- Email: [email protected]
Methionine sulfoxide reduction in ciliates: Characterization of the ready-to-use methionine sulfoxide-R-reductase genes in Euplotes
Gene 515 (2013) 110–116
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Methionine sulfoxide reduction in ciliates: Characterization of the ready-to-use methionine sulfoxide-R-reductase genes in Euplotes Nicoleta Dobri a , 1, Eugenie Emilie Ngueng Oumarou a, Claudio Alimenti a, Claudio Ortenzi b, Pierangelo Luporini a, Adriana Vallesi a,⁎ a b
Dipartimento di Scienze Ambientali e Naturali, University of Camerino, 62032 Camerino (MC), Italy Laboratorio di Protistologia e Didattica della Biologia, University of Macerata, 62100 Macerata, Italy
a r t i c l e
i n f o
Article history: Accepted 21 November 2012 Available online 30 November 2012 Keywords: Methionine sulfoxide reductase (Msr) Oxidative stress Protein oxidation Ciliate macronuclear genes
a b s t r a c t Genes encoding the enzyme methionine sulfoxide reductase type B, specific to the reduction of the oxidized methionine-R form, were characterized from the expressed (macronuclear) genome of two ecologically separate marine species of Euplotes, i.e. temperate water E. raikovi and polar water E. nobilii. Both species were found to contain a single msrB gene with a very simple structural organization encoding a protein of 127 (E. raikovi) or 126 (E. nobilii) amino acid residues that belongs to the group of zinc-containing enzymes. Both msrB genes are constitutively expressed, suggesting that the MsrB enzyme plays an essential role in repairing oxidative damages that appear to be primarily caused by physiological cell aging in E. raikovi and by interactions with an O2 saturated environment in E. nobilii. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Reactive oxygen species are physiologically produced by every aerobic cell and oxidize a vast array of cellular constituents, which need to be continuously repaired by anti-oxidative enzymes in order to prevent loss of activity and accumulation within cells that would otherwise cause deleterious effects on the organisms' lifespan (Friguet, 2006; Stadtman, 2006). Elective targets of protein oxidation are methionine residues; in particular, those residues that are exposed on the molecular surface (Friguet, 2006; Vogt, 1995). Their modification into hydrophilic sulfoxides may cause effective changes of the protein polarity with consequent alterations of the molecule functions (Petropoulos and Friguet, 2006). Reversible oxidation of Met residues may also serve as a regulatory mechanism of protein activity and cellular signaling (Bigelow and Squier, 2005). Consequently, methionine sulfoxide reductases (Msr) that catalyze the reduction of methionine sulfoxide back to methionine are usually regarded as a family of essential enzymes with a virtually universal distribution; only organisms living in anoxic environments or within host cells lack them due to secondary, adaptive loss (Delaye et al., 2007; Moskovitz, 2005). Abbreviations: Msr, methionine sulfoxide reductase; PCR, polymerase chain reaction; RT-PCR, reverse transcriptase-polymerase chain reaction; MTT, 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide; Sec, selenocysteine; SECIS, selenocysteineinsertion sequence element. ⁎ Corresponding author. Tel.: +39 0737403256; fax: +39 0737403290. E-mail address: [email protected] (A. Vallesi). 1 Present address: Columbia University, Edward S. Harkness Institute, 630 West 165th Street, NY, NY 10032, USA. Tel.: +1 212 305 9059; fax: +1 212 305 8993. 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2012.11.019
Two functionally distinct and structurally unrelated Msr subfamilies, designated MsrA and MsrB, are commonly recognized. The MsrA subfamily is specific to repair the methionine-sulfoxide S-enantiomer, while the MsrB subfamily repairs the methionine-sulfoxide R-enantiomer (Sharov et al., 1999; Weissbach et al., 2002). Although different in sequence and structure, the MsrA and MsrB subfamilies work with a similar three-step reaction mechanism based on the catalytic and recycling activities of two cysteins. It involves (i) the attack of the catalytic Cys residue on oxidized-methionine with the production of a sulfenic acid intermediate, (ii) the attack of the recycling Cys residue on the sulfenic acid intermediate with the formation of a disulfide bond between the catalytic and recycling cysteines, and (iii) the reduction of the disulfide bond preferentially operated by thioredoxin (Boschi-Muller et al., 2008; Kim and Gladyshev, 2007; Neiers et al., 2004; Weissbach et al., 2002). Ciliates represent one of the major eukaryotic components of every aquatic microbiota (Fenchel, 1987) and are very common experimental material (Nanney, 1980). However, virtually nothing is known about the structure and activity of their Msrs. Only annotations of genes encoding Msrs of both the A and B types have been reported in the genome databases of Paramecium (Aury et al., 2006) and Tetrahymena (Stover et al., 2012). Working on two species of the ciliate Euplotes, namely E. raikovi and E. nobilii, which are phylogenetically close yet ecologically separated (Jiang et al., 2010; Vallesi et al., 2008), significant increases in methionine-oxidized protein concentrations have recently been recorded in correlation with distinct causes. In E. raikovi, a species dwelling in temperate seawater, the oxidative damages have been observed to ensue in correlation with cell aging (Alimenti et al., 2012); in E. nobilii, which inhabits polar seawater (Valbonesi and
N. Dobri et al. / Gene 515 (2013) 110–116
Luporini, 1990), the oxidative damages are likely the result of the cell adaptation to cope with a unique environment characterized by unusually high (saturated) O2 concentrations (unpublished results). In light of these observations, we studied the molecular mechanisms on which E. raikovi and E. nobilii rely to repair the oxidative damage of their proteins, and identified the genes encoding the enzyme Msr of type B. These genes, designated Er-msrB in E. raikovi and En-msrB in E. nobilii, were cloned from the transcriptionally active genome of the cell macronucleus, that in Euplotes (and ciliates in general) consists exclusively of free, linear DNA molecules amplified to hundreds or thousands of copies, each capped with two telomeres that are uniformly characterized by repetitions of the C4A4 motif in position 5′ and the G4T4 motif in position 3′ (Jahn and Klobutcher, 2002; Klobutcher et al., 1998). Coherent with their unusual organization characterized by an apparent lack of any structural information for the regulation of transcription, the Er-msrB and En-msrB genes equally show a constitutive expression and behave as housekeeping genes to ensure cell basal functions with their constant activity. 2. Materials and methods
111
Table 1 Primers used to amplify msrB genes: designations and sequences. Name Common primers msrB-fw1a msrB-rv1a Tel Er-msrB specific primers fw2 rv2 5′-fw 3′-rv fwA rvA En-msrB specific primers fw2 rv2 5′-fw 3′-rv fwA rvA
Nucleotide sequence (5′–3′) AAGTTCAATWCAGGATGHGGNTGGC GTTGCCTTTGGTCCATCATTGAANACRTGNCC CCCCAAAACCCCAAAACCCC CTTCACATGGCATGATTAGGACTG GCTCCTGCTTTATCATTGAAAGCT CCCCTACTTTTTAGAACTTCATAGA CCCCTTCACAATATCCAATAATTGA ATGAGTGAAGAGACGAAAGATGAC TCAGTCCTAATCATGCCATGTGAAG GTGGAGGTGCAATGTGATAAA CTTAATAGCACCTGCCTTATCATT TTCATAAGCAAATTTGGTAGATACATT TATTCATATCTTATGCATTGAAAATG ATGAGTGAAGAGACTAAAGATGAC CCACCCGAGTCATACCATGTGTTGT
a In the degenerate primers, W and R represent alternatives between A and T, and A and G; H, alternatives among A, C and T; N, alternatives among the four nucleotides.
2.1. Cell cultures Cell cultures of the E. raikovi strain 13 (deposited at the American Type Culture Collection (ATCC), reference number “PRA-327”) and the E. nobilii strain Far (Di Giuseppe et al., 2011) were maintained under a cycle of 12 h of moderate light and 16 h of darkness at 22 °C (E. raikovi), or 4–6 °C (E. nobilii). They were grown in natural seawater (salinity, 30–33‰; pH, 8.1–8.2), using the green alga Dunaniella tertiolecta as nutrient. Cells were deprived of food for 2–3 days before being used in experiments. 2.2. DNA and RNA purification DNA was purified from cells according to standard protocols (Vallesi et al., 2010). Total RNA was extracted from cells using Trizol reagent (Invitrogen, Life Technologies Corporation, Carlsbad, CA, USA) following the procedure described by the manufacturer, and purified from contaminating DNA by treatment with RNAse-free DNAse I (1 U/μg of RNA) (Fermentas International Inc., Thermo Fisher Scientific Inc., Maryland), at 37 °C for 1 h, in the presence of 40 U RiboLock (Fermentas International Inc.). After solubilization in RNase-free water, RNA was quantified by absorbance at 260 nm and its quality was verified in 1.2% agarose gel. 2.3. DNA amplification by polymerase chain reaction (PCR) DNA amplifications were performed by PCR in the Eppendorf Mastercycler (Eppendorf AG, Hamburg, Germany), using oligonucleotides synthesized by Invitrogen (Life Technologies Corporation) and listed in Table 1. DNA aliquots of 0.5 μg were used as template in 50 μl-reaction mixtures containing 0.5 μM of each primer, 0.3 mM dNTP, 1 U of Platinum Taq polymerase High Fidelity (Invitrogen, Life Technologies Corporation), 60 mM Tris–SO4 (pH 8.9), 2 mM MgSO4, and 18 mM ammonium sulfate. In general, 35 PCR cycles were carried out, each consisting of a 30 s 94 °C denaturation step, a 30 s annealing step, and a 30 s 72 °C elongation step. The temperature of the annealing step varied from 55 to 65 °C, depending on the G + C content of the primers. A final incubation step, at 72 °C for 5 min, was added to the last cycle. The resulting PCR products were run on 1.7% agarose gel, visualized with ethidium bromide, purified and cloned into the pCR TOPO 2.1 vector using TOPO-TA Cloning kit (Invitrogen, Carlsbad, CA USA), according to the manufacturer's recommendations. Sequencing was performed at the BMR Genomics Center of the University of Padua (Italy).
