MdCER2 conferred to wax accumulation and increased drought tolerance in plants

Journal Pre-proof MdCER2 conferred to wax accumulation and increased drought tolerance in plants Ming-Shuang Zhong, Han Jiang, Yue Cao, Yong-Xu Wang, Chun-Xiang You, YuanYuan Li, Yu-Jin Hao PII:

S0981-9428(20)30067-X

DOI:

https://doi.org/10.1016/j.plaphy.2020.02.013

Reference:

PLAPHY 6047

To appear in:

Plant Physiology and Biochemistry

Received Date: 26 September 2019 Revised Date:

10 February 2020

Accepted Date: 11 February 2020

Please cite this article as: M.-S. Zhong, H. Jiang, Y. Cao, Y.-X. Wang, C.-X. You, Y.-Y. Li, Y.-J. Hao, MdCER2 conferred to wax accumulation and increased drought tolerance in plants, Plant Physiology et Biochemistry (2020), doi: https://doi.org/10.1016/j.plaphy.2020.02.013. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Masson SAS.

The title:

MdCER2 conferred to wax accumulation and increased drought tolerance in plants

The full names of all the authors: Ming-Shuang Zhong1, Han Jiang2, Yue Cao1, Yong-Xu Wang1, Chun-Xiang You1, Yuan-Yuan Li1*, Yu-Jin Hao1*.

The email addresses of all authors Ming-Shuang Zhong: [email protected]; Han Jiang: [email protected]; Yue Cao: [email protected]; Yong-Xu Wang: [email protected]; Chun-Xiang You: [email protected]

The names and address of the institution: 1 National Key Laboratory of Crop Biology; Collaborative Innovation Center of Fruit ＆ Vegetable Quality and Efficient Production in Shandong; College of Horticulture Science and Engineering, Shandong Agricultural University, Tai-An, Shandong 271018, China 2 State Key Laboratory of Crop Stress Biology for Arid Areas/Shaanxi Key Laboratory of Apple, College of Horticulture, Northwest A&F University, Yangling, Shaanxi 712100, China

Corresponding author: *Corresponding author: Yuan-Yuan Li, Yu-Jin Hao E-mail: [email protected], [email protected] Phone: +86-538-824-6151, +86-538-824-6692 Fax: 86-538-824-2364

Abstract: Drought can activate many stress responses in plant growth and development, including the synthesis of epidermal wax and the induction of abscisic acid (ABA), and increased wax accumulation will improve plant drought resistance. Therefore, an examination of wax biosynthesis genes could help to better understand the molecular mechanism of environmental factors regulating wax biosynthesis and the wax associated stress response. Here, we identified the MdCER2 gene from the 'Gala' (Malus× domestica Borkh.) variety of domestic apple, which is a homolog of Arabidopsis AtCER2. It possesses a transferase domain and the protein localizes on the cell membrane. The MdCER2 gene was constitutively expressed in apple tissues and was induced by drought treatment. Finally, we transformed the MdCER2 gene into Arabidopsis to identify its function, and found ectopic expression of MdCER2 promoted accumulation of cuticular wax in both leaves and stems, decreased water loss and permeability in leaves, increased lateral root number, changed plant ABA sensitivity, and increased drought resistance.

Key words: Apple; MdCER2; Cuticular wax; Drought tolerance; ABA sensitivity

1. Introduction

Plants are subjected to various stresses during growth and development. Among them, drought is a form of abiotic stress that can disrupt the normal growth and development patterns of plants, especially impacting the physiology and morphology of terrestrial plants (Kazuko and Kazuo, 2006). Plants have evolved many unique adaptive mechanisms in response to drought, including induction of the accumulation of a variety of stress response hormones, whether involved in short-term or long-term growth and development (Fang and Xiong, 2015). The hormone response induced by abscisic acid (ABA) is unique in plant drought resistance. ABA is a key hormone that regulates water status and stomatal movement (Lim et al., 2015). In addition, the existence of epidermal wax is a more prominent mechanism for dealing with drought. It has also become clear that the physiological role of cuticle wax, beyond its primary function as a transpiration barrier, plays important roles in processes ranging from development to microbial interactions (Yeat and Rose, 2013; Zhu and Guo, 2014).

The unique mechanism of cutin defense is closely tied to cuticular wax. Many studies have reported that cuticular wax undergoes synthesis in four stages, in cellular compartments spanning from plastids to the endoplasmic reticulum to the extracellular space (Bernard et al., 2012). The first stage is composed of the synthesis of fusions of C16 and C18 fatty acid monomers to aceyl carrier protein (ACP) to form C16-ACP and C18-ACP, which mainly involves the plasticidal fatty acid synthase (FAS) complex, ACP, and a long-chain acyl-CoA synthetase (LACS). The second stage, the rate limiting step, involves the elongation of C16 and C18 fatty acids into very long chain fatty acids (VLCFAs) composed of 20 to 36 carbons. It mainly consists of the fatty acid elongase (FAE) complex, 3-ketoacyl CoA synthase (KCS), 3-ketoacyl CoA reductase (KCR), 3-hydroxyacyl CoA dehydratase (PAS2), trans-2-enoyl-CoA reductase (ECR), and andglycerol 3-phosphate acyltransferase (GPAT). The third stage is the synthesis of different waxy products by VLCFA distribution. Finally, a variety of keratinous wax components are transported out of the cell to perform their function. The internal regulatory mechanism controlling wax synthesis is complex. More than 190 genes are reported to be involved in waxy synthesis in Arabidopsis, and 89 Arabidopsis mutants affect wax accumulation (Borisjuk et al., 2014). Transcriptional regulation is one of the most important regulatory mechanisms involved in this process. Five main transcription factors have been identified in this process to date: Ethylene responsive factors, WRINKLED transcription factors, CBF/DREB transcription factors, MYB transcription factors, and HD-Zip class IV transcription factors. AtWIN1/SHN1 affects cuticular components including C30/34 FA, C28/30 aldehyde, C27/C29/C33 alkane, C16:0 and C18:1 ω-HFAs, and C31 and C29 alkanes (Broun et al., 2004; Aharoni et al., 2004; Kannangara et al., 2007). OsWR1 participates in the synthesis of wax components by regulating multiple downstream target genes (Wang et al., 2012). The transcription factor AtMYB96 is the most representative waxy drought resistance gene. It induces both stomatal closure via RD22 and cuticular wax biosynthesis by upregulating directly cuticular wax biosynthetic enzyme genes (Seo et al., 2011). In addition, more and more studies have shown that wax synthesis also involves indirect transcriptional regulation. It has been reported that AtCER9 can change the synthesis of wax in stems and leaves. It encodes a protein with sequence likeness to yeast Doa10, an E3 ubiquitin ligase involved in ER-associated degradation of misfolded proteins (Lü et al., 2012). A recent study

