Mechanisms of erythromycin resistance of Campylobacter spp. isolated from food, animals and humans

Available online at www.sciencedirect.com

International Journal of Food Microbiology 120 (2007) 186 – 190 www.elsevier.com/locate/ijfoodmicro

Mechanisms of erythromycin resistance of Campylobacter spp. isolated from food, animals and humans M. Kurinčič a , N. Botteldoorn b , L. Herman b , S. Smole Možina a,⁎ a

b

University of Ljubljana, Biotechnical Faculty, Department of Food Science and Technology, Ljubljana, Slovenia Ministry of the Flemish Community; Centre for Agricultural Research, Department for Animal Product Quality and Transformation Technology, Melle, Belgium

Abstract Macrolides are regarded as drugs of choice for treatment of human campylobacteriosis. The use of antimicrobials for this purpose as well as in food animal production could result in macrolide resistance in Campylobacter species. Campylobacter isolates exhibit two different phenotypes with regard to erythromycin resistance: high-level resistance (HLR) and low-level resistance (LLR). Thirty-six food/animal and human isolates of Campylobacter jejuni and C. coli were examined for their mechanisms of resistance to erythromycin. The data presented here confirm the previous findings that the A2075G mutation in the 23S rRNA gene is the most frequently reported mechanism of high-level erythromycin resistance in Campylobacter isolates. The efflux pump inhibitor PAβN increased susceptibility to erythromycin for at least 16–32-fold in all examined HLR isolates, suggesting that the efflux mechanism acts in synergy with the 23S rRNA mutation to confer high-level erythromycin resistance. This was also confirmed in the isolates with sequence variation in the efflux pump cmeB gene. Additionally, the PAβN restored the susceptibility of LLR strains to the level of minimal inhibitory concentrations (MICs) of the susceptible strains and also reduced the MICs of the susceptible C. jejuni and C. coli isolates. The data suggest that active efflux contributes to the intrinsic resistance to erythromycin in Campylobacter and also contribute to high-level resistance. © 2007 Elsevier B.V. All rights reserved. Keywords: Campylobacter; Erythromycin resistance mechanisms; Mutation; Efflux pump gene cmeB

1. Introduction Thermotolerant Campylobacter spp., especially Campylobacter jejuni and C. coli, are considered to be the most frequent cause of human acute bacterial enteritis worldwide (Tauxe, 2002). Campylobacters are widely distributed and occur in the intestine of domestic, production and wild animals. Numerous transmission vehicles are known, but raw milk, untreated surface water and especially poultry meat are major sources of human infections (Franco, 1988; Corry and Atabay, 2001). Campylobacteriosis is usually self-limiting, but in immunocompromised patients and in cases of severe diseases, antibiotic treatment is required (Aarestrup and Engberg, 2001; Allos, 2001). In these cases, macrolide erythromycin and fluoroqui⁎ Corresponding author. University of Ljubljana, Biotechnical Faculty, Department of Food Science and Technology, Jamnikarjeva 101, SI-1111 Ljubljana, Slovenia. Tel.: +386 1 423 11 61; fax: +386 1 256 62 96. E-mail address: [email protected] (S. Smole Možina). 0168-1605/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2007.03.012

nolones are the antibiotics of choice for treatment (Moore et al., 2005). The increasing level of resistance to these antibiotics among Campylobacter spp. (Engberg et al., 2001) is recognized as emerging public health problem. The inhibitory action of erythromycin is effective at the early stages of protein synthesis when the drug blocks the growth of the nascent peptide chain (Andersson and Kurland, 1987), presumably causing premature dissociation of the peptidyltRNA from the ribosome (Menninger, 1995). Two mechanisms of erythromycin resistance have been described in C. jejuni and C. coli. Mutations in domain V of the 23S rRNA gene at positions 2074 and 2075 have been attributed with high-level erythromycin resistance (Jensen and Aarestrup, 2001; Vacher et al., 2003; Payot et al., 2004). In addition, a number of recent studies demonstrated the involvement of CmeABC efflux pump in both intrinsic and acquired resistance to erythromycin in C. jejuni and C. coli, mostly by the use of the efflux pump inhibitor (EPI), phenylalanine-arginine β-naphthylamide (PAβN) (Payot et al., 2004; Mamelli et al., 2005).

