- Email: [email protected]
MicroRNA-181a regulates endoplasmic reticulum stress in offspring of mice following prenatal microcystin-LR exposure
Chemosphere 240 (2020) 124905
Contents lists available at ScienceDirect
Chemosphere journal homepage: www.elsevier.com/locate/chemosphere
MicroRNA-181a regulates endoplasmic reticulum stress in offspring of mice following prenatal microcystin-LR exposure Jue Liu a, Yangyang Huang b, Fei Cai c, d, Yao Dang b, Chunsheng Liu b, Jianghua Wang b, * a
Department of Pharmacy, The Central Hospital of Wuhan, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 430014, China Fisheries College, Huazhong Agricultural University, Wuhan, 430070, China c Hubei Province Key Laboratory on Cardiovascular, Cerebrovascular, and Metabolic Disorders, Hubei University of Science and Technology, Xianning, 437100, Hubei, China d Department of Pharmacology, Hubei University of Science and Technology, Xianning, 437100, China b
h i g h l i g h t s Maternal MC-LR exposure altered behavioral responses in offspring mice. MC-LR prenatal exposure led to endoplasmic reticulum (ER) stress and neuronal apoptosis in offspring. Inhibition in miR-181a resulted in the activation of ER stress and subsequent apoptosis.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 17 June 2019 Received in revised form 17 September 2019 Accepted 17 September 2019 Available online 18 September 2019
Microcystin-LR (MCLR) was commonly regarded as a potent hepatotoxin and has been reported to cause neurotoxicity. This study was aimed to investigate how maternal MCLR exposure during pregnancy alters behavioral responses in offspring mice and the possible molecular mechanism involved in this procedure. Three doses of MCLR solutions (0, 3 or 15 mg/kg body weight) were administered subcutaneously to pregnant C57bl/6 from gestation day (GD) 6e19. Our results showed that MCLR prenatal exposure led to the impairment of learning and memory function in offspring on postnatal days (PND) 35, accompanied by endoplasmic reticulum (ER) stress and neuronal apoptosis in hippocampal CA1 regions of mice. Sixteen miRNAs in hippocampus of pups on PND 35 were significantly affected by MCLR exposure with the markedly decreased transcription of miR-181a-5p. We then found that miR-181a-5p was downregulated, accompanied by activation of ER stress after prenatal exposure to MCLR using qPCR analysis. Furthermore, glucose-regulated protein, 78kDa/binding immunoglobulin protein (Grp78/BIP), a major ER chaperone and signaling regulator, was identified as a target of miR-181a-5p. Our study showed that miR-181a could lead to a decrease in the mRNA expression and protein levels of Grp78 by directly binding to its 30 -untranslated region (30 -UTR) in primary hippocampal neurons. Our findings indicate that the up-regulation of Grp78 mediated by inhibition of miR-181a-5p is a possible mechanism resulting in ER stress and cognitive impairment in pups following prenatal MCLR exposure. © 2019 Elsevier Ltd. All rights reserved.
Handling Editor: A. Gies Keywords: Microcystin microRNA Neurobehavioral impairment Endoplasmic reticulum stress
1. Introduction Microcystins (MCs), a family of algal toxins produced by freshwater cyanobacteria, are common in ponds, lakes, and rivers (Graham et al., 2010). They pose a threat to drinking water supplies and aquatic food products owing to their extreme stability and resistance to heat, hydrolysis, and oxidation (Mohamed et al.,
* Corresponding author. E-mail address: [email protected] (J. Wang). https://doi.org/10.1016/j.chemosphere.2019.124905 0045-6535/© 2019 Elsevier Ltd. All rights reserved.
2015). Although their concentrations in natural waters are generally low, MCs have been widely reported to poison animals and humans over the past decades. There are over 100 identified congeners of MCs, among which microcystin-LR (MCLR) is the most toxic and common variant (Vesterkvist et al., 2012). A limit of 1 mg/L MCLR in drinking water is recommended by the World Health Organization (WHO). However, MCLR concentration in surface waters often exceeds this threshold in a number of water bodies (lakes, reservoirs, and rivers) during the period of cyanobacterial blooms (Wang et al., 2010), which poses potential health threat to the
2
J. Liu et al. / Chemosphere 240 (2020) 124905
animals and humans. For example, total concentrations of MCs in lake water varied from traces to 35.8 mg/L after the outbreak of cyanobacterial blooms in Lake Taihu of China (Wang et al., 2010). MCLR is hydrophilic and require active transport into cells by specific organic anion-transporting peptides (rodent Oatp; human OATP) (Fischer et al., 2005). It is a potent hepatoxin which can also damage other organs such as the lungs, the kidneys and the brain (Christen et al., 2013). It was demonstrated that MCLR could penetrate blood-brain-barrier in OATP1A2-dependent manner, suggesting that MCLR could accumulate and induce toxicity in brain cells (Fischer et al., 2005). Up to now, increasing evidence has confirmed that MCLR can cause neurotoxicity and impair rat behavior (Hu et al., 2016). Behavioral changes are considered to be important indicators to assess neurotoxicity of compounds (Tilson, 1990). Our previous studies revealed that acute high level and subchronic low dose treatment with MCLR could impair spatial learning and memory in rats (Li et al., 2012, 2014). The inhibition of phosphatases PP1 and PP2A is also considered to be one of the main mechanisms of MCLR toxicity. This inhibition leads to an imbalance of protein phosphorylation, which consequently causes disruption of the cell cytoskeleton, cell apoptosis and necrosis (Campos and Vasconcelos, 2010). A previous study of MCLR neurotoxicity revealed that multiple factors, such as cytoskeleton, neurotransmission, oxidative stress, channel, and signal transduction, were involved in regulating the neurobehaviors, especially the learning and memory (Hu et al., 2016). Similarly, we previously reported that the induction of endoplasmic reticulum (ER) stress and the change in intracellular free calcium concentration, as well as increased apoptosis in hippocampus could help explain cognitive impairment induced by MCLR (Cai et al., 2015a, 2015b). Thus, toxicity of MCLR is a multi-pathway process and the molecular mechanisms underlying its toxicity are still not well understood. It should be noted that OATP1B3 was confirmed to be expressed in human trophoblasts (Douglas et al., 2016), suggesting that MCs might transport across the maternal-fetal interface in the human placenta, subsequently causing developmental impairment in fetus. After 28-day maternal MCLR exposure, MCLR was found to accumulate in the brain of neonatal rats, which indicated that brain of neonatal rats was under the risk of MCLR attack (Zhao et al., 2015). The developing brain was reported to be particularly sensitive to disturbances, and that even very low level of compound exposure might lead to persistent damage to cognitive functions and other neurobehaviors (Grandjean and Landrigan, 2006, 2014). Little literature has been available as to the association between prenatal MCLR exposure and subsequent neurotoxicity in exposed offspring. A previous study revealed that long-term adverse effects on the behavior of rat offspring could be induced by maternal exposure to MCLR and that oxidative stress responses might partially contribute to the impairment of neurobehavior (Li et al., 2015). However, the exact mechanism of neurotoxicity induced by MCLR in the developing brain is still not fully understood. MicroRNAs (miRNAs) are a class of endogenous noncoding, highly conserved RNA molecules with ~22 nucleotides, and regulate gene expression negatively, playing a critical role in fundamental biological and metabolic processes (Fiore et al., 2008). MiRNAs negatively regulate their target mRNA by binding imperfectly to the 30 -untranslated region (30 -UTR) of the target mRNAs. As a result, the target mRNA is degraded or the process of translation is repressed (Lee et al., 1993). Plenty of evidence indicate that brain dysfunction was associated with abnormal expression of miRNAs (Zhang and Pan, 2009; Sathyan et al., 2007; Hua et al., 2009). There was a down-regulation of the brain-specific microRNAs: miRs-9, -29b, and 181 in Alzheimer's disease patients (Lau and de Strooper, 2010). Neurotoxicity conferred by ethanol, cocaine, Huntington's disease, and brain injuries have all been linked to
microRNA dysregulation (Kaur et al., 2012). Changes in miRNA profiles caused by environmental chemicals have been extensively studied in order to explore the molecular mechanism underlying chemical toxicity (Hou et al., 2011; Lee et al., 2018). Adverse mitochondrial health induced by down-regulation of miR-21 contributed to developmental neurotoxicity upon exposure to propofol, which implicated the importance of microRNA in chemical-induced neurotoxicity in the developing brain (Twaroski et al., 2014). However, little is known about the role of miRNAs in neurotoxicity induced by prenatal exposure to MCLR. Although fish test is suitable for assessing toxicity of more pollutants in aquatic environment, mouse can provide plentiful toxicological data on pollutants. Furthermore, mouse is the main model organisms used to investigate the molecular mechanism underlying the effects of chemicals on human health because of the genetic (99%) and physiological similarities between the species (Vandamme, 2014). So, mice were used as test species to investigate the effects of prenatal MCLR exposure on neurobehavior in offspring. Histological examination, microRNA microarray and validation experiments were conducted to investigate the molecular mechanisms involved in neurotoxic effects of prenatal MCLR exposure. In in vitro experiments, we explored the relationship between miRNA-181a and MCLR-induced ER stress. Our findings will provide valuable information for the epigenetic mechanism of adverse effects after prenatal MCLR exposure, and offer new views for miRNA biomarkers affected by MCLR.
2. Materials and methods 2.1. Chemicals and reagents The cyanobacterial toxin MCLR standards were obtained from Alexis Biochemicals (Lausen, Switzerland) with a purity of >95%, dissolved in 0.9% saline solution to desirable concentrations. All other chemicals and reagents used in the study were of analytical grade.
2.2. Experimental objects Specific pathogen free (SPF) C57bl/6 (22 ± 2g weight) were obtained from Animal Experiment Center of Wuhan University (License no. SCXK 2014-0004, China). Mice were housed in controlled conditions (21e23 C, 45e65% RH, 12:12-h dark:light cycle) and were fed with standard food and water. All animal experiments were conducted according to the Guidelines for the Care and Use of Laboratory Animals of the Chinese Animal Welfare Committee. After 7 days of acclimatization, the experiments were performed on virgin female and male mice. For mating, two female mice and one male mouse were placed together overnight. When the evidence of mating, such as vaginal plug or vaginal smear with sperm cells, was obtained, the day was designated as gestational day (GD) 0. Pregnant mice were individually housed during gestation and the control mice received the same volume of the saline solution. After injection with 10 mg/kg body weight (BW) MCLR for 4 weeks or administration by gavage (5.0 and 20 mg/kg BW) for 8 weeks in pregnant rats, MCLR accumulation and neurotoxicity in the brains of offspring were detected (Zhao et al., 2015; Li et al., 2015). Based on these two studies, 3 mg/kg BW as a suitable low dose and 15 mg/ kg BW as a suitable high dose of MCLR were selected for injection subcutaneous into the back of pregnant mice for 2 weeks from GD 6 to GD19 in this study. The delivery of offspring of all the pregnant mice occurred between GD 20.5 and GD 22.5. The offspring were raised for 30 days and then assigned to the MWM test.