showed that the Arabidopsis F-box protein SAGL1 mediates proteasome-dependent degradation of ECERIFERUM3, thereby negatively regulating cuticular wax biosynthesis in response to changes in humidity (Kim et al., 2019). This demonstrates a mechanism for how DHS negatively regulates wax biosynthesis through promoting the degradation of ROC4 for the condition of drought-tolerant rice (Wang et al., 2018). Besides transcription factors, structural genes function in a more direct way to regulate wax accumulation. The CERs gene family, for example, regulates wax biosynthesis and drought response. CER1-overexpressing plants show reduced soil water deficit susceptibility and decreased cuticle permeability (Bourdenx et al., 2011). A recent report demonstrated that altering the activity of CER1-LIKE1 influences VLC-n-alkane biosynthesis and wax crystallization (Pascala et al., 2019). AtCER3 can affect the synthesis of stem wax (Wang et al., 2018). Moreover, CER1 interacts with CER3 to catalyze the redox-dependent synthesis of VLC-alkanes from VLC acyl-CoAs (Bernard et al., 2012). AtCER4 is involved in the synthesis of very-long-chain primary alcohols with C24-C28 (Rowl et al., 2006). AtCER11 is involved a dephosphorylation step in secretory trafficking in plant cells (Shi et al., 2019). Many articles have reported roles for AtCER2 and its different congeners in wax accumulation. Wang et al. demonstrated that WSL4 participates in VLCFA elongation beyond C22, and elongation beyond C24 requires the participation of OsCER2 (2017). Another group provides evidence for the function of CER2 in C28 elongation based on experiments in yeast (Haslam et al., 2012). The results of other assays show that the changes in acyl chain length caused by each CER2-LIKE protein are of substantial importance for cuticle formation and pollen coat function. CER2 and CER2-LIKE2 are both involved in VLCFA elongation to C30 (Haslam et al., 2015). These findings proved that CER2 is deeply integral to the process of long chain fatty acid extension. Although CER2 has been examined in detail in several species, its function in apples has not been reported. Cuticular wax has significant role in apple resistance to stresses and fruit quality. Therefore, we isolated the MdCER2 gene from apple, and analyzed its function under drought conditions and varying exposure to ABA, which provides new insights for further studying the molecular mechanisms of cuticular wax biosynthesis in plants.

2. Material and methods

2.1. Plant materials and growth conditions The materials used in this experiment were ‘Gala’ apple seedlings and fruits, apple tissue culture seedlings, Arabidopsis thaliana (Columbia) and tobacco (Nicotiana benthamiana). The growing roots, young stems, new leaves, flowers, and fruit of the apple seedlings were collected from the fruit tree experimental station of Shandong Agricultural University from June to September, 2018. Apple tissue culture seedlings were grown on MS medium containing 0.5 mg l-1 6-BA and 0.5mg ml-1 NAA for 25 days (room temperature 24 ℃), then treated with 10% polyethylene glycol (PEG 6000) and 50 μmol L-1ABA for 0, 1, 3, 6, 12, and 24 h, respectively. Then cryopreserved with liquid nitrogen immediately after treatment. Wild type (WT) Arabidopsis grew at 22 °C under a 16-h light/8-h dark photoperiod. After 20 days of growth, transgenic Arabidopsis was obtained as described (Zhang et al., 2019a). After screening, the T3 generation plants were obtained and used in the experiment. Tobacco grows at room temperature until at least five leaves can be used for injection to perform the MdCER2 localization experiment (Wang et al., 2014).

2.2. Subcellular localization

The

primers

(AAGGAGCCCTTCACCATGGTTTCATCAACCAGCTTGAGG) MdCER2-TOPO-R

MdCER2-TOPO-F and

(GGCGCGCCCACCCTTAGCAATACTCCAATTCCTTTGG)

were designed to construct TOPO vector (The Gateway® System). Then, the MdCER2-GFP was obtained by connecting to the GFP carrier by LR substitution reaction to exchange the MdCER2 gene to the PAL1107 vector. Subcellular localization of MdCER2 was identified by transient expression in Nicotiana benthamiana as described (Qi et al., 2019).

2.3. RNA extraction and qRT-PCR analysis of gene expression

Total RNA of different apple tissues and Arabidopsis seedlings were obtained

using the RNA Plant Plus Reagent kit (Tiangen Biotech, Beijing, China). cDNA was obtained using the PrimeScript™ RT reagent Kit (TaKaRa, Shiga, Japan) and stored at −80 ℃ (An et al., 2018). The upstream primer 5’-ATCCGGATAACCGAAACGGG-3’ and downstream primer 5’-AGGCAGAAAACGCATCTCCA-3’ of MdCER2 were designed for qRT-PCR analysis. qRT-PCR was performed using the UltraSYBR Mixture (with ROX) kit (CoWin Biosciences, Taizhou, Jiangsu, China) under the following conditions: pre-denaturation at 94 °C for 10 min, denaturation at 94 °C for 15 s, annealing at 55 °C for 15 s, and elongation at 65 °C for 15 s for 40 cycles. Samples were collected at step 3 of each cycle for fluorescence analysis. The 2−ΔΔCt method was applied for data analysis.

