confirmed by Southern blot of BamHI-digested genomic DNA. The 5⬘ probe is an approximately 1.5-kb AccI restriction fragment that has not been mapped accurately, but lies 5⬘ to the 5⬘ arm of homology between the BglII site and BamHI site indicated in Fig. 1. Three targeted clones were injected into C57B16/J-derived blastocysts. Male chimaeras were crossed with C57B16/J females to give N1F0 offspring, which were subsequently intercrossed to generate N1F1 offspring. Genotyping of N1F0 and N1F1 offspring was confirmed by the above Southern blot procedure. In addition N1F0 offspring were successively backcrossed to C57B16/J females to generate N6FO mice. These were intercrossed to create an N6F1 study population. Genotype analysis of mice during backcrossing and for the generation of the N5F1 study population was performed by PCR of tail DNA. Primers were designed to generate PCR products specific to the wild-type locus (common 5⬘ primer intron 2 specific: 5⬘-GGAGTCTTGTGTTGCCTGTCC-3⬘; 3⬘ primer exon 3 specific: 5⬘-GCAAACAGTGATGCCCAGCTC3⬘, giving a product of 224 bp) and targeted locus (common 5⬘ primer intron 2 specific: 5⬘-GGAGTCTTGTGTTGCCTGTCC-3⬘; 3⬘ primer specific to the 5⬘ end of the IRES cassette: 5⬘-CCCTCGAGGTCGACGGTATCG-3⬘; giving a product of 170 bp). Thirty cycles of 94°C (30 s), 60°C (30 s), and 72°C (90 s) were used. Prepulse inhibition The lpa1(⫹/⫺) mice at N6 were interbred to produce the study cohort [10 mice of each sex and genotype (N6F1)] for this study. Mice were housed in individual cages and maintained under a 12-h light:dark cycle with food and water available ad libitum. Testing began when the mice were approximately 9 weeks of age and was repeated in two separate cohorts. Mice were tested using the SHIRPA panel of behavioural tests, which include analysis of LMA, motor balance, analgesia, and prepulse inhibition (Rogers et al., 1997). Each of the 12 test assemblies consisted of a Perspex chamber with a moving base and accelerometer mounted on springs. The test chambers also housed a light and speaker and were isolated by placing each chamber within a sound attenuated chamber. Experimental design was based on that reported previously (Willott et al., 1994) with modifications. Mice were placed in startle chambers and left for a pretrial delay of

1178

S.M. Harrison et al. / Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

approximately 2 min. The mice were then exposed to a series of acoustic stimuli, which were configured in six blocks of trials. The blocks of trials varied according to the frequency of the prepulse; thus two blocks each were allocated to a prepulse of 4, 12, or 20 kHz. Each block was composed of five trials of a prepulse tone 4, 12, or 20 kHz and 80 dB for 10 ms followed by an interstimulus delay of 100 ms followed by a pulse of white noise, 110 dB for 10 ms; and 3 trials of a pulse of white noise, 110 dB for 10 ms. The order of the eight trials within each block was randomised. The house light was on throughout, and there was a constant background of 60 dB white noise. The intertrial delay was set to a minimum of 15 s and maximum of 30 s with the trial condition set to “quiet.” Under these conditions, there was a minimum trial delay of 15 s following the preceding trial after which the next trial was triggered at the moment when the subject was not moving within the following 15 s. Following completion of the session, the protocol was repeated using a prepulse of 90 dB. Brain slice electrophysiology Horizontal hippocampal slices were prepared from lpa1(⫺/⫺) and WT littermate mice using standard techniques (Davies et al., 1990). Extracellular field excitatory postsynaptic potential (fEPSP) recordings were made from stratum radiatum of area CA1 using glass microelectrodes (2– 4 M⍀) filled with aCSF. Concentric platinum iridium bipolar stimulating electrodes (FHC, Bowdoinham, ME, USA) were positioned either in the stratum radiatum of area CA1, the granular layer of the dentate hilus, or the molecular layer of the dentate gyrus. Stimuli comprising square-wave pulses (20 ␮s; 5–30 V) were delivered at a fixed intensity every 30 s and baseline recordings were made for a minimum of 20 min to ensure stationarity of fEPSPs before experiments were initiated. Recordings were made with an AxoClamp-2A amplifier (Axon Instruments, Foster City, CA, USA), digitised, and captured using pClamp7 software (Axon Instruments Ltd.). Data are presented as means ⫾ standard error of the mean (S.E.M.) and n values refer to the number of times a particular experiment was performed, each in a different slice prepared from a different mouse. All experiments and analysis were performed blind with respect to genotype. Neurochemical analysis Upon completion of behavioural testing, female lpa1(⫺/⫺) mouse brain tissue samples were dissected from the dorsal striatum, nucleus accumbens, hippocampus, hypothalamus, cerebellum, and frontal cortex (both left and right hemispheres) and stored at ⫺80°C until assayed. An aliquot (10 ␮l, per mg of tissue) of homogenising buffer (0.1% wt/vol sodium metabisulphite, 0.01% wt/vol EDTA, 0.1% wt/vol L-cysteine, 0.4 M perchloric acid) was added to each sample and sonicated (Soniprep 150; Gallenkamp, Fisons Instruments, Crawley, Sussex). The resulting homogenate was centrifuged (Labofuge 400R, Heraeus Instruments, Germany) at 10,000 rpm, 4°C for 10 min, and 20 ␮l

