Methionine sulfoxide reductases and methionine sulfoxide in the subterranean mole rat (Spalax): Characterization of expression under various oxygen conditions

Comparative Biochemistry and Physiology, Part A 161 (2012) 406–414

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part A journal homepage: www.elsevier.com/locate/cbpa

Methionine sulfoxide reductases and methionine sulfoxide in the subterranean mole rat (Spalax): Characterization of expression under various oxygen conditions Jackob Moskovitz a,⁎, Assaf Malik b, Alvaro Hernandez c, Mark Band c, 1, Aaron Avivi b,⁎⁎, 1 a b c

Department of Pharmacology and Toxicology, School of Pharmacy, University of Kansas, Lawrence Kansas, 66045, USA Laboratory of Animals Molecular Evolution, Institute of Evolution, University of Haifa, Mt. Carmel, Haifa 31905, Israel The W.M. Keck Center for Comparative and Functional Genomics, University of Illinois at Urbana-Champaign, Urbana, IL, 61801, USA

a r t i c l e

i n f o

Article history: Received 27 October 2011 Received in revised form 21 December 2011 Accepted 22 December 2011 Available online 30 December 2011 Keywords: Oxidative stress Methionine oxidation Hypoxia Hyperoxia Antioxidants

a b s t r a c t The blind subterranean mole rat (Spalax ehrenbergi) exhibits a relatively long life span, which is attributed to an efficient antioxidant defense affording protection against accumulation of oxidative modifications of proteins. Methionine residues can be oxidized to methionine sulfoxide (MetO) and then enzymatically reduced by the methionine sulfoxide reductase (Msr) system. In the current study we have isolated the cDNA sequences of the Spalax Msr genes as well as 23 additional selenoproteins and monitored the activities of Msr enzymes in liver and brain of rat (Rattus norvegicus), Spalax galili, and Spalax judaei under normoxia, hypoxia, and hyperoxia. Under normoxia, the Msr activity was lower in S. galili in comparison to S. judaei and R. norvegicus especially in the brain. The pattern of Msr activity of the three species was similar throughout the tested conditions. However, exposure of the animals to hypoxia caused a significant enhancement of Msr activity, especially in S. galili. Hyperoxic exposure showed a highly significant induction of Msr activity compared with normoxic conditions for R. norvegicus and S. galili brain. It was concluded that among all species examined, S. galili appears to be more responsive to oxygen tension changes and that the Msr system is upregulated mainly by severe hypoxia. © 2011 Elsevier Inc. All rights reserved.

1. Introduction The blind subterranean mole rats of the Spalax ehrenbergi superspecies are wild rodents that belong to the family Spalacidae (Nevo, 1999; Nevo et al., 2001). Spalax superspecies consist of at least 12 allospecies in the Near East, in which four Spalax allospecies reside in Israel (Nevo, 1991, 1999; Nevo et al., 2001) These allospecies are adapted to four different climatic regimes: Spalax galili (2n = 52) inhabits the cool-humid Upper Galilee mountains; Spalax golani (2n = 54) lives in the semi-humid, cool Golan Heights; Spalax carmeli (2n = 58) inhabits the humid–warm central region of Israel and Spalax judaei (2n = 60) resides in the warm-dry southern regions (Nevo et al., 2001). Spalax represents an extreme model of adaptation to an underground environment consistent with almost total darkness and a hypoxic and hypercapnic stress caused by rapid and sudden changes of O2 and CO2 levels during the winter rainy season (Nevo,

Abbreviations: (Msr), Methionine sulfoxide reductase; (MetO), Methionine sulfoxide. ⁎ Corresponding author. Tel.: + 1 785 864 3536; fax: + 1 785 864 5219. ⁎⁎ Corresponding author. Tel.: + 972 4 8240446; fax: + 972 4 8246554. E-mail addresses: [email protected] (J. Moskovitz), [email protected] (A. Avivi). 1 Equal contribution. 1095-6433/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpa.2011.12.014

1999). Oxygen levels close to normal (21%) were monitored in the burrows of Spalax during the dry season in Israel; however, these levels are reduced to 6% O2 with increased CO2 levels (7%) during the rainy season (Shams et al., 2005). Moreover, in laboratory experiments, Spalax survives 3% O2 and 15% CO2 for 8 to 14 h compared with 2 to 4 h for the above ground hypoxia-sensitive rat (Avivi et al., 1999). The terminal pO2 record is approximately 3% with significant differences between the most hypoxia-tolerant S. galili and the less hypoxia- tolerant S. judaei (Arieli and Nevo, 1991). A known response to hypoxia is the generation of reactive oxygen species (ROS). The adaptive strategies that Spalax developed to counteract the deleterious effects of hypoxia have only recently been investigated. It was found, that Spalax exhibits remarkably low biomolecular damage, which implies the existence of physiological strategies to avoid oxidative damage under fluctuating O2 and CO2 levels in the mole rat's subterranean niche (Widmer et al., 1997; Band et al., 2009). Moreover, antioxidant enzymes, such as superoxide dismutase (SOD), catalase, and glutathione reductase (GR), exhibited high activity in both Spalax genders (Caballero et al., 2006; Soria-Valles et al., 2010). Interestingly, SOD and GR activities showed statistically significant differences between Spalax judaei (S. judaei), Spalax galili (S. galili) and rat (S. Schülke et al., Unpublished results). The blind subterranean mole rat (Spalax) and naked mole rat (NMR) exhibit relatively long life spans (Nevo, 1999). This phenomenon is attributed to their induced antioxidant defense that, among

