- Email: [email protected]
MicroRNA 182 inhibits CD4+ CD25+ Foxp3+ Treg differentiation in experimental autoimmune encephalomyelitis
MicroRNA 182 inhibits CD4 + CD25+ Foxp3+ Treg differentiation in experimental autoimmune encephalomyelitis Cong Wan, Chang-Yun Ping, Xiao-Yu Shang, Jiang-Tian Tian, Si-Han Zhao, Lei Li, Shao-Hong Fang, Wei Sun, Yan-Feng Zhao, Zhao-Ying Li, Yan-Wen Xu, Li-Li Mu, Jing-Hua Wang, Qing-Fei Kong, Guang-You Wang, Hu-Lun Li, Bo Sun PII: DOI: Reference:
S1521-6616(16)30398-9 doi: 10.1016/j.clim.2016.09.008 YCLIM 7735
To appear in:
Clinical Immunology
Received date: Revised date: Accepted date:
15 October 2015 19 September 2016 20 September 2016
Please cite this article as: Cong Wan, Chang-Yun Ping, Xiao-Yu Shang, JiangTian Tian, Si-Han Zhao, Lei Li, Shao-Hong Fang, Wei Sun, Yan-Feng Zhao, ZhaoYing Li, Yan-Wen Xu, Li-Li Mu, Jing-Hua Wang, Qing-Fei Kong, Guang-You Wang, Hu-Lun Li, Bo Sun, MicroRNA 182 inhibits CD4+ CD25+ Foxp3+ Treg differentiation in experimental autoimmune encephalomyelitis, Clinical Immunology (2016), doi: 10.1016/j.clim.2016.09.008
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT MicroRNA 182 Inhibits CD4+CD25+Foxp3+ Treg Differentiation in Experimental Autoimmune Encephalomyelitis.
SC R
IP
T
Cong Wan 1 a b, Chang-Yun Ping 1 a, Xiao-Yu Shang 1 a f, Jiang-Tian Tian b e, Si-Han Zhao a, Lei Li c, Shao-Hong Fang b e, Wei Sun d, Yan-Feng Zhao c, Zhao-Ying Li a, Yan-Wen Xu a, Li-Li Mu a, Jing-Hua Wang a, Qing-Fei Kong a, Guang-You Wang a , Hu-Lun Li * a b and Bo Sun * a a
TE
D
MA
NU
Department of Neurobiology, Harbin Medical University, No.194 XueFu Road, Harbin, Heilongjiang 150081, China b The Key Laboratory of Myocardial Ischemia, Harbin Medical University, Ministry of Education, Heilongjiang Provence, 150086, China. c Department of Neurology, The Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang, 150086, China. d Department of Neurology, The First Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang, 150086, China. e Department of Cardiology, The Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang, 150086, China. f Xiamen City, Huli District, Administration Center of Parks and Gardens. * Corresponding authors: Hu-Lun Li and Bo Sun
AC
CE P
Bo Sun: Department of Neurobiology, Harbin Medical University, Harbin, Heilongjiang 150086, China. Email: [email protected] Tel.: +86 451 8666 2943; fax: +86 451 8750 2363. Hu-Lun Li: Department of Neurobiology, Harbin Medical University, Harbin, Heilongjiang 150086, China. The Key Laboratory of Myocardial Ischemia, Harbin Medical University, Ministry of Education, Heilongjiang Provence, China. Email: [email protected] Tel.: +86 451 8666 2943; fax: +86 451 8750 2363. 1
These authors contributed equally to this work.