M. Kurinčič et al. / International Journal of Food Microbiology 120 (2007) 186–190

We studied 36 Campylobacter food/animal and human isolates to examine the presumptive diversity in the mechanisms of erythromycin resistance. After MICs determination with the broth microdilution method, we compared phenotypic results, PCR-restriction fragment length polymorphism (PCR-RFLP) and sequence of the 23S rRNA gene. The contribution of efflux pump activity was also examined together with the sequence variation in the efflux pump cmeB gene. 2. Materials and methods 2.1. Bacterial strains and growth conditions Human and food/animal strains used in this study are listed in Table 1. C. coli ATCC 33559 was used as a control strain. They were isolated and identified phenotypically and by multiplex polymerase chain reaction (mPCR) as described previously (Zorman and Smole Možina, 2002). The cultures were stored at − 80 °C in brain heart infusion (BHI) broth with blood and glycerol (Herman et al., 2003). The isolates were cultivated at 42 °C under microaerophilic conditions in gas tight containers (O2 5%, CO2 10, N2 85%) on charcoal cefoperazone deoxycholate (CCDA) or Columbia agar, supplemented with 5% horse blood (Oxoid, Hampshire, UK). 2.2. Antimicrobial susceptibility testing C. jejuni and C. coli isolates were selected from different sources on the basis of high or intermediate erythromycin resistance, determined first by disk-diffusion and Epsilometertest as described previously (Kurinčič et al., 2005). The MICs (minimal inhibitory concentration) of erythromycin (Sigma– Aldrich, Saint Louis, USA) in Campylobacter isolates were then determined using the broth microdilution method as described previously (Luber et al., 2003), with slight modifications. Two-fold serial dilutions of erythromycin were used at the concentrations from 0.015 to 512 μg/mL. Breakpoint used was N 4 μg/mL as recommended by the French Antibiogram Committee (CA-SFM, available at http://www.sfm.asso.fr/). The MICs, lowest concentration were no growth was observed, were determined on the base of fluorescent signal measured by Microplate Reader (Tecan, Mannedorf/Zurich, Switzerland) after adding CellTiter-Blue® Reagent following manufacturers' instructions (Promega Corporation, Madison, USA) to culture media. According to the recommendations of CA-SFM, strains with the MICs ≤ 2 μg/mL and N4 μg/mL were susceptible and resistant, respectively. Strains that repeatedly presented the MIC of erythromycin from 4 μg/mL to 8 μg/mL and ≥ 512 μg/mL were termed low-level resistant (LLR) and high-level resistant (HLR) strains, respectively.

187

Table 1 Isolates of Campylobacter jejuni and C. coli used in the study, the results of antimicrobial susceptibility testing and PCR-RFLP and sequencing of 23S rRNA Strains

MIC Erythromycin (μg/mL)

Target modifications of 23S rRNA

Number

Species

Source −EPI a

+EPI b

PCRRFLP

Sequencing

5815 K 33/1 115P 17015 23416 28264 28841 GC 182 WC 35 FC 80 28233 21F FC 41 573/03 K 44/3 K 51/1 3755 3552 GC 190 K 29/1 28432 229 VC 81 GC 154 FC 8 FC 10 VC 110722 VC 110725 M 37 137 140 VC 7114 VC 11076 2235 171 Reference strain ATCC 33559

C. coli C. coli C. coli C. jejuni C. jejuni C. jejuni C. coli C. coli C. coli C. coli C. jejuni C. coli C. coli C. jejuni C. coli C. coli C. jejuni C. jejuni C. coli C. jejuni C. jejuni C. coli C. jejuni C. coli C. coli C. coli C. coli C. coli C. coli C. coli C. coli C. coli C. coli C. coli C. coli

