MAP kinase gene STK1 is required for hyphal, conidial, and appressorial development, toxin biosynthesis, pathogenicity, and hypertonic stress response in the plant pathogenic fungus Setosphaeria turcica

Journal of Integrative Agriculture 2016, 15(12): 2786–2794 Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

MAP kinase gene STK1 is required for hyphal, conidial, and appr­e­ ssorial development, toxin biosynthesis, pathogenicity, and hypertonic stress response in the plant pathogenic fungus Setosphaeria turcica LI Po1, 2*, GONG Xiao-dong1*, JIA Hui1*, FAN Yong-shan1, 3, ZHANG Yun-feng1, 3, CAO Zhi-yan1, HAO Zhi-min1, HAN Jian-min1, GU Shou-qin1, DONG Jin-gao1 1

Mycotoxin and Molecular Plant Pathology Laboratory, Agricultural University of Hebei, Baoding 071000, P.R.China Institute of Plant Protection, Hebei Academy of Agriculture and Forestry Sciences, Baoding 071000, P.R.China 3 Tangshan Normal University, Tangshan 063000, P.R.China 2

Abstract The mitogen-activated protein kinase (MAPK), a key signal transduction component in the MAPK cascade pathway, regulates a variety of physiological activities in eukaryotes. However, little is known of the role MAPK plays in phytopathogenic fungi. In this research, we cloned the MAPK gene STK1 from the northern corn leaf blight pathogen Setosphaeria turcica and found that the gene shared high homology with the high osmolality glycerol (HOG) MAPK gene HOG1 of Saccharomyces cerevisiae. In addition, gene knockout technology was employed to investigate the function of STK1. Gene knockout mutants (KOs) were found to have altered hyphae morphology and no conidiogenesis, though they did show similar radial growth rate compared to the wild-type strain (WT). Furthermore, microscope observations indicated that STK1 KOs did not form normal appressoria at 48 h post-inoculation on a hydrophobic surface. STK1 KOs had reduced virulence, a significantly altered Helminthosporium turcicum (HT)-toxin composition, and diminished pathogenicity on the leaves of susceptible inbred corn OH43. Mycelium morphology appeared to be significantly swollen and the radial growth rates of STK1 KOs declined in comparison with WT under high osmotic stress. These results suggested that STK1 affects the hyphae development, conidiogenesis, and pathogenicity of S. turcica by regulating appressorium development and HT-toxin biosynthesis. Moreover, the gene appears to be involved in the hypertonic stress response in S. turcica. Keywords: Setosphaeria turcica, MAPK, conidiogenesis, HT-toxin, pathogenicity

Received 25 January, 2016 Accepted 25 August, 2016 LI Po, Tel: +86-312-7528142, E-mail: [email protected]; GONG Xiao-dong, Tel: +86-312-7528142, E-mail: gxdjiy123@ gmail.com; JIA Hui, Tel: +86-312-7528260, E-mail: shmjiahui@ hebau.edu.cn; Correspondence GU Shou-qin, Tel: +86-3127528142, E-mail: [email protected]; DONG Jin-gao, Tel: +86312-7528266, E-mail: [email protected] * These authors contributed equally to this study. © 2016, CAAS. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/) doi: 10.1016/S2095-3119(16)61472-7

1. Introduction Setosphaeria turcica (anamorph Exserohilum turcicum, syn. Helminthosporium turcicum), the causal agent of northern corn leaf blight (NCLB), has caused severe damage to corn production around the world, particularly in areas with moderate temperature and high humidity (Raymundo and Hooker 1981; Perkins and Pedersen 1987). However, little is known about the pathogenic mechanism of the fungus to