2.4. Reverse transcriptase (RT)-PCR The 3′-end of the Er-msrB and En-msrB transcripts was obtained by converting 1 μg-aliquots of total RNA into cDNA by reverse transcription with oligo(dT)20 and 200 U SuperScript III reverse transcriptase in 10 μl-volume, following the protocol provided by the SuperScript III First-Strand Synthesis System (Invitrogen, Life Technologies Corporation). 2 μl-aliquots of cDNA were next amplified using the gene-specific primer “fwA” (Table 1) and oligo(dT)20 under the conditions described in the previous section (Section 2.3). Variations in the expression of the En-msrB and Er-msrB genes in cells treated with H2O2 were assessed by converting 1 μg-aliquots of total RNA into cDNA by reverse transcription with random hexamers and 200 U SuperScript III reverse transcriptase in 10 μl-volume (as above), and using 2 μl-aliquots of cDNA in PCR amplifications with the msrB gene-specific primers, “fwA” and “rvA” (Table 1). The template concentration and external control for PCR amplifications were obtained by amplifying 2 μl-aliquots of cDNA with the 18S-rRNA specific primers, 5′-CGCAAGGTCTACTGAGRTGATTC-3′ and 5′-CCATAGCC RCCCTCCTGTCT-3′. The amplification conditions were the following: 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 40 s, for 30 cycles. Absence of DNA contaminations was verified by running PCR with total RNA preparations not incubated with reverse transcriptase as template. Amplified products were separated by electrophoresis in 1.7% agarose gels and visualized by ethidium bromide staining. The msrB gene expression levels were quantified using the ImageJ software (NIH, USA) and normalized to the 18S internal control gene.
2.5. Southern and Northern blot analysis Aliquots of DNA and total RNA (15 μg and 40 μg, respectively) were separated by electrophoresis on agarose gels and blotted onto Hybond-N+ membranes (GE Healthcare, Life Sciences, Piscataway, NJ, USA) according to standard procedures (Sambrook et al., 1989). The products of 156-bp obtained by PCR amplifications with the “msrB-fw1” and “msrB-rv1” primers (Table 1) were labeled with 32P using the random hexamer priming method (Feinberg and Vogelstein, 1983) and used as specific probes of the Er-msrB and En-msrB genes. Hybridizations were carried out overnight at 65 °C. Blotted membranes were washed at the hybridization temperature, dried, and exposed for autoradiography using a PhosphorImager system (BioRad).
112
N. Dobri et al. / Gene 515 (2013) 110–116
2.6. Cell viability assay Cell viability was assessed through the reduction of 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), as previously described by Di Giuseppe et al. (2012). After exposure to increasing H2O2 concentrations, cells were incubated for 60 min with 10 μl MTT (5 mg/ml stock solution). The MTT reduction to formazan by viable cells was stopped by dimethyl sulfoxide and quantified by absorbance at 570 nm using a microplate reader 680 spectrophotometer (Bio-Rad, Hercules, CA, USA). The value of reduced MTT absorbance in equivalent cell samples not exposed to H2O2 was used as control. 2.7. Bioinformatics Multiple alignment was performed using the ClustalW Multiple Alignment Program (http://www.ebi.ac.uk/clustalw/) (Thompson
et al., 1997). Database searches were performed on the NCBI/ GenBank/Blast website. The nucleotide sequences were analyzed with the SECISearch tool (http://genome.unl.edu/SECISearch.html), while the deduced amino acid sequences were analyzed with PROSITE (http://www.expasy.ch/prosite/) to check for functional protein domains, protein molecular weight and isoelectric point prediction. The predicted 3D structures were determined through comparative protein modeling on the SWISS-MODEL protein structure homology-modeling server (http://swissmodel.expasy.org/) (Arnold et al., 2006). The crystallographic structure of the Burkholderia pseudomallei MsrB (PDB ID: 3cxk) was automatically selected by the server as a template since it shows an amino acid sequence identity of 53% and 56% with the MsrB protein of E. raikovi and E. nobilii, respectively. The 3D structural models have previously been validated with the algorithms ANOLEA (Melo et al., 1997), Verify 3D (Luthy et al., 1992) and Ramachandran Plot (Gopalakrishnan et al.,
Fig. 1. Nucleotide and deduced amino acid sequences of the Er-msrB and En-msrB genes. In the nucleotide sequences, the telomeric repeats are in bold and italics, the putative motifs for the transcription regulation and the polyadenylation signal are underlined, and the TGA codons specifying cysteines are boxed. Arrows indicate positions, directions, and denominations of the PCR primers. In the amino acid sequences, the catalytic site is highlighted in gray.
N. Dobri et al. / Gene 515 (2013) 110–116
2007), and visualized and manipulated using MOLMOL (Koradi et al., 1996).
3. Results 3.1. Er-msrB and En-msrB gene identification and cloning The full-length nucleotide sequences of the E. raikovi Er-msrB and E. nobilii En-msrB genes were determined as a result of a multi-step PCR strategy. A single 156-bp product was first obtained from E. raikovi and E. nobilii DNA amplifications with two degenerated oligonucleotides (“msrB-fw1” and “msrB-rv1” in Table 1), specific to the sequences Lys59-Tyr-Asp-Ser-Gly-Cys-Gly-Trp-Pro67 and Gly103-HisVal-Phe-Pro-Asp-Gly-Pro-Gln-Pro-Thr113 (Escherichia coli MsrB numeration, Olry et al., 2005), which are shared among most prokaryotic and eukaryotic MsrBs. This 156-bp product was then used as probe in Southern blot analysis and shown to hybridize in both species to a single macronuclear gene-sized DNA molecule of approximately 550 bp (data not shown). In the second amplification step, Er-msrB and En-msrB genespecific oligonucleotides (“fw2” and “rv2” in Table 1) were synthesized on the sequence of the 156 bp-product and alternatively used as forward or reverse primer in combination with the oligonucleotide “Tel” (Table 1) equivalent to the strictly conserved C4A4 repeats that distinguish the telomeric ends of every Euplotes macronuclear gene (Jahn and Klobutcher, 2002; Klobutcher et al., 1998), and have no counterparts in genes of bacteria or any other microorganisms that may coexist in culture with Euplotes cells.
113
The full-length Er-msrB and En-msrB sequences were eventually reconstructed from overlapping individual sequences, and the accuracy of this reconstruction was validated through direct analysis of products of the third DNA amplification step carried out with two oligonucleotides (“5′-fw” and “3′-rv” in Table 1), derived from sequence stretches located immediately adjacent to the Er-msrB and En-msrB 5′ and 3′-telomeric ends. The Er-msrB and En-msrB gene sequences (deposited at the GenBank with the accession numbers JX978448 and JX978449) extend, the telomeric repeats included, for 547 and 551 bp, respectively (Fig. 1). They are closely similar (65% of nucleotide identity) and comprise two short 5′ and 3′ non-coding regions of 49 and 58 bp, respectively, in Er-msrB, and 50 and 64 bp in En-msrB. In both genes, the 5′ non-coding region is particularly rich in A and T (the A+T content is higher than 80%) and lacks the canonical CAAT and TATA boxes for the transcription initiation. As proposed by Ghosh et al. (1994), these boxes are most likely replaced with the CAAAT and TAATAA motifs at positions 9 and 27 in En-msrB, and with the GAAAA motif at position 20 in Er-msrB (counting from the end of the telomeric repeats). Similarly, the 3′ region of both genes lacks the canonical AAATAA polyadenylation signal that is most likely replaced with the AATTTT and AAATTT motifs. The putative coding regions of 384 bp in Er-msrB and 381 bp in En-msrB terminate with either a canonical TAA codon (En-msrB), or a TAG codon (Er-msrB) which is less commonly used in Euplotes species. They show only few variations that are relevant to the codon usage. While in En-msrB there is no deviation from the standard genetic code, the Er-msrB coding region includes two in-frame TGA codons that in Euplotes species may be either translated as cysteine
Fig. 2. (A) Effect of H2O2-induced oxidative stress on cell viability. E. raikovi and E. nobilii cells (squares and circles, respectively) were treated with increasing H2O2 concentrations for 2 h before measuring the cell viability by MTT assay. Values are averages of two separate experiments in quadruplicate and expressed as means ± SD. (B) Northern blot analysis of total RNA extracted from cells maintained in sea water, or exposed to 200 μM (E. raikovi) or 700 μM (E. nobilii) of H2O2 for 30 min. (C) RT-PCR analysis of msrB-specific mRNA synthesized by cells exposed to increasing H2O2 concentrations for 30 min. In each lane, equal volumes of amplification products were loaded, and a RT-PCR fragment of 18S-rRNA was used as loading control. The relative mRNA levels were measured using the ImageJ software (NIH, USA), taking the 18S-rRNA PCR fragments from equivalent cell samples as value 1. The experiment was repeated twice, with equivalent results.