Human Poultry Poultry Human Human Human Human Poultry Poultry Poultry Human Animal Poultry Human Poultry Poultry Human Human Poultry Poultry Human Poultry Poultry Poultry Poultry Poultry Pig Pig Poultry Poultry Poultry Pig Pig Human Poultry

0.25 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 1 1 1 1 1 1 1 2 2 2 2 2 2 4 4 4 8 8 512 N512 N512 N512 N512 512 512

b0.03 0.063 b0.03 0.063 b0.03 b0.03 b0.03 0.125 b0.015 0.125 0.125 0.125 0.063 b0.03 0.063 0.063 0.125 0.03 0.25 0.063 0.063 0.03 2 b0.015 0.125 0.063 0.125 0.063 16 32 32 32 32 16 32

− − − − − − − − − − − − − − − − − − − − − − − − − − − − A2075G A2075G A2075G − A2075G ND c ND

− − − − − − − − − − − − − − − − − − − − − − − − − − − − A2075G A2075G A2075G − A2075G ND ND

C. coli

Feces, Pig

2

a b c

0.0625 −

−

EPI: efflux pump inhibitor. Concentration used: (20 μg/ml). ND, not determined.

Müller Hinton (MH) broth was supplemented with PAβN (Sigma–Aldrich, Saint Louis, USA) to a of final concentration 20 μg/mL as described by Cagliero et al. (2005) and Corcoran et al. (2005). Three independent experiments were conducted to confirm the reproducibility of MIC data and the ATCC 33559 strain was included as a quality control strain.

2.3. The effect of efflux pump inhibitor PAβN 2.4. Detection of mutation in the 23S rRNA gene by PCR-RFLP To investigate the contribution of efflux pump activity to erythromycin resistance, the MIC of erythromycin was determined in all selected isolates using broth microdilution method in the presence and absence of EPI PAβN. For this purpose, the

A PCR-RFLP protocol was used to detect the mutation at position 2075 of the 23S rRNA gene as described by Leser et al. (1997). The primers Ery23Sfor (5′ GTAAACGGCCGTAACTA

188

M. Kurinčič et al. / International Journal of Food Microbiology 120 (2007) 186–190

3′) and Ery23Srev (5′ GACCGAACTGTCTCACGACG 3′) were designed to amplify a 714 bp long fragment. A mutation at position 2075 led to five fragments after BsmAI digestion (311, 226, 102, 57 and 18 bp). The fragments were separated on 1.5% agarose gel. 2.5. Sequence analysis of the 23S rRNA gene Sequence analysis was used to confirm the results obtained by PCR-RFLP and to detect potential mutations in the 23S rRNA gene. Briefly, the 23S rRNA gene was amplified using PCR as described previously (Leser et al., 1997), and the amplification product was run on agarose gel to confirm the correct amplicon size. Purification of the PCR products was done using a High Pure PCR Product Purification Kit (Roche, Germany) following manufacturers' instructions. Sequence reaction using the forward primer Ery23Sfor was done using 4 μl of the Big Dye Ready Reaction mix (BigDyeTerminator version 3.1; Applied Biosystems, Foster City, California), 1.6 μl of 1: 50 diluted primer, 1.4 μl of HPLC-water and 3 μl of the purified PCR product. The sequence reaction conditions were 28 cycles of 90 °C for 10 s, 50 °C for 5 s, and 60 °C for 4 min. Separation of the obtained fragments was performed in 3700 ABI capillary sequencer (Applied Biosystems, Foster City, California). The 23S rRNA nucleotide sequences of the Campylobacter strains were aligned using Kodon (Applied Maths, Sint-Martens-Latem, Belgium), and compared with previously reported sequence. 2.6. PCR amplification and sequencing of cmeB gene The primers used for amplification of cmeB gene were designed from the published genome sequence of the C. jejuni NCTC 11168 strain. The 661 bp long fragment of cmeB gene was amplified using the MK-2 (5′ AGCTGGAGCTATAGGTCTTACAAA 3′) and MK RT-4 (5′ TAGTCTTCCTTGCATAGTGATTGAATAA 3′) primers. Amplification reactions were carried out in a 25 μL volume containing 1 μL of crude cell lysate, 2.5 μL 10× PCR buffer II, 1.5 μL MgCl2 (25 mM), 1.25 μL dNTP (2 mM), 0.25 μL of each primer (1 μg/μL), and 0.2 μL of AmpliTaq® DNA Polymerase (5 U/μL). PCR reagents were obtained from Applied Biosystems. The PCR cycle included initial denaturation at 95° for 1 min and 30 cycles of denaturation for 15 s at 95°, primer annealing for 15 s at 58°, and extension of denaturation for 30 s at 72°. Amplified PCR fragments were separated on 1.5% agarose gel. PCR products were purified and sequenced using the forward primer MK-2 as described in Section 2.5. 3. Results and discussion 3.1. Antimicrobial susceptibility In total, thirty-six food/animal and human selected isolates of C. jejuni and C. coli, were examined for erythromycin resistance with broth microdilution method. The results of testing are presented in Table 1.