of supernatant was removed and subsequently analysed using high performance liquid chromatography (HPLC). Chromatographic conditions Dopamine (DA), 5-hydroxytryptamine (5-HT), and metabolites [(3,4-dihydroxyphenylacetic acid (DOPAC), 5-hydroxyindole-3-acetic acid (5-HIAA), homovanillic acid (HVA), 3-methoxytyramine (3-MT), and 5-hydroxytryptophan (5-HTP)] were analysed using an isocratic HPLC system consisting of PU-980 pumps (Jasco, Essex, UK), a Gilson model 234 autosampler (Anachem, Luton, UK) coupled to electrochemical amperometric detector (Decade, Antec-Leyden, Netherlands) fitted with a 3-mm glassy carbon electrode set at ⫹800 mV vs. Ag/AgCl (VT-03, Antec-Leyden, Netherlands). Separations were performed using two 100 ⫻ 4.6 mm i.d. Chromolith Speerod C18 columns connected in series and a mobile phase consisting of 0.07 M KH2PO4, 1.5 mM OSA · Na, 0.1 mM EDTA · Na2 (pH 2.85; adjusted using orthophosphoric acid MeOH and THF (88:11.5:0.5% vol/vol). A flow rate of 2.5 ml/min was used. All data were captured using Waters Millennium (Waters, Elstree, UK). Amino acid samples were prederivatised with napthalene-2,3-dicarboxaldehyde (Dawson et al., 1997). Derivatised samples were analysed using a Waters 2690 HPLC system (Waters, Elstree, UK) composed of a ternary gradient pumping system, an autosampler, and a Waters 474 spectrofluorometric detector. Separations were carried out using a 100 ⫻ 4.6 mm i.d. and a 50 ⫻ 4.6 mm i.d. Chromolith SpeedRod RP 18e columns (Lutterworth, UK) connected in series and a ternary gradient elution profile composed of 50 mM ammonium acetate, acetonitrile, and methanol at a flow rate of 2.5 ml/min. Eluates were detected spectrofluorometrically with excitation and emission wavelengths set at 442 and 480 nm, respectively. Data analysis The levels of substrates in each brain sample were expressed as nanograms per milligram (ng/mg) of tissue. Turnover rates were assessed by calculating the following ratios: DOPAC/DA, HVA/DA, DOPAC/HVA, and 5-HIAA/5-HT. The ex vivo neurochemical phenotype of lpa1(⫺/⫺) mouse vs. wild type was analysed by a one-way analysis of variance (ANOVA) for each brain region and neurochemical parameter. Statistical significance was set at a probability level of 0.05.

Acknowledgments We are grateful to Lesley Rooke and Colin Clapham for genotyping support for study cohorts and also to Drs. Jim Hagan, Carol Scorer, and Declan Jones for valuable discussions and comments.