ACCEPTED MANUSCRIPT Abstract
AC
CE P
TE
D
MA
NU
SC R
IP
T
MicroRNA 182 has been found to have a distinct contribution in the clonal expansion of activated- and functioning of specialized- helper T cells. In this study we knocked down microRNA 182 in vivo and induced experimental autoimmune encephalomyelitis (EAE) to determine the influences of microRNA 182 in the Treg cells functional specialization through Foxo1 dependent pathway in the peripheral lymphoid organs. Down-regulation of microRNA 182 significantly increased the proportions of Foxp3+ T cells in the peripheral lymph nodes and spleen. In vivo study verified a positive correlation between microRNA 182 levels and symptom severity of EAE, and a negative correlation between microRNA 182 and the transcriptional factor Foxp3. In vitro polarization study also confirmed the contribution of Foxo1 in microRNA 182 mediated down-regulation of Foxp3+ T cells. Together, our results provide evidence that during the development of EAE, microRNA 182 repressed Treg cells differentiation through the Foxo1 dependent pathway.
ACCEPTED MANUSCRIPT Highlights
T
IP
SC R NU MA D TE
CE P
MicroRNA 182 expression correlates with the progression of MOG35-55 mediated autoimmune inflammation. Down-regulation of microRNA 182 increases percentages of regulatory T cells in the peripheral lymph nodes and spleen and mitigates EAE. During the pathogenesis of EAE, microRNA 182 regulates the differentiation of Treg cells through Foxo1 dependent pathway.
AC
ACCEPTED MANUSCRIPT Key words
AC
CE P
TE
D
MA
NU
SC R
IP
T
MicroRNA 182; Treg cells; Experimental Autoimmune Encephalomyelitis; Foxo1
ACCEPTED MANUSCRIPT 1. Introduction
MA
NU
SC R
IP
T
MicroRNAs have been recognized to play critical roles in post-transcriptional regulation of gene expression [1-3]. In the immune system, microRNAs were highly expressed [4] and participated in autoimmunity as the regulators [3, 5]. Notably, the miR-155 was known highly expressed in Treg cells and miR-125a-deficient Treg cells demonstrated reduced immune-regulatory function [6]. MiR-146a was also found expressed in Treg cells and plays an important role in Treg cell-mediated immunological tolerance [7]. microRNA 182 of the microRNA-182-96-183 cluster was found to be essential in regulating CD4+T cells, and promotes activation of Th lymphocytes by IL-2 [1, 8]. A recent report further verified that microRNA 182 regulates clonal expression by post-transcriptional regulating clonal expansion [8, 9]. In breast cancer cell, microRNA 182 down-regulated the expression of Foxo1 mRNA [8]. MicroRNA 182 targets the 3’ untranslated region (UTR) of Foxo1 transcripts and their expressions were negatively correlated in Th cells [10]. However, participation of microRNA 182 directed regulation of Foxo1 in autoimmune disorders such as MS/EAE, still remains to be established.
CE P
TE
D
In 2009 [11, 12], studies provided new sight into the role of the forkhead box (Fox) transcription factor in various cellular processes. In mammals, members of the Foxo subfamily include Foxo1, Foxo3, Foxo4, and Foxo6 [13], which participate in regulating processes such as cell cycle progression, proliferation, energy metabolism, differentiation, apoptosis, and stress resistance [13-15]. In the immune system, Foxo1 regulates T cell and B cell mediated immune responses [16, 17]. Recently, researchers have demonstrated that Foxo1 is essential for the induction of Foxp3 expression in Treg cells [18, 19]. In addition, Foxo1 can inhibit T-bet expression and differentiation of effector CD4+T cells – Th1 and Th17 indirectly [20].
AC
In this study, we observed an elevated level of microRNA 182 and decreased Foxo1 at acute phase of Experimental Autoimmune Encephalomyelitis (EAE). Then we demonstrated that overall knockdown of microRNA 182 in C57BL/6 mice was accompanied by increased regulatory T cellpolarizations in peripheral lymphoid organs after myelin oligodendrocytic glycoprotein35-55 (MOG35-55) immunization. In addition, our in vitro experiments based on the CD4+T cells, revealed the opposing effects of microRNA 182 and its putative target Foxo1, abetting that microRNA 182 and Foxo1 act antagonistically in the specialization of regulatory T cells. Finally, the proliferation experiment of CD4+T cells from C57BL/6 mice confirmed that the microRNA 182 inhibited Treg cell specialization through Foxo1 dependent pathway.