114
N. Dobri et al. / Gene 515 (2013) 110–116
(Meyer et al., 1991) or, more unusually, selenocysteine (Turanov et al., 2009). 3.2. Expression of the Er-msrB and En-msrB genes It was first verified whether the Er-msrB and En-msrB genes are effectively expressed by a RT-PCR analysis carried out with oligo(dT)20 and a gene-specific primer annealing at the beginning of the open reading frame (Fig. 1). The amplification products extended for 402 bp (polyA tail excluded) in the Er-msrB gene transcript and 403 bp in the En-msrB gene transcript, and contained the coding region plus a short 3′-untranslated region of 18 and 22 bp, respectively. In this region, the putative polyadenylation signals AATTT, or AAATTT appear located 5 bp upstream the poly(A) tail. We then analyzed the Er-msrB and En-msrB gene expression in cells subjected to oxidative stress by exposure to H2O2. Preliminary to this analysis it was necessary to assess the maximal H2O2 concentrations that E. raikovi and E. nobilii were able to tolerate with no apparent damage of their viability. The viability of E. nobilii resulted to be above 90% even after a 2 h-incubation with a 1000 μM H2O2 concentration, while E. raikovi did not tolerate H2O2 concentrations higher than 500 μM (Fig. 2A). Therefore, a range of 250 to 750-μM H2O2 concentrations was chosen for this experimental analysis in E. nobilii and a range of 100 to 400-μM H2O2 concentrations for E. raikovi. The levels of Er-msrB and En-msrB expression were first compared by Northern blot analysis of total RNA extracted from cells suspended in fresh sea water and cells exposed for 30 min to H2O2 (used at the final concentrations of 700 μM in E. nobilii and 200 μM in E. raikovi) (Fig. 2B). The comparison was then extended to a semi-quantitative RT-PCR analysis of cells incubated for 30 min in the presence of increasing H2O2 concentrations (Fig. 2C). In both cases, mRNA signals of closely matching intensities were systematically detected, thus implying that the En-msrB and Er-msrB genes are constitutively expressed independently of the H2O2 concentrations at which cells were exposed. 3.3. Er-msrB and En-msrB amino acid sequences The two proteins specified by the Er-msrB and En-msrB open reading frames extend for 127 and 126 amino acids, respectively, and are predicted to be cytosolic enzymes with a theoretical molecular mass of
approximately 14,000 Da and an isoelectric point of approximately 5. Their amino acid sequences are similar to each other as well as to MsrBs of other uni- and multi-cellular organisms (Fig. 3). The correspondence is particularly significant at the level of the carboxyterminal region containing the conserved Arg-Tyr-Cys-Ile-Asn-Ser catalytic site, and of the basic pattern of six Cys residues that are necessary for the MsrB activity. Four cysteines (i.e., Cys45, Cys48, Cys92 and Cys95) form the two Cys-Xxx-Xxx-Cys motifs of the MsrB Zinc-ion binding domain (Kumar et al., 2002; Olry et al., 2005), while the two other cysteines (i.e., Cys63 and Cys115) find their counterparts with the recycling Cys63 and the catalytic Cys117 (E. coli sequence numeration) responsible for the reductase activity of most MsrBs. The MsrB of E. raikovi includes a seventh Cys residue in position 61, which has no counterpart in the E. nobilii MsrB and finds counterparts only with a few other MsrBs (Oke et al., 2009). 4. Discussion Euplotes species have substantially contributed to our understanding of Mendelian genetics of ciliate multiple mating type systems (Padhke and Zufall, 2009), whose determinants are found in the transcriptionally inert chromosomic genome of the cell germinal micronucleus. In contrast, relatively little progress has been made with regard to knowledge of the organization and transcription regulation of their sub-chromosomic genome expressed in the cell somatic macronucleus. Most available information is limited to E. crassus, of which a draft analysis of the macronuclear genome and transcriptome has recently been published by Vinogradov et al. (2012). This analysis substantially confirms previous observations predicting that the relatively simple structural organization of Euplotes macronuclear DNA molecules (each molecule containing a single gene usually flanked by short 5′ and 3′ non-coding regions) is often counterbalanced by rather complex mechanisms of gene expression involving transcriptional frame-shifting and removal of introns that have widely variable dimensions and splicing sites (Brünen-Nieweler et al., 1998; Ghosh et al., 1994; Klobutcher, 2005; Klobutcher et al., 1998; Miceli et al., 1992; Tan et al., 2001; Vallesi et al., 2009, 2010). The En-msrB and Er-msrB genes characterized from E. nobilii and E. raikovi appear to be organized differently with respect to this general picture. Their simple structural organization is associated with a mechanism of expression that is unhampered by phenomena of intron splicing and frame-shifting. In addition, their putative structural motifs for the
Fig. 3. Alignment of the E. raikovi and E. nobilii MsrB amino acid sequences (in bold) with MsrB sequences of other organisms. The alignment was maximized by gap insertions and dots indicate identical residues. The Cys residues are numbered according to their sequence positions. The catalytic site is boxed and the functionally more significant amino acid variations between E. raikovi and E. nobilii MsrBs are indicated by filled circles. GenBank accession numbers of protein sequences used in the alignment are: Tetrahymena thermophila, XP_001019714; Paramecium tetraurelia, XP_001426263; Polynucleobacter necessarius, YP_001155752; Burkholderia sp., YP_004228185; Apis mellifera, XP_001120023; Tribolium castaneum, XP_967693; Drosophila melanogaster, NP_731525; Schistosoma mansoni, AAT77264.
N. Dobri et al. / Gene 515 (2013) 110–116
transcription initiation are not appropriately positioned at around − 30 from the transcription initiation sites, which is different from what is usually observed in other macronuclear genes of E. crassus, Sterkiella histriomuscorum and Stylonychia lemnae (Ghosh et al., 1994; Lascasse et al., 2005; Skovorodkin et al., 2007). In fact, these motifs lie close to the translation starting site, implying that the En-msrB and Er-msrB mRNA leader regions are either extremely short or, according to Ghosh et al. (1994), the control of transcription involves the telomeres themselves. The En-msrB and Er-msrB constitutive expression raises the question of the mechanism that determines a stable MsrB protein concentration in the cell. This mechanism may depend on the degree of En-msrB and Er-msrB gene amplification that is established at the very beginning of the cell life cycle at the time of synthesis of a new macronucleus from the zygotic nucleus; alternatively, it may depend on the stability of En-msrB and Er-msrB specific mRNAs. The former possibility is supported by previous findings in E. octocarinatus and E. raikovi, showing that the levels of expression of RNA polymerase and pheromone genes are directly correlated with the number of macronuclear copies of these genes (Kaufmann and Klein, 1992; La Terza et al., 1995); the latter possibility is consistent with the presence of AT-rich motifs in the En-msrB and Er-msrB 3′ non-coding region which are reminiscent of the “stability-control” motifs for the rapid mRNA degradation (Chen and Shyu, 1995). The MsrB enzymes are subdivided between selenocysteinecontaining and cysteine-containing proteins on the basis of the presence, or absence of selenocysteine (Sec) in the catalytic site (Kim and Gladyshev, 2005, 2007). Sec is encoded by an in-frame UGA codon, and its insertion in the nascent protein requires the presence of a stem loop structure, known as Sec-insertion sequence (SECIS) element, in the mRNA 3′-untranslated region (Kryukov et al., 2003; Turanov et al., 2009). The E. raikovi and E. nobilii MsrBs do not appear to belong to Sec-containing enzymes for the reasons that (i) their active sites do not contain UGA codon specifying Sec, and (ii) no SECIS structure is present in the 3′ non-coding regions of the En-msrB and Er-msrB genes. In addition, the E. raikovi and E. nobilii MsrBs carry three residues, namely His98, Val101 and Asn117 (corresponding to His77, Val/Ile81 and Asn97 of the mouse MsrB), that appear to be conserved uniquely in Cys-containing MsrBs and absent in Sec-forms in which they are replaced with Gly77, Glu81 and Phe97 (mouse Sec-MsrB1 numeration), respectively. The three conserved residues are part of the active site and critical for the Cys-containing MsrB activity; their introduction into mouse Sec-containing MsrB1 was shown to be detrimental to the activity of this enzyme (Kim and Gladyshev, 2005). Also the MsrBs known in other ciliates, two in Tetrahymena thermophila (NCBI Reference Sequences: XP_001019714.3 and XP_001009805.1) and five in Paramecium tetraurelia (NCBI Reference Sequences: XP_001426263.1, XP_001447179.1, XP_001438438.1, XP_001431532.1 and XP_001439533.1), have similarly been regarded as not Sec-containing proteins. In addition, it is likely that only one MsrB form (XP_001019714.3) in T. thermophila and one (XP_001426263. 1) in P. tetraurelia are functional proteins, since they contain a Cys residue in the catalytic site (see Fig. 3). Substitutions of the catalytic cysteine with Ser residues suggest that the other forms are not functional. Although largely overlapping the E. raikovi and E. nobilii MsrBs diversify for a total of 27 amino acid variations, five of which appear to be functionally more significant for their location in the E. raikovi and E. nobilii MsrB structures (Fig. 4). One is relative to the Cys61 residue specific of the E. raikovi MsrB protein, which appears to be strategically positioned to form a disulfide bond with either Cys115, or Cys63 (Fig. 4A). In the former case, Cys61 might play a recycling role similar to that carried out by Cys63, while in the latter one the formation of the Cys61–Cys63 disulfide bond, in addition to reducing the local flexibility of the MsrB structure, might be responsible for a non-canonical recycling process as suggested in other systems (Ranaivoson et al., 2009; Tarrago et al., 2009).
115
Fig. 4. (A) Three-dimensional structures (ribbon presentations) of E. raikovi and E. nobilii MsrB proteins obtained through comparative modeling of the Burkholderia pseudomallei MsrB. The two regular α-helices and the two 310-helical turns are red-yellow colored, while the eight β-strands are light-blue colored. The Cys residues are indicated as yellow stick diagrams and the additional Cys61 of E. raikovi MsrB is marked with a red circle. N and C indicate the positions of the molecule amino- and carboxy-terminus, respectively. (B) Electrostatic potential distributions of the E. raikovi and E. nobilii MsrB molecular surfaces, shown rotated by 40° around the molecule vertical axis with respect to the ribbon presentations in A. Positive and negative charged residues are marked blue and red, respectively. The positions of the catalytic Cys115 and the residues responsible for electrostatic surface potential variations are indicated.