J. Liu et al. / Chemosphere 240 (2020) 124905
2.3. Morris water maze test Two males and two females from each litter were randomly chosen for the Morris water maze test from postnatal day 31e35 (PD 31e35). The protocol used in this study referred to a previous report (Vorhees and Williams, 2006) with some minor modifications. Briefly, a clear plexiglass platform (10 10 cm) was placed in a circular black pool (diameter: 120 cm). The white opaque water was filled into the pool until the platform was 1 cm above the surface of the water. The mice (n ¼ 10) underwent a 5-day trials. First of all, the mice in each group were allowed to swim freely in the pool for 120 s, the swimming speed and travel distance of each mouse were recorded by a tracking system connected to an image analyzer (HVS Image, Hampton, UK). The acquisition phase consisted of four trials. During these four trials, the mice were placed at four different positions on the pool rim to look for the same platform before the 120 s cut-off, and then were allowed to stay on the platform for 10 s after each trial. The trial time of memory test lasted 120 s, and the platform was removed in the last trial. During the whole experiment, the mice were allowed to rest in a warm cage for at least 20 min at interval between trials. The time and trajectory for finding the platform and the time spent in the platform quadrant were monitored and recorded semi-automatically with the same tracking system. 2.4. Histopathological analysis Offspring (2 females and 2 males from each group) were deeply anesthetized with ether for histopathological analysis after the behavioral test. Brains of pups were rapidly removed and fixed with 4% (w/v) paraformaldehyde in phosphate-buffered saline (PBS) for 24 h, then trimmed and embedded in paraffin. In order to determine histopathological impairment induced by prenatal MCLR exposure, paraffin-embedded sections (4 mm) of brains in pups were stained with hematoxylin and eosin (H&E). Sections were evaluated using a light microscope (400 ) to examine the morphological alterations of neurons in the hippocampal CA1 region. An in situ cell death detection kit (Roche Diagnostic GmbH, Mannhein, Germany) was used to perform terminal deoxynucleotidyl transferase-mediated (dUTP) end-labeling (TUNEL) in accordance with the manufacturer's instructions. Tissue sections were then incubated with proteinase K (20 mg/ml in 10 mM Tris-Cl, pH 7.6) for 15 min at room temperature. The incubated tissue sections were blocked in methanol containing 3% H2O2 for 10 min, permeabilized in 0.1% Triton X-100/sodium citrate at 4 C for 2 min, and treated with TUNEL reaction mixture. The treated tissue sections were observed and analyzed using the light microscope and Improvision Open Lab version software. 2.5. MiRNA microarray assay Three pups of each group (control and 15 mg MCLR/kg BW group) were chosen and their brains were collected for miRNA microarray assay after the behavioral test on PND 35. Triplicate measurements were performed for each mouse, and there were 3 independent mice samples in each group. Total RNA was harvested using TRIzol reagent (Invitrogen) and a miRNeasy mini kit (Qiagen) according to the manufacturers’ instruction. NanoDrop spectrophotometer (ND-1000, NanoDrop Technology) was used to examine RNA quality and quantity. Sample labeling was conducted by a miRCURY™ Array Power Labeling kit (Cat #208032-A, Exiqon, Vedbaek, Denmark) and array hybridization was exerted using miRCURY LNA Array (v.18.0). The Hybridized arrays were washed, fixed and scanned using the Axon GenePix 4000B microarray
3
scanner (Axon Instruments, Foster City, CA, USA). The scanned images were analyzed using the GenePix Pro6.0 software (Axon). Differentially expressed miRNAs between MCLR-treated group and control group were identified through Volcano Plot filtering (fold change >1.5 and p < 0.05). 2.6. Quantitative real-time PCR The additional qRT-PCR analyses of brain samples of PND35 mice were performed to validate the microarray results. Three pups from each litter (3 replicates) were included for each group and brain of each replicate was from a single mouse. Total RNA isolation, first-strand cDNA synthesis, and qRT-PCR were performed according to the method described in our previous study (Li et al., 2012). In miRNA assay, small nuclear RNA U6 (U6) was used as a control. In mRNA assay, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. The quantification values of miRNA and mRNA were evaluated by using the 2-△△Ct method. The sequences of miRNA and mRNA primer pairs in this assay were listed in Tables 1 and 2. 2.7. Dual luciferase reporter assay Based on the human and mouse Grp78 mRNA sequences in GenBank, the 30 -untranslated region (30 -UTR) of the Grp78 gene, which contained the targeted site of mmu-miR-181a-5p, was amplified by using primers containing Xbal restriction sites. The mmu-miR-181a-5p and the 30 -UTR dual-luciferase vectors were transfected into HEK 293T cells by using Lipofectamine 2000 transfection reagent (Invitrogen). Six hours later, the medium was refreshed. Cells were collected after 48 h and luciferase activity was assayed by the Dual-Luciferase system (E1960, Promega) in accordance with manufacturer's protocol. 2.8. Cell culture and cell viability assay Primary mouse hippocampal neuronal cultures were prepared from 3-day-old C57bl/6 pups following methods previously described. On day 4, primary neurons were transfected with control miRNA, miR-181a mimic, or miR-181a inhibitor (RiboBio Co. Ltd., Guangdong, China) by using X-tremeGENE HP DNA Transfection Reagent (Roche, Mannheim, Germany) according to the manufacturer's instruction and they were exposed to various concentrations of MCLR on day 5. After MCLR treatment, the cell viability of neurons was tested by using a CCK-8 kit (Sigma-Aldrich, St. Louis, MO, USA), following the
Table 1 Oligonucleotide sequences of the mRNA primers. Accession No.
Gene name
Sequence of the primer (50 -30 )
NM_001081304.1
ATF6
NM_009716.3
ATF4
NM_009808.4
Caspase12
NM_001163434.1
GRP78
NM_007837.4
CHOP
NM_013842.3
XBP-1
XM_011241212.1
GAPDH
NM_023913.2
IRE-1
Forward: GTTACTCACCCATCCGAGTTGT Reverse: CAACGTCGACTCCCAGTCTTC Forward: CTGGCCGAGGCTATAAAGGG Reverse: TGAAGAGCGCCATGGCTTAG Forward: ATTGTGAGAGCCACCCCTTC Reverse: TGGGGAACCACCAGACCTTA Forward: TGCGGCCAAGAACCAACTC Reverse: AATGTCTTGGTTTGCCCACCTC Forward: AATAACAGCCGGAACCTGAGGA Reverse: ACTCAGCTGCCATGACTGCAC Forward: CAGCAAGTGGTGGATTTGGAAG Reverse: TCTTAACTCCTGGTTCTCAACCACA Forward: AATGTGTCCGTCGTGGATCTGA Reverse: GATGCCTGCTTCACCACCTTCT Forward: ACGAAGGCCTGACGAAACTT Reverse: ATCAGCAAAGGCCGATGACA
4
J. Liu et al. / Chemosphere 240 (2020) 124905 Table 2 Oligonucleotide sequences of miRNA primers. miRNA
Sequence (50 -30 )
U6
F:50 GCTTCGGCAGCACATATACTAAAAT30 R:50 CGCTTCACGAATTTGCGTGTCAT30 GSP:50 GGGGGTTTGTGACCTGGT30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 GGGGGGTGGATATTCCTTCTA30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 GGGGGTGAGGTAGTAGGTTGT30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 GGGCTTTCAGTCGGATGTT30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 ACATATACTCACAGTGAACCG30 R:50 CAGTGCGTGTCGTGGA30 GSP:50 GGGAACATTCAACGCTGTCG30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 GGGGGTTATTGCTTAAGAATAC30 R:50 CAGTGCGTGTCGTGGAGT30 GSP:50 GGGGTCAGTGCACTACAGAA30 R:50 CAGTGCGTGTCGTGGAGT30 GSP:50 GGGGTGTAAACATCCTCG30 R:50 CAGTGCGTGTCGTGGAG30 GSP:50 GGGGAATGACACGATCACTC30 R:50 GTGCGTGTCGTGGAGTCG30
mmu-miR-758-3p mmu-miR-376b-5p mmu-let-7a-5p mmu-miR-30a-3p mmu-miR-128-3p mmu-miR-181a-5p mmu-miR-137-3p mmu-miR-148a-3p mmu-miR-30a-5p mmu-miR-425-5p
procedures recommended by manufacturer. 2.9. Statistical analysis SPSS 19.0 (SPSS, Chicago, IL) was used to perform all statistical analyses. The normality and homogeneity of data were evaluated by Kolmogorov-Smirnow and Levene's Tests, respectively. If necessary, data were log-transformed to approximate normality. One-way analysis of variance (ANOVA) and Tukey's multiple range tests were used for data analysis. Fold-changes for differentially expressed miRNAs between qPCR analysis and miRNA microarray analysis were compared and subjected to bivariate regression analysis, and Pearson correlation coefficient (r) was calculated. A value of p < 0.05 and p < 0.01 was considered as statistically significant. All data were expressed as means ± SEM. 3. Results 3.1. Maternal MCLR exposure impaired learning and memory function in offspring No statistical significance in the swimming speed was observed between the control group and the MC-treated groups (data not shown), which excluded the possibility that sensorimotor disturbances influenced the learning in the present study. A significantly longer escape latency was observed in MC-treated groups than that in the control group at PND 35 (p < 0.05) (Fig. 1B). Moreover, we found that time spent in the target quadrant by MC-treated groups was significantly shorter than that by control group (p < 0.05) (Fig. 1C). These data indicated that spatial learning and memory function were impaired in offspring after maternal MCLR exposure. 3.2. Histological changes of hippocampal CA1 area Fig. 2 showed that maternal exposure to MCLR induced the histological damage to the hippocampus of offspring. Cellular edema, nuclear condensation, and neuronal disarray were observed in MCLR treated group by H&E staining (Fig. 2B and C). As shown in Fig. 2EeF, the number of apoptotic cells in the hippocampal CA1 region was significantly increased in maternal MCLR treated pups by TUNEL staining.
Fig. 1. Maternal MCLR exposure damaged learning and memory function of offspring. A: Swimming track in Morris water maze test. B: Escape latency in the hidden platform test. C: Time spent in target quadrant in the probe trial. For each group, male n ¼ 12, female n ¼ 12. Data are expressed by Mean ± SEM with **p < 0.01 regarded as a high degree of significant difference.
3.3. Expression profiles of miRNA in offspring brain after maternal exposure to MCLR Offspring of the group treated with MCLR at 15 mg/kg BW were selected in the following study to investigate mechanisms underlying the neurotoxicity of prenatal MCLR exposure. In order to identify miRNAs involved in histological alterations and memory impairment, the miRNA microarray was performed on the brains of offspring (PND 35) with maternal exposure to MCLR. From the detected 1178 miRNAs, we identified 16 miRNAs to be differentially expressed after MCLR maternal exposure. A volcano plot (Fig. 3A) showed that 15 miRNAs were up-regulated, and only one miRNA was down-regulated upon maternal MCLR exposure (foldchange>1.5, p < 0.05). Fold changes of differentially expressed miRNAs by miRNA microarray assay were showed in Fig. 3B. To validate the array data, ten dysregulated miRNAs were confirmed performing qPCR. And the trend in regulation was consistent with the miRNA microarray analysis. According to the PCR results, expressions of miR-376b-5p, let-7a-5p, miR-30a-5p, miR-425-5p,
J. Liu et al. / Chemosphere 240 (2020) 124905
5
Fig. 2. Histological changes in hippocampal CA1 area. (AeC) Representative photomicrographs of histopathological injury (H&E staining) in pyramidal layer of hippocampal CA1 region (400 ). (DeF) Representative photomicrographs of apoptotic cells in hippocampal CA1 region by TUNEL staining (400 ). Apoptotic cells were pointed by arrows. (G) Total number of TUNEL positive cells in the CA1 region of the control and MCLR treated group. *p < 0.05 and **p < 0.01 indicate the significant difference and higher degree of significant difference, respectively.
miR-148a-3p, miR-128-3p, and miR-181a-5p were found to be down-regulated significantly (Fig. 3C, p < 0.05). Fig. 3D showed the comparison of fold-change results obtained from qPCR validation and miRNA microarray data, indicating a correlation coefficient of 0.855 (p < 0.05). This result suggested qPCR validation display concordance with miRNA microarray expression profiling. MiR181a was chosen for the further study due to its potential crucial role in the molecular mechanism underlying the effects of MCLR. 3.4. Prenatal MCLR exposure induced ER stress in hippocampus of offspring Given that ER stress is related to neurotoxicity caused by MCLR, we examined the mRNA expression of the ER stress markers using qPCR analysis. The difference in mRNA expression was detected between control group and 15 mg MCLR/kg BW prenatal exposure group. As shown in Fig. 4, the mRNA expression levels of Grp78, Chop, and Ire-1 were significantly increased, while the expression of Atf-4, Atf-6, Xbp-1, and Caspase-12 exhibited no significant difference between control and MCLR prenatal exposure offspring (15 mg MCLR/kg BW). 3.5. Grp78 is the direct target of miR-181a Grp78 was found to be a good marker for ER stress and might be the possible target of miR-181a through database prediction (miRbase, targetSCAN, and RNAhybrid database).