2.4. Scanning electron microscopy (SEM)

After 30 days of growth, we cut off the leaves and stems of Arabidopsis to observe surface wax morphology. The leaves and stems were vacuum-dried at –80 °C in a freeze drier for 12 h. Then, the sample was placed on a round table and treated with gold spray for observation with a scanning electron microscope as described (Lü et al., 2009).

2.5. Wax extracting method

Cuticular wax was extracted exhaustively using the following steps: chloroform extraction, nitrogen blow drying, derivatization reaction, and sample analysis following that described previously (Zhang et al., 2019b).

2.6. Water loss experiment

Water loss in 25-day old Arabidopsis leaves was carried out as follows: Rosette leaves were cut and immediately incubated in deionized water for 3 hours under dark conditions. Excess water was removed with filter paper. The leaves were then placed in the dark, and their weight was measured every 30 min for 180 min. The rate of water loss of the leaves was then calculated. Each experiment was carried out five times independently.

2.7. Chlorophyll extraction

After 25 days of growth, Arabidopsis rosette leaves were removed for a chlorophyll extraction assay. The leaves were soaked in the dark with 80% anhydrous ethanol and their absorbance at 665 and 649 was measured every ten minutes until 80 min (Yu et al., 2018). The total micromoles of chlorophyll were calculated by: 6.63*(A665) + 18.08*(A649). This experiment was repeated five times.

2.8. PEG and ABA treatment

Arabidopsis seeds were seeded on normal MS medium. After germination and growth for 5 days, Arabidopsis seedlings were transferred to MS, MS+10 μmol L-1 ABA, MS+30 μmol L-1 ABA, MS+4% PEG 4000, and MS+6% PEG 4000 medium. Seedlings were then grown in growth chambers at 24 ℃ under 16 h of light per day (An et al., 2016). After seven days of treatment, the root length and number of lateral roots of 30 seedlings of each experimental condition were measured at a time, and the experiment was repeated five times.

2.9. Drought treatment

The drought treatment assay was carried out with single pot seedling and four pot seedlings, respectively. The seedlings were grown in 50% vermiculite and 50% coarse vermiculite. After 20 days of normal plant growth, the seedlings were no longer watered until the leaves wilted and turned yellow.

2.10. Data analysis

Each experiment was carried out five times. DPS software was used to analyze the data, and the single factor Tukey method was used to analyze the relative expression levels. Different letters represent different significant differences at P < 0.05.

2.11. Bioinformatics analysis of MdCER2

Gene sequences of 10 different species were obtained from BLAST, DNAMAN was used to create a multiple sequence alignment, and MEGA. 7 was used to generate a

phylogenetic

tree.

The

online

software

SOPMA

(https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html)

and

PHYRE2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index) were used to predict the second-level structure and the three-dimensional structure, respectively. The gene structure and domain were found by GSDS 2.0 (http://gsds.cbi.pku.edu.cn) and SMART (smart.embl-heidelberg.de). ProtParam (http://web.expasy.org/protparam) was conducted to analyze the molecular weight and isoelectric point of proteins. Protein

interaction

was

predicted

by

the

online

software

STRING

(https://string-db.org).

3. Results

3.1. Gene cloning and sequence analysis of MdCER2

The MdCER2 gene of apple was identified from NCBI sequence data using AtCER2 as bait. MdCER2 is 1,299 bp in length, encodes 432 amino acids, and has two exons and a single intron (Figure 1a). In addition, the sequence similarity of CER2 between apple and other plant species was analyzed, including peach, plum, waxberry, white pear, rose, durian, cocoa, poplar, rubber tree, and castor oil, and an evolutionary tree was generated based a multisequence alignment (Figure 1b). The results show that the MdCER2 sequence is highest in similarity to white pear (both belong to the Rosaceae family). Based on the second-level structure and the three-dimensional structure of MdCER2, the molecular weight of MdCER2 is predicted to be 48 kD and the theoretical PI is 5.84. We compared the protein sequences of AtCER2 and MdCER2, and found that the two sequences were highly similar (Figure 1c). Then, we analyzed the domains of the two proteins, and found that they both have only one transferase domain with predicted transferase activity (Supplemental Figure 1).

3.2. Cis-regulatory analysis

Using PLANTCARE software, we studied the 1,400 bp upstream of the MdCER2 transcription initiation site (TSS) to explore the potential response of MdCER2 to various regulatory inputs. As shown in Table 1, several cis-regulatory elements were identified in the promoter sequence of MdCER2, including ABRE and SARE sites, which have been shown to respond to abscissic and salicylic acid, respectively. MdCER2 also contains some plant hormone related sequences, such as MBSI, involved in flavonoid biosynthetic gene regulation. In addition, it also includes five sites related to optical signal components, including BOX4, G-BOX, and others. These results suggest that MdCER2 may be affected by external environmental factors such as light to regulate growth and development.

3.3. MdCER2 Localization and Expression pattern in different apple tissues

To study the localization of MdCER2 protein, two expression vectors of MdCER2-GFP and AtCBL1-RFP were constructed using the full sequence of MdCER2, and transiently injected into the epidermal cells of tobacco leaves. Two-photon laser confocal microscopy revealed that MdCER2 is located on the cell membrane (Figure 2a). The specific expression pattern of MdCER2 in different apple tissues, including root, stem, leaf, and fruit was then analyzed by qRT-PCR (Figure 2b). MdCER2 constitutively expressed in all tissues tested. The highest expression was observed in fruit, and then stem and leaf, and the lowest expression level was observed in the root, suggesting its potential function in plant aerial organs.