LI Po et al. Journal of Integrative Agriculture 2016, 15(12): 2786–2794

date. Thus, we constructed a molecular genetic platform for identifying the genes responsible for vegetative growth, conidiogenisis, and pathogenesis in S. turcica. In plant pathogenic fungi, conidia infect plant tissues by germinating and developing appressoria, dome-shaped and melanin-pigmented infection structures (Hamer et al. 1988; Cho et al. 2012; Leroch et al. 2013; Serrano et al. 2014). Appressoria attach firmly to the host surface and generate enormous turgor pressure to rupture the cuticle layer (Howard et al. 1991; Nesher et al. 2008). In S. turcica, upon entering corn tissues, infection hyphae grow into host epidermal cells and secrete a chemical factor called HT-toxin, the name of which was derived from the alternative species name - H. turcicum (Raistrick et al. 1936), which is a chemical mixture of low molecular weight that is poisonous to host cells. Consequently, clarifying the molecular mechanism of appressorium formation and HT-toxin production is crucial for understanding the pathogenicity of the fungus and development of the disease. At present, the breeding of resistant cultivars and application of fungicide have not led to the control of NCLB; this is because the broad genetic diversity of S. turcica results in rapid race differentiation and threatens the resistance of current corn cultivars containing the resistant genes Ht1, Ht2, Ht3, and HtN (Zhang et al. 2011). Moreover, changes in HT-toxin components across different fungal races have induced a variety of resistance levels in host plants and influenced the effect of fungicides. In previous research, we found that the selective toxin fraction in HT-toxin, which was specifically virulent against corn with the Ht1 resistance gene from S. turcica race 1, played an essential role in fungal pathogenicity (Fan et al. 2007). Thus, illuminating the regulatory mechanisms of HT-toxin production will be a significant step in elucidating the pathogenicity mechanisms of S. turcica. Interactions between the pathogen and host plant include specific extracellular recognition, intracellular signal transduction, and a series of physiological reactions and metabolic processes (Flaishman and Kolattukudy 1994; Serrano et al. 2014). Extracellular physical and/or chemical signals from the plant surface trigger the chain reactions that occur between the pathogen and host cells, eventually affecting disease establishment (Podila et al. 1993; Serrano et al. 2014). Molecular biological analysis showed that cyclic adenosine monophosphate (cAMP) and the catalytic subunit of protein kinase A (CPKA) signaling pathways were involved in cell surface recognition and appressorium turgor generation in several fungal pathogens (Mitchell and Dean 1995; Thines et al. 2000; Shen et al. 2013). In addition, the mitogen-activated protein kinase (MAPK) cascade pathway was found to regulate conidiogenesis, appressorium development, and infectious hyphal growth (Xu and Hamer 1996; Thines et al. 2000; Moriwaki et al. 2007). Some reports

2787

have highlighted the MAPK cascade pathway as essential in mediating important aspects of phytopathogenic fungi, such as growth, differentiation, osmoregulation, and cell wall biosynthesis (Hou et al. 2002; Schamber et al. 2010; Zheng et al. 2012; Yong et al. 2013). However, functions of MAPK genes, the pivotal components of the MAPK pathway, appear to differ across diverse phytopathogenic fungi. In our previous research, we documented that the MAPK pathway regulated conidium germination, appressorium development, HT-toxin activity, and virulence against corn leaves through the extracellular signal-regulated kinase (MEK)-specific inhibitor U0126 (Fan et al. 2007, 2008). In the present study, we further cloned the MAPK gene STK1 and analyzed its functional significance in S. turcica using gene knockout technology. This research provides insight into the mechanism of MAPK signaling and possible fungicidal active sites in this pathogen.

2. Materials and methods 2.1. Fungal strains and culture conditions The strains used in this study were S. turcica wild-type strain 01-23 (WT) and STK1 knockout mutants (KOs) ΔSTK1-1 and ΔSTK1-2. The mycelium was cultured in potato dextrose (PD) medium shaken at 100 r min–1 and 25°C for 10 d before being harvested for extraction of genomic DNA and total RNA. The protoplasts were prepared using a spore suspension, which was cultured for 14 d in patato dextrose agar (PDA) medium and harvested with sterile water as described in our previous experiment (Zhang et al. 2012). Conidia counting and appressoria induction were performed by culturing the strains on PDA medium in darkness for 14 d and harvesting with 10 mL sterile water in each Petri dish. Crude HT-toxin was extracted by culturing fungal strains in Fries medium. All experiments were repeated at least three times with identical results.

2.2. Nucleic acid isolation and analysis Genomic DNA was extracted from lyophilized ground mycelia of monoconidial isolates using the cetyltriethyl ammonium bromide (CTAB) method. The 10 µg of DNA were digested with appropriate enzymes (SalI, SacII, KpnI) and subjected to Southern hybridization as described in standard protocols using a nonisotopic DIG-dUTP Labeling Kit (Boehringer Mannheim, Mannheim, Germany) in accordance with the manufacturer’s instructions. Total RNA was prepared with UNIQ-10 Trizol Total RNA Extraction Kit (Sangon, Shanghai, China). Full first-strand cDNA was synthesized with Reverse Transcriptase M-MLV Protocol (Promega, USA) according to the manufacturer’s instructions. Phylogenetic and sequence

2788

LI Po et al. Journal of Integrative Agriculture 2016, 15(12): 2786–2794

analyses were conducted using the neighbor-joining (NJ) method by MEGA 5.0 and Clustalx 2.1.

2.3. Transformation-mediated gene disruption The knockout strategy used in the present study was based on the method of Ruiz-Roldán (2001). An upstream fragment of STK1 (STK1-L) was amplified with forward (GGCACCACTTTTGAGATTACG) and reverse (GCCTC GAGGTCAGCAGACGG) primers. A downstream fragment (STK1-R) was amplified with forward (CGGAGCTTTTG GGCACTCCT) and reverse (CCTGTGCGGCTGCATC GACA) primers. After purification with the TaKaRa DNA Fragment Purification Kit ver. 2.0 (Sangon), STK1-L and STK1-R were cloned into the vector pAN7-1 (Punt et al. 1987) containing the hygromycin resistance gene HPH as a selective marker. The resulting plasmid was used to transform WT protoplasts of S. turcica. The transformed protoplasts were incubated in hygromycin medium (1.2% w/v agar in water containing 70 μg mL–1 hygromycin B) at 25°C for 6–7 d until hygromycin-resistant transformants were observed. All transformants were individually preserved and subjected to verification of KOs by PCR (forward primer: ATCGTTATGTTTATCGGCACTTT; reverse primer: ACTATCGGCGAGTACTTCTACACAG), RT-PCR (forward primer: CGTAGAGACGTAGCCCGTCATCTGG; reverse primer: CTCTACCAGATTTTGCGTGGGCTGA), and Southern blotting with specific STK1 fragments (forward primer: CAGCCCCTCCGAGTCCAGTAAAAT; reverse primer: CCCGCGCTCCAGATGTCCAC) and HPH fragments (forward primer: ATCGTTATGTTTATCGGCACTTT; reverse primer: ACTATCGGCGAGTACTTCTACACAG).