Complementation between the seed region of miR-181a and Grp78 30 -UTR along with some supplementary pairing sites at the 50 end of miR-181a was revealed by bioinformatics analysis (Fig. 5A). MiR181a mimics was used to determine whether Grp78 is a direct target of miR-181a in luciferase reporter assay. Compared with HEK293T cells only transfected with a luciferase report vector containing the mRNA 30 -UTR of Grp78 (NC), the luciferase activity was significantly inhibited in the cells co-treated with miR-181a mimic (Fig. 5B). In contrast, the luciferase activity was not changed in cells transfected with vector of Grp78 30 -UTR mutant (MU). All these results indicated that miR-181a-5p directly targeted the 30 -UTR of Grp78 mRNA. 3.6. miR-181a mediated expression of Grp78 in neurons treated with MCLR In primary hippocampal neurons, the expression of miR-181a was significantly decreased after MCLR exposure (Fig. 6A). The miR-181a mimic or inhibitor was used to up-regulate or downregulate the expression of miR-181a. Overexpression of miR-181a markedly increased cell viability of neurons post MCLR exposure. When endogenous miR-181a expression was knocked down in neurons with a miR-181a inhibitor before MCLR treatment, the decrease in cell viability was aggravated (Fig. 6B). The qPCR results revealed that, compared with control group, miR-181a mimic significantly alleviated the increase in mRNA expression of Grp78 caused by MCLR. The changing trend of protein level of Grp78
6
J. Liu et al. / Chemosphere 240 (2020) 124905
Fig. 3. Differentially expressed miRNAs in microarray analysis and post validation. (A) Volcano plot represents a differential expression of all miRNAs obtained with red indicating fold-change > 1.5 and p < 0.05). The green line indicates the cut-off criteria. (B) Fold changes of differentially expressed miRNAs in miRNA microarray assay. (C) Validation of changes in expression of miRNAs by qPCR in offspring post maternal MCLR exposure compared to control group. One way ANOVA test (*p < 0.05 and **p < 0.01) was used to determine significant differences between control and MCLR-treated (15 mg/kg BW) group. (D) Fold-change correlations between qPCR analysis and miRNA microarray. The solid line represents the linear regression fit.
Fig. 4. The mRNA expression of the ER stress markers in the hippocampus of pups after prenatal MCLR exposure. *p < 0.05 and **p < 0.01 indicate significant difference and a higher degree of significant difference, respectively.
observed in Western blot analysis was similar to that of mRNA expression in qPCR. On the contrary, inhibiting miR-181a expression with miR-181a inhibitor aggravated the increase in the expression of Grp78 caused by MCLR treatment at mRNA and protein levels (Fig. 6CeF). 4. Discussion Since toxic cyanobacterial blooms frequently occur in inland waters worldwide, the potential risk of offspring after the exposure of pregnant female to MCs should not be neglected. Previous studies have demonstrated that prenatal exposure to MCLR can affect fetal development (Li et al., 2015; Zhao et al., 2015). However, the exact molecular mechanisms of MCLR toxicity remain poorly understood. In aquatic environment, MCs content is generally low except during periods of cayanobacterial blooms. However, MCs are
Fig. 5. Grp78 30 -UTR was targeted by miR-181a-5p. (A) miR-181a-5p and its putative binding sequence in the 30 -UTR of Grp78. The mutant Grp78 30 -UTR binding site was generated at the complementary site for the seed region of miR-181a-5p. (B) Confirmation of direct binding of miR-181a-5p to Grp78 mRNA 30 -UTR by luciferase assay. The experiments were performed in triplicates. Data are expressed as the mean ± SEM. *p < 0.05.
bioavailable and can be accumulated in fish, mammals including human beings through the food web (Sahin et al., 1996). It is documented that the most frequent route of MCLR exposure is consumption of microcystin-contaminated water and aquatic animals (Poste et al., 2011). And MCLR is usually taken orally in low-
J. Liu et al. / Chemosphere 240 (2020) 124905
7
Fig. 6. Grp78 expression modulated by miR-181a and apoptosis induced by MCLR. (A) The expression of miR-181a under the treatment of MCLR. (BeF) Cells were pre-treated with 50 mM miR-181a mimic or 100 mM miR-181a inhibitor for 12 h and then treated with MCLR (1 mM) for 24 h. (B) Cell viability. (CeD) mRNA levels of Grp78. (EeF) Protein levels of Grp78 in hippocampal neurons. *p < 0.05 vs control, #p < 0.05 vs MCLR alone.
dose toxicology studies (He et al., 2017; Chen et al., 2019). Aims of these studies were to assess potential health risks about environmentally relevant concentrations of MCLR rather than determining qualitative and quantitative toxic characteristics. A previous result indicated that the lethality of MCLR was much lower in oral dosage than by intraperitoneal administration, but toxic effects were similar (Yoshida et al., 1997). Thus, although considered to be of low ecological relevance, intraperitoneal administration and subcutaneous injection were often chosen in acute and sub-chronic toxicity tests (Arman et al., 2019; Huang et al., 2013; Myhre et al., 2018). Subcutaneous injection was more widely used in the pregnant mice (Park and Choi, 2016; Tadotsu et al., 2018). In the present study, we attempted to determine the role of miRNAs and ER stress in offspring of mice to explain the mechanism of neurotoxicity caused by MCLR prenatal exposure. So, subcutaneous injection was selected as the exposure route of MCLR. In our study, the toxin content were 2.98 ± 0.41 ng/g dry weight (data not shown) in brains of pups after prenatal exposed to 15 mg MCLR/kg BW, which is similar to that in fishes from natural waters (Deblois et al., 2008). In addition, the plasma concentration of MCLR in pregnant mice
(15 mg/kg) was about 0.47 ± 0.13 ng/ml (data not shown), which is similar to that in fishes from natural waters with cyanobacterial blooms and populations with high levels of exposure (Chen et al., 2009). In this way, the results obtained in the present study could be applied to species living with environmental exposure to MCLR. The Morris water maze experiment is used to evaluate spatial learning and memory function of rodents (Vorhees and Williams, 2006). In the present study, all offspring post prenatal exposure to MCLR exhibited longer escape latency to locate the platform and spent less time in the target zone, indicating a potential neurobehavioral impairment caused by MCLR to offspring mouse. Our study found that increased cell apoptosis was observed in hippocampal CA1 region which is closely related to spatial learning and memory ability (Ocampo et al., 2018). Several previous studies have demonstrated that MCLR could induce apoptosis (Chen and Xie, 2016; Chen et al., 2016; Qi et al., 2016), and that cell apoptosis occurred after sustained and massive ER stress (Di Sano et al., 2006; Oyadomari et al., 2001). Our previous study also reported that MCLR-induced apoptosis in the brain might be due to ER stress (Qi et al., 2016; Cai et al., 2015a). When stress lasted, three major
8
J. Liu et al. / Chemosphere 240 (2020) 124905
transmembrane proteins, activating transcription factor 6 (Atf6), inositol-requiring enzyme 1 alpha (Ire1a), and protein kinase RNAlike ER protein kinase (Perk), were released from Grp78 to activate the unfolded protein response (UPR) which increased the levels of ER chaperones, such as Grp78, leading to the restoration of the normal function of ER. When the ER damage was irreversible, cell apoptosis occurred (Deldicque et al., 2010; Nakanishi et al., 2005). Additionally, Grp78 and Chop were reported to be key mediators of ER stress-mediated apoptosis (Gulyaeva, 2015). Our study indicated that the mRNA expression levels of Grp78, Chop, and Ire-1 were significantly increased, suggesting that MCLR activated ER stress in the brain of offspring. Some researchers have found that miRNAs played critical role in UPR-dependent signaling, and that they were important regulators of ER homeostasis (Maurel and Chevet, 2013). Other researchers found that MCLR altered miRNA levels in the nervous system (Saul et al., 2014), which prompted us to study the role of miRNAs in brain-specific MCLR toxicity. This study revealed that prenatal exposure to MCLR at concentration of 15 mg/kg significantly changed the expression levels of 16 miRNAs. Our qPCR verified the changes in the expression levels of miR-376b-5p, let-7a-5p, miR30a-5p, miR-425-5p, miR-148a-3p, miR-128-3p, and miR181a-5p. Our study also confirmed the pivotal role of miR-181a in regulating ER stress. The miR-181a was reported to be associated with memory function and it was highly expressed in a variety of brain regions (Chandrasekar and Dreyer, 2011; Stary et al., 2017). Our results showed that MCLR decreased the expression of miR-181a in primary hippocampal neurons, which was consistent with the data of the brain of offspring post prenatal MCLR exposure. The abovementioned results revealed that miR-181a played a significant role in neuron apoptosis of the offspring undergoing prenatal exposure to MCLR. Our findings were in line with the previous study results that overexpression of miR-181a inhibited autophagy and reduced apoptosis of neurons (Liu et al., 2017). However, overexpression of miR-181a was reported to have enhanced apoptosis in C2C12 cells (Wei et al., 2016). The conflicting reports suggested a complex role of miR181a in cell survival or death under different conditions. Bioinformatics analysis using HEK cells showed that there was a possible target of miR-181a in Grp 78 mRNA 30 -UTR sequence. Bioinformatic analysis between the miR-181a-5p seed region and the seed matches on Grp78 mRNA 30 -UTR region revealed that they are highly complementary and highly conservative in human and mouse (Wei et al., 2016). Thus, for murine tissues and human cell line (HEK293 cells), the target relationship between miR-181a-5p and Grp78 is very similar across species. Grp78, as an ER chaperone protein, was involved in many critical biological processes, such as facilitating protein degradation, maintaining calcium homeostasis, and serving as a sensor for ER stress (Luo et al., 2006). A previous proteomic result showed that the abundance of Grp 78 was significantly up-regulated in the offspring mice post maternal perinatal exposure to MCLR (Zhao et al., 2015), which was consistent with the results of our study of the offspring following prenatal MCLR exposure. Luciferase reporter assay confirmed that miR-181a directly targeted the 30 -UTR of Grp78. Moreover, 181a mimic significantly alleviated the increase in Grp78 caused by MCLR at mRNA and protein levels. However, suppressing miR-181a expression with miR-181a inhibitor aggravated the increase in the expression of Grp78 caused by MCLR at mRNA and protein levels. Cell viability assay indicated that cell viability following MCLR exposure was obviously increased through transfection of miR181a mimic, and significantly decreased by miR-181a inhibitor. Our findings together with the previous study evidence confirmed that a negative effect of MCLR on miR-181a resulted in the activation of ER stress and subsequent apoptosis in the brain of offspring
following prenatal MCLR exposure. Taken together, the neurobehavioral impairment induced by prenatal MCLR exposure in offspring are likely partly related to the activation of ER stress and the change in expression level of miR181a. However, all the conclusions were based on the microarray and bioinformatics assessment. More work is needed to further confirm the predicted mechanisms. Conflicts of interest The authors declare that they have no conflicts of interest. Acknowledgments This work was supported by the National Natural Science Foundation of China (31770553, 31370525, 81870576) and the Natural Science Foundation of Hubei Province of China (2014CFA031, 2019CFB426). This work was also supported by grant from Basic Research of Wuhan Science and Technology Bureau (2017060201010204). References Arman, T., Lynch, K.D., Montonye, M.L., Goedken, M., Clarke, J.D., 2019. Sub-chronic microcystin-LR liver toxicity in preexisting diet-induced nonalcoholic steatohepatitis in rats. Toxins (Basel) 11 (7), E398, 2019 Jul 9. Cai, F., Liu, J., Li, C., Wang, J., 2015a. Critical role of endoplasmic reticulum stress in cognitive impairment induced by microcystin-LR. Int. J. Mol. Sci. 16, 28077e28086. Cai, F., Liu, J., Li, C., Wang, J., 2015b. Intracellular calcium plays a critical role in the microcystin-LR-elicited neurotoxicity through PLC/IP3 pathway. Int. J. Toxicol. 34, 551e558. Campos, A., Vasconcelos, V., 2010. Molecular mechanism of microcystin toxicity in animal cells. Int. J. Mol. Sci. 11, 268e287. Chandrasekar, V., Dreyer, J.L., 2011. Regulation of MiR-124, Let-7d, and MiR-181a in the accumbens affects the expression, extinction, and reinstatement of cocaineinduced conditioned place preference. Neuropsychopharmacology 36, 1149e1164. Chen, J., Bian, R., Li, J., Qiu, L., Lu, B., Ouyang, X., 2019. Chronic exposure to microcystin-LR reduces thyroid hormone levels by activating p38/MAPK and MEK/ERK signal pathway. Ecotoxicol. Environ. Saf. 173, 142e148. Chen, J., Xie, P., Li, L., Xu, J., 2009. First identification of the hepatotoxic microcystins in the serum of a chronically exposed human population together with indication of hepatocellular damage. Toxicol. Sci. 108 (1), 81e89. Chen, L., Li, S., Guo, X., Xie, P., Chen, J., 2016. The role of GSH in microcystin-induced apoptosis in rat liver: involvement of oxidative stress and NF-kB. Environ. Toxicol. 31, 552e560. Chen, L., Xie, P., 2016. Mechanisms of microcystin-induced cytotoxicity and apoptosis. Mini Rev. Med. Chem. 16, 1018e1031. Christen, V., Meili, N., Fent, K., 2013. Microcystin-LR induces endoplasmatic reticulum stress and leads to induction of NFkB, interferon-alpha, and tumor necrosis factor-alpha. Environ. Sci. Technol. 47 (7), 3378e3385. Deblois, C.P., Aranda-Rodriguez, R., Giani, A., Bird, D.F., 2008. Microcystin accumulation in liver and muscle of tilapia in two large Brazilian hydroelectric reservoirs. Toxicon 51 (3), 435e448. Deldicque, L., Cani, P.D., Philp, A., Raymackers, J.M., Meakin, P.J., Ashford, M.L., Delzenne, N.M., Francaux, M., Baar, K., 2010. The unfolded protein response is activated in skeletal muscle by high-fat feeding: potential role in the downregulation of protein synthesis. Am. J. Physiol. Endocrinol. Metab. 299, E695eE705. Di Sano, F., Ferraro, E., Tufi, R., Achsel, T., Piacentini, M., Cecconi, F., 2006. Endoplasmic reticulum stress induces apoptosis by an apoptosome-dependent but caspase 12-independent mechanism. J. Biol. Chem. 281, 2693e2700. Douglas, G.C., Thirkill, T.L., Kumar, P., Loi, M., Hilborn, E.D., 2016. Effect of microcystin-LR on human placental villous trophoblast differentiation in vitro. Environ. Toxicol. 31, 427e439. Fiore, R., Siegel, G., Schratt, G., 2008. MicroRNA function in neuronal development, plasticity and disase. Biochim. Biophys. Acta 1779, 471e478. Fischer, W.J., Altheimer, S., Cattori, V., Meier, P.J., Dietrich, D.R., Hagenbuch, B., 2005. Organic anion transporting polypeptides expressed in liver and brain mediate uptake of microcystin. Toxicol. Appl. Pharmacol. 203, 257e263. Graham, J.L., Loftin, K.A., Meyer, M.T., Ziegler, A.C., 2010. Cyanotoxin mixtures and taste-and odor compounds in cyanobacterial blooms from the Midwestern United States. Environ. Sci. Technol. 44, 7361e7368. Grandjean, P., Landrigan, P.J., 2006. Developmental neurotoxicity of industrial chemicals. Lancet 368, 2167e2178. Grandjean, P., Landrigan, P.J., 2014. Neurobehavioural effects of developmental toxicity. Lancet Neurol. 13, 330e338.