J. Moskovitz et al. / Comparative Biochemistry and Physiology, Part A 161 (2012) 406–414

other effects, has provided these animals with better protection against accumulation of oxidative modifications of proteins. Enhanced oxidative modification of methionine (Met) residues in proteins is usually accompanied with an increase of protein-carbonyl adducts and are mostly associated with aging and the occurrence of neurodegenerative diseases (Gabbita et al., 1999; Dong et al., 2003; Moskovitz, 2007; Oien and Moskovitz, 2007; Oien et al., 2009, 2010b; Moskovitz and Oien, 2010). These modifications are often detrimental to protein function (Oien and Moskovitz, 2008) and thereby mechanisms have evolved to readily reverse them. Met residues undergo substantial oxidation in-vivo, producing Met sulfoxide (MetO). Moreover, MetO is enzymatically reduced by the methionine sulfoxide reductase (Msr) system, consisting of MsrA and MsrB enzymes that specifically reduce either the S or R enantiomer of MetO, respectively (Moskovitz, 2005; Oien and Moskovitz, 2008). MsrA is a positive regulator of MsrB (Moskovitz and Stadtman, 2003), is down regulated with age (Stadtman et al., 2002), and is considered to be the major enzyme in the Msr system, providing protection against oxidative stress (Moskovitz et al., 1995, 1998, 2001). Thus, insufficient reduction of MetO residues by the Msr system may cause protein malfunction (via MetO accumulation) leading to abnormal cellular function and premature death. Indeed, disruption of the MsrA gene in mouse (Msr −/ − mouse) (Moskovitz et al., 2001) and other lower organisms (Moskovitz et al., 1995, 1997) resulted in increased oxidative stress, protein oxidation, and shortened life span. In mice, the ablation of MsrA also caused neurological changes that are associated with age-dependent neurodegenerative diseases such as sporadic Parkinson's and Alzheimer's diseases (Pal et al., 2007; Oien et al., 2008, 2010a; Ortiz et al., 2011). Thus, it was concluded that the Msr system is important in protecting an organism against oxidative stress damage and promotes longevity. As mole rat and naked mole rat exhibit exceptional long life span it was intriguing to follow the expression pattern of the Msr enzymes in these organisms. Recently, it has been reported that Msr activities of the naked mole rat are similar to those observed in control mice. In the current study we have characterized the expression pattern of the Msr genes in S. gallili and S. judaei and monitored the effects of various oxygen levels on gene expression. MsrB1 and thioredoxin reductase are selenoproteins that participate in the enzymatic activity of the Msr system. Selenoproteins and the Msr system play an important role in antioxidant defense. Through a recent Spalax transcriptome project we have identified the cDNA sequences of S. galili MsrA, MsrB1 (a selenoprotein), MsrB2, and 23 additional selenoproteins found in this species (Malik et al., 2011).

407

University Local Animal Care and Use Committee approved the experimental protocol.

2.2. Determining mRNA levels of MsrA, MsrB1, MsrB2, and MsrB3 in brain and liver tissues Total RNA was extracted from Spalax tissues using TRI Reagent (Molecular Research Center, Inc.) following the manufacturer's instructions. All RNA samples were checked for quality using the Agilent Bioanalyzer (Agilent). Two micrograms of total RNA was used in a 20 μL reverse transcription reaction. The equivalent of 5 ng RNA was used as template for quantitative PCR (qPCR). Calibration curves were produced with 1:5 dilution series for all primer sets in order to determine PCR efficiency. Fold change and statistical analysis were computed using the program REST (Pfaffl et al., 2002) using 10,000 permutations and normalized to an 18S control gene. Reactions were run using either Power Sybergreen or Universal Taqman Mastermix (Applied Biosystems-Life Technologies). Each of 3 biological replicates for each condition was run in triplicate wells on an Applied Biosciences Sequence Analyzer HT7900 (Applied Biosystems-Life Technologies). Primer sequences are listed below: Primer sets for rat sequences: Rat primer sets were ordered directly from Applied Biosciences (part numbers listed below): Rn00584008_m1 (MsrA); Rn01461232_g1 Sepx1 (MsrB1); Rn01765104_m1 (MsrB2); and Rn01509709_m1 LOC680036 (MsrB3). Spalax Primers used are as follows: Spalax MsrA Amplicon = 61 bp, 5′-GGAGGCTACACACGCAATCC (forward) and CTGCATGCCCAGTTTTTCCT (reverse). Spalax MsrB1 (SelX) Amplicon = 64 bp, 5′-TTTCCAGTTGCTCAAAGTATGCA (forward) and 5′-CATGGATGGTCTCAGTGAATGC (reverse). Spalax MsrB2 Amplicon = 59 bp, 5′-ACCAGCCAAAGGTTTTGCAT (forward) and 5′-CAGGGTTTGCTTGGTTTGAAG (reverse). Spalax MsrB3 Amplicon = 63 bp, 5′-AGGCTGTGGCAAGTAAGTGTGA (forward) and 5′-GAGGTGCCTGAGGAAACACAA (reverse) 18S Amplicon = 79 bp, 5′-GATCCATTGGAGGGCAAGTCT (forward) and 5′AACTGCAGCAACTTTAATATACGCTATT 2.3. Determining the DNA sequences of Spalax selenoproteins

2. Materials and methods 2.1. Animals and experimental conditions Spalax, wild subterranean rodents, must be hunted in the field. They can be captured only during the short rainy season in Israel, and cannot be bred in captivity; hence the paucity of available working material. Adult males of the following three species (n = 3 per species): Rattus norvegicus, S. judaei and S. galili (Nevo et al., 2001), were used in each experiment performed in this study. Spalax were captured in the field and housed in individual cages in the animal house of the Institute of Evolution, University of Haifa, Israel. They were kept under ambient O2 atmosphere, at controlled temperatures (22–24 °C), under seasonal light/dark cycle, and fed with carrots ad libitum. Following exposure of each animal group to hypoxia (6% O2 for 5 h or 10% O2 for 44 h), hyperoxia (85% O2 for 24 h), or normoxia, the animals were euthanized. Tissues were surgically removed, snapped frozen in Liquid N2 and stored at −80 °C until further use. The Haifa

Sequence contigs of Spalax selenoproteins were identified by similarity search of Spalax transcriptome sequences against known mouse, rat and human selenoprotein RNA sequences (Malik et al., 2011).