ACCEPTED MANUSCRIPT 2. Material and Methods
AC
CE P
TE
D
MA
NU
SC R
IP
T
2.1. Animals Female C57BL/6 mice, 6-8 weeks old, were purchased from Peking Vital River Laboratory Animal Ltd. (Beijing, China). MicroRNA 182 transgenic mice constructions were cooperated with The Key Laboratory of Myocardial Ischemia (Chinese Ministry of Education, Harbin, Heilongjiang, China). All mice were kept in specific pathogen-free environments. Genetic engineering of microRNA 182 was achieved by infection of zygotes by lentiviral vectors. The specific process is as follows: Female C57BL/6 mice, 4-6 weeks old, were purchased from Peking Vital River Laboratory Animal Ltd; each mice was injected pregnant mare’s serum gonadotropin (PMSG) 5 IU; 48 hours later, each mice was injected human chorionic gonadotropin (hCG) 5 IU, then put together with mature male mice (more than 2 months old) into the same cage immediately; female mice with visible vaginal plug were selected for breeding, and zygotes were collected surgically. (SF. 4A-a). Harvested zygotes were maintained in M2 culture medium; after cleaning these zygotes with the hyaluronic acid enzyme solution, cleaned zygotes were then maintained in M16 culture medium. Indicated lentiviral vectors were injected into the zygotes (SF. 4A-b&c), and transplanted into the fallopian tube of surrogate mother mice (Female C57BL/6 mice, 6-8 weeks old, post-mating with male mice undergone vasectomy). Surrogate mother mice gave birth to the F-0 generation “transgenic mice” (SF. 4A-d&e), after detecting and screening by fluorescent lamp (SF. 4A-f&g) and qPCR analysis (SF. 4B), we could acquire the transgenic mice. Animals were inbred for more than 3 generations. Successful construction was identified by significantly lower expression of microRNA 182 compared with the WT mice in qPCR genotyping (SF. 4B). The following plasmids were engineered to lentiviruses for experiments in this study: mmu-miR-182-inhibitor (microRNA 182-inhibitor) (CGGUGUGAGUUCUACCAUUGCCAAA), and the negative control (UUCUCCGAACGUGUCACGUTT; ACGUGACACGUUCGGAGAATT) (synthesized by Shanghai GenePharma Co.,Ltd). 2.2. Induction and Clinical Evaluation of EAE Mice were immunized subcutaneously with 200μg MOG35-55 peptide (MEVGWYRSPFSRVVHLYRNGK) emulsified in complete Freund’s adjuvant (Sigma) supplemented with heat-inactivated Mycobacterium tuberculosis H37 RA (Difco Laboratories, Detroit, MI). 50μl of the emulsion were injected in each axillary fossa. 200ng of pertussis toxin (LIST BIOLOGICAL LABORATORIES, INC) were administered intravenously at the time of immunization and 48 h later. Clinical score was assessed daily according to the following scoring criteria: 0, no detectable signs of EAE; 1, limp tail; 2, hind limb weakness or impaired gait; 3, complete hind limb paralysis; 4, paralysis of fore and hind limbs; and 5, moribund or death. 0.5 was added to the lower score when clinical signs were intermediate between two grades of disease. 2.3. Preparation of mononuclear cells from lymph nodes and spleen Mononuclear cells (MNC) were obtained from the axillary lymph nodes, spleen and thymus isolated from both EAE and CFA groups on 7, 14 and 21 days post immunization. Cells from lymph nodes and thymus were washed in PBS, then filtered through a 40μm cell strainer (BD Biosciences),
ACCEPTED MANUSCRIPT and centrifuged at 700g for 10min at 4ºC, then cultured in DMEM medium (Hyclone, Logan, UT) containing 10% fetal bovine serum (Gibco, Paisley, UK), and 1% penicillin–streptomycin (Gibco). Red blood cells from spleen were lysed in ACK lysis buffer for 5min at room temperature, centrifuged at 200g for 10min and then followed the same steps as lymph nodes.