S.M. Harrison et al. / Molecular and Cellular Neuroscience 24 (2003) 1170 –1179

References Allard, J., Barron, S., Diaz, J., Lubetzki, C., Zalc, B., Schwartz, J.-C., Sokoloff, P.A., 1998. A rat G protein-coupled receptor selectively expressed in myelin-forming cells. Eur. J. Neurosci. 10, 1045–1053. An, S., Dickens, M.A., Bleu, T., Hallmark, O.G., Goetzl, E.J., 1997. Molecular cloning of the human Edg2 protein and its identification as a functional cellular receptor for lysophosphatidic acid. Biochem. Biophys. Res. Commun. 231, 619 – 622. Asberg, M., Traskman, L., Thoren, P., 1976. 5-HIAA in the cerebrospinal fluid. A biochemical suicide predictor? Arch Gen. Psychiatry 33, 1193–1197. Bickerdike, M.J., Wright, I.K., Marsden, C.A., 1993. Social isolation attenuates rat forebrain 5-HT release induced by KCl stimulation and exposure to a novel environment. Behav. Pharmacol. 4, 231–236. Bilder, R.M., 2001. Schizophrenia as a neurodevelopmental disorder. Curr. Opin. Psychiatry 14, 9 –15. Braff, D.L., Grillon, C., Geyer, M.A., 1992. Sensorimotor gating and schizophrenia. Arch. Gen. Psychiatry 49, 206 –215. Callicott, J.H., Bertolino, A., Egan, M.F., Mattay, V.S., Langheim, F.J., Weinberger, D.R., 2000. Selective relationship between prefrontal Nacetylaspartate measures and negative symptoms in schizophrenia. Am. J. Psychiatry 157, 1646 –1651. Contos, J.J., Fukushima, N., Weiner, J.A., Kaushal, D., Chun, J., 2000. Requirement for the lpA1 lysophosphatidic acid receptor gene in normal suckling behavior. Proc. Natl. Acad. Sci. USA 97, 13384–13389. Davies, C.H., Davies, S.N., Collingridge, G.L., 1990. Paired-pulse depression of monosynaptic GABA-mediated inhibitory postsynaptic responses in rat hippocampus. J. Physiol. 424, 513–531. Dawson, L.A., Stow, J.M., Palmer, A.M., 1997. Improved temporal resolution of microdialysis measurement of glutamate and aspartate using capillary electrophoresis with laser induced fluorescence detection. J. Chromatogr. B. 694, 455– 460. Depue, R.A., Spoont, M.R., 1986. Conceptualizing a serotonin trait. Ann. NY Acad. Sci. 487, 47– 62. Dursun, S.M., Szemis, A., Andrews, H., Whitaker, P., Reveley, M.A., 2000. Effects of clozapine and typical antipsychotic drugs on plasma 5-HT turnover and impulsivity in patients with schizophrenia: a crosssectional study. J. Psychiatry Neurosci. 25, 347–352. Ende, G., Braus, D.F., Walter, S., Weber-Fahr, W., Soher, B., Maudsey, A.A., Henn, F.A., 2000. Effects of age, medication, and illness duration on the N-acetyl aspartate signal of the anterior cingulate region in schizophrenia. Schizophr. Res. 41, 389 –395. Fletcher, P.J., Phil, D., Selhi, Z.F., Azampanah, A., Sills, T.L., 2001. Reduced brain serotonin activity disrupts prepulse inhibition of the acoustic startle reflex: effects of 5,7-dihydroxytryptamine and p-chlorophenylalanine. Neuropsychopharmacology 24, 399 – 409. Fukushima, N., Kimura, Y., Chun, J., 1998. A single receptor encoded by vzg-1/lpa1/edg-2 couples to G proteins and mediates multiple cellular responses to lysophosphatidic acid. Proc. Natl. Acad. Sci. USA 95, 6151– 6156. Fukushima, N., Weiner, J.A., Chun, J., 2000. Lysophosphatidic acid (LPA) is a novel extracellular regulator of cortical neuroblast morphology. Dev. Biol. 228, 6 –18. Gogos, J.A., Santha, M., Takacs, Z., Beck, K.D., Luine, V., Lucas, L.R., Nadler, J.V., Karayiorgou, M., 1999. The gene encoding proline dehydrogenase modulates sensorimotor gating in mice. Nat. Genet. 21, 434 – 439. Handford, E.J., Smith, D., Hewson, L., McAllister, G., Beer, M., 2001. Edg2 receptor distribution in adult rat brain. Neuroreport 12, 757– 760. Harrison, D.C., Davis, R.P., Bond, B.C., Campbell, C.A., James, M.F., Parsons, A.A., Philpott, K.L., 2001. Caspase mRNA expression in a rat model of focal cerebral ischemia. Mol. Brain. Res. 89, 133–146. Harrison, P.J., 1999. The neuropathology of schizophrenia: a critical review of the data and their interpretation. Brain 122, 593– 624.