3.4. Change of wax load in stems and leaves

To identify the function of MdCER2, an MdCER2 overexpression vector was constructed and transformed into wild type Arabidopsis, and three ectopically expressing MdCER2 strains with different MdCER2 transcription levels of Arabidopsis were generated (Figure 3a). Based on the tissue-specific expression levels of MdCER2, we next analyzed the wax load in stem and leaf in WT and MdCER2 ectopically-expressed lines of Arabidopsis to detect whether MdCER2 protein expression is related to wax accumulation. Figure 3b and c shows that the wax

content is higher in leaves of Arabidopsis expressing MdCER2 than those of the wild type, and was significantly higher in transgenic stems compared to the WT. The morphology of wax crystals was observed by SEM (Figure 3d and e). In stem tissue, there was more wax observed in transgenic lines than in wild type, but there was no significant difference in the wax crystals' morphology. In leaves, the wax was observed as lamellar, and the quantity is slightly higher in transgenic Arabidopsis than in WT.

3.5. MdCER2 affects leaf permeability in plants

A previous study has shown that a change in wax load in leaves affects the permeability of leaf epidermis (Schönherr, 1976). Therefore, we performed a leaf water loss experiment and a chlorophyll extraction experiment to observe the permeability of MdCER2 transgenic and WT plant leaf epidermis. The rate of water loss was measured for six time periods. As shown in Figure 4a, the water loss rate of wild type plants was higher than that of MdCER2 transgenic plants at each time point examined. Similarly, after soaking leaves with 80% anhydrous ethanol, the chlorophyll leached out of the leaves of wild type plants faster than that of MdCER2 transgenic plants (Figure 4b). These results indicate that MdCER2 affects the permeability of plant leaves, which suggest its potential role in drought tolerance.

3.6. MdCER2 transgenic Arabidopsis is sensitive to ABA

In the MdCER2 promoter sequence, we found an ABRE cis-regulatory element that is involved in the ABA response. Here, we examined whether transcription of MdCER2 is regulated by ABA. The qRT-PCR results show that the presence of ABA significantly decreases the expression of MdCER2, and MdCER2 is highly sensitive to ABA treatment (Figure 5a). Subsequently, we used WT and MdCER2 transgenic Arabidopsis to analyze their ABA response. Arabidopsis seeds were germinated and grew on normal MS medium for 5 days, then transferred to MS medium containing 10 μmol L-1 ABA or 30 μmol L-1 ABA for 7 days, respectively. As is shown in Figure 5b and c, the root length of MdCER2 transgenic plant was significantly shorter than that of wild type under ABA treatment, but there was no obvious difference in the number

of lateral roots among different lines (Figure 5b, d). This confirms that MdCER2 is sensitive to ABA signaling.

3.7. MdCER2 enhances plant drought resistance

ABA sensitivity is often closely related to plant drought tolerance, so we examined the expression levels of MdCER2 under different drought treatment times by qRT-PCR. The results show that the expression level of MdCER2 increases gradually within 12 h of drought treatment, and then decreases (Figure 6a). We then analyzed the phenotype of WT and MdCER2 transgenic Arabidopsis under 7 days of drought treatment and found that, in WT Arabidopsis, more leaves turn yellow and wilt than in MdCER2 transgenic plants under drought treatment, while there is no difference among the different Arabidopsis lines under normal watering condition (Figure 6b). We similarly detected the leaf chlorophyll content (Figure 6c). Under normal watering condition, there is no obvious difference in chlorophyll content of leaves of the four lines. However, after drought treatment, the chlorophyll content of WT Arabidopsis leaves is significantly lower than that of transgenic plants. To confirm these results, we tested Arabidopsis seedlings under PEG treatment (Figure 5b). After 5 days of growth, we transferred MdCER2 transgenic and WT Arabidopsis from normal MS medium to MS medium containing 4% or 6%PEG, and treated for 7 days. Then, we measured the root length and number of lateral roots. Figure 6d shows that the roots of PEG-treated MdCER2 transgenic plant are longer than those of WT, and the number of lateral roots is significantly increased (Figure 6e). These results indicate that MdCER2 can improve the plant drought tolerance. Finally, we used the online software STRING to predict protein-protein interactions and found that MdCER2 protein might interact with MdMYB96 (Supplemental Figure 2), which suggests a possible pathway for regulating plant drought tolerance. However, this interaction needs to be further verified by experiments.

4. Discussion

The CER gene family is involved in the response to biological and abiotic stresses in many plant species, which suggest areas for the subsequent study of CER