SC R
IP
T
2.4. CD4+ T cell purification and sorting CD4+ T cell from lymph nodes, spleen and thymus of mice were isolated using the MagCellectTM Mouse CD4+T Cell Isolation Kit (R&D systems) according to manufacturer’s instruction.
NU
2.5. CD4+CD25+ Regulatory T cell purification and sorting CD4+CD25+ Regulatory T Cell from lymph nodes, spleen and thymus of mice were isolated using the MagCellectTM Mouse CD4+CD25+ Regulatory T Cell Isolation Kit (R&D systems) according to manufacturer’s instruction.
AC
CE P
TE
D
MA
2.6. Flow cytometry EAE and CFA mice were sacrificed on 7, 14 and 21 days post immunization. Lymph node, spleen and thymus MNC were harvested and prepared as described above. FACSCalibur™ System (BD Biosciences) was used for profiling of CD4+T-cell subsets. The following antibodies were used for cell surface staining: PERCP-anti-CD4 (BD), FITC-anti-CD4 (BD), PE-anti-CD25 (eBioscience). For intracellular cytokine staining, mononuclear cells were stimulated with PMA and ionomycin (Sigma) in the presence of Brefeldin A (GolgiStop; BD) for 4h before staining. After incubated with surface marker, samples were treated with fixation/permeabilization buffer (eBioscience) and then stained with PE-anti–IFN-γ (eBioscience), PE-anti–IL-17 (eBioscience) and PE-anti-IL-4 (eBioscience). Intranuclear staining for APC-anti-Foxp3 was performed with the mouse regulatory T cell staining kit (eBioscience) according to the manufacturer’s instructions. Flow cytometry was performed with FACSCalibur™ (BD Biosciences) and data were analyzed using FlowJo software (Tree Star). 2.7. Quantitative PCR Total RNA from sorted CD4+T cells and CD4+CD25+ Regulatory T Cell were extracted with TRIzol reagent RnaEx (GENEray) following the manufacturer’s protocol. After microRNA was reverse transcribed with the All-in-OneTM miRNA First-Strand cDNA Synthesis Kit (GeneCopoeia, Inc) and mRNA with the M-MLV Reverse Transcriptase (Invitrogen), TransStart® Top Green qPCR SuperMix and CFX96TM Real-Time System (C1000 Touch Thermal Cycler; BIORAD) were used to assay the microRNA 182, Foxo1and Foxp3 expression using sequence specific primers. Primers of microRNA 182 and Foxo1 were purchased from GENECOPIEA, and Foxp3 were synthesized by Invitrogen (sequences available upon request). MiRNA was normalized to U6 (mouse), and other mRNAs were normalized to β-actin for qPCR analysis. Fold difference was determined by ddCq method. 2.8. CD4+T cells transduction in vitro CD4+T cells were isolated from lymph node of EAE mice on 7 days post immunization, then
ACCEPTED MANUSCRIPT
NU
SC R
IP
T
transfected with LV-mmu-miR-182-5p-inhibition (anti-LV-microRNA 182) (Viral Products were purchased from SHANGHAI GENECHEM Co., Ltd) separately according to the manufacturer’s protocol. Under the same condition, anti-LV-microRNA 182-NC was used as the negative control. All cells were treated with MOG35-55, and then collected for analysis with flow cytometry or extracted RNA or protein after 96h. CD4+T cells were transfected with oligomers, mmu-miR-182-inhibitor (microRNA 182-inhibitor) (CGGUGUGAGUUCUACCAUUGCCAAA), and the negative control (UUCUCCGAACGUGUCACGUTT; ACGUGACACGUUCGGAGAATT) (synthesized by Shanghai GenePharma Co.,Ltd) using RNAi-Mate (Shanghai GenePharma Co., Ltd) according to the manufacturer’s protocol. For siRNA-Foxo1 transfection, the transfection mixture (100μl) consists of 60pmol siRNA-Foxo1 (QIAGEN), 6μl Reagent (QIAGEN). All cells were treated with MOG35-55, and then collected to extract RNA or protein 48h later.