2.4. Determining Msr activity levels in postmortem brain and liver tissues Defrosted postmortem brains and livers were homogenized with PBS at 4 °C using a Teflon homogenizer in the presence of protease inhibitors cocktail (Roche). Tissue extracts were spun down (10,000 ×g) and the resulting supernatant was kept at −80 °C until further use. Aliquots of defrosted supernatants were taken for measuring protein concentration using the Bio-Rad protein assay (Bio-Rad). Equal amounts of protein from each sample were analyzed for total Msr activity in a reaction mixture containing dabsyl-MetO (substrate, 200 μM), DTT (reducing agent, 20 mM), and Tris, pH = 7.4 (buffer, 25 mM). Following incubation for 30 min at 37 °C, the reaction mixture was analyzed for the formation of dabsyl-Met using an HPLC based method, as previously described (Moskovitz et al., 1998, 2000).

408

J. Moskovitz et al. / Comparative Biochemistry and Physiology, Part A 161 (2012) 406–414

2.5. Determining protein-MetO levels in postmortem brain and liver tissues Supernatant fractions prepared from brain tissues (as described above) were separated on SDS-gel electrophoresis (50 μg per fraction), followed by western blot analysis using primary rabbit anti-MetO antibodies (Oien et al., 2009) and secondary HRP-anti rabbit antibodies (Santa Cruz). After exposure of the nitrocellulose blot to an X-ray film, the intensity of each detected band was determined using the Image J program. 3. Results and discussion Both Spalax species, S. galili and S. judaei, as well as control rat (R. norvegicus) were exposed to normoxia, hypoxia (acute-short insult of 6% O2 for 5 h and long-mild stress of 10% O2 for 44 h), and hyperoxia (85% O2 for 24 h). The hypoxic treatments used reflect the oxygen levels measured in Spalax's underground tunnels after a rain session (6% O2), and the estimated longer term hypoxic conditions under which Spalax is exposed while rebuilding collapsed burrows after a rain-session (10% O2 for 44 h). Total Msr specific activity was measured in postmortem liver and brain of the animals to evaluate the Msr activity among the species and at different oxygen regimes. 3.1. Msr enzyme total specific activity in liver and brain 3.1.1. Overall observations Generally, the pattern of Msr activity in liver and brain of all species was similar throughout the tested conditions, with few exceptions. Interestingly, the Msr activity pattern in brain showed greater

changes from normoxic levels compared with liver under conditions of 6% O2 and 85% O2. For example, brain and liver showed between 1.3–10 fold and 1.3–2.3 fold changes in Msr activity, respectively, following 6% O2 exposure compared to the corresponding normoxic levels (Fig. 1). Similarly, brain and liver showed between 1.0–2.0 fold and 0.5–1.0 fold change in Msr activity, respectively, following 85% O2 exposure compared to the corresponding normoxic levels (Fig. 1). The larger changes of Msr activity in brain may be explained by the fact that the total Msr level in brain is about 10% of the total Msr level expressed in liver. Thus, the relative changes in brain Msr expression levels are better represented by the measured Msr activity, since it is monitored more in the linear range of the assay (Moskovitz et al., 2001). Accordingly, it is suggested that the brain is more responsive than the liver to compensate for any shortage of active Msrs due to environmental changes including oxygen tension.

3.1.2. Normoxia specific observations Under normoxia (Fig. 1), the averaged Msr activity was lower in S. galili in comparison to S. judaei and R. norvegicus especially in the brain (Fig. 1B; P b 0.001 compared with either strain) and to a lower extent in liver (Fig. 1A; P b 0.01 compared with either strain). Considering the fact that S. galili has a higher tolerance to hypoxic conditions than both S. judaei and rat, if the levels of Msr activity can serve as an indicator of oxidative stress level (i.e. higher level of oxidative stress induces Msr activity to protect against oxidative damage), then it is suggested that S. galili is better protected from oxidative damage relative to the other two species. The specific mechanism that provides S. galili the ability to maintain survival under relative lower Msr levels in the presence of normoxic

Fig. 1. Total Msr specific activity in liver and brain of R. norvegicus, S. judaei, and S. galili. Msr activity of each species organ (n = 3) was measured in a reaction mixture that was incubated for 30 min at 37 °C containing: 25 mM Tris pH, 7.4, aliquots of liver (A) or brain (B) tissue extracts, dabsyl-MetO (200 μM substrate), and 20 mM DTT. Then the reaction mixture was analyzed for the levels of Met-dabsyl formed according to the procedure (Moskovitz et al., 1998; 2000). Specific activity is defined as pMoles dabsyl Met formed/min/ mg of tissue extract protein. The specific activity measured is calculated as % of the specific activity determined for R. norvegicus at normoxic conditions (which represents 100% Msr specific activity). Note that only for data presentation reasons, each presented percent activity refers to the activity as percent of rat normoxic activity. It facilitates data presentation and comparison to control animal under normal conditions (normoxia). Statistical analyses were performed using student's t-test and significance was determined as follows: *, represents P b 0.01 of the value compared with normoxic value of each species. ** represents P b 0.01 of the S. galili normoxic value compared with R. norvegicus normoxic value. #, represents P b 0.01 of the S. galili hypoxic/hyperoxic values compared with S. galili normoxic value in brain.