genes in apples. Qi et al. showed that, when compared to AtCERs, MdCERs had high similarity in 3D structures, indicating MdCER proteins might have similar functions as AtCERs (2019). Qi also identified the first CER gene from apple, MdCER1. MdCER1 is associated with the accumulation of cuticular wax and drought resistance (2018). In the present study, we identify another CER gene from apple, a homolog of AtCER2, to further investigate the apple CER family. Phylogenetic analysis indicates that CER2 genes from different species of dicotyledonous plants have a high degree of similarity, demonstrating that the gene has been conserved in the course of evolution. We also show that there is high sequence similarity between MdCER2 and AtCER2, and it is presumed that they have similarly conserved functions. In a study of AtCER2, CER2 was classified, based on sequence homology, as a BAHD acyltransferase (Haslam et al., 2012). Similarly, domain analysis showed that MdCER2 and AtCER2 each have only one transferase domain. This indicates that MdCER2 may also produce C28 and C30 long-chain fatty acids during long-chain fatty acid synthesis. The protein interaction prediction suggests that MdCER2 might interact with multiple transcription factors, indicating that MdCER2, as a target gene, might be involved in multiple waxy biosynthetic pathways. Previous studies have shown that most wax synthase proteins in Arabidopsis are located in the endoplasmic reticulum (ER), such as AtCER17 (Yang et al., 2017). In Apple, it was found that MdCER1 was also located in ER (Qi et al., 2018). However, we found that MdCER2 localizes to the cell membrane, which is different than AtCER2, whose localization has been placed in either the ER or the nucleus in different studies (Xia et al., 1997; Haslam et al., 2012). AtCER2 is a acyl-transferase, but does not have the activity of a acyl-transferase (Aarts et al., 2017). Therefore, we propose that the localization to the cell membrane may relate to MdCER2's transferase activity, or play a role in the wax synthetic pathway. Next, we analyzed the expression pattern of MdCER2. The apple CER family is mostly expressed in apple leaves and stems, with low distribution levels in the roots, indicating that the MdCER genes are highly distributed in the organs exposed to the air above the ground, which are with covered cuticles. Our results for MdCER2 are in concert with the broader family expression. To efficiently adapt to the complex and changeable environment, terrestrial plants have evolved many different adaptive mechanisms, including changing the properties of epidermal wax in some organs above the ground. In this study, MdCER2 transgenic plants have higher wax accumulation than WT

in both leaves and stem. This result was confirmed by SEM. It was also found that the wax crystal structure of the transgenic plant exhibited snowflake-like wax accumulation in leaves, which is closely related to the drought tolerance of transgenic plants. It has been demonstrated in a series of species in addition to Arabidopsis that there is a relationship between wax and epidermis permeability (Shepherd and Griffiths, 2006). Epidermis permeability can be measured by the rates of water loss and chlorophyll-leaching (Wang et al., 2014). Therefore, our observation that reduced water loss and chlorophyll leaching is positively correlated with the content of more wax in the epidermis of MdCER2 transgenic plant is further confirmation that MdCER2 has a unique effect on epidermis permeability. MdCER2 may affect the regulation of wax biosynthesis and play an active role in the drought resistance. From upstream sequence analysis of MdCER2, a MBSI acting element, a MYB binding site involved in flavonoid biosynthetic gene regulation, was found, indicating that the gene might play an important role in the regulation of fruit quality. In addition, the gene contains many elements related to light. Light is able to induce wax accumulation (Hooke et al., 2006), and it has been pointed out that the protective effect of ultraviolet radiation is due to the light-scattering characteristics of the cuticular layer (Seo and Park, 2011; Li et al., 2013). Therefore, we speculate that light is highly likely to affect wax accumulation and fruit quality by regulating the expression of MdCER2. We also found an ABA response element. ABA plays a central role in modulating the effect of stress via maintaining plant homeostasis. (Liu et al., 2019). ABA deficiency consistently results in differences in the composition of epidermis waxes and leaf cutin (Martin et al., 2017). Furthermore, decreased expression of genes involved in wax or cutin formation has been shown consistently among ABA mutants (Martin et al., 2017). ABA can induce the transcription of MYB96 to regulate drought resistance (Borisjuk et al., 2014), and guide the expression of AtCER6 (Hooker et al., 2002). We demonstrate that ABA could not induce high MdCER2 expression, but MdCER2 transgenic plants show hypersensitivity to ABA. Therefore, we speculate that MdCER2, as a target gene, may be regulated by some upstream transcription factors, resulting in its susceptibility to ABA. The accumulation of the phytohormone ABA is a major response to water deficiency in plants (Osakabe et al., 2013). After drought treatment, MdCER2 transgenic plants have increased drought resistance compared to WT. Therefore, it is reasonable to believe that high waxy content in plants is a key factor in regulating plant drought

resistance, and drought stress could be effective to induce the expression of MdCER2 to increase wax accumulation and enhance tolerance, which forms a regulatory pathway among drought, MdCER2, wax accumulation, and drought resistance. It is known to all that ABA content will increase after drought treatment. However, ABA treatment decreased, while drought stress induced the expression of MdCER2 in our result. Zong et al. reported that the feedback up-regulation of ABA synthesis may contribute to the enhancement of ABA signaling, especially under persistent drought stress, plants have evolved other mechanisms to avoid over-amplification. (2016). Therefore, we speculate that when drought induces high expression of MdCER2, excessive expression of the gene may adversely affect plant growth and development. In this case, the accumulation of drought-induced ABA causes a protection mechanism that prevents the increase of MdCER2 expression. MYB96 is an important regulator of drought stress. There is a molecular link that mediates ABA-auxin cross-talk in drought stress response and lateral root growth, providing an adaptive mechanism under drought stress conditions (Seo et al., 2009). And MYB96 is a positive regulator of ABI4 in the control of seed germination (Lee et al., 2015). According to the protein-protein interaction prediction, we found that there may be an interaction between CER2 and MYB96. We speculate two regulatory pathways between CER2, MYB96, and drought. First, MYB96, as a transcription factor, may act on the upstream sequence of CER2 to activate or suppress its transcription and thereby regulate the accumulation of wax in drought. Second, CER2 and MYB96 protein directly interact with each other to positively or negatively regulate plant drought resistance. In conclusion, our study identified a wax-related gene, MdCER2, in apple. MdCER2 functions to enhance plant drought resistance by increasing the accumulation of wax or by interacting with MdMYB96, which needs to be further investigated.

Conflict of interest

The authors declare no conflict of interest regarding the publication of this paper.

Author Contributions

YYL and YJH initiated and designed the research. MSZ, HJ, YC, YXW, and CXY performed the experiments. MSZ analyzed the data. YYL contributed reagents/materials/analysis tools. MSZ and YYL wrote the manuscript. All authors have read and approved the manuscript.