J. Liu et al. / Chemosphere 240 (2020) 124905 Gulyaeva, N.V., 2015. Brain ischemia, endoplasmic reticulum stress, and astroglial activation: new insights. J. Neurochem. 132, 263e265. He, J., Li, G., Chen, J., Lin, J., Zeng, C., Chen, J., Deng, J., Xie, P., 2017. Prolonged exposure to low-dose microcystin induces nonalcoholic steatohepatitis in mice: a systems toxicology study. Arch. Toxicol. 91 (1), 465e480. Hou, L., Wang, D., Baccarelli, A., 2011. Environmental chemicals and microRNAs. Mutat. Res. 714, 105e112. Hu, Y., Chen, J., Fan, H., Xie, P., He, J., 2016. A review of neurotoxicity of microcystins. Environ. Sci. Pollut. Res. Int. 23, 7211e7219. Hua, Y.J., Tang, Z.Y., Tu, K., Zhu, L., Li, Y.X., Xie, L., Xiao, H.S., 2009. Identification and target prediction of miRNAs specifically expressed in rat neural tissue. BMC Genomics 10, 214. Huang, X., Zhang, Y., Xiao, W., Ye, X., Zhong, Q., Gu, K., 2013. Comparison of response indices to toxic microcystin-LR in blood of mice. Chemosphere 92 (5), 563e569. Kaur, P., Armugam, A., Jeyaseelan, K., 2012. MicroRNAs in neurotoxicity. J. Toxicol. 2012, 870150. Lau, P., de Strooper, B., 2010. Dysregulated microRNAs in neurodegenerative disorders. Semin. Cell Dev. Biol. 21 (7), 768e773. Lee, R.C., Feinbaum, R.L., Ambros, V., 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843e854. Lee, J., Kho, K., Kim, P.G., Ji, K., 2018. Exposure to bisphenol S alters the expression of microRNA in male zebrafish. Toxicol. Appl. Pharmacol. 338, 191e196. Li, G., Cai, F., Yan, W., Li, C., Wang, J., 2012. A proteomic analysis of MCLR-induced neurotoxicity: implications for Alzheimer's disease. Toxicol. Sci. 127, 485e495. Li, G., Yan, W., Cai, F., Li, C., Chen, N., Wang, J., 2014. Spatial learning and memory impairment and pathological change in rats induced by acute exposure to microcystin-LR. Environ. Toxicol. 29, 261e268. Li, X., Zhang, X., Ju, J., Li, Y., Yin, L., Pu, Y., 2015. Maternal repeated oral exposure to microcystin-LR affects neurobehaviors in developing rats. Environ. Toxicol. Chem. 34, 64e69. Liu, Y., Song, Y., Zhu, X., 2017. MicroRNA-181a regulates apoptosis and autophagy process in Parkinson's disease by inhibiting p38 mitogen-activated protein kinase (MAPK)/c-Jun N-terminal kinases (JNK) signaling pathways. Med. Sci. Monit. 23, 1597e1606. Luo, S., Mao, C., Lee, B., Lee, A.S., 2006. GRP78/BiP is required for cell proliferation and protecting the inner cell mass from apoptosis during early mouse embryonic development. Mol. Cell. Biol. 26, 5688e5697. Maurel, M., Chevet, E., 2013. Endoplasmic reticulum stress signaling: the microRNA connection. Am. J. Physiol. Cell Physiol. 304, C1117eC1126. Mohamed, Z.A., Deyab, M.A., Abou-Dobara, M.I., El-Sayed, A.K., El-Raghi, W.M., 2015. Occurrence of cyanobacteria and microcystin toxins in raw and treated waters of the Nile River, Egypt: implication for water treatment and human health. Environ. Sci. Pollut. Res. 15, 11716e11727. Myhre, O., Eide, D.M., Kleiven, S., Utkilen, H.C., Hofer, T., 2018. Repeated five-day administration of L-BMAA, microcystin-LR, or as mixture, in adult C57BL/6 mice - lack of adverse cognitive effects. Sci. Rep. 8 (1), 2308. Nakanishi, K., Sudo, T., Morishima, N., 2005. Endoplasmic reticulum stress signaling transmitted by ATF6 mediates apoptosis during muscle development. J. Cell Biol. 169, 555e560. Ocampo, A.C., Squire, L.R., Clark, R.E., 2018. The beneficial effect of prior experience on the acquisition of spatial memory in rats with CA1, but not large hippocampal lesions: a possible role for schema formation. Learn. Mem. 25, 115e121. Oyadomari, S., Takeda, K., Takiguchi, M., Gotoh, T., Matsumoto, M., Wada, I., Akira, S., Araki, E., Mori, M., 2001. Nitric oxide-induced apoptosis in pancreatic beta cells
9
is mediated by the endoplasmic reticulum stress pathway. Proc. Natl. Acad. Sci. U. S. A. 98, 10845e10850. Park, J.H., Choi, T.S., 2016. Subcutaneous administration of monosodium glutamate to pregnant mice reduces weight gain in pups during lactation. Lab. Anim. 50 (2), 94e99. Poste, A.E., Hecky, R.E., Guildford, S.J., 2011. Evaluating microcystin exposure risk through fish consumption. Environ. Sci. Technol. 45 (13), 5806e5811. Qi, M., Dang, Y., Xu, Q., Yu, L., Liu, C., Yuan, Y., Wang, J., 2016. Microcystin-LR induced developmental toxicity and apoptosis in zebrafish (Danio rerio) larvae by activation of ER stress response. Chemosphere 157, 166e173. Sahin, A., Tencalla, F.G., Dietrich, D.R., Naegeli, H., 1996. Biliary excretion of biochemically active cyanobacteria (blue-green algae) hepatotoxins in fish. Toxicology 106 (1e3), 123e130. Saul, N., Chakrabarti, S., Stürzenbaum, S.R., Menzel, R., Steinberg, C.E., 2014. Neurotoxic action of microcystin-LR is reflected in the transcriptional stress response of Caenorhabditis elegans. Chem. Biol. Interact. 223, 51e57. Sathyan, P., Golden, H.B., Miranda, R.C., 2007. Competing interactions between micro-RNAs determine neural progenitor survival and proliferation after ethanol exposure: evidence from an ex vivo model of the fetal cerebral cortical neuroepithelium. J. Neurosci. 27, 8546e8557. Stary, C.M., Xu, L., Li, L., Sun, X., Ouyang, Y.B., Xiong, X., Zhao, J., Giffard, R.G., 2017. Inhibition of miR-181a protects female mice from transient focal cerebral ischemia by targeting astrocyte estrogen receptor-a. Mol. Cell. Neurosci. 82, 118e125. Tadotsu, D., Kawate, N., Tamada, H., 2018. Rescue of the fetal damage associated with high intrauterine pressure by 17b-estradiol injection in ovariectomized progesterone-treated pregnant mice. Endocr. J. 65 (12), 1219e1224. Tilson, H.A., 1990. Behavioral indices of neurotoxicity. Toxicol. Pathol. 18, 96e104. Twaroski, D.M., Yan, Y., Olson, J.M., Bosnjak, Z.J., Bai, X., 2014. Down-regulation of microRNA-21 is involved in the propofol-induced neurotoxicity observed in human stem cell-derived neurons. Anesthesiology 121 (4), 786e800. Vandamme, T.F., 2014. Use of rodents as models of human diseases. J. Pharm. BioAllied Sci. 6 (1), 2e9. Vesterkvist, P.S., Misiorek, J.O., Spoof, L.E., Toivola, D.M., Meriluoto, J.A., 2012. Comparative cellular toxicity of hydrophilic and hydrophobic microcystins on Caco-2 cells. Toxins 4, 1008e1023. Vorhees, C.V., Williams, M.T., 2006. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 1, 848e858. Wang, Q., Niu, Y., Xie, P., Chen, J., Ma, Z., Tao, M., Qi, M., Wu, L., Guo, L., 2010. Factors affecting temporal and spatial variations of microcystins in Gonghu bay of lake Taihu, with potential risk of microcystin contamination to human health. Sci. World J. 10, 1795e1809. Wei, Y., Tao, X., Xu, H., Chen, Y., Zhu, L., Tang, G., Li, M., Jiang, A., Shuai, S., Ma, J., Jin, L., Wen, A., Wang, Q., Zhu, G., Xie, M., Wu, J., He, T., Jiang, Y., Li, X., 2016. Role of miR-181a-5p and endoplasmic reticulum stress in the regulation of myogenic differentiation. Gene 592, 60e70. Yoshida, T., Makita, Y., Nagata, S., Tsutsumi, T., Yoshida, F., Sekijima, M., Tamura, S., Ueno, Y., 1997. Acute oral toxicity of microcystin-LR, a cyanobacterial hepatotoxin, in mice. Nat. Toxins 5 (3), 91e95. Zhang, B., Pan, X., 2009. RDX induces aberrant expression of microRNAs in mouse brain and liver. Environ. Health Perspect. 117, 231e240. Zhao, S., Li, G., Chen, J., 2015. A proteomic analysis of prenatal transfer of microcystin-LR induced neurotoxicity in rat offspring. J Proteomics 114, 197e213.