D
MA
2.9. T cell polarization Mice CD4+T cells were purified and polarized under Th1 (anti-mouse-IL-4 3.3μg/ml, IL-2 4ng/ml, IL-12 5ng/ml); Th2(anti-mouse-IL-12 0.12μg/ml, anti-mouse-IFN-γ 5μg/ml, IL-2 4ng/ml, IL-4 10ng/ml); Th17(anti-mouse-IL-4 5μg/ml, anti-mouse-IFN-γ 5μg/ml, TGF-β 2ng/ml, IL-6 20ng/ml) ; Treg (anti-mouse-IL-4 5μg/ml, anti-mouse-IFN-γ 5μg/ml, TGF-β 2ng/ml) conditions. Cells were collected at 5 days post polarization.
AC
CE P
TE
2.10. Western blotting Nuclear proteins were purified with Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime). Nuclear protein lysates were separated by 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred onto a polyvinylidene difluoride (PVDF) membrane via Mini Trans-Blot® Electrophoretic Transfer Cell (Bio-Rad Laboratories, INC). Membranes were blocked with 5% non-fat milk for 1h at room temperature. Specific antibodies were used to detect Foxo1, Foxp3 and TBP. Use the TBP (TATA-binging protein) as the internal reference. 2.11. Reagents for FACS and Western blot The following antibodies were from BD Pharmingen: FITC-conjugated anti-mouse CD4; PerCP-conjugated anti-mouse CD4; PE-conjugated anti-mouse IL-4. The following antibodies were from eBioscience (eBioscience, San Diego, CA): APC-conjugated anti-mouse Foxp3; PE-conjugated anti-mouse IFN-γ; PE-conjugated anti-mouse CD25 and PE-conjugated anti-mouse IL-17. The fixation and permeabilization kit used for flow cytometry was purchased from eBioscience. Western blotting Reagents as follows: rabbit anti-mouse/human Foxo1 (Santa Cruz Biotechnology, Santa Cruz, CA); rabbit anti-mouse/human Foxp3, rabbit anti-mouse/human TBP (Cell Signaling Technology). 2.12. Statistics All statistical analysis was performed using GraphPad Prism (GraphPad Software Inc., La Jolla, CA). Two-tailed Student’s t-test was used for comparison between pairs of groups, ANOVA among groups and clinical scores of EAE used a nonparametric Mann-Whitney test. P < 0.05 was considered statistically significant.
ACCEPTED MANUSCRIPT 3. Results
NU
SC R
IP
T
3.1. MicroRNA 182 is up-regulated and Foxo1 is down-regulated at acute phase of inflammation among peripheral CD4+ T helper cells of EAE C57BL/6 mice. Female C57BL/6 mice immunized with MOG35-55 in complete Freund’s adjuvant (CFA) demonstrated higher level of microRNA 182 in CD4+ T helper cells from axillary lymph nodes (Fig. 1A) and spleen (Fig. 1B) at acute phase of EAE (14 days post immunization) comparing with mice immunized with CFA alone. Forkhead box O1 (Foxo1) transcription factor reached the lowest level at the peak of disease progression among T helper cells from either axillary lymph nodes (Fig. 1C) or spleen (Fig. 1D). The change of Foxo1 was not significantly different between EAE and CFA group in spleen. This is probably a result of the CNS focused pathology of EAE whereas the spleen reflects the systemic immune response of the entire body.