Acknowledgement

We would like to thank Prof. Takaya Moriguchi of the National Institute of Fruit Tree Science, Japan, for ‘Orin’ apple calli. This study was financially supported by the National Key Research and Development Program (2018YFD1000200), the National Natural Science Foundation of China (31772275), and the Natural Science Fund for Excellent Young Scholars of Shandong Province (ZR2018JL014).

Reference

An, J-P., Li, R., Qu, F-J., You, C-X., Wang, X-F., Hao, Y-J., 2016. Apple F-Box Protein MdMAX2 Regulates Plant Photomorphogenesis and Stress Response. Frontiers in Plant Science., 7. An, J-P., Yao, J-F., Xu, R-R., You, C-X., Wang, X-F., Hao, Y-J., 2018. Apple bZIP transcription factor MdbZIP44 regulates abscisic acid-promoted anthocyanin accumulation. Plant, Cell & Environment., 41(11), 2678-2692. Aarts, M.G., Keijzer, C.J., Stiekema, W.J., Pereira, A., 1995. Molecular characterization of the CER1 gene of Arabidopsis involved in epicuticular wax biosynthesis and pollen fertility. Plant Cell, 7, 2115-2127. Bernard, A., Domergue, F., Pascal, S., Jetter, R., Renne, C., Faure, J-D., Haslam, R-P., Napier, J.A., Lessire, R., Joubès, J., 2012. Reconstitution of Plant Alkane Biosynthesis in Yeast Demonstrates That Arabidopsis ECERIFERUM1and ECERIFERUM3 Are Core Components of a Very-Long-Chain Alkane Synthesis Complex. Plant Cell, 24, 3106-3118. Bernard, A., Joubès, J., 2013. Arabidopsis cuticular waxes: Advances in synthesis, export and regulation. Prog. Lipid Res., 52, 110-129. Borisjuk, N., Hrmova, M., Lopato, S., 2014. Transcriptional regulation of cuticle biosynthesis. Biotechnol. Adv., 32, 526-540.

Bourdenx, B., Bernard, A., Domergue, F., Pascal, S., Le´ger, A., Roby, D., Pervent, M., Vile, D., Haslam, R.P., Lessire, J.A.N.R., Joube`s, J., 2011. Overexpression of Arabidopsis

ECERIFERUM1

Promotes

Wax

Very-Long-Chain

Alkane

Biosynthesis and Influences Plant Response to Biotic and Abiotic Stresses. Plant Physiol., 156, 29-45. Fang, Y.J., Xiong, L.Z., 2015. General mechanisms of drought response and their application in drought resistance improvement in plants. Cell. Mol. Life Sci., 72(4), 673-689. Haslam, T.M., Haslam, R., Thoraval, D., Pascal, S., Delude, C., Domergue, F., Fernández, A.M., Beaudoin, F., Napier, J.A., Kunst, L., Joubès, J., 2015. ECERIFERUM2-LIKE Proteins Have Unique Biochemical and Physiological Functions in Very-Long-Chain Fatty Acid Elongation. Plant Physiol., 167, 682-692. Haslam, T.M., Mañas-Fernández, A., Zhao, L., Kunst, L., 2012. Arabidopsis ECERIFERUM2 is a component of the fatty acid elongation machinery required for fatty acid extension to exceptional lengths. Plant Physiol., 160, 1164-1174. Hooker, T.S., Millar, A.A., Kunst, J., 2002. Significance of the Expression of the CER6 Condensing Enzyme for Cuticular Wax Production in Arabidopsis. Plant Physiol., 129, 1568-1580. Kazuko, Y.S., Kazuo, S., 2006. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Ann. Rev. Plant Biol., 2006, 57(0), 781-803. Kim, H., Yu, S-in., Jung, S.H., Lee, B., Suh, M.C., 2019. The F-box Protein SAGL1 and ECERIFERUM3 Regulate Cuticular Wax Biosynthesis in Response to Changes

in

Humidity

in

Arabidopsis.

Plant

Cell,

https://doi.org/10.1105/tpc.19.00152 Lee, K., Lee, H.J., Yoon, S., Kim, H.U., Seo, P.J., 2015. The Arabidopsis MYB96 Transcription

Factor

Is

a

Positive

Regulator

of

ABSCISIC

ACID-INSENSITIVE4 in the Control of Seed Germination. Plant Physiol., 168, 677-689. Lim, C.W., Baek, W., Jung, J., Kim, J-H., Lee, S.C., 2015. Function of ABA in stomatal defense against biotic and drought stresses. Int. J. Mol. Sci., 16(7), 15251-15270. Liu, X-J., Liu, X., An X-H., Han, P-L., You, C-X., Hao, Y-J., 2017. An Apple Protein

Kinase MdSnRK1.1 Interacts with MdCAIP1 to Regulate ABA Sensitivity. Plant Cell Physiol., 58(10), 1631–1641. Li, Y-Y., Mao, K., Zhao, C., Zhao, X-Y., Zhang, R-F., Zhang, H-L., Shu, H-R., Hao, Y-J., 2013. Molecular cloning and functional analysis of a blue light receptor gene MdCRY2 from apple (Malus domestica). Plant Cell Rep., 32(4), 555–566. Lü, S., Song, T., Kosma, D.K., Parsons, E.P., Rowland, O., Jenks, M.A., 2009. Arabidopsis CER8 encodes LONG-CHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis. Plant J., 59, 553-564. Martin, L.B.B., Romero, P., Fich, E.A., Domozych, D.S., Rose, J.K.C., 2017. Cuticle Biosynthesis in Tomato Leaves Is Developmentally Regulated by Abscisic Acid. Plant Physiol., 174, 1384-1398. Osakabe, Y., Yamaguchi-Shinozaki, K., Shinozaki, K., Tran, L-S, P., 2013. ABA control of plant macroelement membrane transport systems in response to water deficit and high salinity. New Phytol., 202, 35-49. Pascala, S., Bernarda, A.,

Deslousa, P., Gronniera, J., Fournier-Goss, A., Domerguea,

F., Rowland, O., Joubès, J., 2019. Arabidopsis CER1-LIKE1 functions in a cuticular

very-long-chain

alkane-forming

complex.