Contents lists available at ScienceDirect
Chemosphere journal homepage: www.elsevier.com/locate/chemosphere
MicroRNA-181a regulates endoplasmic reticulum stress in offspring of mice following prenatal microcystin-LR exposure Jue Liu a, Yangyang Huang b, Fei Cai c, d, Yao Dang b, Chunsheng Liu b, Jianghua Wang b, * a
Department of Pharmacy, The Central Hospital of Wuhan, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 430014, China Fisheries College, Huazhong Agricultural University, Wuhan, 430070, China c Hubei Province Key Laboratory on Cardiovascular, Cerebrovascular, and Metabolic Disorders, Hubei University of Science and Technology, Xianning, 437100, Hubei, China d Department of Pharmacology, Hubei University of Science and Technology, Xianning, 437100, China b
h i g h l i g h t s Maternal MC-LR exposure altered behavioral responses in offspring mice. MC-LR prenatal exposure led to endoplasmic reticulum (ER) stress and neuronal apoptosis in offspring. Inhibition in miR-181a resulted in the activation of ER stress and subsequent apoptosis.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 17 June 2019 Received in revised form 17 September 2019 Accepted 17 September 2019 Available online 18 September 2019
Microcystin-LR (MCLR) was commonly regarded as a potent hepatotoxin and has been reported to cause neurotoxicity. This study was aimed to investigate how maternal MCLR exposure during pregnancy alters behavioral responses in offspring mice and the possible molecular mechanism involved in this procedure. Three doses of MCLR solutions (0, 3 or 15 mg/kg body weight) were administered subcutaneously to pregnant C57bl/6 from gestation day (GD) 6e19. Our results showed that MCLR prenatal exposure led to the impairment of learning and memory function in offspring on postnatal days (PND) 35, accompanied by endoplasmic reticulum (ER) stress and neuronal apoptosis in hippocampal CA1 regions of mice. Sixteen miRNAs in hippocampus of pups on PND 35 were significantly affected by MCLR exposure with the markedly decreased transcription of miR-181a-5p. We then found that miR-181a-5p was downregulated, accompanied by activation of ER stress after prenatal exposure to MCLR using qPCR analysis. Furthermore, glucose-regulated protein, 78kDa/binding immunoglobulin protein (Grp78/BIP), a major ER chaperone and signaling regulator, was identified as a target of miR-181a-5p. Our study showed that miR-181a could lead to a decrease in the mRNA expression and protein levels of Grp78 by directly binding to its 30 -untranslated region (30 -UTR) in primary hippocampal neurons. Our findings indicate that the up-regulation of Grp78 mediated by inhibition of miR-181a-5p is a possible mechanism resulting in ER stress and cognitive impairment in pups following prenatal MCLR exposure. © 2019 Elsevier Ltd. All rights reserved.
Handling Editor: A. Gies Keywords: Microcystin microRNA Neurobehavioral impairment Endoplasmic reticulum stress
1. Introduction Microcystins (MCs), a family of algal toxins produced by freshwater cyanobacteria, are common in ponds, lakes, and rivers (Graham et al., 2010). They pose a threat to drinking water supplies and aquatic food products owing to their extreme stability and resistance to heat, hydrolysis, and oxidation (Mohamed et al.,
* Corresponding author. E-mail address: [email protected] (J. Wang). https://doi.org/10.1016/j.chemosphere.2019.124905 0045-6535/© 2019 Elsevier Ltd. All rights reserved.
2015). Although their concentrations in natural waters are generally low, MCs have been widely reported to poison animals and humans over the past decades. There are over 100 identified congeners of MCs, among which microcystin-LR (MCLR) is the most toxic and common variant (Vesterkvist et al., 2012). A limit of 1 mg/L MCLR in drinking water is recommended by the World Health Organization (WHO). However, MCLR concentration in surface waters often exceeds this threshold in a number of water bodies (lakes, reservoirs, and rivers) during the period of cyanobacterial blooms (Wang et al., 2010), which poses potential health threat to the
2
J. Liu et al. / Chemosphere 240 (2020) 124905
animals and humans. For example, total concentrations of MCs in lake water varied from traces to 35.8 mg/L after the outbreak of cyanobacterial blooms in Lake Taihu of China (Wang et al., 2010). MCLR is hydrophilic and require active transport into cells by specific organic anion-transporting peptides (rodent Oatp; human OATP) (Fischer et al., 2005). It is a potent hepatoxin which can also damage other organs such as the lungs, the kidneys and the brain (Christen et al., 2013). It was demonstrated that MCLR could penetrate blood-brain-barrier in OATP1A2-dependent manner, suggesting that MCLR could accumulate and induce toxicity in brain cells (Fischer et al., 2005). Up to now, increasing evidence has confirmed that MCLR can cause neurotoxicity and impair rat behavior (Hu et al., 2016). Behavioral changes are considered to be important indicators to assess neurotoxicity of compounds (Tilson, 1990). Our previous studies revealed that acute high level and subchronic low dose treatment with MCLR could impair spatial learning and memory in rats (Li et al., 2012, 2014). The inhibition of phosphatases PP1 and PP2A is also considered to be one of the main mechanisms of MCLR toxicity. This inhibition leads to an imbalance of protein phosphorylation, which consequently causes disruption of the cell cytoskeleton, cell apoptosis and necrosis (Campos and Vasconcelos, 2010). A previous study of MCLR neurotoxicity revealed that multiple factors, such as cytoskeleton, neurotransmission, oxidative stress, channel, and signal transduction, were involved in regulating the neurobehaviors, especially the learning and memory (Hu et al., 2016). Similarly, we previously reported that the induction of endoplasmic reticulum (ER) stress and the change in intracellular free calcium concentration, as well as increased apoptosis in hippocampus could help explain cognitive impairment induced by MCLR (Cai et al., 2015a, 2015b). Thus, toxicity of MCLR is a multi-pathway process and the molecular mechanisms underlying its toxicity are still not well understood. It should be noted that OATP1B3 was confirmed to be expressed in human trophoblasts (Douglas et al., 2016), suggesting that MCs might transport across the maternal-fetal interface in the human placenta, subsequently causing developmental impairment in fetus. After 28-day maternal MCLR exposure, MCLR was found to accumulate in the brain of neonatal rats, which indicated that brain of neonatal rats was under the risk of MCLR attack (Zhao et al., 2015). The developing brain was reported to be particularly sensitive to disturbances, and that even very low level of compound exposure might lead to persistent damage to cognitive functions and other neurobehaviors (Grandjean and Landrigan, 2006, 2014). Little literature has been available as to the association between prenatal MCLR exposure and subsequent neurotoxicity in exposed offspring. A previous study revealed that long-term adverse effects on the behavior of rat offspring could be induced by maternal exposure to MCLR and that oxidative stress responses might partially contribute to the impairment of neurobehavior (Li et al., 2015). However, the exact mechanism of neurotoxicity induced by MCLR in the developing brain is still not fully understood. MicroRNAs (miRNAs) are a class of endogenous noncoding, highly conserved RNA molecules with ~22 nucleotides, and regulate gene expression negatively, playing a critical role in fundamental biological and metabolic processes (Fiore et al., 2008). MiRNAs negatively regulate their target mRNA by binding imperfectly to the 30 -untranslated region (30 -UTR) of the target mRNAs. As a result, the target mRNA is degraded or the process of translation is repressed (Lee et al., 1993). Plenty of evidence indicate that brain dysfunction was associated with abnormal expression of miRNAs (Zhang and Pan, 2009; Sathyan et al., 2007; Hua et al., 2009). There was a down-regulation of the brain-specific microRNAs: miRs-9, -29b, and 181 in Alzheimer's disease patients (Lau and de Strooper, 2010). Neurotoxicity conferred by ethanol, cocaine, Huntington's disease, and brain injuries have all been linked to
microRNA dysregulation (Kaur et al., 2012). Changes in miRNA profiles caused by environmental chemicals have been extensively studied in order to explore the molecular mechanism underlying chemical toxicity (Hou et al., 2011; Lee et al., 2018). Adverse mitochondrial health induced by down-regulation of miR-21 contributed to developmental neurotoxicity upon exposure to propofol, which implicated the importance of microRNA in chemical-induced neurotoxicity in the developing brain (Twaroski et al., 2014). However, little is known about the role of miRNAs in neurotoxicity induced by prenatal exposure to MCLR. Although fish test is suitable for assessing toxicity of more pollutants in aquatic environment, mouse can provide plentiful toxicological data on pollutants. Furthermore, mouse is the main model organisms used to investigate the molecular mechanism underlying the effects of chemicals on human health because of the genetic (99%) and physiological similarities between the species (Vandamme, 2014). So, mice were used as test species to investigate the effects of prenatal MCLR exposure on neurobehavior in offspring. Histological examination, microRNA microarray and validation experiments were conducted to investigate the molecular mechanisms involved in neurotoxic effects of prenatal MCLR exposure. In in vitro experiments, we explored the relationship between miRNA-181a and MCLR-induced ER stress. Our findings will provide valuable information for the epigenetic mechanism of adverse effects after prenatal MCLR exposure, and offer new views for miRNA biomarkers affected by MCLR.
2. Materials and methods 2.1. Chemicals and reagents The cyanobacterial toxin MCLR standards were obtained from Alexis Biochemicals (Lausen, Switzerland) with a purity of >95%, dissolved in 0.9% saline solution to desirable concentrations. All other chemicals and reagents used in the study were of analytical grade.
2.2. Experimental objects Specific pathogen free (SPF) C57bl/6 (22 ± 2g weight) were obtained from Animal Experiment Center of Wuhan University (License no. SCXK 2014-0004, China). Mice were housed in controlled conditions (21e23 C, 45e65% RH, 12:12-h dark:light cycle) and were fed with standard food and water. All animal experiments were conducted according to the Guidelines for the Care and Use of Laboratory Animals of the Chinese Animal Welfare Committee. After 7 days of acclimatization, the experiments were performed on virgin female and male mice. For mating, two female mice and one male mouse were placed together overnight. When the evidence of mating, such as vaginal plug or vaginal smear with sperm cells, was obtained, the day was designated as gestational day (GD) 0. Pregnant mice were individually housed during gestation and the control mice received the same volume of the saline solution. After injection with 10 mg/kg body weight (BW) MCLR for 4 weeks or administration by gavage (5.0 and 20 mg/kg BW) for 8 weeks in pregnant rats, MCLR accumulation and neurotoxicity in the brains of offspring were detected (Zhao et al., 2015; Li et al., 2015). Based on these two studies, 3 mg/kg BW as a suitable low dose and 15 mg/ kg BW as a suitable high dose of MCLR were selected for injection subcutaneous into the back of pregnant mice for 2 weeks from GD 6 to GD19 in this study. The delivery of offspring of all the pregnant mice occurred between GD 20.5 and GD 22.5. The offspring were raised for 30 days and then assigned to the MWM test.