MA
Furthermore, we isolated CD4+CD25+Treg cells from axillary lymph nodes and spleen, the data showed that at acute phase of EAE microRNA 182 expressed highest in CD4+CD25+Treg cells of axillary lymph nodes (Fig. 1E) and spleen(Fig. 1F). Foxo1 was expressed lower than CFA group at acute phase of EAE (Fig. 1G&1H), especially in Treg cells from spleen (Fig. 1H), the change of Foxo1 was significantly different between EAE and CFA group.
CE P
TE
D
Foxo1 protein demonstrated inverse correlations with the expression of microRNA 182 (Fig. 1I&SF. 1), and transcriptional factor Foxp3 also showed inverse correlations with the expression of microRNA 182 (Fig. 1J&1K), that is, the changing of Foxp3 expression was in concert with Foxo1. (Fig. 1I&SF. 1). In vivo analyses of Treg cells among CD4+ T helper cells from the spleen at 14 days post immunization displayed that the proportion of Foxp3+ Treg cells showed significant reduction in EAE mice (Fig. 1L&1M).
AC
Both at gene level (Fig. 1C&1D&1K) and protein level (Fig. 1I&1J&SF. 1), lower expression of Foxo1 in EAE mice were accompanied by reduction in Foxp3 expression compared with CFA mice in lymph nodes and spleen. 3.2. Knockdown of microRNA 182 alleviates MOG35-55 mediated autoimmune inflammation in female C57BL/6 mice in vivo. MicroRNA 182 genetic manipulation in female C57BL/6 mice showed that mice with systemic knockdown of microRNA 182 since embryo stage demonstrated shorter disease course of EAE as expected and mitigated EAE symptoms (Fig. 2B). The expression of microRNA 182 in CD4+T cells from lymph nodes and spleen were confirmed by qPCR and results showed that the expression of microRNA 182 were significantly lower in microRNA 182 knockdown mice than in WT mice at the acute phase (14dpi) of EAE (Fig. 2A). Foxo1 mRNA and Foxo1 protein demonstrated inverse correlations with microRNA 182 expression, and the tendency of transcriptional factor Foxp3 was same as Foxo1, both mRNA and protein were demonstrated inverse correlations with microRNA 182 expression in lymph nodes (Fig. 2C) and spleen (Fig. 2D). To explore if the microRNA 182 have effect on development and differentiation of CD4+CD25+Treg cells, we detected the CD4+CD25+Treg cells and the microRNA 182 expression
ACCEPTED MANUSCRIPT
IP
T
in thymus of WT and microRNA 182 knockdown mice before immunization. MicroRNA 182 expressed lower in Thymus of microRNA 182 knockdown mice compared with WT mice (SF. 2B). However, there was no significantly change with the proportion of Treg cells compared with WT mice (SF. 2A), demonstrating that knockdown microRNA 182 didn’t influence the development of Treg cells. Following EAE induction, the dynamic expression of microRNA 182 changed with the development of EAE, and displayed the same tendency in peripheral lymph organs (SF. 2C&2D).
NU
SC R
Systemic silencing of microRNA 182 consistently and significantly up-regulated regulatory T cells proportions in the peripheral lymphoid organs at acute phase (Fig. 2E&2F) of EAE course, but down-regulated regulatory T cell proportions in central lymphoid organ (SF. 2E). In addition, compared with WT mice, the expression of microRNA 182 decreased in CD4+CD25+Treg cells in Thymus of microRNA 182 KD mice at acute phase of EAE (SF. 2F).