When assuming the results, 24 out of 36 strains (66.6%) of Campylobacter spp. were susceptible to erythromycin. A significant difference was found between C. jejuni and C. coli. Only C. coli strains were confirmed to be resistant to erythromycin. A similar situation was reported previously (Payot et al., 2004; Cagliero et al., 2005, 2006). Although since 1990s, a significant increase in the prevalence of resistance to macrolides among human Campylobacter isolates has been reported, the prevalence of erythromycin resistance in C. jejuni has remained low, often well below 12% of isolates (Gibreel and Taylor, 2006; Quinn et al., 2006). Conversely, a higher frequency of resistance is reported in C. coli (up to 70%). Similarly, in food animals, the prevalence of erythromycin resistance is generally reported to be higher in C. coli than in C. jejuni, particularly among C. coli isolates from swine (Bywater et al., 2004; Aarestrup et al., 1997; Saenz et al., 2000). With regard to erythromycin resistance, three groups of strains were observed: the first group was susceptible with MICs from 0.25 to 2 μg/mL, the second was low-level resistant (LLR) with MICs from 4 to 8 μg/mL, and the third group was high-level resistant (HLR) with MICs higher than 512 μg/mL. The results of erythromycin resistance in Campylobacter isolates from poultry meat determined in our previous study (Kurinčič et al., 2005) are in several cases significantly different from those obtained with broth microdilution method. There is no simple explanation for this. Additionally, the instability of the erythromycin resistance phenotype of isolate VC 81 has been observed. Low-level erythromycin resistance (64 μg/mL) has been determined in the first antimicrobial testing, while no resistance (2 μg/mL) has been confirmed in further investigation. No clear explanation was found for this finding although it could be reasonable that low-level erythromycin resistance mediated by efflux mechanism would be only a conditional (temporary) induction that provide bacterial pathogens a rapid adaptation to environmental changes. Therefore, the stability of erythromycin resistance in LLR Campylobacter isolates should be a subject of additional examination. 3.2. Target modifications in the 23S rRNA gene Modification of the ribosomal target of macrolides is the most known mechanism, and this occurs by mutation. In our study, the PCR-RFLP procedure has been used to test for the presence of the A2075G mutation in the 23S rRNA gene. Four out of five tested strains of C. coli, belonging to the HLR group, exhibited the A2075G mutation (Table 1). Conversely, the A2075G mutation was not identified in any of LLR and susceptible strains. Other studies have also indicated that the mutation at position 2075 is usually responsible for high-level erythromycin resistance (Vacher et al., 2003; Payot et al., 2004; Mamelli et al., 2005; Gibreel et al., 2005; Corcoran et al., 2005; Cagliero et al., 2005, 2006; Keller and Perreten, 2006). Interestingly, no A2075G mutation was identified in one HLR C. coli (VC 7114). A similar situation has been reported by Gibreel et al. (2005).