2.4. Detection of growth rates, conidial yield, and microscopic observation of hyphal morphology Colony growth rate and conidial yield were monitored using a method established in our previous report (Zhang et al. 2012; Gu et al. 2014). To compare hyphal morphology on PDA medium, WT and KOs were inoculated onto PDA medium and incubated for 15 d at 25°C. Hyphal morphologies were observed using a microscope (Nikon eclipse E-200).

2.5. Appressorium development assay In order to observe appressorium development, a small amount of mycelium or/and conidial suspension was suspended in 0.5 mL of PD medium and placed onto sterile glass slides. The slides were incubated at 25°C in dishes lined with moist Whatman 3 paper and then covered and sealed with Parafilm. At 48 h post-incubation (hpi), the appressoria were observed and photographed using

phase-contrast optics.

2.6. Pathogenicity test Mycelia and conidia suspensions of WT and KOs were prepared using a glass-glass homogenizer. Tween 20 was added to the suspension to a final concentration of 0.1%. Approximately 5 mL of the suspension was inoculated into new, fully developed leaves of 4-wk-old susceptible corn seedlings (OH43). The seedlings were incubated in moist chambers for 24 h and then transferred to a growth chamber at 25°C with a 12-h photoperiod using fluorescent lamps.

2.7. HT-toxin isolation, HPLC analysis, and toxicity assay After 21 d of culture in 150 mL of Fries medium in the dark at 25°C, mycelia were filtered away with 4-layer gauze. The filtrate was centrifuged twice (2 000×g, 10 min) to remove debris and conidia, and the supernatant was extracted with an equal volume of acetic ether ethyl acetate (AEEC) at 25°C and 200 r min–1 for 12 h. The water-soluble extract was further extracted 3 times with equal volumes of ethyl acetate (AEEC) before the AEEC phases were pooled and dried by evaporation. The residue was dissolved in 1 mL methanol and used in the subsequent HPLC analysis and toxicity assay, as described previously (Fan et al. 2008). To detect HT-toxin activity, 20 μL HT-toxin extract was dropped onto 4-wk-old punctured corn leaves incubated at 25°C in dishes with moist Whatman 3 paper, with methanol used as the mock negative control. Excised corn leaves of OH43 were incubated at 25°C and observed 48 hpi, and the lesions were characterized as previously described (Fan et al. 2008).

2.8. Detection of colony growth rate and hyphal morphology under hyperosmotic stress To assess the effect of hyperosmotic stress on colony growth rate and hyphal morphology, WT and KOs were cultured on PDA medium containing 1 mol L–1 KCl, 1 mol L–1 LiCl, and 2 mol L–1 D-sorbitol in the dark at 25°C. Colony growth rate of WT and KOs were measured from d 4 to d 7. Hyphal morphology was observed using a microscope (Nikon eclipse E-200). Three replicates were performed of all above experiments.

3. Results 3.1. Characterization of STK1 A nested-primer PCR strategy and rapid amplification of

LI Po et al. Journal of Integrative Agriculture 2016, 15(12): 2786–2794

cDNA ends (RACE) were employed to amplify the cDNA sequence of STK1 from WT S. turcica. The cDNA sequence, which contained a 1 071-bp open reading frame (ORF) and encoded a putative 356-amino acid protein, was then cloned. In addition, a 1 506-bp genomic DNA sequence was obtained, and sequence analysis showed that 8 introns, of length 53, 51, 50, 51, 76, 49, 48, and 57 bp, existed in the genomic DNA sequence. The gene, designated as STK1, was deposited in GenBank under the accession number AY849317. Southern blotting analysis indicated that STK1 was present as a single copy in the WT strain (data not shown). To investigate the evolutionary relationships between Stk1 in S. turcica and several MAPK members in other model fungi (S. cerevisiae, Magnaporthe oryzae, Ustilago maydis, and Botrytis cinerea), an unrooted tree was constructed by MEGA5.0 from alignments of the full MAPK amino acid sequences using the NJ method. Phylogenetic analysis showed that there were four typical MAPK clades in fungi: Hog1 homologs, Fus1/Kss1 homologs, Slt2 homologs, and Ime2 homologs. Stk1 was classified in the MAPK subgroup of Hog1 homologs (Fig. 1-A). Amino acid sequence alignment showed that the Stk1 protein contained conserved protein kinase subdomains, as well as TGY and DLK motifs, known for containing phosphorylation and active sites, respectively, in fungi (Fig. 1-B). A