AC
CE P
TE
D
MA
3.3. MicroRNA 182 suppresses differentiation to regulatory T cells (Treg) through Foxo1 dependent pathway in vitro. To exclude the unknown systemic influence on CD4+Th cells in microRNA 182 transgenic mice, we infected CD4+ T cells isolated from the draining lymph nodes of MOG35-55 immunized WT mice at early phase of EAE (7 days post immunization) with lentiviral vectors to deliver microRNA 182 inhibitor in vitro at the presence of MOG35-55. The infection efficiency of GFP shRNA lentivirus showed in SF. 3A&3B. The expression of microRNA 182 was significantly lower post infected by microRNA 182-inhibitor, which compared with negative control (Fig. 3A). The inhibition effective of microRNA 182 in vitro experiments with the lentiviral vectors was same as the knockdown effective in transgenic mice (Fig. 2A). In vitro down-regulation of microRNA 182 remarkably increased the expression of Foxo1 mRNA (Fig. 3B), the transcriptional factor Foxp3 (Fig. 3C) and the proportion of Treg cells (Fig. 3D&3E), in accord with the in vivo findings (Fig. 2). To further confirm that microRNA 182 inhibited Treg cells specialization through Foxo1 dependent pathway, we also infected CD4+T cells isolated from the draining lymph nodes of MOG35-55 immunized WT mice at early phase of EAE (7 days post immunization) with microRNA 182 inhibitor oligomers in vitro at the presence of MOG35-55. The infection efficiency is shown in Fig. 3F and SF. 3C&3D, and the expression of Foxo1 mRNA and Foxp3 mRNA also remarkably increased, these results showed same tendency as in lentiviral vectors infection experiments (Fig. 3G). 3.4. MicroRNA 182 suppresses differentiation to regulatory T cells (Treg) through Foxo1 dependent pathway in vitro. At the same time, in multiple Th subsets induction systems, siRNA inhibition of Foxo1 alone induced decreased Treg populations (Fig. 4A), and decreased the expression of the transcriptional factor Foxp3 (Fig.4B). Both at gene level and protein level, repression of Foxo1 was accompanied by reduction in Foxp3 expression (Fig. 4B). Then we suppressed the expression of Foxo1 in naïve T helper cells by siRNA and cultured these naïve cells in different polarization conditions for Th1, Th2, Th17 and Treg cells in vitro. We observed that only regulatory T cells were significantly down-regulated (Fig. 4C). These results, again raise the question of how exactly microRNA 182 manipulates the direction of
ACCEPTED MANUSCRIPT
AC
CE P
TE
D
MA
NU
SC R
IP
T
specialization for naïve helper T cells. It was well established that regulatory Th cells (Treg) and pro-inflammatory Th cells (Th1 and Th17) could inhibit the specialization of each other. To exclude the inhibitory effect of different Th cells on each other in multiple Th subsets culture system, we separately cultured naïve CD4+T cells isolated from lymph nodes of microRNA 182 knockdown mice under the polarization condition for Treg cells. Treg cells frequencies showed significant increase following microRNA 182 silencing (Fig. 4D). In further experiments, Foxo1 expression in microRNA 182 knockdown CD4+ T cells were interfered with siRNA transfection, the transfection efficiency was shown in Fig. 4B. Only Treg frequencies were downregulated and other Th cells were not influenced (Fig. 4E).