J. Moskovitz et al. / Comparative Biochemistry and Physiology, Part A 161 (2012) 406–414

conditions is yet to be determined. No significant difference in Msr activity was observed between S. judaei and R. norvegicus under normoxia in either tissue (Fig. 1). 3.1.3. Hypoxia specific observations Short time exposure of the animals to severe hypoxia (6% O2 for 5 h) caused a significant enhancement of Msr activity mostly in brain, but also in liver of the three species examined, compared with the corresponding normoxic levels of each species (Fig. 1 P b 0.01). When comparing to normoxic levels of each species, the most significant change in Msr activity in response to 6% O2 exposure was observed in S. galili (Fig. 1). S. galili lives under the most hypoxic conditions and this may explain its greater response to 6% O2 hypoxia. Overall, the increased activity of Msr enzymes in response to hypoxia in all species examined provides the first evidence indicating that the Msr system may be induced upon exposure to hypoxia. The cellular factors that are involved in the regulation of this process of elevating Msr activity under hypoxia are yet to be determined. Exposure of R. norvegicus and S. judaei to a longer and milder hypoxic stress (44 h of 10% O2) did not cause a significant change in Msr activities compared with Msr activities monitored in their parallel animal groups under normoxia (control normal conditions; although non-significant fluctuations of activities were observed) (Fig. 1). In contrast, only the Msr activity of S. galili brain was significantly increased relative to its normoxic activity level following 10% O2 exposure (4.0 fold increase, P b 0.01, Fig. 1B). The latter observation is mainly due to the relative lower Msr specific activity of S. galili compared to the activities observed for R. norvegicus and S. judaei under normoxia (Fig. 1B). Nevertheless, S. galili Msr activity was elevated to similar levels shown for R. norvegicus and S. judaei under 10% O2 hypoxia. This observation may be an indicative factor demonstrating

409

a greater response sensitivity to oxygen tension changes of S. galili than R. norvegicus and S. judaei. 3.1.4. Hyperoxia specific observations After exposure of the animals to hyperoxic conditions (85% O2), the liver Msr activity showed a slight non-significant increase in R. norvegicus and a slight non-significant reduction in S. judaei and S. galili compared with their normoxic Msr activities (Fig. 1A). In contrast, the hyperoxic exposure showed a highly significant induction of Msr activity compared with normoxic conditions in R. norvegicus and S. galili brain (2.0 fold increase in R. norvegicus brain (P b 0.01) and 4.0 fold increase in S. galili brain (P b 0.01); Fig. 1B). It is important to note that the observed increase of Msr activity in S. galili under hyperoxia is mainly due to the relatively lower Msr specific activity of S. galili under normoxia (while the hyperoxic Msr activities of S. galili and S. judaei are similar, Fig. 1B). Similarly to the response of S. galili to 10% O2 hypoxia (see above), this observation reinforces other evidence for the higher sensitivity to oxygen tension changes of S. galili than R. norvegicus and S. judaei. The exposure of animals to 85% hyperoxia most likely causes an increase of protein oxidation (e.g. increase in protein carbonyl moiety, (Moskovitz et al., 2001)) that may inhibit Msr enzymatic activity through oxidative damage to Msr proteins (Moskovitz et al., 2001). Therefore, the monitored Msr activity resulting from such treatment may not reflect the total expressed levels of the Msr enzymes (active and non-active forms). It is suggested that both S. judaei and S. galili are more vulnerable to oxidative damage than R. norvegicus under hyperoxia, as reflected by the inhibitory effect on Msr activities (compared with the higher Msr activity of R. norvegicus under hyperoxia). The hyperoxic brain of S. judaei showed a slight non-significant increase of Msr activity and the hyperoxic brain of S. galili showed a significant increase of

Fig. 2. Changes of liver mRNA levels of Msr genes following hypoxia and hyperoxia compared with normoxia. A. 6% hypoxia for 5 h. B. 10% hypoxia for 44 h; C. 85% hyperoxia for 24 h. mRNA levels were determined as described in Materials and methods. Significance was determined when P b 0.05 using REST (Pfaffl et al., 2002) using 10,000 permutations and normalized to an 18S control gene.

410

J. Moskovitz et al. / Comparative Biochemistry and Physiology, Part A 161 (2012) 406–414

Fig. 3. Changes of brain mRNA levels of Msr genes following hypoxia and hyperoxia compared with normoxia. A. 6% hypoxia for 5 h. B. 10% hypoxia for 44 h; C. 85% hyperoxia for 24 h. mRNA levels were determined as described in Materials and methods. Significance was determined when P b 0.05 using REST (Pfaffl et al., 2002) using 10,000 permutations and normalized to an 18S control gene.