The four other variations of potential functional importance are relevant to the E. nobilii MsrB protein and likely reflect the need of this protein to enhance its structural flexibility for better coping with the thermodynamically adverse conditions of the polar waters inhabited by E. nobilii. These variations lie in the segment which extends between the positions 15 and 28 largely involved in the organization of the MsrB helix 2, and all appear to be responsible for a substantial modification of the electrostatic potential distribution on the molecular surface surrounding the active site provided by the Cys115 residue (Fig. 4B). The polar Thr15 and the negatively charged Glu23 residues of the E. raikovi MsrB appear to be replaced with a negatively charged aspartic acid and a positively charged lysine, respectively. More importantly the two positively charged residues Arg19 and Arg28 of the E. raikovi MsrB are replaced by a polar asparagine and a hydrophobic proline, respectively. The En-msrB and Er-msrB genes are not the only Msr genes on which E. raikovi and E. nobilii rely to repair oxidized macromolecules. Also Msrs of type A appear to be present in these two species, each specified by multiple gene isoforms which have not yet been completely characterized for their structure and mechanism of expression (Oumarou, PhD Thesis, 2011). The evolution of such a diverse array of Msr genes in Euplotes species, and ciliates in general, does not come as a surprise considering the unmatched ability that distinguish these organisms in
116
N. Dobri et al. / Gene 515 (2013) 110–116
facing the two main causes, namely senescence and environmental stress, of protein oxidation. Acknowledgments The authors heartily thank: Prof. Konstantin Petrukhin (Columbia University) for helpful suggestions on a preliminary draft of the manuscript, one anonymous reviewer for very constructive criticisms and insightful suggestions, and Dr. Martha Dumbar for assistance in the English revision. Research financially supported by the “Programma Nazionale di Ricerche in Antartide” (PNRA) and “Progetti di Ricerca di Interesse Nazionale” (PRIN). References Alimenti, C., Vallesi, A., Luporini, P., Buonanno, F., Ortenzi, C., 2012. Cell aging-induced methionine oxidation causes an autocrine to paracrine shift of the pheromone activity in the protozoan ciliate, Euplotes raikovi. Exp. Cell Res. 318, 144–151. Arnold, K., Bordoli, L., Kopp, J., Schwede, T., 2006. The SWISS-MODEL Workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22, 195–201. Aury, J.M., et al., 2006. Global trends of whole-genome duplications revealed by the ciliate Paramecium tetraurelia. Nature 444, 171–178. Bigelow, D.J., Squier, T.C., 2005. Redox modulation of cellular signaling and metabolism through reversible oxidation of methionine sensors in calcium regulatory proteins. Biochim. Biophys. Acta 1703, 121–134. Boschi-Muller, S., Gand, A., Branlant, G., 2008. The methionine sulfoxide reductases: catalysis and substrate specificities. Arch. Biochem. Biophys. 474, 266–273. Brünen-Nieweler, C., Weiligmann, J.C., Hansen, B., Kuhlmann, H.W., Möllenbeck, M., Heckmann, K., 1998. The pheromones and pheromone genes of new stocks of the Euplotes octocarinatus species complex. Eur. J. Protistol. 34, 124–132. Chen, C.Y., Shyu, A.B., 1995. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20, 465–470. Delaye, L., Becerra, A., Orgel, L., Lazcano, A., 2007. Molecular evolution of peptide methionine sulfoxide reductases (MsrA and MsrB): on the early development of a mechanism that protects against oxidative damage. J. Mol. Evol. 64, 15–32. Di Giuseppe, G., et al., 2011. Antarctic and Arctic populations of the ciliate Euplotes nobilii show common pheromone-mediated cell–cell signaling and cross-mating. Proc. Natl. Acad. Sci. U. S. A. 108, 3181–3186. Di Giuseppe, G., Cervia, D., Vallesi, A., 2012. Divergences in the response to ultraviolet radiation between polar and non-polar ciliated protozoa. Microb. Ecol. 63, 334–338. Feinberg, A.P., Vogelstein, B., 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6–13. Fenchel, T., 1987. Ecology of Protozoa. Springer-Verlag, Berlin. Friguet, B., 2006. Oxidized protein degradation and repair in ageing and oxidative stress. FEBS Lett. 580, 2910–2916. Ghosh, S., Jaraczewski, J.W., Klobutcher, L.A., Jahn, C.L., 1994. Characterization of transcription initiation, translation initiation, and poly(A) addition sites in the genesized macronuclear DNA molecules of Euplotes. Nucleic Acids Res. 22, 214–221. Gopalakrishnan, K., Sowmiya, G., Sheik, S.S., Sekar, K., 2007. Ramachandran Plot on the web (2.0). Protein Pept. Lett. 14, 669–671. Jahn, C.L., Klobutcher, L.A., 2002. Genome remodeling in ciliated protozoa. Ann. Rev. Microbiol. 56, 489–520. Jiang, J., Zhang, Q., Warren, A., Al-Rasheid, K.A.S., Song, S., 2010. Morphology and SSU rRNA gene-based phylogeny of two marine Euplotes species, E. orientalis spec. nov. and E. raikovi Agamaliev, 1966 (Ciliophora, Euplotida). Eur. J. Protistol. 46, 121–132. Kaufmann, J., Klein, A., 1992. Gene dosage as a possible major determinant for equal expression levels of genes encoding RNA polymerase subunits in the hypotrichous ciliate Euplotes octocarinatus. Nucleic Acids Res. 20, 4445–4450. Kim, H.Y., Gladyshev, V.N., 2005. Different catalytic mechanisms in mammalian selenocysteine- and cysteine-containing methionine-R-sulfoxide reductase. PLoS Biol. 3, e375. Kim, H.Y., Gladyshev, V.N., 2007. Methionine sulfoxide reductases: selenoprotein forms and roles in antioxidant protein repair in mammals. Biochem. J. 407, 321–329. Klobutcher, L.A., 2005. Sequencing of random Euplotes crassus macronuclear genes supports a high frequency of +1 translational frameshifting. Eukaryot. Cell 4, 2098–2105. Klobutcher, L.A., et al., 1998. Conserved DNA sequences adjacent to chromosome fragmentation and telomere addition sites in Euplotes crassus. Nucleic Acids Res. 26, 4230–4240. Koradi, R., Billeter, M., Wüthrich, K., 1996. MOLMOL: a program for display and analysis of macromolecular structures. J. Mol. Graph. 14, 51–55. Kryukov, G.V., et al., 2003. Characterization of mammalian selenoproteomes. Science 300, 1439–1443.
Kumar, R.A., Koc, A., Cerny, R.L., Gladyshev, V.N., 2002. Reaction mechanism, evolutionary analysis, and role of zinc in Drosophila methionine-R-sulfoxide reductase. J. Biol. Chem. 277, 37527–37535. La Terza, A., Miceli, C., Luporini, P., 1995. Differential amplification of pheromone genes of the ciliate Euplotes raikovi. Dev. Genet. 17, 272–279. Lascasse, R., et al., 2005. Gene structure of the ciliate Sterkiella histriomuscorum based on a combined analysis of DNA and cDNA sequences from 21 macronuclear chromosomes. Chromosoma 114, 344–351. Luthy, R., Bowie, J.U., Eisemberg, D., 1992. Assessment of protein models with threedimensional profiles. Nature 356, 83–85. Melo, F., Devos, D., Depiereux, E., Feytmans, E., 1997. ANOLEA: a www server to assess protein structures. Intell. Syst. Mol. Biol. 97, 110–113. Meyer, F., et al., 1991. UGA is translated as cysteine in pheromone 3 of Euplotes octocarinatus. Proc. Natl. Acad. Sci. U. S. A. 88, 3758–3761. Miceli, C., La Terza, A., Bradshaw, R.A., Luporini, P., 1992. Identification and structural characterization of a cDNA clone encoding a membrane-bound form of the polypeptide pheromone Er-1 in the ciliate protozoan Euplotes raikovi. Proc. Natl. Acad. Sci. U. S. A. 89, 1988–1992. Moskovitz, J., 2005. Methionine sulfoxide reductases: ubiquitous enzymes involved in antioxidant defense, protein regulation, and prevention of aging-associated diseases. Biochim. Biophys. Acta 1703, 213–219. Nanney, D.L., 1980. Experimental Ciliatology. Wiley, New York. Neiers, F., Kriznik, A., Boschi-Muller, S., Branlant, G., 2004. Evidence for a new sub-class of methionine sulfoxide reductases B with an alternative thioredoxin-recognition signature. J. Biol. Chem. 279, 42462–42468. Oke, T.T., Moskovitz, J., Williams, D.L., 2009. Characterization of the methionine sulfoxides reductase of Schistosoma mansoni. J. Parassitol. 95, 1421–1428. Olry, A., Boschi-Muller, S., Yu, H., Burnel, D., Branlant, G., 2005. Insights into the role of the metal binding site in methionine-R-sulfoxide reductases B. Protein Sci. 14, 2828–2837. Oumarou, E.E.N., 2011. Mechanisms of repairing age-induced protein oxidation in the protozoan ciliate Euplotes: characterization of the methionine sulfoxide reductase genes. PhD dissertation, University of Camerino. Padhke, S.S., Zufall, R.A., 2009. Rapid diversification of mating systems in ciliates. Biol. J. Linn. Soc. 98, 187–197. Petropoulos, I., Friguet, B., 2006. Maintenance of proteins and aging: the role of oxidized protein repair. Free Radic. Res. 40, 1269–1276. Ranaivoson, F.M., Neiers, F., Kauffmann, B., Boschi-Muller, S., Branlant, G., Favier, F., 2009. Methionine sulfoxide reductase B displays a high level of flexibility. J. Mol. Biol. 394, 83–93. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Sharov, V.S., Ferrington, D.A., Squier, T.C., Schöneich, C., 1999. Diastereoselective reduction of protein-bound methionine sulfoxide by methionine sulfoxide reductase. FEBS Lett. 455, 247–250. Skovorodkin, I., Pimenov, A., Raykhel, I., Schimanski, B., Ammermann, D., Günzl, A., 2007. α-Tubulin minichromosome promoters in the Stichotrichous ciliate Stylonychia lemnae. Eukaryot Cell 6, 28–36. Stadtman, E.R., 2006. Protein oxidation and aging. Free Radic. Res. 40, 1250–1258. Stover, N.A., Punia, R.S., Bowen, M.S., Dolins, S.B., Clark, T.G., 2012. Tetrahymena genome database Wiki: a community-maintained model organism database. Database 2012 http://dx.doi.org/10.1093/database/bas007. Tan, M., Liang, A., Brünen-Nieweler, C., Heckmann, K., 2001. Programmed translational frameshifting is likely required for expressions of genes encoding putative nuclear protein kinases of the ciliate Euplotes octocarinatus. J. Eukaryot. Microbiol. 48, 575–582. Tarrago, L., et al., 2009. Regeneration mechanisms of Arabidopsis thaliana methionine sulfoxide reductases B by glutaredoxins and thioredoxins. J. Biol. Chem. 284, 18963–18971. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 4, 4876–4882. Turanov, A.A., et al., 2009. Genetic code supports targeted insertion of two amino acids by one codon. Science 323, 259–261. Valbonesi, A., Luporini, P., 1990. Description of two new species of Euplotes and Euplotes rariseta from Antarctica. Polar Biol. 11, 47–53. Vallesi, A., Di Giuseppe, G., Dini, F., Luporini, P., 2008. Pheromone evolution in the protozoan ciliate, Euplotes: the ability to synthesize diffusible forms is ancestral and secondarily lost. Mol. Phylogenet. Evol. 47, 439–442. Vallesi, A., Alimenti, C., La Terza, A., Di Giuseppe, G., Dini, F., Luporini, P., 2009. Characterization of the pheromone gene family of an Antarctic and Arctic protozoan ciliate, Euplotes nobilii. Mar. Genomics 2, 27–32. Vallesi, A., Di Pretoro, B., Ballarini, P., Apone, F., Luporini, P., 2010. A novel protein kinase from the ciliate Euplotes raikovi with close structural identity to the mammalian intestinal and male-germ cell kinases: characterization and functional implications in the autocrine pheromone signaling loop. Protist 161, 250–263. Vinogradov, D.V., et al., 2012. Draft macronucleus genome of Euplotes crassus ciliate. Mol. Biol. 46, 328–333. Vogt, W., 1995. Oxidation of methionyl residues in proteins: tools, targets, and reversal. Free Radic. Biol. Med. 18, 93–105. Weissbach, H., et al., 2002. Peptide methionine sulfoxide reductase: structure, mechanism of action, and biological function. Arch. Biochem. Biophys. 397, 172–178.