J. Liu et al. / Chemosphere 240 (2020) 124905
2.3. Morris water maze test Two males and two females from each litter were randomly chosen for the Morris water maze test from postnatal day 31e35 (PD 31e35). The protocol used in this study referred to a previous report (Vorhees and Williams, 2006) with some minor modifications. Briefly, a clear plexiglass platform (10 10 cm) was placed in a circular black pool (diameter: 120 cm). The white opaque water was filled into the pool until the platform was 1 cm above the surface of the water. The mice (n ¼ 10) underwent a 5-day trials. First of all, the mice in each group were allowed to swim freely in the pool for 120 s, the swimming speed and travel distance of each mouse were recorded by a tracking system connected to an image analyzer (HVS Image, Hampton, UK). The acquisition phase consisted of four trials. During these four trials, the mice were placed at four different positions on the pool rim to look for the same platform before the 120 s cut-off, and then were allowed to stay on the platform for 10 s after each trial. The trial time of memory test lasted 120 s, and the platform was removed in the last trial. During the whole experiment, the mice were allowed to rest in a warm cage for at least 20 min at interval between trials. The time and trajectory for finding the platform and the time spent in the platform quadrant were monitored and recorded semi-automatically with the same tracking system. 2.4. Histopathological analysis Offspring (2 females and 2 males from each group) were deeply anesthetized with ether for histopathological analysis after the behavioral test. Brains of pups were rapidly removed and fixed with 4% (w/v) paraformaldehyde in phosphate-buffered saline (PBS) for 24 h, then trimmed and embedded in paraffin. In order to determine histopathological impairment induced by prenatal MCLR exposure, paraffin-embedded sections (4 mm) of brains in pups were stained with hematoxylin and eosin (H&E). Sections were evaluated using a light microscope (400 ) to examine the morphological alterations of neurons in the hippocampal CA1 region. An in situ cell death detection kit (Roche Diagnostic GmbH, Mannhein, Germany) was used to perform terminal deoxynucleotidyl transferase-mediated (dUTP) end-labeling (TUNEL) in accordance with the manufacturer's instructions. Tissue sections were then incubated with proteinase K (20 mg/ml in 10 mM Tris-Cl, pH 7.6) for 15 min at room temperature. The incubated tissue sections were blocked in methanol containing 3% H2O2 for 10 min, permeabilized in 0.1% Triton X-100/sodium citrate at 4 C for 2 min, and treated with TUNEL reaction mixture. The treated tissue sections were observed and analyzed using the light microscope and Improvision Open Lab version software. 2.5. MiRNA microarray assay Three pups of each group (control and 15 mg MCLR/kg BW group) were chosen and their brains were collected for miRNA microarray assay after the behavioral test on PND 35. Triplicate measurements were performed for each mouse, and there were 3 independent mice samples in each group. Total RNA was harvested using TRIzol reagent (Invitrogen) and a miRNeasy mini kit (Qiagen) according to the manufacturers’ instruction. NanoDrop spectrophotometer (ND-1000, NanoDrop Technology) was used to examine RNA quality and quantity. Sample labeling was conducted by a miRCURY™ Array Power Labeling kit (Cat #208032-A, Exiqon, Vedbaek, Denmark) and array hybridization was exerted using miRCURY LNA Array (v.18.0). The Hybridized arrays were washed, fixed and scanned using the Axon GenePix 4000B microarray
3
scanner (Axon Instruments, Foster City, CA, USA). The scanned images were analyzed using the GenePix Pro6.0 software (Axon). Differentially expressed miRNAs between MCLR-treated group and control group were identified through Volcano Plot filtering (fold change >1.5 and p < 0.05). 2.6. Quantitative real-time PCR The additional qRT-PCR analyses of brain samples of PND35 mice were performed to validate the microarray results. Three pups from each litter (3 replicates) were included for each group and brain of each replicate was from a single mouse. Total RNA isolation, first-strand cDNA synthesis, and qRT-PCR were performed according to the method described in our previous study (Li et al., 2012). In miRNA assay, small nuclear RNA U6 (U6) was used as a control. In mRNA assay, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. The quantification values of miRNA and mRNA were evaluated by using the 2-△△Ct method. The sequences of miRNA and mRNA primer pairs in this assay were listed in Tables 1 and 2. 2.7. Dual luciferase reporter assay Based on the human and mouse Grp78 mRNA sequences in GenBank, the 30 -untranslated region (30 -UTR) of the Grp78 gene, which contained the targeted site of mmu-miR-181a-5p, was amplified by using primers containing Xbal restriction sites. The mmu-miR-181a-5p and the 30 -UTR dual-luciferase vectors were transfected into HEK 293T cells by using Lipofectamine 2000 transfection reagent (Invitrogen). Six hours later, the medium was refreshed. Cells were collected after 48 h and luciferase activity was assayed by the Dual-Luciferase system (E1960, Promega) in accordance with manufacturer's protocol. 2.8. Cell culture and cell viability assay Primary mouse hippocampal neuronal cultures were prepared from 3-day-old C57bl/6 pups following methods previously described. On day 4, primary neurons were transfected with control miRNA, miR-181a mimic, or miR-181a inhibitor (RiboBio Co. Ltd., Guangdong, China) by using X-tremeGENE HP DNA Transfection Reagent (Roche, Mannheim, Germany) according to the manufacturer's instruction and they were exposed to various concentrations of MCLR on day 5. After MCLR treatment, the cell viability of neurons was tested by using a CCK-8 kit (Sigma-Aldrich, St. Louis, MO, USA), following the
Table 1 Oligonucleotide sequences of the mRNA primers. Accession No.
Gene name
Sequence of the primer (50 -30 )
NM_001081304.1
ATF6
NM_009716.3
ATF4
NM_009808.4
Caspase12
NM_001163434.1
GRP78
NM_007837.4
CHOP
NM_013842.3
XBP-1
XM_011241212.1
GAPDH
NM_023913.2
IRE-1
Forward: GTTACTCACCCATCCGAGTTGT Reverse: CAACGTCGACTCCCAGTCTTC Forward: CTGGCCGAGGCTATAAAGGG Reverse: TGAAGAGCGCCATGGCTTAG Forward: ATTGTGAGAGCCACCCCTTC Reverse: TGGGGAACCACCAGACCTTA Forward: TGCGGCCAAGAACCAACTC Reverse: AATGTCTTGGTTTGCCCACCTC Forward: AATAACAGCCGGAACCTGAGGA Reverse: ACTCAGCTGCCATGACTGCAC Forward: CAGCAAGTGGTGGATTTGGAAG Reverse: TCTTAACTCCTGGTTCTCAACCACA Forward: AATGTGTCCGTCGTGGATCTGA Reverse: GATGCCTGCTTCACCACCTTCT Forward: ACGAAGGCCTGACGAAACTT Reverse: ATCAGCAAAGGCCGATGACA
4
J. Liu et al. / Chemosphere 240 (2020) 124905 Table 2 Oligonucleotide sequences of miRNA primers. miRNA
Sequence (50 -30 )
U6
F:50 GCTTCGGCAGCACATATACTAAAAT30 R:50 CGCTTCACGAATTTGCGTGTCAT30 GSP:50 GGGGGTTTGTGACCTGGT30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 GGGGGGTGGATATTCCTTCTA30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 GGGGGTGAGGTAGTAGGTTGT30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 GGGCTTTCAGTCGGATGTT30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 ACATATACTCACAGTGAACCG30 R:50 CAGTGCGTGTCGTGGA30 GSP:50 GGGAACATTCAACGCTGTCG30 R:50 GTGCGTGTCGTGGAGTCG30 GSP:50 GGGGGTTATTGCTTAAGAATAC30 R:50 CAGTGCGTGTCGTGGAGT30 GSP:50 GGGGTCAGTGCACTACAGAA30 R:50 CAGTGCGTGTCGTGGAGT30 GSP:50 GGGGTGTAAACATCCTCG30 R:50 CAGTGCGTGTCGTGGAG30 GSP:50 GGGGAATGACACGATCACTC30 R:50 GTGCGTGTCGTGGAGTCG30
mmu-miR-758-3p mmu-miR-376b-5p mmu-let-7a-5p mmu-miR-30a-3p mmu-miR-128-3p mmu-miR-181a-5p mmu-miR-137-3p mmu-miR-148a-3p mmu-miR-30a-5p mmu-miR-425-5p
procedures recommended by manufacturer. 2.9. Statistical analysis SPSS 19.0 (SPSS, Chicago, IL) was used to perform all statistical analyses. The normality and homogeneity of data were evaluated by Kolmogorov-Smirnow and Levene's Tests, respectively. If necessary, data were log-transformed to approximate normality. One-way analysis of variance (ANOVA) and Tukey's multiple range tests were used for data analysis. Fold-changes for differentially expressed miRNAs between qPCR analysis and miRNA microarray analysis were compared and subjected to bivariate regression analysis, and Pearson correlation coefficient (r) was calculated. A value of p < 0.05 and p < 0.01 was considered as statistically significant. All data were expressed as means ± SEM. 3. Results 3.1. Maternal MCLR exposure impaired learning and memory function in offspring No statistical significance in the swimming speed was observed between the control group and the MC-treated groups (data not shown), which excluded the possibility that sensorimotor disturbances influenced the learning in the present study. A significantly longer escape latency was observed in MC-treated groups than that in the control group at PND 35 (p < 0.05) (Fig. 1B). Moreover, we found that time spent in the target quadrant by MC-treated groups was significantly shorter than that by control group (p < 0.05) (Fig. 1C). These data indicated that spatial learning and memory function were impaired in offspring after maternal MCLR exposure. 3.2. Histological changes of hippocampal CA1 area Fig. 2 showed that maternal exposure to MCLR induced the histological damage to the hippocampus of offspring. Cellular edema, nuclear condensation, and neuronal disarray were observed in MCLR treated group by H&E staining (Fig. 2B and C). As shown in Fig. 2EeF, the number of apoptotic cells in the hippocampal CA1 region was significantly increased in maternal MCLR treated pups by TUNEL staining.
Fig. 1. Maternal MCLR exposure damaged learning and memory function of offspring. A: Swimming track in Morris water maze test. B: Escape latency in the hidden platform test. C: Time spent in target quadrant in the probe trial. For each group, male n ¼ 12, female n ¼ 12. Data are expressed by Mean ± SEM with **p < 0.01 regarded as a high degree of significant difference.
3.3. Expression profiles of miRNA in offspring brain after maternal exposure to MCLR Offspring of the group treated with MCLR at 15 mg/kg BW were selected in the following study to investigate mechanisms underlying the neurotoxicity of prenatal MCLR exposure. In order to identify miRNAs involved in histological alterations and memory impairment, the miRNA microarray was performed on the brains of offspring (PND 35) with maternal exposure to MCLR. From the detected 1178 miRNAs, we identified 16 miRNAs to be differentially expressed after MCLR maternal exposure. A volcano plot (Fig. 3A) showed that 15 miRNAs were up-regulated, and only one miRNA was down-regulated upon maternal MCLR exposure (foldchange>1.5, p < 0.05). Fold changes of differentially expressed miRNAs by miRNA microarray assay were showed in Fig. 3B. To validate the array data, ten dysregulated miRNAs were confirmed performing qPCR. And the trend in regulation was consistent with the miRNA microarray analysis. According to the PCR results, expressions of miR-376b-5p, let-7a-5p, miR-30a-5p, miR-425-5p,
J. Liu et al. / Chemosphere 240 (2020) 124905
5
Fig. 2. Histological changes in hippocampal CA1 area. (AeC) Representative photomicrographs of histopathological injury (H&E staining) in pyramidal layer of hippocampal CA1 region (400 ). (DeF) Representative photomicrographs of apoptotic cells in hippocampal CA1 region by TUNEL staining (400 ). Apoptotic cells were pointed by arrows. (G) Total number of TUNEL positive cells in the CA1 region of the control and MCLR treated group. *p < 0.05 and **p < 0.01 indicate the significant difference and higher degree of significant difference, respectively.
miR-148a-3p, miR-128-3p, and miR-181a-5p were found to be down-regulated significantly (Fig. 3C, p < 0.05). Fig. 3D showed the comparison of fold-change results obtained from qPCR validation and miRNA microarray data, indicating a correlation coefficient of 0.855 (p < 0.05). This result suggested qPCR validation display concordance with miRNA microarray expression profiling. MiR181a was chosen for the further study due to its potential crucial role in the molecular mechanism underlying the effects of MCLR. 3.4. Prenatal MCLR exposure induced ER stress in hippocampus of offspring Given that ER stress is related to neurotoxicity caused by MCLR, we examined the mRNA expression of the ER stress markers using qPCR analysis. The difference in mRNA expression was detected between control group and 15 mg MCLR/kg BW prenatal exposure group. As shown in Fig. 4, the mRNA expression levels of Grp78, Chop, and Ire-1 were significantly increased, while the expression of Atf-4, Atf-6, Xbp-1, and Caspase-12 exhibited no significant difference between control and MCLR prenatal exposure offspring (15 mg MCLR/kg BW). 3.5. Grp78 is the direct target of miR-181a Grp78 was found to be a good marker for ER stress and might be the possible target of miR-181a through database prediction (miRbase, targetSCAN, and RNAhybrid database).