Plant

Physiol.,

https://doi.org/10.1104/pp.18.01075 Qi, C-H., Jiang, H., Zhao, X-Y., Mao, K., Liu, H-T., Li, Y-Y., Hao, Y-J., 2019. The Characterization, Authentication, and Gene Expression Pattern of the MdCER Family in Malus domestica. Hort. Plant J., 5 (1), 1-9. Qi, C-H., Zhao, X-Y., Jiang, H., Zheng, P-F., Liu, H-T., Li, Y-Y., Hao, Y-J., 2019. Isolation and functional identification of an apple MdCER1 gene. Plant Cell Tiss. Org. Cul., 136, 1-13. Rowl, O., Zheng, H., Hepworth, S.R., Lam, P., Jetter, R., Kunst, L., 2006. CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. Plant Physiol., 142: , 866-877. Schönherr, J., 1976. Water permeability of isolated cuticular membranes:The effect of cuticular waxes on diffusion of water. Planta., 131(2), 159-164. Seo. P.J., Park, C.M., 2011. Cuticular wax biosynthesis as a way of inducing drought resistance. Plant Signal. Behav., 6:7, 1043-1045. Seo, P.J., Lee, S.B., Suh, M.C., Park, M.J., Go, Y.S., Park, C.M., 2011. The MYB96 transcription factor regulates cuticular wax biosynthesis under drought

conditions in Arabidopsis. Plant Cell, 23, 1138-1152. Seo, P.J., Xiang, F., Qiao, M., Park, J-Y., Lee, Y.N., Kim, S-J., Lee, Y-H., Park, W.J., Park, C-M., 2009. The MYB96 Transcription Factor Mediates Abscisic Acid Signaling during Drought Stress Response in Arabidopsis. Plant Physiol., 151, 275-289. Shepherd, T., Griffiths, D.W., 2006. The effects of stress on plant cuticular waxes. New Phytol., 171, 469-499. Shi, L., Dean, G.H., Zheng, H., Meents, M.J., Haslam, T.M., Haughn, G.W., 2019. ECERIFERUM11/C-TERMINAL DOMAIN PHOSPHATASE LIKE 2 affects secretory trafficking. Plant Physiol., https://doi.org/10.1104/pp.19.00722 Wang, R-K., Cao, Z-H., Hao, Y-J., 2014. Overexpression of a R2R3 MYB gene MdSIMYB1 increases tolerance to multiple stresses in transgenic tobacco and apples. Physiologia Plantarum, 150(1), 76-87. Wang, T., Xing, J., Liu, X., Yao, Y., Hu, Z., Peng, H., Xin, M., Zhou, D., Zhang, Y., Ni, Z., 2018. GCN5 contributes to stem cuticular wax biosynthesis by histone acetylation of CER3 in Arabidopsis. J. Exp. Bot., 69, 2911-2922. Wang, W., Xu, C., Ren, J., Liu, X., Black, K., Gai, X., Wang, Q., Ren, H., 2015. Cucumber ECERIFERUM1 (CsCER1), which influences the cuticle properties and drought tolerance of cucumber, plays a key role in VLC alkanes biosynthesis. Plant Mol. Biol., 87, 219-233. Wang,

X., Guan, Y., Zhang, D., Dong, X., Tian, L., Qu, L.Q., 2017. A

b-Ketoacyl-CoA Synthase Is Involved in Rice Leaf Cuticular Wax Synthesis and Requires a CER2-LIKE Protein as a Cofactor. Plant Physiol., 173, 944-955. Wang, Z., Tian, X., Zhao, Q., Liu, Z., Li, X., Ren, Y., Tang, J., Fang, J., Xu, Q., Bua, Q., 2018. The E3 Ligase DROUGHT HYPERSENSITIVE Negatively Regulates Cuticular Wax Biosynthesis by Promoting the Degradation of Transcription Factor ROC4 in Rice. Plant Cell, 30, 228-244. Xia, Y., Nikolau, B.J., Schnable, P.S., 1996. Cloning and Characterization of CER2, an Arabidopsis Gene Cuticular Wax Accumulation. Plant Cell, 8, 1291-1304. Xia, Y., Nikolau , B.J., Schnable, P.S., 1997. Developmental and Hormonal Regulation of the Arabidopsis CER2 Gene That Codes for a Nuclear-Localized Protein Required for the Normal Accumulation of Cuticular Waxes. Plant Physiol., 115(3), 925-937. Yang, X., Zhao, H., Kosma, D.K., Tomasi, P., Dyer, J.M., Li, R., Liu , X., Wang, Z.,

Parsons, E.P., Jenks , M.A., Lü, S., 2017. The Acyl Desaturase CER17 Is Involved in Producing Wax Unsaturated Primary Alcohols and Cutin Monomers. Plant Physiol., 173, 1109-1124. Yeat, T.H., Rose, J.K.C., 2013. The Formation and Function of Plant Cuticles. Plant Physiol., 163 (1), 5-20. Yu, Y-Q., Wang, J-H., Sun C-H., Zhang Q-Y., Hu, D-G., Hao, Y-J. 2018. Ectopic expression of the apple nucleusencoded thylakoid protein MdY3IP1 triggers early-flowering and enhanced salt tolerance in Arabidopsis thaliana. BMC Plant Biol., 18, 18. Zhang, Y-L., Zhang, C-L., Wang, G-L., Wang, Y-X., Qi, C-H., You, C-X., Li, Y-Y., Hao, Y-J., 2019. Apple AP2/EREBP transcription factor MdSHINE2 confers drought resistance by regulating wax biosynthesis. Planta, 249(5), 1627-1643. Zhang, Y-L., Zhang, C-L., Wang, G-L., Wang, Y-X., Qi, C-H., Zhao Q., You, C-X., Li, Y-Y., Hao, Y-J., 2019. The R2R3 MYB transcription factor MdMYB30 modulates plant resistance against pathogens by regulating cuticular wax biosynthesis. BMC Plant Biol., 19, 362. Zhu, L.,