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Methionine sulfoxide reduction in ciliates: Characterization of the ready-to-use methionine sulfoxide-R-reductase genes in Euplotes Nicoleta Dobri a , 1, Eugenie Emilie Ngueng Oumarou a, Claudio Alimenti a, Claudio Ortenzi b, Pierangelo Luporini a, Adriana Vallesi a,⁎ a b
Dipartimento di Scienze Ambientali e Naturali, University of Camerino, 62032 Camerino (MC), Italy Laboratorio di Protistologia e Didattica della Biologia, University of Macerata, 62100 Macerata, Italy
a r t i c l e
i n f o
Article history: Accepted 21 November 2012 Available online 30 November 2012 Keywords: Methionine sulfoxide reductase (Msr) Oxidative stress Protein oxidation Ciliate macronuclear genes
a b s t r a c t Genes encoding the enzyme methionine sulfoxide reductase type B, specific to the reduction of the oxidized methionine-R form, were characterized from the expressed (macronuclear) genome of two ecologically separate marine species of Euplotes, i.e. temperate water E. raikovi and polar water E. nobilii. Both species were found to contain a single msrB gene with a very simple structural organization encoding a protein of 127 (E. raikovi) or 126 (E. nobilii) amino acid residues that belongs to the group of zinc-containing enzymes. Both msrB genes are constitutively expressed, suggesting that the MsrB enzyme plays an essential role in repairing oxidative damages that appear to be primarily caused by physiological cell aging in E. raikovi and by interactions with an O2 saturated environment in E. nobilii. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Reactive oxygen species are physiologically produced by every aerobic cell and oxidize a vast array of cellular constituents, which need to be continuously repaired by anti-oxidative enzymes in order to prevent loss of activity and accumulation within cells that would otherwise cause deleterious effects on the organisms' lifespan (Friguet, 2006; Stadtman, 2006). Elective targets of protein oxidation are methionine residues; in particular, those residues that are exposed on the molecular surface (Friguet, 2006; Vogt, 1995). Their modification into hydrophilic sulfoxides may cause effective changes of the protein polarity with consequent alterations of the molecule functions (Petropoulos and Friguet, 2006). Reversible oxidation of Met residues may also serve as a regulatory mechanism of protein activity and cellular signaling (Bigelow and Squier, 2005). Consequently, methionine sulfoxide reductases (Msr) that catalyze the reduction of methionine sulfoxide back to methionine are usually regarded as a family of essential enzymes with a virtually universal distribution; only organisms living in anoxic environments or within host cells lack them due to secondary, adaptive loss (Delaye et al., 2007; Moskovitz, 2005). Abbreviations: Msr, methionine sulfoxide reductase; PCR, polymerase chain reaction; RT-PCR, reverse transcriptase-polymerase chain reaction; MTT, 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide; Sec, selenocysteine; SECIS, selenocysteineinsertion sequence element. ⁎ Corresponding author. Tel.: +39 0737403256; fax: +39 0737403290. E-mail address: [email protected] (A. Vallesi). 1 Present address: Columbia University, Edward S. Harkness Institute, 630 West 165th Street, NY, NY 10032, USA. Tel.: +1 212 305 9059; fax: +1 212 305 8993. 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2012.11.019
Two functionally distinct and structurally unrelated Msr subfamilies, designated MsrA and MsrB, are commonly recognized. The MsrA subfamily is specific to repair the methionine-sulfoxide S-enantiomer, while the MsrB subfamily repairs the methionine-sulfoxide R-enantiomer (Sharov et al., 1999; Weissbach et al., 2002). Although different in sequence and structure, the MsrA and MsrB subfamilies work with a similar three-step reaction mechanism based on the catalytic and recycling activities of two cysteins. It involves (i) the attack of the catalytic Cys residue on oxidized-methionine with the production of a sulfenic acid intermediate, (ii) the attack of the recycling Cys residue on the sulfenic acid intermediate with the formation of a disulfide bond between the catalytic and recycling cysteines, and (iii) the reduction of the disulfide bond preferentially operated by thioredoxin (Boschi-Muller et al., 2008; Kim and Gladyshev, 2007; Neiers et al., 2004; Weissbach et al., 2002). Ciliates represent one of the major eukaryotic components of every aquatic microbiota (Fenchel, 1987) and are very common experimental material (Nanney, 1980). However, virtually nothing is known about the structure and activity of their Msrs. Only annotations of genes encoding Msrs of both the A and B types have been reported in the genome databases of Paramecium (Aury et al., 2006) and Tetrahymena (Stover et al., 2012). Working on two species of the ciliate Euplotes, namely E. raikovi and E. nobilii, which are phylogenetically close yet ecologically separated (Jiang et al., 2010; Vallesi et al., 2008), significant increases in methionine-oxidized protein concentrations have recently been recorded in correlation with distinct causes. In E. raikovi, a species dwelling in temperate seawater, the oxidative damages have been observed to ensue in correlation with cell aging (Alimenti et al., 2012); in E. nobilii, which inhabits polar seawater (Valbonesi and
N. Dobri et al. / Gene 515 (2013) 110–116
Luporini, 1990), the oxidative damages are likely the result of the cell adaptation to cope with a unique environment characterized by unusually high (saturated) O2 concentrations (unpublished results). In light of these observations, we studied the molecular mechanisms on which E. raikovi and E. nobilii rely to repair the oxidative damage of their proteins, and identified the genes encoding the enzyme Msr of type B. These genes, designated Er-msrB in E. raikovi and En-msrB in E. nobilii, were cloned from the transcriptionally active genome of the cell macronucleus, that in Euplotes (and ciliates in general) consists exclusively of free, linear DNA molecules amplified to hundreds or thousands of copies, each capped with two telomeres that are uniformly characterized by repetitions of the C4A4 motif in position 5′ and the G4T4 motif in position 3′ (Jahn and Klobutcher, 2002; Klobutcher et al., 1998). Coherent with their unusual organization characterized by an apparent lack of any structural information for the regulation of transcription, the Er-msrB and En-msrB genes equally show a constitutive expression and behave as housekeeping genes to ensure cell basal functions with their constant activity. 2. Materials and methods
111
Table 1 Primers used to amplify msrB genes: designations and sequences. Name Common primers msrB-fw1a msrB-rv1a Tel Er-msrB specific primers fw2 rv2 5′-fw 3′-rv fwA rvA En-msrB specific primers fw2 rv2 5′-fw 3′-rv fwA rvA
Nucleotide sequence (5′–3′) AAGTTCAATWCAGGATGHGGNTGGC GTTGCCTTTGGTCCATCATTGAANACRTGNCC CCCCAAAACCCCAAAACCCC CTTCACATGGCATGATTAGGACTG GCTCCTGCTTTATCATTGAAAGCT CCCCTACTTTTTAGAACTTCATAGA CCCCTTCACAATATCCAATAATTGA ATGAGTGAAGAGACGAAAGATGAC TCAGTCCTAATCATGCCATGTGAAG GTGGAGGTGCAATGTGATAAA CTTAATAGCACCTGCCTTATCATT TTCATAAGCAAATTTGGTAGATACATT TATTCATATCTTATGCATTGAAAATG ATGAGTGAAGAGACTAAAGATGAC CCACCCGAGTCATACCATGTGTTGT
a In the degenerate primers, W and R represent alternatives between A and T, and A and G; H, alternatives among A, C and T; N, alternatives among the four nucleotides.
2.1. Cell cultures Cell cultures of the E. raikovi strain 13 (deposited at the American Type Culture Collection (ATCC), reference number “PRA-327”) and the E. nobilii strain Far (Di Giuseppe et al., 2011) were maintained under a cycle of 12 h of moderate light and 16 h of darkness at 22 °C (E. raikovi), or 4–6 °C (E. nobilii). They were grown in natural seawater (salinity, 30–33‰; pH, 8.1–8.2), using the green alga Dunaniella tertiolecta as nutrient. Cells were deprived of food for 2–3 days before being used in experiments. 2.2. DNA and RNA purification DNA was purified from cells according to standard protocols (Vallesi et al., 2010). Total RNA was extracted from cells using Trizol reagent (Invitrogen, Life Technologies Corporation, Carlsbad, CA, USA) following the procedure described by the manufacturer, and purified from contaminating DNA by treatment with RNAse-free DNAse I (1 U/μg of RNA) (Fermentas International Inc., Thermo Fisher Scientific Inc., Maryland), at 37 °C for 1 h, in the presence of 40 U RiboLock (Fermentas International Inc.). After solubilization in RNase-free water, RNA was quantified by absorbance at 260 nm and its quality was verified in 1.2% agarose gel. 2.3. DNA amplification by polymerase chain reaction (PCR) DNA amplifications were performed by PCR in the Eppendorf Mastercycler (Eppendorf AG, Hamburg, Germany), using oligonucleotides synthesized by Invitrogen (Life Technologies Corporation) and listed in Table 1. DNA aliquots of 0.5 μg were used as template in 50 μl-reaction mixtures containing 0.5 μM of each primer, 0.3 mM dNTP, 1 U of Platinum Taq polymerase High Fidelity (Invitrogen, Life Technologies Corporation), 60 mM Tris–SO4 (pH 8.9), 2 mM MgSO4, and 18 mM ammonium sulfate. In general, 35 PCR cycles were carried out, each consisting of a 30 s 94 °C denaturation step, a 30 s annealing step, and a 30 s 72 °C elongation step. The temperature of the annealing step varied from 55 to 65 °C, depending on the G + C content of the primers. A final incubation step, at 72 °C for 5 min, was added to the last cycle. The resulting PCR products were run on 1.7% agarose gel, visualized with ethidium bromide, purified and cloned into the pCR TOPO 2.1 vector using TOPO-TA Cloning kit (Invitrogen, Carlsbad, CA USA), according to the manufacturer's recommendations. Sequencing was performed at the BMR Genomics Center of the University of Padua (Italy).