Msr activity, relative to their basal activities under normoxia (Fig. 1B). The latter results may hint at a compensatory mechanism for the oxidative damage that affects Msr activity through upregulation of Msr transcription in brain of Spalax animals (See supporting evidence for such possibility in Fig. 3C). To assess the contribution of transcription regulation on the observed Msr activities, the mRNA levels of each organ tested was determined.

in liver than MsrA1 and MsrB1 (Hansel et al., 2003); therefore their contribution to the total Msr activity measured is minimal. Following exposure to hyperoxia (85% O2), liver showed a significant upregulation of MsrB3 transcription in R. norvegicus and MsrB1 in S. judaei but not in S. galili (compared to normoxia, 1.9 fold and 1.3 fold increase respectively, P b 0.05; Fig. 2C). This upregulation of R. norvegicus MsrB3 mRNA probably contributed to the slight nonsignificant increase of total Msr activity observed in R. norvegicus liver (Fig. 1A). However, the upregulation of S. judaei MsrB1 mRNA

3.2. Transcription regulation of Msr genes 3.2.1. Transcription regulation of Msr genes in liver Following exposure to hypoxia (6% O2 for 5 h), a significant upregulation of MsrA transcription in livers of all three species was observed (compared to normoxia, an average of ~1.7 fold increase, P b 0.05; Fig. 2A). MsrB3 transcription, however, was upregulated only in R. norvegicus under these conditions (an average of ~ 2.0 fold increase, P b 0.05; Fig. 2A). In liver, MsrA is considered to be the major enzyme of the Msr system (Moskovitz et al., 2001). Thus, it is suggested that upregulation of MsrA transcription is the major contributing factor to the total Msr activity observed in liver of all the examined species under these conditions (Fig. 1A). Exposure of the animals to hypoxic stress of 10% O2 for 44 h showed a significant upregulation of MsrB2 and MsrB3 transcription in R. norvegicus only (compared to normoxia, an average of ~ 1.5 fold increase, P b 0.05; Fig. 2B). In contradistinction to the hypoxia-tolerant Spalax, R. norvegicus are hypoxia-sensitive. This may explain the liver upregulation of MsrB2 under 6% O2 (Fig. 2A) and MsrB2 and MsrB3 under 10% O2 (Fig. 2B) in R. norvegicus, but not in Spalax, as a means to compensate for this vulnerability. There is no correlation between R. norvegicus Msr activity and mRNA levels of R. norvegicus MsrB2 and MsrB3 (Fig. 1A vs Fig. 2B) in liver. This phenomenon may be because MsrB2 and MsrB3 proteins are expressed in much lower abundance

Fig. 4. Methionine sulfoxide (MetO) levels in brain of R. norvegicus, S. judaei, and S. galili. A. Equal protein amounts (50 μg) of the brain extracts used for Msr activity analyses (Fig. 1) were separated on SDS-gel-electrophoresis followed by western blot analysis, using anti-MetO antibodies as the primary antibodies. The same blot was probed with anti-β actin antibodies (Abcam) and their reaction served as protein loading control. kDa, molecular mass in kilo-Dalton. S.J., S. judaei. S.G., S. galili. B. Densitometry measurements of the 50 kDa band detected in panel A.

J. Moskovitz et al. / Comparative Biochemistry and Physiology, Part A 161 (2012) 406–414

was too low to produce a significant induction of total Msr activity (Fig. 1A). 3.2.2. Transcription regulation of Msr genes in brain Compared to normoxia, 5 h exposure to 6% O2 caused a significant upregulation of MsrA transcription in R. norvegicus (1.5 fold increase, P b 0.05; Fig. 3A) and MsrB3 in S. judaei and S. galili brain (2.13 and 1.6 fold increases respectively, P b 0.05; Fig. 3A). These responses correlate with the induction of total Msr activity under 6% hypoxia in all species examined (Fig. 1B). Compared to normoxia, hypoxia of 10% O2 for 44 h induced a significant upregulation of MsrB3 transcription in the brain of both S. judaei and S. galili (1.74 and 1.62 fold increase respectively, P b 0.05; Fig. 3A) but not in R. norvegicus. This upregulation of MsrB3 probably

411

contributes to the total upregulation of Msr activity demonstrated in brain of S. galili under 10% hypoxia (Fig. 1B, when comparing the activity value to the normoxic activity value; P b 0.01). However, the transcriptional upregulation of MsrB3 in S. judaei seems to have a negligent effect on total Msr activity in this species (Fig. 1B). Following exposure to hyperoxia (85% O2), MsrA and MsrB3 transcription in S. galili was significantly upregulated (compared to normoxia, 1.62 fold increase for both genes, P b 0.05; Fig. 2C). This response probably contributes to the total upregulation of Msr activity demonstrated in brain of S. galili under 85% hyperoxia (Fig. 1B, when comparing the activity value to the S. galili normoxic activity value; P b 0.01). The average changes of Msr transcription levels in R. norvegicus and S. judaei were not significantly altered upon exposure to hyperoxia. This data correlates with the insignificant change in

Fig. 5. cDNA sequences of Msr gene family of Spalax. Sequences (5′ to 3′) were determined according to procedures described in Materials and methods. The starting ATG codon and the stop codon are underlined. The TGA codon that codes for selenocysteine in MsrB1 is highlighted.

412

J. Moskovitz et al. / Comparative Biochemistry and Physiology, Part A 161 (2012) 406–414

Fig. 5 (continued).

total Msr activity in S. galili (Fig. 1B, when comparing to the S. galili normoxic activity value). However, there is no correlation between the increase of total Msr activity and the unchanged Msr transcription levels in R. norvegicus under hyperoxia (Fig. 3C vs Fig. 1B). One possible explanation for such patterns is that translational or posttranslational events, that are mediated through oxidative stress and are specific to rodents like R. norvegicus, but do not affect Spalax, may enhance translation or activation of Msr. 3.3. Methionine oxidation To determine the effects of accumulation of methionine-oxidized proteins on the presence of MetO-proteins, western blot analysis was applied (Fig. 4). The analysis was performed on brain extracts because they have shown much greater changes between species and conditions used in Msr activity. In addition, as mentioned before, total Msr specific activity in brain is about 10% of the total Msr activity shown in liver. Therefore, brain will be more vulnerable to the accumulation of MetO-proteins than liver due to relatively limited capability of reducing them. Following the western blot analysis using our novel anti-MetO antibodies (Oien et al., 2009), a major protein band of ~50 kDa was observed (Fig. 4A). Accordingly, the Met-oxidized 50 kDa band intensity was followed as a marker for the levels of MetO-proteins in each fraction. The data presented in Fig. 4A and its quantification in Fig. 4B