2789

3.2. Disruption of STK1 and confirmation of KOs The strategy used in the present study followed that of RuizRoldán (2001) with slight changes. Upstream (STK1-L) and downstream (STK1-R) fragments of STK1 and HPH (hygromycin phosphotransferase) were amplified with corresponding primers and the fragments were linked in multiple endonuclease sites of the vector pAN7-1 (Ruiz-Roldan et al. 2001) (Fig. 2-A). The recombination vector was introduced into the protoplast of WT S. turcica with PEG4000. A total of 246 resistant transformants were obtained after culturing on PDA medium containing 70 μg mL–1 hygromycin B. Of these, 50 resistant strains were further confirmed by PCR with HPH-specific and STK1-specific primers. An 800-bp fragment based on HPH was present in ΔSTK1-1 and ΔSTK1-2 but not in the WT strain (Fig. 2-B). In contrast, a 1 100-bp fragment based on STK1 was detected in the WT strain but not in the ΔSTK1-1 and ΔSTK1-2 mutants (Fig. 2-B). Furthermore, RT-PCR analysis revealed that STK1 was no longer active in the mutants (Fig. 2-B). Southern blotting revealed that STK1 was replaced with a single copy of HPH inserted into the genomic DNA of the mutants (data not shown). These results validated that two STK1 knockout mutants, ΔSTK1-1 and ΔSTK1-2, were obtained. Notably, there was no significant difference between the two mutants in characteristics such as colony and my-

B UmKss1-2 UmKss1-1 72 BcKss1 67 99 MoKss1 95 ScFus3 ScKss1 66 UmSlt2-2 ScSlt2 55 UmSlt2-1 97 87 BcSlt2 70 100 MoSlt2 ScHog1 Umhog1 100 Stk1 55 BcHog1 59 67 MoHog1 ScSmk1 UmIme2 ScIme2 100 BcIme2 42 100 MoIme2 33

StStk1 1 Umhog1 1 BcHog1 1 ScHog1 1 MoHog1 1

StStk1 61 Umhog1 88 BcHog1 88 ScHog1 91 MoHog1 88

StStk1 151 Umhog1 178 BcHog1 178 ScHog1 181 MoHog1 178

StStk1 241 Umhog1 268 BcHog1 268 ScHog1 271 MoHog1 268

StStk1 318 Umhog1 345 BcHog1 345 ScHog1 361 MoHog1 345

0.1

Fig. 1 Phylogenetic and sequence analysis of Stk1 according to amino acid sequences from Setosphaeria turcica and other representative fungi. A, phylogenetic analysis of mitogen-activated protein kinases selected from typical fungi, such as Ustilago maydis, Saccharomyces cerevisiae, S. turcica, Botrytis cinerea, and Magnaporthe oryzae. B, sequence analysis of Stk1 and its homologs from other fungi: UmHog1 from U. maydis, ScHog1 from S. cerevisiae, Stk1 from S. turcica, ScHog1 from B. cinerea, and MoHog1 from M. oryzae. Sequence alignment and phylogenetic tree construction were performed using neighbor-joining (NJ) method by MEGA 5.0 and Clustalx 2.1. Amino acids with ≥90% conservation are colored, and boxes highlight the active site of the DLK motif (–D[L/I/V]K–) and the phosphorylation site of the TGY motif (–TGY–).

2790

LI Po et al. Journal of Integrative Agriculture 2016, 15(12): 2786–2794

A Wild type genomic DNA Targeting vector

STK1-L STK

STK1-R

ΔSTK1-1 STK1-L

HPH STK1-R Homologous recombination

Mutant genomic DNA

B

STK1-L

HPH

STK1-R

ΔSTK1-2

WT

STK1 (PCR) HPH (PCR) STK1 (RT-PCR)

Fig. 2 Targeted gene mutation strategy for STK1 and confirmation of STK1 knockout mutants (KOs) in S. turcica. A, strategy of STK1 knockout. B, confirmation of STK1 knockout mutants. STK1-specific PCR, HPH (hygromycin phosphotransferase)-specific PCR, and STK1-specific RT-PCR were conducted in the experiment. The 1 100-bp fragment amplified using STK1-specific PCR primers could be identified in wild-type strain (WT) but not in the ΔSTK1-1 and ΔSTK1-2 mutants. An 800-bp fragment was amplified by HPH-specific PCR primers in ΔSTK1-1 and ΔSTK1-2 but not in WT. There was a 250-bp fragment amplified with STK1 transcript-specific primers in WT that was not found in ΔSTK1-1 and ΔSTK1-2 mutants.

celium morphology, appressorium formation, bioactivity and components of HT-toxin, and pathogenicity. Thus, the results above on ΔSTK1-1 and ΔSTK1-2 are given interchangeably.