2.4. Reverse transcriptase (RT)-PCR The 3′-end of the Er-msrB and En-msrB transcripts was obtained by converting 1 μg-aliquots of total RNA into cDNA by reverse transcription with oligo(dT)20 and 200 U SuperScript III reverse transcriptase in 10 μl-volume, following the protocol provided by the SuperScript III First-Strand Synthesis System (Invitrogen, Life Technologies Corporation). 2 μl-aliquots of cDNA were next amplified using the gene-specific primer “fwA” (Table 1) and oligo(dT)20 under the conditions described in the previous section (Section 2.3). Variations in the expression of the En-msrB and Er-msrB genes in cells treated with H2O2 were assessed by converting 1 μg-aliquots of total RNA into cDNA by reverse transcription with random hexamers and 200 U SuperScript III reverse transcriptase in 10 μl-volume (as above), and using 2 μl-aliquots of cDNA in PCR amplifications with the msrB gene-specific primers, “fwA” and “rvA” (Table 1). The template concentration and external control for PCR amplifications were obtained by amplifying 2 μl-aliquots of cDNA with the 18S-rRNA specific primers, 5′-CGCAAGGTCTACTGAGRTGATTC-3′ and 5′-CCATAGCC RCCCTCCTGTCT-3′. The amplification conditions were the following: 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 40 s, for 30 cycles. Absence of DNA contaminations was verified by running PCR with total RNA preparations not incubated with reverse transcriptase as template. Amplified products were separated by electrophoresis in 1.7% agarose gels and visualized by ethidium bromide staining. The msrB gene expression levels were quantified using the ImageJ software (NIH, USA) and normalized to the 18S internal control gene.
2.5. Southern and Northern blot analysis Aliquots of DNA and total RNA (15 μg and 40 μg, respectively) were separated by electrophoresis on agarose gels and blotted onto Hybond-N+ membranes (GE Healthcare, Life Sciences, Piscataway, NJ, USA) according to standard procedures (Sambrook et al., 1989). The products of 156-bp obtained by PCR amplifications with the “msrB-fw1” and “msrB-rv1” primers (Table 1) were labeled with 32P using the random hexamer priming method (Feinberg and Vogelstein, 1983) and used as specific probes of the Er-msrB and En-msrB genes. Hybridizations were carried out overnight at 65 °C. Blotted membranes were washed at the hybridization temperature, dried, and exposed for autoradiography using a PhosphorImager system (BioRad).
112
N. Dobri et al. / Gene 515 (2013) 110–116
2.6. Cell viability assay Cell viability was assessed through the reduction of 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), as previously described by Di Giuseppe et al. (2012). After exposure to increasing H2O2 concentrations, cells were incubated for 60 min with 10 μl MTT (5 mg/ml stock solution). The MTT reduction to formazan by viable cells was stopped by dimethyl sulfoxide and quantified by absorbance at 570 nm using a microplate reader 680 spectrophotometer (Bio-Rad, Hercules, CA, USA). The value of reduced MTT absorbance in equivalent cell samples not exposed to H2O2 was used as control. 2.7. Bioinformatics Multiple alignment was performed using the ClustalW Multiple Alignment Program (http://www.ebi.ac.uk/clustalw/) (Thompson
et al., 1997). Database searches were performed on the NCBI/ GenBank/Blast website. The nucleotide sequences were analyzed with the SECISearch tool (http://genome.unl.edu/SECISearch.html), while the deduced amino acid sequences were analyzed with PROSITE (http://www.expasy.ch/prosite/) to check for functional protein domains, protein molecular weight and isoelectric point prediction. The predicted 3D structures were determined through comparative protein modeling on the SWISS-MODEL protein structure homology-modeling server (http://swissmodel.expasy.org/) (Arnold et al., 2006). The crystallographic structure of the Burkholderia pseudomallei MsrB (PDB ID: 3cxk) was automatically selected by the server as a template since it shows an amino acid sequence identity of 53% and 56% with the MsrB protein of E. raikovi and E. nobilii, respectively. The 3D structural models have previously been validated with the algorithms ANOLEA (Melo et al., 1997), Verify 3D (Luthy et al., 1992) and Ramachandran Plot (Gopalakrishnan et al.,
Fig. 1. Nucleotide and deduced amino acid sequences of the Er-msrB and En-msrB genes. In the nucleotide sequences, the telomeric repeats are in bold and italics, the putative motifs for the transcription regulation and the polyadenylation signal are underlined, and the TGA codons specifying cysteines are boxed. Arrows indicate positions, directions, and denominations of the PCR primers. In the amino acid sequences, the catalytic site is highlighted in gray.
N. Dobri et al. / Gene 515 (2013) 110–116
2007), and visualized and manipulated using MOLMOL (Koradi et al., 1996).
3. Results 3.1. Er-msrB and En-msrB gene identification and cloning The full-length nucleotide sequences of the E. raikovi Er-msrB and E. nobilii En-msrB genes were determined as a result of a multi-step PCR strategy. A single 156-bp product was first obtained from E. raikovi and E. nobilii DNA amplifications with two degenerated oligonucleotides (“msrB-fw1” and “msrB-rv1” in Table 1), specific to the sequences Lys59-Tyr-Asp-Ser-Gly-Cys-Gly-Trp-Pro67 and Gly103-HisVal-Phe-Pro-Asp-Gly-Pro-Gln-Pro-Thr113 (Escherichia coli MsrB numeration, Olry et al., 2005), which are shared among most prokaryotic and eukaryotic MsrBs. This 156-bp product was then used as probe in Southern blot analysis and shown to hybridize in both species to a single macronuclear gene-sized DNA molecule of approximately 550 bp (data not shown). In the second amplification step, Er-msrB and En-msrB genespecific oligonucleotides (“fw2” and “rv2” in Table 1) were synthesized on the sequence of the 156 bp-product and alternatively used as forward or reverse primer in combination with the oligonucleotide “Tel” (Table 1) equivalent to the strictly conserved C4A4 repeats that distinguish the telomeric ends of every Euplotes macronuclear gene (Jahn and Klobutcher, 2002; Klobutcher et al., 1998), and have no counterparts in genes of bacteria or any other microorganisms that may coexist in culture with Euplotes cells.
113
The full-length Er-msrB and En-msrB sequences were eventually reconstructed from overlapping individual sequences, and the accuracy of this reconstruction was validated through direct analysis of products of the third DNA amplification step carried out with two oligonucleotides (“5′-fw” and “3′-rv” in Table 1), derived from sequence stretches located immediately adjacent to the Er-msrB and En-msrB 5′ and 3′-telomeric ends. The Er-msrB and En-msrB gene sequences (deposited at the GenBank with the accession numbers JX978448 and JX978449) extend, the telomeric repeats included, for 547 and 551 bp, respectively (Fig. 1). They are closely similar (65% of nucleotide identity) and comprise two short 5′ and 3′ non-coding regions of 49 and 58 bp, respectively, in Er-msrB, and 50 and 64 bp in En-msrB. In both genes, the 5′ non-coding region is particularly rich in A and T (the A+T content is higher than 80%) and lacks the canonical CAAT and TATA boxes for the transcription initiation. As proposed by Ghosh et al. (1994), these boxes are most likely replaced with the CAAAT and TAATAA motifs at positions 9 and 27 in En-msrB, and with the GAAAA motif at position 20 in Er-msrB (counting from the end of the telomeric repeats). Similarly, the 3′ region of both genes lacks the canonical AAATAA polyadenylation signal that is most likely replaced with the AATTTT and AAATTT motifs. The putative coding regions of 384 bp in Er-msrB and 381 bp in En-msrB terminate with either a canonical TAA codon (En-msrB), or a TAG codon (Er-msrB) which is less commonly used in Euplotes species. They show only few variations that are relevant to the codon usage. While in En-msrB there is no deviation from the standard genetic code, the Er-msrB coding region includes two in-frame TGA codons that in Euplotes species may be either translated as cysteine
Fig. 2. (A) Effect of H2O2-induced oxidative stress on cell viability. E. raikovi and E. nobilii cells (squares and circles, respectively) were treated with increasing H2O2 concentrations for 2 h before measuring the cell viability by MTT assay. Values are averages of two separate experiments in quadruplicate and expressed as means ± SD. (B) Northern blot analysis of total RNA extracted from cells maintained in sea water, or exposed to 200 μM (E. raikovi) or 700 μM (E. nobilii) of H2O2 for 30 min. (C) RT-PCR analysis of msrB-specific mRNA synthesized by cells exposed to increasing H2O2 concentrations for 30 min. In each lane, equal volumes of amplification products were loaded, and a RT-PCR fragment of 18S-rRNA was used as loading control. The relative mRNA levels were measured using the ImageJ software (NIH, USA), taking the 18S-rRNA PCR fragments from equivalent cell samples as value 1. The experiment was repeated twice, with equivalent results.