Guo, J.S., Zhu, J., Zhou, C., 2014. Enhanced expression of EsWAX1

improves drought tolerance with increased accumulation of cuticular wax and ascorbic acid in transgenic Arabidopsis. Plant Physiol. Biochem., 75, 24-35. Zong, W., Tang, N., Yang, J., Peng, L., Ma, S-Q., Xu, Y., Li, G-L., Xiong, L-Z., 2016. Feedback Regulation of ABA Signaling and Biosynthesis by a bZIP Transcription Factor Targets Drought-Resistance-Related Genes. Plant Physiol., 171, 2810–2825

Figure Legends

Figure 1. Schematic diagram of the MdCER2 sequence and phylogenetic analysis of the CER2 gene family in different species. (a) Schematic diagram of MdCER2 genomic and cDNA sequences. (b) Phylogenetic tree of the CER2 gene family in different species, including peach (Prunus persica), plum (Prunus domestica), waxberry (Prunus yedoensis), white pear (Pyrus bretschneideri), apple (Malus domestica), rose (Rosa chinensis), durian (Durio zibethinus), cocoa (Theobroma cacao), poplar (Populus trichocarpa), rubber tree (Hevea brasiliensis), and castor oil (Ricinus communis). (c) Alignment of amino acid sequences of MdCER2 and AtCER2

proteins.

Figure 2. MdCER2 localization and expression analysis. (a) Subcellular localization of MdCER2. (b) MdCER2 expression in apple root, stem, leaf, flower, and fruit as detected by qRT-PCR.

Figure 3. Change of wax load. (a) qRT-PCR analysis of ectopic expression of MdCER2 in Arabidopsis. (b) Total cuticular wax content of leaves from WT and MdCER2 transgenic Arabidopsis lines. (c) Total cuticular wax content of stems from WT and MdCER2 transgenic Arabidopsis lines. (d) Scanning electron microscopy showing the relative of wax structures of leaves in WT and MdCER2 transgenic plants. The magnification times of the SEM was 1500x. (e) Scanning electron microscopy showing the relative of wax structures of stems in WT and MdCER2 transgenic plants. The magnification times of the SEM was 1000x.

Figure 4. Examination of Water loss and permeability of Arabidopsis leaves. (a) The rate of water loss from leaves in WT and MdCER2 transgenic plants. (b) Chlorophyll leaching assay in rosette leaves of WT and MdCER2 transgenic plants. FW indicates fresh weight.

Figure 5. Transgenic expression of MdCER2 in Arabidopsis enhances ABA sensitivity. (a) Expression analysis of MdCER2 in response to ABA. (b) Phenotype of MdCER2 transgenic and WT Arabidopsis in MS, MS+10 µmol L−1 ABA, and MS+30 µmol L−1 ABA media. Growth of WT and MdCER2 Arabidopsis in MS, MS+4% PEG, and MS+6% PEG media, scale bar=1 cm. (c) The primary root length of WT versus transgenic Arabidopsis. (d) The number of lateral roots. The means and standard deviations were calculated from the results of five independent experiments.

Figure 6. MdCER2 improves drought resistance. (a) The expression of MdCER2 in response to drought, as determined by qPCR. (b) Watered and unwatered WT and MdCER2 transgenic Arabidopsis growing in soil. (c) Chlorophyll leaching assay in rosette leaves of WT and MdCER2 transgenic Arabidopsis, expressed in µmol/mg. FW = fresh weight. (d) The root length of WT versus transgenic Arabidopsis. (e) The number of lateral roots in WT versus transgenic Arabidopsis. The means and standard

deviations were calculated from the results of five independent experiments.

Supplementary Figure 1. Conserved transferase domains in MdCER2 and AtCER2.

Supplementary Figure 2. Predicted protein interactions of MdCER2. MdCER2 is denoted by the red asterisk.

Table 1. MdCER2 promoter cis-regulatory element analysis. Cis-eleme

Cis-element

nt name

sequence

ABRE

ACGTG

Function

cis-acting element involved in the abscisic acid responsiveness

MBSI

Number

2

AAAAAAC MYB binding site involved in (G/C)GTTA

flavonoid biosynthetic genes regulation 1

Box 4

ATTAAT

Part of a conserved DNA module involved in light responsiveness 4

G-box

CACGTC TACGTG

cis-acting regulatory element involved in light responsiveness

1

MYB

TAACTG

1

MYC

CATGTG

6

CAATTG SARE

TTCGAC CATCTT

cis-acting element involved in salicylic acid responsiveness

1

Our study identified a wax-related gene, MdCER2, in apple. MdCER2 functions in promoting accumulation of cuticular wax in both leaves and stems, decreasing water loss and permeability in leaves, increasing lateral root number, changing plant ABA sensitivity, and enhancing drought resistance.

Declaration of interests ☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ☐The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Author Contributions YYL initiated and designed the research. MSZ, HJ, YC, YXW, and CXY performed the experiments. MSZ analyzed the data. YYL and YJH contributed reagents/materials/analysis tools. MSZ and YYL wrote the manuscript. All authors have read and approved the manuscript.