3.3. STK1 is essential for hyphal morphology and conidiogenesis but not for colony growth rate To confirm whether STK1 was involved in regulating the growth and development of S. turcica, morphologies of the colonies, hyphae, and conidia in KOs were compared with those of WT. The two KOs displayed identical phenotypes which differed significantly from WT. Colony color of the KOs was light gray, while that of WT was dark brown. KOs presented with poorly developed, moist, adhered aerial hyphae in the center of the colony, while WT exhibited well-developed, long aerial hyphae across the whole colony (Fig. 3-A). In contrast, statistical data showed that the KOs revealed similar growth rates to WT under the same culture conditions (Fig. 3-B). Microscope observations demonstrated that most hyphae in the central region of mutant colonies exhibited cell deformation and light cell color, a significant contrast to WT (Fig. 3-A). Moreover, most mycelium cells showed signs of internal autolysis or breakdown, a finding that was clearly abnormal compared with WT (Fig. 3-A). Also, no conidia were observed when KOs were inoculated on PDA medium for 3–4 wk, whereas WT produced 5×105 spores per petri dish (Fig. 3-C). Thus, the results indicate that STK1 regulates hyphal morphology as well as conidium yield, but does not regulate growth rate in colonies of S. turcica.

3.4. STK1 is necessary for appressorium formation, bioactivity of HT­toxin, and pathogenicity of S. turcica To evaluate whether STK1 is essential for pathogenicity,

corn leaves were inoculated with mycelial suspensions of KOs and WT, because the KOs did not produce conidia. 3 wk after inoculation, almost 70% of susceptible corn (inbred OH43) exhibited typical fusiform lesions after exposure to WT, while no lesions were detected after inoculation with any of the KOs, even 4 wk after inoculation (Fig. 4-A). This indicates that STK1 is required for pathogenesis of S. turcica on susceptible hosts. To further investigate the effects of STK1 knockout on the pathogenicity of the pathogen, an appressorium development assay was performed on a natural hydrophobic surface. The results showed that the WT strain formed appressoria at 12 hpi on onion epidemics, while no appressoria were detected in the KOs under the same conditions, even at 48 hpi (data not shown). These results suggest that STK1 controls appressorium development in S. turcica. To further elucidate the possible pathogenesis of S. turcica, the virulence and the components of HT-toxin from KOs and WT were assessed. Virulence analysis revealed that HT-toxin extracted from the mutants did not cause any necrotic lesions on excised corn leaves, and the lesions were similar to those caused by methanol alone, which was used as a solvent in the experiment. However, HT-toxin extracted from WT caused obvious necrotic lesions, similar to those caused by WT inoculated on susceptible corn leaves (Fig. 4-B). HPLC analysis revealed four main peaks (Fig. 4, I–IV), with obvious differences between the WT and mutant strains in the peak areas (especially in peak II), indicating that HT-toxin composition of the KOs significantly differed from that of WT (Fig. 4-C). The above results revealed that STK1 is also involved in the biosynthesis of HT-toxin, which is a vital virulence factor in S. turcica. STK1 regulates not only appressorium formation but also the bioactivity of the HT-toxin, two main factors affecting the overall pathogenicity of S. turcica.

2791

LI Po et al. Journal of Integrative Agriculture 2016, 15(12): 2786–2794

WT

ΔSTK1-1

B Colony diameter (cm)

A

Colony

Wild type ΔSTK1-1

7 6 5 4 3 2 1 0

4

5

6

Conidial number (mL)

C

Hypha

7 8 Days (d)

9

10

8 000 7 000 6 000 5 000 4 000 3 000 2 000 1 000 0 –1 000

WT

ΔSTK1-1

Fig. 3 Observation of the growth and development of colonies, hyphae, and conidiospores of STK1 KO and WT strains of Setosphaeria turcica on patato dextrose agar (PDA) medium. A, colony growth of ΔSTK1-1 and WT on PDA medium for 14 d and microscopic observation (10×40) of hyphal development under the same culture conditions. B, colony growth rates of ΔSTK1-1 and WT. C, yield of conidiospores from ΔSTK1-1 and WT on PDA medium. Data are means±SE. The same as in Fig. 5. II

C

A

III

IV

WT 800

I

600 400 200 B

ΔSTK1-1

WT

ΔSTK1-1

300 250

CK

WT ΔSTK1-1

200 150 100 50 0

0

5

10

15

20

25

30

Fig. 4 Analysis of changes in pathogenicity and Helminthosporium turcicum (HT)-toxin virulence and composition of STK1 KO and WT strains of S. turcica. A, typical fusiform lesions were detected on the leaves of susceptible corn (inbred OH43) inoculated with WT, while no lesions were seen on the leaves inoculated with ΔSTK1-1 after 3 wk. B, virulence analysis of HT-toxin. HTtoxin of WT caused necrotic lesions on the excised corn leaves, while HT-toxin of ΔSTK1-1 did not produce necrotic lesions. The lesions produced were similar to those caused by methanol, the control. C, high performance liquid chromatography (HPLC) analysis of HT-toxins of WT and ΔSTK1-1. Four peaks named I to IV changed significantly upon gene knockout, suggesting that the components of HT-toxin from ΔSTK1-1 differed from those of WT and that STK1 is therefore involved in the biosynthesis of HT-toxin in S. turcica.