114
N. Dobri et al. / Gene 515 (2013) 110–116
(Meyer et al., 1991) or, more unusually, selenocysteine (Turanov et al., 2009). 3.2. Expression of the Er-msrB and En-msrB genes It was first verified whether the Er-msrB and En-msrB genes are effectively expressed by a RT-PCR analysis carried out with oligo(dT)20 and a gene-specific primer annealing at the beginning of the open reading frame (Fig. 1). The amplification products extended for 402 bp (polyA tail excluded) in the Er-msrB gene transcript and 403 bp in the En-msrB gene transcript, and contained the coding region plus a short 3′-untranslated region of 18 and 22 bp, respectively. In this region, the putative polyadenylation signals AATTT, or AAATTT appear located 5 bp upstream the poly(A) tail. We then analyzed the Er-msrB and En-msrB gene expression in cells subjected to oxidative stress by exposure to H2O2. Preliminary to this analysis it was necessary to assess the maximal H2O2 concentrations that E. raikovi and E. nobilii were able to tolerate with no apparent damage of their viability. The viability of E. nobilii resulted to be above 90% even after a 2 h-incubation with a 1000 μM H2O2 concentration, while E. raikovi did not tolerate H2O2 concentrations higher than 500 μM (Fig. 2A). Therefore, a range of 250 to 750-μM H2O2 concentrations was chosen for this experimental analysis in E. nobilii and a range of 100 to 400-μM H2O2 concentrations for E. raikovi. The levels of Er-msrB and En-msrB expression were first compared by Northern blot analysis of total RNA extracted from cells suspended in fresh sea water and cells exposed for 30 min to H2O2 (used at the final concentrations of 700 μM in E. nobilii and 200 μM in E. raikovi) (Fig. 2B). The comparison was then extended to a semi-quantitative RT-PCR analysis of cells incubated for 30 min in the presence of increasing H2O2 concentrations (Fig. 2C). In both cases, mRNA signals of closely matching intensities were systematically detected, thus implying that the En-msrB and Er-msrB genes are constitutively expressed independently of the H2O2 concentrations at which cells were exposed. 3.3. Er-msrB and En-msrB amino acid sequences The two proteins specified by the Er-msrB and En-msrB open reading frames extend for 127 and 126 amino acids, respectively, and are predicted to be cytosolic enzymes with a theoretical molecular mass of
approximately 14,000 Da and an isoelectric point of approximately 5. Their amino acid sequences are similar to each other as well as to MsrBs of other uni- and multi-cellular organisms (Fig. 3). The correspondence is particularly significant at the level of the carboxyterminal region containing the conserved Arg-Tyr-Cys-Ile-Asn-Ser catalytic site, and of the basic pattern of six Cys residues that are necessary for the MsrB activity. Four cysteines (i.e., Cys45, Cys48, Cys92 and Cys95) form the two Cys-Xxx-Xxx-Cys motifs of the MsrB Zinc-ion binding domain (Kumar et al., 2002; Olry et al., 2005), while the two other cysteines (i.e., Cys63 and Cys115) find their counterparts with the recycling Cys63 and the catalytic Cys117 (E. coli sequence numeration) responsible for the reductase activity of most MsrBs. The MsrB of E. raikovi includes a seventh Cys residue in position 61, which has no counterpart in the E. nobilii MsrB and finds counterparts only with a few other MsrBs (Oke et al., 2009). 4. Discussion Euplotes species have substantially contributed to our understanding of Mendelian genetics of ciliate multiple mating type systems (Padhke and Zufall, 2009), whose determinants are found in the transcriptionally inert chromosomic genome of the cell germinal micronucleus. In contrast, relatively little progress has been made with regard to knowledge of the organization and transcription regulation of their sub-chromosomic genome expressed in the cell somatic macronucleus. Most available information is limited to E. crassus, of which a draft analysis of the macronuclear genome and transcriptome has recently been published by Vinogradov et al. (2012). This analysis substantially confirms previous observations predicting that the relatively simple structural organization of Euplotes macronuclear DNA molecules (each molecule containing a single gene usually flanked by short 5′ and 3′ non-coding regions) is often counterbalanced by rather complex mechanisms of gene expression involving transcriptional frame-shifting and removal of introns that have widely variable dimensions and splicing sites (Brünen-Nieweler et al., 1998; Ghosh et al., 1994; Klobutcher, 2005; Klobutcher et al., 1998; Miceli et al., 1992; Tan et al., 2001; Vallesi et al., 2009, 2010). The En-msrB and Er-msrB genes characterized from E. nobilii and E. raikovi appear to be organized differently with respect to this general picture. Their simple structural organization is associated with a mechanism of expression that is unhampered by phenomena of intron splicing and frame-shifting. In addition, their putative structural motifs for the
Fig. 3. Alignment of the E. raikovi and E. nobilii MsrB amino acid sequences (in bold) with MsrB sequences of other organisms. The alignment was maximized by gap insertions and dots indicate identical residues. The Cys residues are numbered according to their sequence positions. The catalytic site is boxed and the functionally more significant amino acid variations between E. raikovi and E. nobilii MsrBs are indicated by filled circles. GenBank accession numbers of protein sequences used in the alignment are: Tetrahymena thermophila, XP_001019714; Paramecium tetraurelia, XP_001426263; Polynucleobacter necessarius, YP_001155752; Burkholderia sp., YP_004228185; Apis mellifera, XP_001120023; Tribolium castaneum, XP_967693; Drosophila melanogaster, NP_731525; Schistosoma mansoni, AAT77264.
N. Dobri et al. / Gene 515 (2013) 110–116
transcription initiation are not appropriately positioned at around − 30 from the transcription initiation sites, which is different from what is usually observed in other macronuclear genes of E. crassus, Sterkiella histriomuscorum and Stylonychia lemnae (Ghosh et al., 1994; Lascasse et al., 2005; Skovorodkin et al., 2007). In fact, these motifs lie close to the translation starting site, implying that the En-msrB and Er-msrB mRNA leader regions are either extremely short or, according to Ghosh et al. (1994), the control of transcription involves the telomeres themselves. The En-msrB and Er-msrB constitutive expression raises the question of the mechanism that determines a stable MsrB protein concentration in the cell. This mechanism may depend on the degree of En-msrB and Er-msrB gene amplification that is established at the very beginning of the cell life cycle at the time of synthesis of a new macronucleus from the zygotic nucleus; alternatively, it may depend on the stability of En-msrB and Er-msrB specific mRNAs. The former possibility is supported by previous findings in E. octocarinatus and E. raikovi, showing that the levels of expression of RNA polymerase and pheromone genes are directly correlated with the number of macronuclear copies of these genes (Kaufmann and Klein, 1992; La Terza et al., 1995); the latter possibility is consistent with the presence of AT-rich motifs in the En-msrB and Er-msrB 3′ non-coding region which are reminiscent of the “stability-control” motifs for the rapid mRNA degradation (Chen and Shyu, 1995). The MsrB enzymes are subdivided between selenocysteinecontaining and cysteine-containing proteins on the basis of the presence, or absence of selenocysteine (Sec) in the catalytic site (Kim and Gladyshev, 2005, 2007). Sec is encoded by an in-frame UGA codon, and its insertion in the nascent protein requires the presence of a stem loop structure, known as Sec-insertion sequence (SECIS) element, in the mRNA 3′-untranslated region (Kryukov et al., 2003; Turanov et al., 2009). The E. raikovi and E. nobilii MsrBs do not appear to belong to Sec-containing enzymes for the reasons that (i) their active sites do not contain UGA codon specifying Sec, and (ii) no SECIS structure is present in the 3′ non-coding regions of the En-msrB and Er-msrB genes. In addition, the E. raikovi and E. nobilii MsrBs carry three residues, namely His98, Val101 and Asn117 (corresponding to His77, Val/Ile81 and Asn97 of the mouse MsrB), that appear to be conserved uniquely in Cys-containing MsrBs and absent in Sec-forms in which they are replaced with Gly77, Glu81 and Phe97 (mouse Sec-MsrB1 numeration), respectively. The three conserved residues are part of the active site and critical for the Cys-containing MsrB activity; their introduction into mouse Sec-containing MsrB1 was shown to be detrimental to the activity of this enzyme (Kim and Gladyshev, 2005). Also the MsrBs known in other ciliates, two in Tetrahymena thermophila (NCBI Reference Sequences: XP_001019714.3 and XP_001009805.1) and five in Paramecium tetraurelia (NCBI Reference Sequences: XP_001426263.1, XP_001447179.1, XP_001438438.1, XP_001431532.1 and XP_001439533.1), have similarly been regarded as not Sec-containing proteins. In addition, it is likely that only one MsrB form (XP_001019714.3) in T. thermophila and one (XP_001426263. 1) in P. tetraurelia are functional proteins, since they contain a Cys residue in the catalytic site (see Fig. 3). Substitutions of the catalytic cysteine with Ser residues suggest that the other forms are not functional. Although largely overlapping the E. raikovi and E. nobilii MsrBs diversify for a total of 27 amino acid variations, five of which appear to be functionally more significant for their location in the E. raikovi and E. nobilii MsrB structures (Fig. 4). One is relative to the Cys61 residue specific of the E. raikovi MsrB protein, which appears to be strategically positioned to form a disulfide bond with either Cys115, or Cys63 (Fig. 4A). In the former case, Cys61 might play a recycling role similar to that carried out by Cys63, while in the latter one the formation of the Cys61–Cys63 disulfide bond, in addition to reducing the local flexibility of the MsrB structure, might be responsible for a non-canonical recycling process as suggested in other systems (Ranaivoson et al., 2009; Tarrago et al., 2009).
115
Fig. 4. (A) Three-dimensional structures (ribbon presentations) of E. raikovi and E. nobilii MsrB proteins obtained through comparative modeling of the Burkholderia pseudomallei MsrB. The two regular α-helices and the two 310-helical turns are red-yellow colored, while the eight β-strands are light-blue colored. The Cys residues are indicated as yellow stick diagrams and the additional Cys61 of E. raikovi MsrB is marked with a red circle. N and C indicate the positions of the molecule amino- and carboxy-terminus, respectively. (B) Electrostatic potential distributions of the E. raikovi and E. nobilii MsrB molecular surfaces, shown rotated by 40° around the molecule vertical axis with respect to the ribbon presentations in A. Positive and negative charged residues are marked blue and red, respectively. The positions of the catalytic Cys115 and the residues responsible for electrostatic surface potential variations are indicated.