M. Kurinčič et al. / International Journal of Food Microbiology 120 (2007) 186–190

3.3. Sequence analysis of the 23S rRNA gene Sequence analysis of the 714 bp amplicon of the 23S rRNA gene was used to confirm results obtained by PCR-RFLP and to reveal other mutations responsible for erythromycin resistance. According to the PCR-RFLP results, sequence analysis confirmed the transition mutation 2075 (A → G) in the 23S rRNA gene in four HLR C. coli isolates. Finally, none of our isolates contained the 2074 mutation that is also responsible for high-level erythromycin resistance in Campylobacter (Vacher et al., 2003). In case of HLR strain VC 11076, the sequence analysis revealed an additional mutation (C → T), already described by Vacher et al. (2003), although it has not been identified to confer erythromycin resistance. 3.4. The effect of the EPI PAβN In our study, the efficiency of the EPI PAβN, regarding erythromycin resistance, was tested for all strains. The PAβN restored the susceptibility of LLR strains to the level of MICs of the susceptible strains and also reduced the MICs of the susceptible C. jejuni and C. coli isolates (Table 1). These strains did not carry any mutation in the 23S rRNA gene. Similar observations have been recently published (Payot et al., 2004; Mamelli et al., 2005; Corcoran et al., 2005; Cagliero et al., 2005, 2006). The results confirm that efflux mechanism mediated mainly by the CmeABC efflux pump plays an active role in lowlevel resistance to erythromycin in Campylobacter. In HLR isolates, the use of PAβN increased the susceptibility by at least 16–32-fold in all examined strains (Table 1). Similar data have been found by Corcoran et al. (2005) in one human isolate of C. jejuni as well as by Gibreel et al. (2005) in four strains of C. jejuni and C. coli. Conversely, a significantly lower effect of PAβN was found in other reports. The use of a low concentration of PAβN (20 μg/mL) mainly caused no change in erythromycinresistance level (Mamelli et al., 2005; Gibreel et al., 2005; Corcoran et al., 2005), whereas a higher concentration of inhibitor (40 μg/mL) led to 2–4-fold decrease in erythromycinresistance level in some HLR isolates (Payot et al., 2004), in spite of the target gene mutation. Additionally, another interesting observation was found in HLR isolate VC 7114 (Table 1). PCR-RFLP and sequencing of the 23S rRNA gene fragment revealed no mutation. In addition, the inhibitor PAβN decreased the MIC for 32-fold. However, the molecular mechanism of erythromycin resistance acting besides the efflux mechanism remains in this case indeterminated. Based on bioinformatics data, ten putative efflux pumps, including the well-known CmeABC system, have been identified in C. jejuni (Ge et al., 2005). To date, the CmeABC system has been well characterized as the major multidrug efflux pump system (Pumbwe and Piddock, 2002; Lin et al., 2003; Luo et al., 2003; Pumbwe et al., 2004) as well as was proved to be involved in macrolide resistance in Campylobacter (Pumbwe and Piddock, 2002; Lin et al., 2003). Alternatively, some observations have been recently published suggesting that an additional efflux mechanism distinct from CmeABC is active in Campylobac-