2792

LI Po et al. Journal of Integrative Agriculture 2016, 15(12): 2786–2794

3.5. STK1 is involved in hypertonic stress response

cascade pathway and found that they are crucial regulatory factors involved in controlling the growth and development of fungi. Phenotypes of HOG1-like gene knockout mutants, however, display some discrepancies. For example, M. grisea osm1 mutants produced normal conidia and appressoria (Motoyama et al. 2005). A Mycosphaerella graminicola mghog1 mutant failed to switch to filamentous growth on water agar plates, melanize, and form infectious germ tubes (Mehrabi et al. 2006). B. cinerea bcsak1 mutants were found to be significantly impaired in vegetative development, such as demonstrating blocked conidia formation and increased sclerotial formation (Segmuller et al. 2007). In our research, STK1 KOs appeared to have altered hyphal morphology and no conidial development, though they exhibited a similar radial growth rate compared with WT. Thus, this suggests that HOG1 homologs are involved in regulating a great many aspects of growth and development, though their functions in different fungi seem to be diverse. A possible reason for this is that MAPK signaling acts as a hub in controlling the growth and development of fungi; the exact regulatory mechanisms should be identified in future research. Recent reports have also indicated that the function of HOG1 homologs in pathogenesis differs drastically among plant pathogens. On the one hand, for OSC1 of Coletotrichum lagenarium, OSM1 of M. grisea, and SRM1 of Bipolaris oryzae, the deletion mutants were fully pathogenic, indicating that these genes were dispensable in pathoge-

In S. cerevisiae and several pathogenic fungi, HOG1 and its homologs are involved in regulating hypertonic stress responses. We wondered whether or not STK1 shared a similar function. Therefore, we compared growth phenotypes of STK1 KOs and WT under hypertonic stress. Microscope observations showed that the hyphal cells of WT swelled and some became spherical under stress, particularly in PDA medium containing 1 mol L–1 LiCl; KO cells, however, were thin and some of them even collapsed (Fig. 5-A). Moreover, KO cells virtually stopped growing when cultured in PDA medium with 1 mol L–1 KCl and 1 mol L–1 LiCl and exhibited a repressed radial growth rate in PDA medium with 2 mol L–1 sorbitol, while WT cells maintained a consistent growth rate (shown in Fig. 5-B). Thus, our data show that WT cells grew much better than those of KOs under the same hypertonic stress. These results revealed that STK1 KOs fail to adapt to the hypertonic environment, indicating that STK1 is essential in the regulation of hypertonic stress in S. turcica.

4. Discussion Growth and development as metabolic processes in phytopathogenic fungi are controlled by signal transduction pathways, such as the MAPK cascade pathway, calcium pathway, and cAMP pathway. Several recent reports have focused on the role of HOG1 homologs in the HOG-MAPK

A

WT

ΔSTK1-1

B Wild type

ΔSTK1-1

*

80

1 mol L–1 LiCl

*

Inhibition rate (%)

1 mol L–1 KCl

60 40 20 0 1 mol L–1 KCl

2 mol L–1 sorbitol

1 mol L–1 LiCl

2 mol L–1 sorbitol

Fig. 5 Mycelium morphology and inhibition rates of STK1 KO and WT S. turcica under high osmotic stress. A, changes in mycelial morphology under 1 mol L–1 KCl, 1 mol L–1 LiCl, and 2 mol L–1 sorbitol. B, comparison of growth rates of WT and KO colonies under high osmotic stress. *, means P≤0.05.

LI Po et al. Journal of Integrative Agriculture 2016, 15(12): 2786–2794

nicity (Dixon et al. 1999; Kojima et al. 2004; Moriwaki et al. 2006). In contrast, M. graminicola mghog1 mutants and B. cinerea bcsak1 mutants were nonpathogenic (Mehrabi et al. 2006; Segmuller et al. 2007), suggesting that the genes are necessary for virulence in the fungi. Interestingly, the functions of these Hog1 homologs from pathogenic fungi were obviously different based on how they affected characteristics of the pathogenic process. For example, MgHog1 of M. graminicola influenced melanization and the formation of infectious germ tubes (Mehrabi et al. 2006). BcSak1 of B. cinerea impacted appressorium formation and plant penetration (Segmuller et al. 2007). Cpmk1 of Cryphonectria parasitica was involved in virulence and the development of cankers (Park et al. 2004). In the present research, STK1 of S. turcica was found to be involved in appressorium formation, as well as virulence and composition of the HT-toxin, suggesting that STK1 regulates all of these crucial pathogenic processes in S. turcica. Therefore, we posit that HOG1 homologs in phytopathogenic fungi may be associated not only with the conidiophore, appressorium development, and penetration but also with the toxicity of pathotoxins. These varying roles of HOG1 homologs among plant pathogens are likely due to differences in host defensive responses or infection mechanisms, as suggested in a review paper by Zhao et al. (2007). Moreover, it should be pointed out that the methods used for detection of HT-toxin composition and analysis of virulence in S. turcica were previously established by our research team (Dong et al. 1993). In this earlier analysis, we compared HT-toxin composition and virulence both in vitro and in vivo and found that the results led to the same conclusions. Due to the complications arising from the host, it is therefore simpler to determine HT-toxin composition and virulence in vitro.