The four other variations of potential functional importance are relevant to the E. nobilii MsrB protein and likely reflect the need of this protein to enhance its structural flexibility for better coping with the thermodynamically adverse conditions of the polar waters inhabited by E. nobilii. These variations lie in the segment which extends between the positions 15 and 28 largely involved in the organization of the MsrB helix 2, and all appear to be responsible for a substantial modification of the electrostatic potential distribution on the molecular surface surrounding the active site provided by the Cys115 residue (Fig. 4B). The polar Thr15 and the negatively charged Glu23 residues of the E. raikovi MsrB appear to be replaced with a negatively charged aspartic acid and a positively charged lysine, respectively. More importantly the two positively charged residues Arg19 and Arg28 of the E. raikovi MsrB are replaced by a polar asparagine and a hydrophobic proline, respectively. The En-msrB and Er-msrB genes are not the only Msr genes on which E. raikovi and E. nobilii rely to repair oxidized macromolecules. Also Msrs of type A appear to be present in these two species, each specified by multiple gene isoforms which have not yet been completely characterized for their structure and mechanism of expression (Oumarou, PhD Thesis, 2011). The evolution of such a diverse array of Msr genes in Euplotes species, and ciliates in general, does not come as a surprise considering the unmatched ability that distinguish these organisms in
116
N. Dobri et al. / Gene 515 (2013) 110–116
facing the two main causes, namely senescence and environmental stress, of protein oxidation. Acknowledgments The authors heartily thank: Prof. Konstantin Petrukhin (Columbia University) for helpful suggestions on a preliminary draft of the manuscript, one anonymous reviewer for very constructive criticisms and insightful suggestions, and Dr. Martha Dumbar for assistance in the English revision. Research financially supported by the “Programma Nazionale di Ricerche in Antartide” (PNRA) and “Progetti di Ricerca di Interesse Nazionale” (PRIN). References Alimenti, C., Vallesi, A., Luporini, P., Buonanno, F., Ortenzi, C., 2012. Cell aging-induced methionine oxidation causes an autocrine to paracrine shift of the pheromone activity in the protozoan ciliate, Euplotes raikovi. Exp. Cell Res. 318, 144–151. Arnold, K., Bordoli, L., Kopp, J., Schwede, T., 2006. The SWISS-MODEL Workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22, 195–201. Aury, J.M., et al., 2006. Global trends of whole-genome duplications revealed by the ciliate Paramecium tetraurelia. Nature 444, 171–178. Bigelow, D.J., Squier, T.C., 2005. Redox modulation of cellular signaling and metabolism through reversible oxidation of methionine sensors in calcium regulatory proteins. Biochim. Biophys. Acta 1703, 121–134. Boschi-Muller, S., Gand, A., Branlant, G., 2008. The methionine sulfoxide reductases: catalysis and substrate specificities. Arch. Biochem. Biophys. 474, 266–273. Brünen-Nieweler, C., Weiligmann, J.C., Hansen, B., Kuhlmann, H.W., Möllenbeck, M., Heckmann, K., 1998. The pheromones and pheromone genes of new stocks of the Euplotes octocarinatus species complex. Eur. J. Protistol. 34, 124–132. Chen, C.Y., Shyu, A.B., 1995. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20, 465–470. Delaye, L., Becerra, A., Orgel, L., Lazcano, A., 2007. Molecular evolution of peptide methionine sulfoxide reductases (MsrA and MsrB): on the early development of a mechanism that protects against oxidative damage. J. Mol. Evol. 64, 15–32. Di Giuseppe, G., et al., 2011. Antarctic and Arctic populations of the ciliate Euplotes nobilii show common pheromone-mediated cell–cell signaling and cross-mating. Proc. Natl. Acad. Sci. U. S. A. 108, 3181–3186. Di Giuseppe, G., Cervia, D., Vallesi, A., 2012. Divergences in the response to ultraviolet radiation between polar and non-polar ciliated protozoa. Microb. Ecol. 63, 334–338. Feinberg, A.P., Vogelstein, B., 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6–13. Fenchel, T., 1987. Ecology of Protozoa. Springer-Verlag, Berlin. Friguet, B., 2006. Oxidized protein degradation and repair in ageing and oxidative stress. FEBS Lett. 580, 2910–2916. Ghosh, S., Jaraczewski, J.W., Klobutcher, L.A., Jahn, C.L., 1994. Characterization of transcription initiation, translation initiation, and poly(A) addition sites in the genesized macronuclear DNA molecules of Euplotes. Nucleic Acids Res. 22, 214–221. Gopalakrishnan, K., Sowmiya, G., Sheik, S.S., Sekar, K., 2007. Ramachandran Plot on the web (2.0). Protein Pept. Lett. 14, 669–671. Jahn, C.L., Klobutcher, L.A., 2002. Genome remodeling in ciliated protozoa. Ann. Rev. Microbiol. 56, 489–520. Jiang, J., Zhang, Q., Warren, A., Al-Rasheid, K.A.S., Song, S., 2010. Morphology and SSU rRNA gene-based phylogeny of two marine Euplotes species, E. orientalis spec. nov. and E. raikovi Agamaliev, 1966 (Ciliophora, Euplotida). Eur. J. Protistol. 46, 121–132. Kaufmann, J., Klein, A., 1992. Gene dosage as a possible major determinant for equal expression levels of genes encoding RNA polymerase subunits in the hypotrichous ciliate Euplotes octocarinatus. Nucleic Acids Res. 20, 4445–4450. Kim, H.Y., Gladyshev, V.N., 2005. Different catalytic mechanisms in mammalian selenocysteine- and cysteine-containing methionine-R-sulfoxide reductase. PLoS Biol. 3, e375. Kim, H.Y., Gladyshev, V.N., 2007. Methionine sulfoxide reductases: selenoprotein forms and roles in antioxidant protein repair in mammals. Biochem. J. 407, 321–329. Klobutcher, L.A., 2005. Sequencing of random Euplotes crassus macronuclear genes supports a high frequency of +1 translational frameshifting. Eukaryot. Cell 4, 2098–2105. Klobutcher, L.A., et al., 1998. Conserved DNA sequences adjacent to chromosome fragmentation and telomere addition sites in Euplotes crassus. Nucleic Acids Res. 26, 4230–4240. Koradi, R., Billeter, M., Wüthrich, K., 1996. MOLMOL: a program for display and analysis of macromolecular structures. J. Mol. Graph. 14, 51–55. Kryukov, G.V., et al., 2003. Characterization of mammalian selenoproteomes. Science 300, 1439–1443.
Kumar, R.A., Koc, A., Cerny, R.L., Gladyshev, V.N., 2002. Reaction mechanism, evolutionary analysis, and role of zinc in Drosophila methionine-R-sulfoxide reductase. J. Biol. Chem. 277, 37527–37535. La Terza, A., Miceli, C., Luporini, P., 1995. Differential amplification of pheromone genes of the ciliate Euplotes raikovi. Dev. Genet. 17, 272–279. Lascasse, R., et al., 2005. Gene structure of the ciliate Sterkiella histriomuscorum based on a combined analysis of DNA and cDNA sequences from 21 macronuclear chromosomes. Chromosoma 114, 344–351. Luthy, R., Bowie, J.U., Eisemberg, D., 1992. Assessment of protein models with threedimensional profiles. Nature 356, 83–85. Melo, F., Devos, D., Depiereux, E., Feytmans, E., 1997. ANOLEA: a www server to assess protein structures. Intell. Syst. Mol. Biol. 97, 110–113. Meyer, F., et al., 1991. UGA is translated as cysteine in pheromone 3 of Euplotes octocarinatus. Proc. Natl. Acad. Sci. U. S. A. 88, 3758–3761. Miceli, C., La Terza, A., Bradshaw, R.A., Luporini, P., 1992. Identification and structural characterization of a cDNA clone encoding a membrane-bound form of the polypeptide pheromone Er-1 in the ciliate protozoan Euplotes raikovi. Proc. Natl. Acad. Sci. U. S. A. 89, 1988–1992. Moskovitz, J., 2005. Methionine sulfoxide reductases: ubiquitous enzymes involved in antioxidant defense, protein regulation, and prevention of aging-associated diseases. Biochim. Biophys. Acta 1703, 213–219. Nanney, D.L., 1980. Experimental Ciliatology. Wiley, New York. Neiers, F., Kriznik, A., Boschi-Muller, S., Branlant, G., 2004. Evidence for a new sub-class of methionine sulfoxide reductases B with an alternative thioredoxin-recognition signature. J. Biol. Chem. 279, 42462–42468. Oke, T.T., Moskovitz, J., Williams, D.L., 2009. Characterization of the methionine sulfoxides reductase of Schistosoma mansoni. J. Parassitol. 95, 1421–1428. Olry, A., Boschi-Muller, S., Yu, H., Burnel, D., Branlant, G., 2005. Insights into the role of the metal binding site in methionine-R-sulfoxide reductases B. Protein Sci. 14, 2828–2837. Oumarou, E.E.N., 2011. Mechanisms of repairing age-induced protein oxidation in the protozoan ciliate Euplotes: characterization of the methionine sulfoxide reductase genes. PhD dissertation, University of Camerino. Padhke, S.S., Zufall, R.A., 2009. Rapid diversification of mating systems in ciliates. Biol. J. Linn. Soc. 98, 187–197. Petropoulos, I., Friguet, B., 2006. Maintenance of proteins and aging: the role of oxidized protein repair. Free Radic. Res. 40, 1269–1276. Ranaivoson, F.M., Neiers, F., Kauffmann, B., Boschi-Muller, S., Branlant, G., Favier, F., 2009. Methionine sulfoxide reductase B displays a high level of flexibility. J. Mol. Biol. 394, 83–93. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Sharov, V.S., Ferrington, D.A., Squier, T.C., Schöneich, C., 1999. Diastereoselective reduction of protein-bound methionine sulfoxide by methionine sulfoxide reductase. FEBS Lett. 455, 247–250. Skovorodkin, I., Pimenov, A., Raykhel, I., Schimanski, B., Ammermann, D., Günzl, A., 2007. α-Tubulin minichromosome promoters in the Stichotrichous ciliate Stylonychia lemnae. Eukaryot Cell 6, 28–36. Stadtman, E.R., 2006. Protein oxidation and aging. Free Radic. Res. 40, 1250–1258. Stover, N.A., Punia, R.S., Bowen, M.S., Dolins, S.B., Clark, T.G., 2012. Tetrahymena genome database Wiki: a community-maintained model organism database. Database 2012 http://dx.doi.org/10.1093/database/bas007. Tan, M., Liang, A., Brünen-Nieweler, C., Heckmann, K., 2001. Programmed translational frameshifting is likely required for expressions of genes encoding putative nuclear protein kinases of the ciliate Euplotes octocarinatus. J. Eukaryot. Microbiol. 48, 575–582. Tarrago, L., et al., 2009. Regeneration mechanisms of Arabidopsis thaliana methionine sulfoxide reductases B by glutaredoxins and thioredoxins. J. Biol. Chem. 284, 18963–18971. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 4, 4876–4882. Turanov, A.A., et al., 2009. Genetic code supports targeted insertion of two amino acids by one codon. Science 323, 259–261. Valbonesi, A., Luporini, P., 1990. Description of two new species of Euplotes and Euplotes rariseta from Antarctica. Polar Biol. 11, 47–53. Vallesi, A., Di Giuseppe, G., Dini, F., Luporini, P., 2008. Pheromone evolution in the protozoan ciliate, Euplotes: the ability to synthesize diffusible forms is ancestral and secondarily lost. Mol. Phylogenet. Evol. 47, 439–442. Vallesi, A., Alimenti, C., La Terza, A., Di Giuseppe, G., Dini, F., Luporini, P., 2009. Characterization of the pheromone gene family of an Antarctic and Arctic protozoan ciliate, Euplotes nobilii. Mar. Genomics 2, 27–32. Vallesi, A., Di Pretoro, B., Ballarini, P., Apone, F., Luporini, P., 2010. A novel protein kinase from the ciliate Euplotes raikovi with close structural identity to the mammalian intestinal and male-germ cell kinases: characterization and functional implications in the autocrine pheromone signaling loop. Protist 161, 250–263. Vinogradov, D.V., et al., 2012. Draft macronucleus genome of Euplotes crassus ciliate. Mol. Biol. 46, 328–333. Vogt, W., 1995. Oxidation of methionyl residues in proteins: tools, targets, and reversal. Free Radic. Biol. Med. 18, 93–105. Weissbach, H., et al., 2002. Peptide methionine sulfoxide reductase: structure, mechanism of action, and biological function. Arch. Biochem. Biophys. 397, 172–178.