189

ter. In addition, this mechanism is sensitive to macrolides and to PAβN (Mamelli et al., 2005). 3.5. Sequence analysis of cmeB gene We examined potential sequence differences in part of the efflux pump cmeB gene among eight C. coli isolates with different levels of erythromycin resistance. The deduced nucleotide sequences of the fragments were compared with the cmeB sequence of the reference strain NCTC 11168 (available in GenBank). Sequencing showed diverse genetic variation among examined strains (84.4%–99.7% of identity) with 99.7% identity with the HLR C. coli VC 7114 strain. To our knowledge, no data are published about direct explanations of efflux function and sequence variations of efflux genes. Further research is necessary to investigate correlations between the polymorphisms in the cmeB gene and the activity or function of the efflux pump CmeABC. Acknowledgments The authors would like to thank the Ministry of Higher Education, Science and Technology of Republic of Slovenia and the Ministry of the Flemish Community for financial support of the project and to Dr. Friederike Hilbert from VUW, Vienna, as well as to Dr. Marina Bujko from IVZ RS, Ljubljana for some Campylobacter strains used in this study. References Aarestrup, F.M., Engberg, J., 2001. Antimicrobial resistance of thermophilic Campylobacter. Veterinary Research 32, 311–321. Aarestrup, F.M., Nielsen, E.M., Madsen, M., Engberg, J., 1997. Antimicrobial susceptibility patterns of thermophilic Campylobacter spp. from humans, pigs, cattle, and broilers in Denmark. Antimicrobial Agents and Chemotherapy 41, 2244–2250. Allos, B.M., 2001. Campylobacter jejuni infections: update on emerging issues and trends. Clinical Diseases 32, 1201–1206. Andersson, S., Kurland, C.G., 1987. Elongating ribosomes in vivo are refractory to erythromycin. Biochimie 69, 901–904. Bywater, R., Deluyker, H., Deroover, E., de Jong, A., Marion, H., McConville, M., Rowan, T., Shryock, T., Shuster, D., Thomas, V., Vallé, M., Walters, J., 2004. A European survey of antimicrobial susceptibility among zoonotic and commensal bacteria isolated from food-producing animals. Journal of Antimicrobial Chemotherapy 54, 744–754. Cagliero, C., Cloix, L., Cloeckaert, A., Payot, S., 2006. High genetic variation in the multidrug transporter cmeB gene in Campylobacter jejuni and Campylobacter coli. Journal of Antimicrobial Chemotherapy 58, 168–172. Cagliero, C., Mouline, C., Payot, S., Cloeckaert, A., 2005. Involvement of the CmeABC efflux pump in the macrolide resistance of Campylobacter coli. Journal of Antimicrobial Chemotherapy 56, 948–950. Corcoran, D., Quinn, T., Cotter, L., Fanning, S., 2005. An investigation of the molecular mechanisms contributing to high-level erythromycin resistance in Campylobacter. International Journal of Antimicrobial Agents 27, 40–45. Corry, J.E.L., Atabay, H.I., 2001. Poultry as a source of Campylobacter and related organisms. Journal of Applied Microbiology 90, 96S–114S. Engberg, J., Aarestrup, F.M., Taylor, D.E., Gerner-Schmidt, P., Nachamkin, I., 2001. Quinolone and macrolide resistance in Campylobacter jejuni and C. coli: resistance mechanisms and trends in human isolates. Emerging Infectious Diseases 7, 24–34. Franco, D.A., 1988. Campylobacter species: considerations for controlling a foodborne pathogen. Journal of Food Protection 51, 145–153.

190

M. Kurinčič et al. / International Journal of Food Microbiology 120 (2007) 186–190

Ge, B., McDermott, P.F., White, D.G., Meng, J., 2005. Role of efflux pumps and topoisomerase mutations in fluoroquinolone resistance in Campylobacter jejuni and Campylobacter coli. Antimicrobial Agents and Chemotherapy 49, 3347–3354. Gibreel, C., Taylor, D.E., 2006. Macrolide resistance in Campylobacter jejuni and Campylobacter coli. Journal of Antimicrobial Chemotherapy 58, 243–255. Gibreel, A., Kos, V.N., Keelan, M., Trieber, C.A., Levesque, S., Michaud, S., Taylor, D.E., 2005. Macrolide resistance in Campylobacter jejuni and Campylobacter coli: molecular mechanism and stability of the resistance phenotype. Antimicrobial Agents and Chemotherapy 49, 2753–2759. Herman, L., Heyndrickx, M., Grijspeerdt, K., Vandekerchove, D., Rollier, I., De Zutter, L., 2003. Routes for Campylobacter contamination of poultry meat: epidemiological study from hatchery to slaughterhouse. Epidemiology and Infection 131, 1169–1180. Jensen, L.B., Aarestrup, F.M., 2001. Macrolide resistance in Campylobacter coli of animal origin in Denmark. Antimicrobial Agents and Chemotherapy 45, 371–372. Keller, J., Perreten, V., 2006. Genetic diversity in fluoroquinolone and macrolide-resistant Campylobacter coli from pigs. Veterinary Microbiology 113, 103–108. Kurinčič, M., Berce, I., Zorman, T., Smole Možina, S., 2005. The prevalence of multiple antibiotic resistance in Campylobacter spp. from retail poultry meat. Food Technology and Biotechnology 43, 157–163. Leser, T.D., Moller, K., Jensen, T.K., Jorsal, S.E., 1997. Specific detection of Serpulina hyodysentariae and potentially pathogenic weakly beta-hemolytic porcine intestinal spirochetes by polymerase chain reaction targeting 23S rRNA. Molecular and Cellular Probes 11, 363–372. Lin, J., Sahin, O., Michel, L.O., Zhang, Q., 2003. Critical role of multidrug efflux pump CmeABC in bile resistance and in vivo colonization of Campylobacter jejuni. Infection and Immunity 71, 4250–4259. Luber, P., Bartelt, E., Genschow, E., Wagner, J., Hahn, H., 2003. Comparison of broth microdilution, E-test, and agar dilution methods for antibiotic susceptibility testing of Campylobacter jejuni and Campylobacter coli. Journal of Clinical Microbiology 41, 1062–1068. Luo, N., Sahin, O., Lin, J., Michel, L., Zhang, O., 2003. In vivo selection of Campylobacter isolates with high levels of fluoroquinolone resistance associated with gyrA mutations and the function of the CmeABC efflux pump. Antimicrobial Agents and Chemotherapy 47, 390–394.