1179

Harrison, P.J., Eastwood, S.L., 2001. Neuropathological studies of synaptic connectivity in the hippocampal formation in schizophrenia. Hippocampus 11, 508 –519. Hecht, J.H., Weiner, J.A., Post, S.R., Chun, J., 1996. Ventricular zone gene-1 (vzg-1) encodes a lysophosphatidic acid receptor expressed in neurogenic regions of the developing cerebral cortex. J. Cell Biol. 135, 1071–1083. Heidbreder, C.A., Weiss, I., Domeney, A., Pryce, C., Homberg, J., Hedou, G., Feldon, J., Moran, M.C., Nelson, P., 2000. Behavioral, neurochemical, and endocrinological characterization of the early social isolation syndrome. Neuroscience 100, 749 –768. Hertel, P., Nomikos, G., Iurlo, M., Svensson, T.H., 1996. Risperidone: regional effects in vivo on release and metabolism of dopamine and serotonin in the rat brain. Psychopharmacology 124, 74 – 86. Hervieu, G.J., Cluderay, J.E., Harrison, D.C., Roberts, J.C., Leslie, R.A., 2001. Gene expression and protein distribution of the Orexin-1 receptor in the rat brain and spinal cord. Neuroscience 103, 777–797. Kehne, J.H., Padich, R.A., McCloskey, T.C., Taylor, V.L., Schmidt, C.J., 1996. 5-HT modulation of auditory and visual sensorimotor gating: I. Effects of 5-HT releasers on sound and light prepulse inhibition in Wistar rats. Psychopharmacology 124, 95–106. Kozlovsky, N., Belmaker, R.H., Agam, G., 2002. GSK-3 and the neurodevelopmental hypothesis of schizophrenia. Eur. Neuropsychopharmacol. 12, 13–25. McIntyre, T.M., Ponstler, A.V., Silva, A.R., St. Hilaire, A., Xu, Y., Hinshaw, J.C., et al., 2003. Identification of an intracellular receptor for lysophosphatidic acid (LPA): LPA is a transcellular PPAR␥ agonist. Proc. Natl. Acad. Sci. USA 100, 131–136. Murphy, K.C., 2002. Schizophrenia and velo-cardio-facial syndrome. Lancet 359, 426 – 430. Noguchi, K., Ishii, S., Shimizu, T., 2003. Identification of p2y9/GPR23 as a novel protein-coupled receptor for lysophosphatidic acid, structurally distant from the Edg family. J. Biol. Chem. 278, 25600 –25606. Robbins, T.W., Jones, G.H., Wilkinson, L.S., 1996. Behavioural and neurochemical effects of early social deprivation in the rat. J. Psychopharmacol. 10, 39 – 47. Rogers, D.C., Fisher, E.M.C., Brown, S.D.M., Peters, J., Hunter, A.J., Martin, J.E., 1997. ‘SHIRPA’—a comprehensive behavioural and functional analysis of mouse phenotype. Mamm. Genome 8, 711–713. Rydin, E., Schalling, D., Asberg, M., 1982. Rorschach ratings in depressed patients and suicidal patients with low levels of 5-hydroxyindoleacetic acid in cerebrospinal fluid. Psychol. Res. 7, 229 –243. Stefansson, H., Sigurdsson, E., Steinthorsdottir, V., Bjornsdottir, S., Sigmundsson, T., Ghosh, S., et al., 2002. Neuregulin 1 and susceptibility to schizophrenia. Am. J. Hum. Genet. 71, 877– 892. Swerdlow, N.R., Geyer, M.A., Braff, D.L., 2001. Neural circuit regulation of prepulse inhibition of startle in the rat: current knowledge and future challenges. Psychopharmacology 156, 194 –215. Tsai, G., Passani, L.A., Slusher, B.S., Carter, R., Baer, L., Kleinman, J.E., Coyle, J.T., 1995. Abnormal excitatory neurotransmitter metabolism in schizophrenic brains. Arch. Gen. Psychiatry 52, 829 – 836. Tueting, P., Costa, E., Dwivedi, Y., Guidotti, A., Impagnatiello, F., Manev, R., Pesold, C., 1999. The phenotypic characteristics of heterozygous reeler mouse. Neuroreport 10, 1329 –1334. Waddington, J.L., Lane, A., Scully, P., Meagher, D., Quinn, J., Larkin, C., O’Callaghan, E., 1999. Early cerebro-craniofacial dysmorphogenesis I schizophrenia: a lifetime trajectory model from neurodevelopmental basis to ‘neuroprogressive’ process. J. Psychiatr. Res. 33, 477– 489. Willott, J.F., Carlson, S., Chen, H., 1994. Prepulse inhibition of the startle response in mice: relationship to hearing loss and auditory system plasticity. Behav. Neurosci. 108, 1039 –1046. Wright, I.K., Crespi, F., Marsden, C.A., Jones, G.H., Robbins, T.W., 1989. Effect of isolation-rearing on 5-HT release in the frontal cortex. J. Neurosci. Methods 29, 283. Yang, A.H., Ishii, I., Chun, J., 2002. In vivo roles of lysophospholipid receptors revealed by gene targeting studies in mice. Biochim. Biophys. Acta 1582, 197–203.