Complementation between the seed region of miR-181a and Grp78 30 -UTR along with some supplementary pairing sites at the 50 end of miR-181a was revealed by bioinformatics analysis (Fig. 5A). MiR181a mimics was used to determine whether Grp78 is a direct target of miR-181a in luciferase reporter assay. Compared with HEK293T cells only transfected with a luciferase report vector containing the mRNA 30 -UTR of Grp78 (NC), the luciferase activity was significantly inhibited in the cells co-treated with miR-181a mimic (Fig. 5B). In contrast, the luciferase activity was not changed in cells transfected with vector of Grp78 30 -UTR mutant (MU). All these results indicated that miR-181a-5p directly targeted the 30 -UTR of Grp78 mRNA. 3.6. miR-181a mediated expression of Grp78 in neurons treated with MCLR In primary hippocampal neurons, the expression of miR-181a was significantly decreased after MCLR exposure (Fig. 6A). The miR-181a mimic or inhibitor was used to up-regulate or downregulate the expression of miR-181a. Overexpression of miR-181a markedly increased cell viability of neurons post MCLR exposure. When endogenous miR-181a expression was knocked down in neurons with a miR-181a inhibitor before MCLR treatment, the decrease in cell viability was aggravated (Fig. 6B). The qPCR results revealed that, compared with control group, miR-181a mimic significantly alleviated the increase in mRNA expression of Grp78 caused by MCLR. The changing trend of protein level of Grp78
6
J. Liu et al. / Chemosphere 240 (2020) 124905
Fig. 3. Differentially expressed miRNAs in microarray analysis and post validation. (A) Volcano plot represents a differential expression of all miRNAs obtained with red indicating fold-change > 1.5 and p < 0.05). The green line indicates the cut-off criteria. (B) Fold changes of differentially expressed miRNAs in miRNA microarray assay. (C) Validation of changes in expression of miRNAs by qPCR in offspring post maternal MCLR exposure compared to control group. One way ANOVA test (*p < 0.05 and **p < 0.01) was used to determine significant differences between control and MCLR-treated (15 mg/kg BW) group. (D) Fold-change correlations between qPCR analysis and miRNA microarray. The solid line represents the linear regression fit.
Fig. 4. The mRNA expression of the ER stress markers in the hippocampus of pups after prenatal MCLR exposure. *p < 0.05 and **p < 0.01 indicate significant difference and a higher degree of significant difference, respectively.
observed in Western blot analysis was similar to that of mRNA expression in qPCR. On the contrary, inhibiting miR-181a expression with miR-181a inhibitor aggravated the increase in the expression of Grp78 caused by MCLR treatment at mRNA and protein levels (Fig. 6CeF). 4. Discussion Since toxic cyanobacterial blooms frequently occur in inland waters worldwide, the potential risk of offspring after the exposure of pregnant female to MCs should not be neglected. Previous studies have demonstrated that prenatal exposure to MCLR can affect fetal development (Li et al., 2015; Zhao et al., 2015). However, the exact molecular mechanisms of MCLR toxicity remain poorly understood. In aquatic environment, MCs content is generally low except during periods of cayanobacterial blooms. However, MCs are
Fig. 5. Grp78 30 -UTR was targeted by miR-181a-5p. (A) miR-181a-5p and its putative binding sequence in the 30 -UTR of Grp78. The mutant Grp78 30 -UTR binding site was generated at the complementary site for the seed region of miR-181a-5p. (B) Confirmation of direct binding of miR-181a-5p to Grp78 mRNA 30 -UTR by luciferase assay. The experiments were performed in triplicates. Data are expressed as the mean ± SEM. *p < 0.05.
bioavailable and can be accumulated in fish, mammals including human beings through the food web (Sahin et al., 1996). It is documented that the most frequent route of MCLR exposure is consumption of microcystin-contaminated water and aquatic animals (Poste et al., 2011). And MCLR is usually taken orally in low-
J. Liu et al. / Chemosphere 240 (2020) 124905
7
Fig. 6. Grp78 expression modulated by miR-181a and apoptosis induced by MCLR. (A) The expression of miR-181a under the treatment of MCLR. (BeF) Cells were pre-treated with 50 mM miR-181a mimic or 100 mM miR-181a inhibitor for 12 h and then treated with MCLR (1 mM) for 24 h. (B) Cell viability. (CeD) mRNA levels of Grp78. (EeF) Protein levels of Grp78 in hippocampal neurons. *p < 0.05 vs control, #p < 0.05 vs MCLR alone.
dose toxicology studies (He et al., 2017; Chen et al., 2019). Aims of these studies were to assess potential health risks about environmentally relevant concentrations of MCLR rather than determining qualitative and quantitative toxic characteristics. A previous result indicated that the lethality of MCLR was much lower in oral dosage than by intraperitoneal administration, but toxic effects were similar (Yoshida et al., 1997). Thus, although considered to be of low ecological relevance, intraperitoneal administration and subcutaneous injection were often chosen in acute and sub-chronic toxicity tests (Arman et al., 2019; Huang et al., 2013; Myhre et al., 2018). Subcutaneous injection was more widely used in the pregnant mice (Park and Choi, 2016; Tadotsu et al., 2018). In the present study, we attempted to determine the role of miRNAs and ER stress in offspring of mice to explain the mechanism of neurotoxicity caused by MCLR prenatal exposure. So, subcutaneous injection was selected as the exposure route of MCLR. In our study, the toxin content were 2.98 ± 0.41 ng/g dry weight (data not shown) in brains of pups after prenatal exposed to 15 mg MCLR/kg BW, which is similar to that in fishes from natural waters (Deblois et al., 2008). In addition, the plasma concentration of MCLR in pregnant mice
(15 mg/kg) was about 0.47 ± 0.13 ng/ml (data not shown), which is similar to that in fishes from natural waters with cyanobacterial blooms and populations with high levels of exposure (Chen et al., 2009). In this way, the results obtained in the present study could be applied to species living with environmental exposure to MCLR. The Morris water maze experiment is used to evaluate spatial learning and memory function of rodents (Vorhees and Williams, 2006). In the present study, all offspring post prenatal exposure to MCLR exhibited longer escape latency to locate the platform and spent less time in the target zone, indicating a potential neurobehavioral impairment caused by MCLR to offspring mouse. Our study found that increased cell apoptosis was observed in hippocampal CA1 region which is closely related to spatial learning and memory ability (Ocampo et al., 2018). Several previous studies have demonstrated that MCLR could induce apoptosis (Chen and Xie, 2016; Chen et al., 2016; Qi et al., 2016), and that cell apoptosis occurred after sustained and massive ER stress (Di Sano et al., 2006; Oyadomari et al., 2001). Our previous study also reported that MCLR-induced apoptosis in the brain might be due to ER stress (Qi et al., 2016; Cai et al., 2015a). When stress lasted, three major
8
J. Liu et al. / Chemosphere 240 (2020) 124905
transmembrane proteins, activating transcription factor 6 (Atf6), inositol-requiring enzyme 1 alpha (Ire1a), and protein kinase RNAlike ER protein kinase (Perk), were released from Grp78 to activate the unfolded protein response (UPR) which increased the levels of ER chaperones, such as Grp78, leading to the restoration of the normal function of ER. When the ER damage was irreversible, cell apoptosis occurred (Deldicque et al., 2010; Nakanishi et al., 2005). Additionally, Grp78 and Chop were reported to be key mediators of ER stress-mediated apoptosis (Gulyaeva, 2015). Our study indicated that the mRNA expression levels of Grp78, Chop, and Ire-1 were significantly increased, suggesting that MCLR activated ER stress in the brain of offspring. Some researchers have found that miRNAs played critical role in UPR-dependent signaling, and that they were important regulators of ER homeostasis (Maurel and Chevet, 2013). Other researchers found that MCLR altered miRNA levels in the nervous system (Saul et al., 2014), which prompted us to study the role of miRNAs in brain-specific MCLR toxicity. This study revealed that prenatal exposure to MCLR at concentration of 15 mg/kg significantly changed the expression levels of 16 miRNAs. Our qPCR verified the changes in the expression levels of miR-376b-5p, let-7a-5p, miR30a-5p, miR-425-5p, miR-148a-3p, miR-128-3p, and miR181a-5p. Our study also confirmed the pivotal role of miR-181a in regulating ER stress. The miR-181a was reported to be associated with memory function and it was highly expressed in a variety of brain regions (Chandrasekar and Dreyer, 2011; Stary et al., 2017). Our results showed that MCLR decreased the expression of miR-181a in primary hippocampal neurons, which was consistent with the data of the brain of offspring post prenatal MCLR exposure. The abovementioned results revealed that miR-181a played a significant role in neuron apoptosis of the offspring undergoing prenatal exposure to MCLR. Our findings were in line with the previous study results that overexpression of miR-181a inhibited autophagy and reduced apoptosis of neurons (Liu et al., 2017). However, overexpression of miR-181a was reported to have enhanced apoptosis in C2C12 cells (Wei et al., 2016). The conflicting reports suggested a complex role of miR181a in cell survival or death under different conditions. Bioinformatics analysis using HEK cells showed that there was a possible target of miR-181a in Grp 78 mRNA 30 -UTR sequence. Bioinformatic analysis between the miR-181a-5p seed region and the seed matches on Grp78 mRNA 30 -UTR region revealed that they are highly complementary and highly conservative in human and mouse (Wei et al., 2016). Thus, for murine tissues and human cell line (HEK293 cells), the target relationship between miR-181a-5p and Grp78 is very similar across species. Grp78, as an ER chaperone protein, was involved in many critical biological processes, such as facilitating protein degradation, maintaining calcium homeostasis, and serving as a sensor for ER stress (Luo et al., 2006). A previous proteomic result showed that the abundance of Grp 78 was significantly up-regulated in the offspring mice post maternal perinatal exposure to MCLR (Zhao et al., 2015), which was consistent with the results of our study of the offspring following prenatal MCLR exposure. Luciferase reporter assay confirmed that miR-181a directly targeted the 30 -UTR of Grp78. Moreover, 181a mimic significantly alleviated the increase in Grp78 caused by MCLR at mRNA and protein levels. However, suppressing miR-181a expression with miR-181a inhibitor aggravated the increase in the expression of Grp78 caused by MCLR at mRNA and protein levels. Cell viability assay indicated that cell viability following MCLR exposure was obviously increased through transfection of miR181a mimic, and significantly decreased by miR-181a inhibitor. Our findings together with the previous study evidence confirmed that a negative effect of MCLR on miR-181a resulted in the activation of ER stress and subsequent apoptosis in the brain of offspring
following prenatal MCLR exposure. Taken together, the neurobehavioral impairment induced by prenatal MCLR exposure in offspring are likely partly related to the activation of ER stress and the change in expression level of miR181a. However, all the conclusions were based on the microarray and bioinformatics assessment. More work is needed to further confirm the predicted mechanisms. Conflicts of interest The authors declare that they have no conflicts of interest. Acknowledgments This work was supported by the National Natural Science Foundation of China (31770553, 31370525, 81870576) and the Natural Science Foundation of Hubei Province of China (2014CFA031, 2019CFB426). This work was also supported by grant from Basic Research of Wuhan Science and Technology Bureau (2017060201010204). References Arman, T., Lynch, K.D., Montonye, M.L., Goedken, M., Clarke, J.D., 2019. Sub-chronic microcystin-LR liver toxicity in preexisting diet-induced nonalcoholic steatohepatitis in rats. Toxins (Basel) 11 (7), E398, 2019 Jul 9. Cai, F., Liu, J., Li, C., Wang, J., 2015a. Critical role of endoplasmic reticulum stress in cognitive impairment induced by microcystin-LR. Int. J. Mol. Sci. 16, 28077e28086. Cai, F., Liu, J., Li, C., Wang, J., 2015b. Intracellular calcium plays a critical role in the microcystin-LR-elicited neurotoxicity through PLC/IP3 pathway. Int. J. Toxicol. 34, 551e558. Campos, A., Vasconcelos, V., 2010. Molecular mechanism of microcystin toxicity in animal cells. Int. J. Mol. Sci. 11, 268e287. Chandrasekar, V., Dreyer, J.L., 2011. Regulation of MiR-124, Let-7d, and MiR-181a in the accumbens affects the expression, extinction, and reinstatement of cocaineinduced conditioned place preference. Neuropsychopharmacology 36, 1149e1164. Chen, J., Bian, R., Li, J., Qiu, L., Lu, B., Ouyang, X., 2019. Chronic exposure to microcystin-LR reduces thyroid hormone levels by activating p38/MAPK and MEK/ERK signal pathway. Ecotoxicol. Environ. Saf. 173, 142e148. Chen, J., Xie, P., Li, L., Xu, J., 2009. First identification of the hepatotoxic microcystins in the serum of a chronically exposed human population together with indication of hepatocellular damage. Toxicol. Sci. 108 (1), 81e89. Chen, L., Li, S., Guo, X., Xie, P., Chen, J., 2016. The role of GSH in microcystin-induced apoptosis in rat liver: involvement of oxidative stress and NF-kB. Environ. Toxicol. 31, 552e560. Chen, L., Xie, P., 2016. Mechanisms of microcystin-induced cytotoxicity and apoptosis. Mini Rev. Med. Chem. 16, 1018e1031. Christen, V., Meili, N., Fent, K., 2013. Microcystin-LR induces endoplasmatic reticulum stress and leads to induction of NFkB, interferon-alpha, and tumor necrosis factor-alpha. Environ. Sci. Technol. 47 (7), 3378e3385. Deblois, C.P., Aranda-Rodriguez, R., Giani, A., Bird, D.F., 2008. Microcystin accumulation in liver and muscle of tilapia in two large Brazilian hydroelectric reservoirs. Toxicon 51 (3), 435e448. Deldicque, L., Cani, P.D., Philp, A., Raymackers, J.M., Meakin, P.J., Ashford, M.L., Delzenne, N.M., Francaux, M., Baar, K., 2010. The unfolded protein response is activated in skeletal muscle by high-fat feeding: potential role in the downregulation of protein synthesis. Am. J. Physiol. Endocrinol. Metab. 299, E695eE705. Di Sano, F., Ferraro, E., Tufi, R., Achsel, T., Piacentini, M., Cecconi, F., 2006. Endoplasmic reticulum stress induces apoptosis by an apoptosome-dependent but caspase 12-independent mechanism. J. Biol. Chem. 281, 2693e2700. Douglas, G.C., Thirkill, T.L., Kumar, P., Loi, M., Hilborn, E.D., 2016. Effect of microcystin-LR on human placental villous trophoblast differentiation in vitro. Environ. Toxicol. 31, 427e439. Fiore, R., Siegel, G., Schratt, G., 2008. MicroRNA function in neuronal development, plasticity and disase. Biochim. Biophys. Acta 1779, 471e478. Fischer, W.J., Altheimer, S., Cattori, V., Meier, P.J., Dietrich, D.R., Hagenbuch, B., 2005. Organic anion transporting polypeptides expressed in liver and brain mediate uptake of microcystin. Toxicol. Appl. Pharmacol. 203, 257e263. Graham, J.L., Loftin, K.A., Meyer, M.T., Ziegler, A.C., 2010. Cyanotoxin mixtures and taste-and odor compounds in cyanobacterial blooms from the Midwestern United States. Environ. Sci. Technol. 44, 7361e7368. Grandjean, P., Landrigan, P.J., 2006. Developmental neurotoxicity of industrial chemicals. Lancet 368, 2167e2178. Grandjean, P., Landrigan, P.J., 2014. Neurobehavioural effects of developmental toxicity. Lancet Neurol. 13, 330e338.