5. Conclusion In the study a MAPK gene named STK1 was cloned from S. turcica and gene knockout technology was employed to investigate the functions of the gene. The results showed that STK1 affects hyphae development, conidiogenesis, appressorium development, HT-toxin biosynthesis, pathogenicity and hypertonic stress response in S. turcica.

Acknowledgements This study was supported by the National Natural Science Foundation of China (31171805 and 31371897).

References Cho Y, Srivastava A, Ohm R A, Lawrence C B, Wang K H, Grigoriev I V, Marahatta S P. 2012. Transcription factor

2793

Amr1 induces melanin biosynthesis and suppresses virulence in Alternaria brassicicola. PLoS Pathogens, 8, 634–643. Dixon K P, Xu J R, Smirnoff N, Talbot N J. 1999. Independent signaling pathways regulate cellular turgor during hyperosmotic stress and appressorium-mediated plant infection by Magnaporthe grisea. The Plant Cell, 11, 2045–2058. Dong J G, Shi Y Y, Kang S L, Huang W F. 1993. Extraction of HT-toxin produced by Helminthosporium turcicum and its pathogenic activity. Microbiology China, 20, 73–77. (in Chinese) Fan Y S, Gu S Q, Dong J G, Dong B F. 2007. Effects of MEK-specific inhibitor U0126 on the conidial germination, appressorium production, and pathogenicity of Setosphaeria turcica. Scientia Agricultura Sinica, 6, 78–85. (in Chinese) Fan Y S, Gu S Q, Dong J G, Dong N. 2008. Regulation of MAPK signal pathway on the production and biological activity of HT-toxin in Setosphaeria turcica. Scientia Agricultura Sinica, 41, 86–92. (in Chinese) Flaishman M A, Kolattukudy P E. 1994. Timing of fungal invasion using host’s ripening hormone as a signal. Proceedings of the National Academy of Sciences of the United States of America, 91, 6579–6583. Gu S Q, Li P, Wu M, Hao Z M, Gong X D, Zhang X Y, Tian L, Zhang P, Wang Y, Cao Z Y, Fan Y S, Han J M, Dong J G. 2014. StSTE12 is required for the pathogenicity of Setosphaeria turcica by regulating appressorium development and penetration. Microbiological Research, 169, 817–823. Hamer J E, Howard R J, Chumley F G, Valent B. 1988. A mechanism for surface attachment in spores of a plant pathogenic fungus. Science, 239, 288–290. Hou Z, Xue C, Peng Y, Katan T, Kistler H C, Xu J R. 2002. A mitogen-activated protein kinase gene (MGV1) in Fusarium graminearum is required for female fertility, heterokaryon formation, and plant infection. Molecular Plant-Microbe Iinteractions, 15, 1119–1127. Howard R J, Ferrari M A, Roach D H, Money N P. 1991. Penetration of hard substrates by a fungus employing enormous turgor pressures. Proceedings of the National Academy of Sciences of the United States of America, 88, 11281–11284. Kojima K, Takano Y, Yoshimi A, Tanaka C, Kikuchi T, Okuno T. 2004. Fungicide activity through activation of a fungal signalling pathway. Molecular Microbiology, 53, 1785–1796. Leroch M, Kleber A, Silva E, Coenen T, Koppenhofer D, Shmaryahu A, Valenzuela P D, Hahn M. 2013. Transcriptome profiling of Botrytis cinerea conidial germination reveals upregulation of infection-related genes during the prepenetration stage. Eukaryotic Cell, 12, 614–626. Mehrabi R, Zwiers L H, de Waard M A, Kema G H. 2006. MgHog1 regulates dimorphism and pathogenicity in the fungal wheat pathogen Mycosphaerella graminicola. Molecular Plant-Microbe Interactions, 19, 1262–1269.