show that both Spalax species contain about 30% of the MetO-50 kDa detected in R. norvegicus under normoxic conditions. However, following exposure to 10% O2 for 44 h, Spalax protein-MetO levels were increased to ~70% compared to R. norvegicus normoxic levels (Fig. 4). We chose to analyze protein-MetO levels in brains that were exposed to 10% O2 for 44 h and not 6% O2 for 6 h for two major reasons: 1. The 10% O2 Msr activities in all species were comparable to the normoxic activity of Msr in R. norvegicus. This similarity of Msr activity provides better assessment of the contribution of other cellular factors to the accumulation of MetO-proteins; 2. The exposure time period to the hypoxic conditions is relatively long (44 h), thereby facilitating the accumulation of MetO-proteins (unlike the exposure to 6% O2 that lasted only 5 h). It is yet to be determined how an exposure to 10% O2 for 44 h causes elevated protein-MetO levels in Spalax. Induction of Spalax protein-MetO levels to similar levels detected in R. norvegicus was observed following hyperoxia of 85% O2 for 24 h (~100%, Fig. 4B). This phenomenon can be explained by two major factors: 1. Oxidation of proteins is enhanced under these or similar hyperoxic conditions as previously observed in mouse (Moskovitz et al., 2001); 2. Msr activities were shown to decline under similar hyperoxic conditions in mouse (Moskovitz et al., 2001) and therefore indirectly causing an increase of protein-MetO accumulation. Based on these data, it is suggested that S. judaei and S. galili have similar and better protection against the accumulation of MetO-proteins in brain

J. Moskovitz et al. / Comparative Biochemistry and Physiology, Part A 161 (2012) 406–414

413

Table 1 Identified cDNA sequences of selenoproteins of Spalax. Sequences were determined according to procedures described in Materials and Methods. Sequence ID

GenBank Spalax ID

Gene symbol

Ref.seq. best hit

e-value

% identity

similarity (bp)

Description

isotig05158 isotig06033 isotig13551 isotig13626 isotig14401 isotig17378 isotig18257 isotig22826 isotig22970 isotig23107 isotig24161 isotig27079 isotig33626 isotig35650 isotig36555 isotig37286 isotig39958 isotig40658 isotig44977 isotig22982 isotig14108 isotig40478 isotig48413

JO008885 JO009755 JO017298 JO017373 JO018138 JL985327 JL986204 JL990749 JL990889 JL991033 JL992083 JL994989 JO001181 JL969787 JL970688 JL971418 JL974085 JL974784 JL979094 JO002447 JO017851 JL974604 JL982524

SEPX1 (MSRB1) SELO SECISBP2 GPX4 SEPN1 SELS GPX8 SELH GPX1 SELM GPX3 SEPHS2 SELT DIO2 TXNRD2 SEPP1 GPX2 SELK GPX7 SEPW1 SEPHS1 TXNRD1 SELI (EPT1)

NM_001170424 NM_027905 NM_024002 NM_008162 NM_029100 NM_173120 NM_001106411 NM_001159501 NM_008160 NM_001199931 NM_022525 NM_009266 NM_001014253 NM_010050 NM_013711 NM_001115115 NM_002083 NM_001114877 NM_001106673 NM_009156 NM_001104630 NM_031614 NM_001168391

1.00E-103 0 0 0 0 0 0 2.00E-93 1.00E-172 1.00E-125 0 0 0 1.00E-162 0 0 0 1.00E-177 0 1.00E-141 0 0 0

88.2 84.6 87.3 89.3 90.8 90.8 90.6 84.8 87.2 85.4 91.5 90.1 91.0 84.2 88.9 81.7 91.9 89.8 92.6 91.9 91.5 87.5 90.8

364 1086 1495 723 1014 663 616 460 639 542 598 1020 1002 852 1505 1589 593 563 501 395 1521 1790 1400

Equus caballus selenoprotein X Mus musculus 1300018J18 gene Rattus norvegicus SECIS binding protein 2 Mus musculus glutathione peroxidase 4 Mus musculus selenoprotein N, Rattus norvegicus selenoprotein S Rattus norvegicus glutathione peroxidase 8 Macaca mulatta selenoprotein H Mus musculus glutathione peroxidase 1 Callithrix jacchus selenoprotein M Rattus norvegicus glutathione peroxidase 3 Mus musculus selenophosphate synthetase 2 Rattus norvegicus selenoprotein T Mus musculus deiodinase, iodothyronine, type II Mus musculus thioredoxin reductase 2 Pan troglodytes selenoprotein P Homo sapiens glutathione peroxidase 2 Pan troglodytes selenoprotein K Rattus norvegicus glutathione peroxidase 7 Mus musculus selenoprotein W Rattus norvegicus selenophosphate synthetase 1 Rattus norvegicus thioredoxin reductase 1 Equus caballus selenoprotein I