J. Liu et al. / Chemosphere 240 (2020) 124905 Gulyaeva, N.V., 2015. Brain ischemia, endoplasmic reticulum stress, and astroglial activation: new insights. J. Neurochem. 132, 263e265. He, J., Li, G., Chen, J., Lin, J., Zeng, C., Chen, J., Deng, J., Xie, P., 2017. Prolonged exposure to low-dose microcystin induces nonalcoholic steatohepatitis in mice: a systems toxicology study. Arch. Toxicol. 91 (1), 465e480. Hou, L., Wang, D., Baccarelli, A., 2011. Environmental chemicals and microRNAs. Mutat. Res. 714, 105e112. Hu, Y., Chen, J., Fan, H., Xie, P., He, J., 2016. A review of neurotoxicity of microcystins. Environ. Sci. Pollut. Res. Int. 23, 7211e7219. Hua, Y.J., Tang, Z.Y., Tu, K., Zhu, L., Li, Y.X., Xie, L., Xiao, H.S., 2009. Identification and target prediction of miRNAs specifically expressed in rat neural tissue. BMC Genomics 10, 214. Huang, X., Zhang, Y., Xiao, W., Ye, X., Zhong, Q., Gu, K., 2013. Comparison of response indices to toxic microcystin-LR in blood of mice. Chemosphere 92 (5), 563e569. Kaur, P., Armugam, A., Jeyaseelan, K., 2012. MicroRNAs in neurotoxicity. J. Toxicol. 2012, 870150. Lau, P., de Strooper, B., 2010. Dysregulated microRNAs in neurodegenerative disorders. Semin. Cell Dev. Biol. 21 (7), 768e773. Lee, R.C., Feinbaum, R.L., Ambros, V., 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843e854. Lee, J., Kho, K., Kim, P.G., Ji, K., 2018. Exposure to bisphenol S alters the expression of microRNA in male zebrafish. Toxicol. Appl. Pharmacol. 338, 191e196. Li, G., Cai, F., Yan, W., Li, C., Wang, J., 2012. A proteomic analysis of MCLR-induced neurotoxicity: implications for Alzheimer's disease. Toxicol. Sci. 127, 485e495. Li, G., Yan, W., Cai, F., Li, C., Chen, N., Wang, J., 2014. Spatial learning and memory impairment and pathological change in rats induced by acute exposure to microcystin-LR. Environ. Toxicol. 29, 261e268. Li, X., Zhang, X., Ju, J., Li, Y., Yin, L., Pu, Y., 2015. Maternal repeated oral exposure to microcystin-LR affects neurobehaviors in developing rats. Environ. Toxicol. Chem. 34, 64e69. Liu, Y., Song, Y., Zhu, X., 2017. MicroRNA-181a regulates apoptosis and autophagy process in Parkinson's disease by inhibiting p38 mitogen-activated protein kinase (MAPK)/c-Jun N-terminal kinases (JNK) signaling pathways. Med. Sci. Monit. 23, 1597e1606. Luo, S., Mao, C., Lee, B., Lee, A.S., 2006. GRP78/BiP is required for cell proliferation and protecting the inner cell mass from apoptosis during early mouse embryonic development. Mol. Cell. Biol. 26, 5688e5697. Maurel, M., Chevet, E., 2013. Endoplasmic reticulum stress signaling: the microRNA connection. Am. J. Physiol. Cell Physiol. 304, C1117eC1126. Mohamed, Z.A., Deyab, M.A., Abou-Dobara, M.I., El-Sayed, A.K., El-Raghi, W.M., 2015. Occurrence of cyanobacteria and microcystin toxins in raw and treated waters of the Nile River, Egypt: implication for water treatment and human health. Environ. Sci. Pollut. Res. 15, 11716e11727. Myhre, O., Eide, D.M., Kleiven, S., Utkilen, H.C., Hofer, T., 2018. Repeated five-day administration of L-BMAA, microcystin-LR, or as mixture, in adult C57BL/6 mice - lack of adverse cognitive effects. Sci. Rep. 8 (1), 2308. Nakanishi, K., Sudo, T., Morishima, N., 2005. Endoplasmic reticulum stress signaling transmitted by ATF6 mediates apoptosis during muscle development. J. Cell Biol. 169, 555e560. Ocampo, A.C., Squire, L.R., Clark, R.E., 2018. The beneficial effect of prior experience on the acquisition of spatial memory in rats with CA1, but not large hippocampal lesions: a possible role for schema formation. Learn. Mem. 25, 115e121. Oyadomari, S., Takeda, K., Takiguchi, M., Gotoh, T., Matsumoto, M., Wada, I., Akira, S., Araki, E., Mori, M., 2001. Nitric oxide-induced apoptosis in pancreatic beta cells
9
is mediated by the endoplasmic reticulum stress pathway. Proc. Natl. Acad. Sci. U. S. A. 98, 10845e10850. Park, J.H., Choi, T.S., 2016. Subcutaneous administration of monosodium glutamate to pregnant mice reduces weight gain in pups during lactation. Lab. Anim. 50 (2), 94e99. Poste, A.E., Hecky, R.E., Guildford, S.J., 2011. Evaluating microcystin exposure risk through fish consumption. Environ. Sci. Technol. 45 (13), 5806e5811. Qi, M., Dang, Y., Xu, Q., Yu, L., Liu, C., Yuan, Y., Wang, J., 2016. Microcystin-LR induced developmental toxicity and apoptosis in zebrafish (Danio rerio) larvae by activation of ER stress response. Chemosphere 157, 166e173. Sahin, A., Tencalla, F.G., Dietrich, D.R., Naegeli, H., 1996. Biliary excretion of biochemically active cyanobacteria (blue-green algae) hepatotoxins in fish. Toxicology 106 (1e3), 123e130. Saul, N., Chakrabarti, S., Stürzenbaum, S.R., Menzel, R., Steinberg, C.E., 2014. Neurotoxic action of microcystin-LR is reflected in the transcriptional stress response of Caenorhabditis elegans. Chem. Biol. Interact. 223, 51e57. Sathyan, P., Golden, H.B., Miranda, R.C., 2007. Competing interactions between micro-RNAs determine neural progenitor survival and proliferation after ethanol exposure: evidence from an ex vivo model of the fetal cerebral cortical neuroepithelium. J. Neurosci. 27, 8546e8557. Stary, C.M., Xu, L., Li, L., Sun, X., Ouyang, Y.B., Xiong, X., Zhao, J., Giffard, R.G., 2017. Inhibition of miR-181a protects female mice from transient focal cerebral ischemia by targeting astrocyte estrogen receptor-a. Mol. Cell. Neurosci. 82, 118e125. Tadotsu, D., Kawate, N., Tamada, H., 2018. Rescue of the fetal damage associated with high intrauterine pressure by 17b-estradiol injection in ovariectomized progesterone-treated pregnant mice. Endocr. J. 65 (12), 1219e1224. Tilson, H.A., 1990. Behavioral indices of neurotoxicity. Toxicol. Pathol. 18, 96e104. Twaroski, D.M., Yan, Y., Olson, J.M., Bosnjak, Z.J., Bai, X., 2014. Down-regulation of microRNA-21 is involved in the propofol-induced neurotoxicity observed in human stem cell-derived neurons. Anesthesiology 121 (4), 786e800. Vandamme, T.F., 2014. Use of rodents as models of human diseases. J. Pharm. BioAllied Sci. 6 (1), 2e9. Vesterkvist, P.S., Misiorek, J.O., Spoof, L.E., Toivola, D.M., Meriluoto, J.A., 2012. Comparative cellular toxicity of hydrophilic and hydrophobic microcystins on Caco-2 cells. Toxins 4, 1008e1023. Vorhees, C.V., Williams, M.T., 2006. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 1, 848e858. Wang, Q., Niu, Y., Xie, P., Chen, J., Ma, Z., Tao, M., Qi, M., Wu, L., Guo, L., 2010. Factors affecting temporal and spatial variations of microcystins in Gonghu bay of lake Taihu, with potential risk of microcystin contamination to human health. Sci. World J. 10, 1795e1809. Wei, Y., Tao, X., Xu, H., Chen, Y., Zhu, L., Tang, G., Li, M., Jiang, A., Shuai, S., Ma, J., Jin, L., Wen, A., Wang, Q., Zhu, G., Xie, M., Wu, J., He, T., Jiang, Y., Li, X., 2016. Role of miR-181a-5p and endoplasmic reticulum stress in the regulation of myogenic differentiation. Gene 592, 60e70. Yoshida, T., Makita, Y., Nagata, S., Tsutsumi, T., Yoshida, F., Sekijima, M., Tamura, S., Ueno, Y., 1997. Acute oral toxicity of microcystin-LR, a cyanobacterial hepatotoxin, in mice. Nat. Toxins 5 (3), 91e95. Zhang, B., Pan, X., 2009. RDX induces aberrant expression of microRNAs in mouse brain and liver. Environ. Health Perspect. 117, 231e240. Zhao, S., Li, G., Chen, J., 2015. A proteomic analysis of prenatal transfer of microcystin-LR induced neurotoxicity in rat offspring. J Proteomics 114, 197e213.