2794

LI Po et al. Journal of Integrative Agriculture 2016, 15(12): 2786–2794

Mitchell T K, Dean R A. 1995. The cAMP-dependent protein kinase catalytic subunit is required for appressorium formation and pathogenesis by the rice blast pathogen Magnaporthe grisea. The Plant Cell, 7, 1869–1878. Moriwaki A, Kubo E, Arase S, Kihara J. 2006. Disruption of SRM1, a mitogen-activated protein kinase gene, affects sensitivity to osmotic and ultraviolet stressors in the phytopathogenic fungus Bipolaris oryzae. FEMS Microbiology Letters, 257, 253–261. Moriwaki A, Kihara J, Mori C, Arase S. 2007. A MAP kinase gene, BMK1, is required for conidiation and pathogenicity in the rice leaf spot pathogen Bipolaris oryzae. Microbiological Research, 162, 108–114. Motoyama T, Kadokura K, Ohira T, Ichiishi A, Fujimura M, Yamaguchi I, Kudo T. 2005. A two-component histidine kinase of the rice blast fungus is involved in osmotic stress response and fungicide action. Fungal Genetics and Biology, 42, 200–212. Nesher I, Barhoom S, Sharon A. 2008. Cell cycle and cell death are not necessary for appressorium formation and plant infection in the fungal plant pathogen Colletotrichum gloeosporioides. BMC Biology, 6. doi: 10.1186/1741-70076-9 Park S M, Choi E S, Kim M J, Cha B J, Yang M S, Kim D H. 2004. Characterization of HOG1 homologue, CpMK1, from Cryphonectria parasitica and evidence for hypovirusmediated perturbation of its phosphorylation in response to hypertonic stress. Molecular Microbiology, 51, 1267–1277. Perkins J M, Pedersen W L. 1987. Disease development and yield losses associated with northern leaf blight on corn. Plant Disease, 71, 940–943. Podila G K, Rogers L M, Kolattukudy P E. 1993. Chemical signals from avocado surface wax trigger germination and appressorium formation in colletotrichum gloeosporioides. Plant Physiology, 103, 267–272. Punt P J, Oliver R P, Dingemanse M A, Pouwels P H, van den Hondel C A. 1987. Transformation of aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene, 56, 117–124. Raistrick H, Robinson R, White D E. 1936. Studies in the biochemistry of micro-organisms: Ravenelin (3-methyl1:4:8-trihydroxyxanthone), a new metabolic product of Helminthosporium ravenelii Curtis and of H. turcicum Passerini. The Biochemical Journal, 30, 1303–1314. Raymundo A D, Hooker A L. 1981. Measuring the relationship between northern corn leaf blight and yield losses. Plant Disease, 65, 325–327. Ruiz-Roldan M C, Maier F J, Schafer W. 2001. PTK1, a mitogenactivated-protein kinase gene, is required for conidiation,

appressorium formation, and pathogenicity of Pyrenophora teres on barley. Molecular Plant-Microbe Interactions, 14, 116–125. Schamber A, Leroch M, Diwo J, Mendgen K, Hahn M. 2010. The role of mitogen-activated protein (MAP) kinase signalling components and the Ste12 transcription factor in germination and pathogenicity of Botrytis cinerea. Molecular Plant Pathology, 11, 105–119. Segmuller N, Ellendorf U, Tudzynski B, Tudzynski P. 2007. BcSAK1, a stress-activated mitogen-activated protein kinase, is involved in vegetative differentiation and pathogenicity in Botrytis cinerea. Eukaryotic Cell, 6, 211–221. Serrano M, Coluccia F, Torres M, L’Haridon F, Metraux J P. 2014. The cuticle and plant defense to pathogens. Frontiers in Plant Science, 5. doi: 10.3389/fpls.2014.00274 Shen S, Hao Z, Gu S, Wang J, Cao Z, Li Z, Wang Q, Li P, Hao J, Dong J. 2013. The catalytic subunit of cAMP-dependent protein kinase A StPKA-c contributes to conidiation and early invasion in the phytopathogenic fungus Setosphaeria turcica. FEMS Microbiology Letters, 343, 135–144. Thines E, Weber R W, Talbot N J. 2000. MAP kinase and protein kinase A-dependent mobilization of triacylglycerol and glycogen during appressorium turgor generation by Magnaporthe grisea. The Plant Cell, 12, 1703–1718. Xu J R, Hamer J E. 1996. MAP kinase and cAMP signaling regulate infection structure formation and pathogenic growth in the rice blast fungus Magnaporthe grisea. Genes & Development, 10, 2696–2706. Yong H Y, Bakar F D, Illias R M, Mahadi N M, Murad A M. 2013. Cgl-SLT2 is required for appressorium formation, sporulation and pathogenicity in Colletotrichum gloeosporioides. Brazilian journal of Microbiology, 44, 1241–1250. Zhang M H, Xu X D, Liu K J, Dong H Y, Jiang Y, Hu L. 2011, Physiological differentiation and races distribution of Exserohilum turcica in China. Journal of Maize Sciences, 19, 138–141. (in Chinese) Zhang S R, Hao Z M, Wang L H, Shen S, Cao Z Y, Xin Y Y, Hou M L, Gu S Q, Han J M, Dong J G. 2012. StRas2 regulates morphogenesis, conidiation and appressorium development in Setosphaeria turcica. Microbiological Research, 167, 478–486. Zhao X, Mehrabi R, Xu J R. 2007. Mitogen-activated protein kinase pathways and fungal pathogenesis. Eukaryotic Cell, 6, 1701–1714. Zheng D, Zhang S, Zhou X, Wang C, Xiang P, Zheng Q, Xu J R. 2012. The FgHOG1 pathway regulates hyphal growth, stress responses, and plant infection in Fusarium graminearum. PLoS ONE, 7, e49495. (Managing editor ZHANG Juan)