Mamelli, L., Prouzet-Mauleon, V., Pages, J.-M., Megraud, F., Bolla, J.-M., 2005. Molecular basis of macrolide resistance in Campylobacter: role of efflux pumps and target mutations. Journal of Antimicrobial Chemotherapy 56, 491–497. Menninger, J.R., 1995. Mechanism of inhibition of protein synthesis by macrolide and lincosamide antibiotics. Journal of Basic & Clinical Physiology & Pharmacology 6, 229–250. Moore, J.E., Corcoran, D., Dooley, J.S.G, Fanning, S., Lucey, B., Matsuda, M., McDowell, D.A., Megraud, F., Millar, B.C., O'Mahony, R., O'Riordan, L., O'Rourke, M., Rao, J.R., Rooney, P.J., Sails, A., Whyte, P., 2005. Campylobacter. Veterinary Research 36, 351–382. Payot, S., Avrain, L., Magras, C., Praud, K., Cloeckaert, A., Chaslus-Dancla, E., 2004. Relative contribution of target gene mutation and efflux to fluoroquinolone and erythromycin resistance, in French poultry and pig isolates of Campylobacter coli. International Journal of Antimicrobial Agents 23, 468–472. Pumbwe, L., Piddock, L.J.V., 2002. Identification and molecular characterization of CmeB, a Campylobacter jejuni multidrug efflux pump. FEMS Microbiology Letters 206, 185–189. Pumbwe, L., Randall, L.P., Woodward, M.J., Piddock, L.J.V., 2004. Expression of the efflux pump genes cmeB, cmeF and the porin gene porA in multipleantibiotic-resistant Campylobacter jejuni. Journal of Antimicrobial Chemotherapy 54, 341–347. Quinn, T., Bolla, J.M., Pages, J.M., Fanning, S., 2006. Antibiotic-resistant Campylobacter: could efflux pump inhibitors control infection? Journal of Antimicrobial Chemotherapy 59, 1230–1236. Saenz, Y., Zarazaga, M., Lantero, M., Gastanares, M.J., Baquero, F., Torres, C., 2000. Antibiotic resistance in Campylobacter strains isolated from animals, foods, and humans in Spain in 1997–1998. Antimicrobial Agents and Chemotherapy 44, 267–271. Tauxe, R.V., 2002. Emerging foodborne pathogens. International Journal of Food Microbiology 78, 31–41. Vacher, S., Menard, A., Bernard, E., Megraud, F., 2003. PCR-restriction fragment length polymorphism analysis for detection of point mutations associated with macrolide resistance in Campylobacter spp. Antimicrobial Agents and Chemotherapy 47, 1125–1128. Zorman, T., Smole Možina, S., 2002. Classical and molecular identification of thermotolerant campylobacters from poultry meat. Food Technology and Biotechnology 40, 177–183.