compared with R. norvegicus under normoxia and mild hypoxia. This protection mechanism against oxidative damage to proteins probably involves not only the Msr system but also other cellular antioxidants. 3.4. Gene sequences for cDNAs of the Msr gene family and genomic sequences of selected selenoproteins of Spalax The cDNA sequences of the Msr genes of Spalax, as observed from our transcriptome sequencing (Malik et al., 2011), were determined as described in “Experimental” and presented here for the first time in Fig. 5. The most significant hit for translated protein of each sequence to a mammalian Msr cDNA was as follows: 6e-92 for MsrA (Rat), 1e-63 for MsrB1 (horse), 9e-86 for MsrB2 (pig), and 2e-116 for MsrB3 (human). The mammalian MsrB1 is a selenoprotein (BarNoy and Moskovitz, 2002) and was also found to be a selenoprotein in Spalax (Fig. 5). Thus, for the sake of sequence comparisons between selenoproteins of Spalax and other species, we have also determined the Spalax cDNA sequences of known selenoproteins (for total of 23 genes: Table 1). It is clear that most of the known mammalian selenoprotein genes are present and conserved in Spalax. However, it is important to note that glutathione peroxidase 1 (GpX1) in naked mole rat has an early stop codon (thereby, does not contain the downstream selenocysteine), which caused significantly lower GPx activity and also selenium content (Oien and Moskovitz, 2009). 4. Conclusions The Msr activities in the naked mole rat are comparable with their mice control activity [35], while the Msr activity in S. galili is much lower than in S. judaei and R. norvegicus controls under normoxic conditions (Fig. 1). These differences between Spalax and naked mole rat may account for their possible differences in adjusting to environmental conditions that are characterized by changes in oxygen levels. There is a solid amount of evidence suggesting that the methionine sulfoxide reductase system, selenoproteins, and selenium play an important role in protecting cells against oxidative stress and protein oxidation (Oien and Moskovitz, 2009). Consequently, new data about the signal transduction processes leading to upregulation of

these components in S. judaei and S. galili will be most beneficial for our understanding of the biological characteristics of these species. For example, this data will provide insight into the biological processes and protein functions that regulate the adaption of these species to their environmental habitats and how they maintain long term survival. In addition, these findings may contribute importantly to the treatment of stroke, or ischemic, conditions resulting from cardiac arrest by developing treatments that cause upregulation of the Msr system. Acknowledgments This work was supported by the United States-Israel Binational Science Foundation (BSF) grant number 2005346 to MB, AH and AA; and by The Hadwig Miller Fund to JM. References Arieli, R., Nevo, E., 1991. Hypoxic survival differs between two mole rat species (Spalax ehrenbergi) of humid and arid habitats. Comp. Biochem. Physiol. A 100, 543–545. Avivi, A., Resnick, M.B., Nevo, E., Joel, A., Levy, A.P., 1999. Adaptive hypoxic tolerance in the subterranean mole rat Spalax ehrenbergi: the role of vascular endothelial growth factor. FEBS Lett. 452, 133–140. Band, M., Joel, A., Hernandez, A., Avivi, A., 2009. Hypoxia-induced BNIP3 expression and mitophagy: in vivo comparison of the rat and the hypoxia-tolerant mole rat, Spalax ehrenbergi. FASEB J. 23, 2327–2335. Bar-Noy, S., Moskovitz, J., 2002. Mouse methionine sulfoxide reductase B: effect of selenocysteine incorporation on its activity and expression of the seleno-containing enzyme in bacterial and mammalian cells. Biochem. Biophys. Res. Commun. 297, 956–961. Caballero, B., Tomas-Zapico, C., Vega-Naredo, I., Sierra, V., Tolivia, D., Hardeland, R., Rodriguez-Colunga, M.J., Joel, A., Nevo, E., Avivi, A., Coto-Montes, A., 2006. Antioxidant activity in Spalax ehrenbergi: a possible adaptation to underground stress. J. Comp. Physiol. A 192, 753–759. Dong, J., Atwood, C.S., Anderson, V.E., Siedlak, S.L., Smith, M.A., Perry, G., Carey, P.R., 2003. Metal binding and oxidation of amyloid-beta within isolated senile plaque cores: Raman microscopic evidence. Biochemistry 42, 2768–2773. Gabbita, S.P., Aksenov, M.Y., Lovell, M.A., Markesbery, W.R., 1999. Decrease in peptide methionine sulfoxide reductase in Alzheimer's disease brain. J. Neurochem. 73, 1660–1666. Hansel, A., Jung, S., Hoshi, T., Heinemann, S.H., 2003. A second human methionine sulfoxide reductase (hMSRB2) reducing methionine-R-sulfoxide displays a tissue expression pattern distinct from hMSRB1. Redox Rep. 8, 384–388. Malik, A., Korol, A., Hubner, S., Hernandez, A.G., Thimmapuram, J., Ali, S., Glaser, F., Paz, A., Avivi, A., Band, M., 2011. Transcriptome sequencing of the blind subterranean

414

J. Moskovitz et al. / Comparative Biochemistry and Physiology, Part A 161 (2012) 406–414

mole rat, Spalax galili: utility and potential for the discovery of novel evolutionary patterns. PLoS One 6, e21227. Moskovitz, J., 2005. Methionine sulfoxide reductases: ubiquitous enzymes involved in antioxidant defense, protein regulation, and prevention of aging-associated diseases. Biochim. Biophys. Acta 1703, 213–219. Moskovitz, J., 2007. Prolonged selenium-deficient diet in MsrA knockout mice causes enhanced oxidative modification to proteins and affects the levels of antioxidant enzymes in a tissue-specific manner. Free Radic. Res. 41, 162–171. Moskovitz, J., Oien, D.B., 2010. Protein carbonyl and the methionine sulfoxide reductase system. Antioxid. Redox Signal. 12, 405–415. Moskovitz, J., Stadtman, E.R., 2003. Selenium-deficient diet enhances protein oxidation and affects methionine sulfoxide reductase (MsrB) protein level in certain mouse tissues. Proc. Natl. Acad. Sci. U. S. A. 100, 7486–7490. Moskovitz, J., Rahman, M.A., Strassman, J., Yancey, S.O., Kushner, S.R., Brot, N., Weissbach, H., 1995. Escherichia coli peptide methionine sulfoxide reductase gene: regulation of expression and role in protecting against oxidative damage. J. Bacteriol. 177, 502–507. Moskovitz, J., Berlett, B.S., Poston, J.M., Stadtman, E.R., 1997. The yeast peptidemethionine sulfoxide reductase functions as an antioxidant in vivo. Proc. Natl. Acad. Sci. U. S. A. 94, 9585–9589. Moskovitz, J., Flescher, E., Berlett, B.S., Azare, J., Poston, J.M., Stadtman, E.R., 1998. Overexpression of peptide-methionine sulfoxide reductase in Saccharomyces cerevisiae and human T cells provides them with high resistance to oxidative stress. Proc. Natl. Acad. Sci. U. S. A. 95, 14071–14075. Moskovitz, J., Poston, J.M., Berlett, B.S., Nosworthy, N.J., Szczepanowski, R., Stadtman, E.R., 2000. Identification and characterization of a putative active site for peptide methionine sulfoxide reductase (MsrA) and its substrate stereospecificity. J. Biol. Chem. 275, 14167–14172. Moskovitz, J., Bar-Noy, S., Williams, W.M., Requena, J., Berlett, B.S., Stadtman, E.R., 2001. Methionine sulfoxide reductase (MsrA) is a regulator of antioxidant defense and lifespan in mammals. Proc. Natl. Acad. Sci. U. S. A. 98, 12920–12925. Nevo, E., 1991. Evolutionary theory and processes of active speciation and adaptative radiation in subterranean mole rats, Spalax ehrenbergi superspecies, in Israel. Evol. Biol. 25, 1–125. Nevo, E., 1999. Mosaic Evolution of Subterranean Mammals: Regression, Progression, and Global Convergence. Oxford University Press, New York. Nevo, E., Ivanitskaya, E., Beiles, A., 2001. Adaptive Radiation of Blind Subterranean Mole Rats. Backhuys, Leiden, Germany. Oien, D., Moskovitz, J., 2007. Protein-carbonyl accumulation in the non-replicative senescence of the methionine sulfoxide reductase A (msrA) knockout yeast strain. Amino Acids 32, 603–606. Oien, D.B., Moskovitz, J., 2008. Substrates of the methionine sulfoxide reductase system and their physiological relevance. Curr Top Dev Biol 80, 93–133.

Oien, D.B., Moskovitz, J., 2009. Selenium and the methionine sulfoxide reductase system. Molecules 14, 2337–2344. Oien, D.B., Osterhaus, G.L., Latif, S.A., Pinkston, J.W., Fulks, J., Johnson, M., Fowler, S.C., Moskovitz, J., 2008. MsrA knockout mouse exhibits abnormal behavior and brain dopamine levels. Free Radic Biol Med 45, 193–200. Oien, D.B., Canello, T., Gabizon, R., Gasset, M., Lundquist, B.L., Burns, J.M., Moskovitz, J., 2009. Detection of oxidized methionine in selected proteins, cellular extracts and blood serums by novel anti-methionine sulfoxide antibodies. Arch. Biochem. Biophys. 485, 35–40. Oien, D.B., Ortiz, A.N., Rittel, A.G., Dobrowsky, R.T., Johnson, M.A., Levant, B., Fowler, S.C., Moskovitz, J., 2010a. Dopamine D(2) receptor function is compromised in the brain of the methionine sulfoxide reductase A knockout mouse. J. Neurochem. 114, 51–61. Oien, D.B., Osterhaus, G.L., Lundquist, B.L., Fowler, S.C., Moskovitz, J., 2010b. Caloric restriction alleviates abnormal locomotor activity and dopamine levels in the brain of the methionine sulfoxide reductase A knockout mouse. Neurosci. Lett. 468, 38–41. Ortiz, A.N., Oien, D.B., Moskovitz, J., Johnson, M.A., 2011. Quantification of reserve pool dopamine in methionine sulfoxide reductase A null mice. Neuroscience 177, 223–229. Pal, R., Oien, D.B., Ersen, F.Y., Moskovitz, J., 2007. Elevated levels of brain-pathologies associated with neurodegenerative diseases in the methionine sulfoxide reductase A knockout mouse. Exp. Brain Res. 180, 765–774. Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, e36. Shams, I., Nevo, E., Avivi, A., 2005. Ontogenetic expression of erythropoietin and hypoxia-inducible factor-1 alpha genes in subterranean blind mole rats. FASEB J. 19, 307–309. Soria-Valles, C., Caballero, B., Vega-Naredo, I., Sierra, V., Huidobro-Fernández, C., Gonzalo-Calvo, D.D., Tolivia, D., Rodríguez-Colunga, M.J., Joel, A., Coto-Montes, A., Avivi, A., 2010. Antioxidant response to variations of oxygen in Harderian gland of different species of Spalax. Can. J. Zool. 88, 803–807. Stadtman, E.R., Moskovitz, J., Berlett, B.S., Levine, R.L., 2002. Cyclic oxidation and reduction of protein methionine residues is an important antioxidant mechanism. Mol. Cell. Biochem. 234–235, 3–9. Widmer, H.R., Hoppeler, H., Nevo, E., Taylor, C.R., Weibel, E.R., 1997. Working underground: respiratory adaptations in the blind mole rat. Proc. Natl. Acad. Sci. U. S. A. 94, 2062–2067.