ACCEPTED MANUSCRIPT 4. Discussion
CE P
TE
D
MA
NU
SC R
IP
T
Based on our results, microRNA 182 could inhibit Foxp3+ Treg by targeting transcriptional factor Foxo1. At acute phase of EAE, microRNA 182 displayed highest level of expression (Fig. 1A&1B and Fig. 1E&1F) concomitant with the lowest expression of Foxo1 (Fig. 1C&1D and Fig. 1G&1H and Fig. 1I&SF. 1). Lower expression of Foxp3 (Fig. 1J&1K&SF. 1) and decreased proportions of Treg cells (Fig. 1L&1M) were also negatively correlated with microRNA 182 expression. In vivo knockdown of microRNA 182 raised peripheral Treg percentages (Fig. 2E&2F), as shown by the increased expression of transcriptional factor Foxp3 (Fig. 2C&2D) at acute phase, i.e. 14 days post MOG35-55 immunization, and the tendency of Foxo1 expression was also negatively correlated with microRNA 182 expression, that is, the expression of Foxo1 increased when the microRNA 182 was knocked down (Fig. 2C&2D). Overall knockdown of microRNA 182 (Fig. 2A) shortened the disease course of EAE as expected and significantly mitigated EAE symptoms (Fig. 2B). In vitro down-regulation of microRNA 182 in CD4+T cells (Fig. 3A) by infecting with lentiviral increased the Foxo1 mRNA and Foxp3 mRNA expression (Fig. 3B&3C) and Treg percentages (Fig. 3D&3E). Silencing Foxo1 in vitro decreased the Treg percentages (Fig. 4A) and transcriptional factor Foxp3 expression (Fig. 4B). Under polarization conditions, Treg demonstrated higher sensitivity towards Foxo1 knockdown (Fig. 4C). In vitro polarization of naïve T helper cells harvested from peripheral axillary draining lymph nodes of microRNA 182 knockdown mice, on the other hand, demonstrated enhanced Treg polarization (Fig. 4D). Unaltered polarization frequencies of Th subsets other than Treg under microRNA 182 knocked down and Foxo1 silenced conditions suggest that Foxo1 might not be a core mediator of microRNA 182 regulation on T helper cells differentiation other than Treg cells (Fig. 4E). From these results we concluded that microRNA 182 suppressed differentiation to regulatory T cells (Treg) through Foxo1 dependent pathway both in vivo and in vitro in MOG 35-55 peptide induced EAE.
AC
Down-regulated of microRNA 182 in mice, both in vivo and in vitro, were unequivocally increased Treg proportions in the draining lymph nodes and spleen (Fig. 2E&2F&3D&3E). Treg cells could decrease the infiltration of self-antigen-specific-reactive CD4+T cells in CNS [14] and itself could also migrate into the CNS to inhibit Th1 and Th17 differentiation. It is likely that microRNA 182 regulates the specialization of T helper cell subsets over the influences of regulatory T cells. In other words, augmentation of autoimmune inflammation by microRNA 182 might be accomplished, by and large, via the inhibition of dominant tolerance, i.e., regulatory T cell development [21]. This, however, cannot exclude the direct influence of microRNA 182 on other T helper subsets. When we knocked down the expression of microRNA 182, the percentage of pro-inflammatory cytokines IFN-γ and IL-17 have no significantly changed, as the proportions of the corresponding cells Th1 and Th17 cells unaltered. However, at the same time, the percentage of CD4+CD25+Foxp3+ Treg cells was much higher in microRNA 182 knockdown mice than in WT mice at acute phase of EAE. Also in vitro experiments, the pro-inflammatory cytokine IFN-γ was decreased significantly, at the same time, the anti-inflammatory cytokine IL-4 was increased as the transcriptional factor Foxp3 was up-regulated when we knocked down the expression of microRNA 182 in CD4+T cells ex vivo (data were not shown). Nevertheless, only Treg cells were significantly up-regulated upon microRNA182 knockdown with Foxo1 silenced conditions whereas other T helper cells were not influenced (Fig. 4E). Furthermore, we isolated Treg cells to specifically examine microRNA 182
ACCEPTED MANUSCRIPT
T
and Foxo1 expressions. Results of the dynamic change of microRNA 182 and Foxo1 mRNA in CD4+CD25+Treg cells (Fig. 1E&1F&1G&1H) also showed same tendency with in total CD4+T helper cells, that is, both in CD4+CD25+Treg cells and in total CD4+T helper cells, microRNA 182 expressed highest at acute phase of EAE in peripheral lymphoid organs, and the dynamic change of Foxo1 mRNA showed negatively correlation with microRNA 182 expression simultaneously.
MA
NU
SC R
IP
In breast cancer cell, Foxo1 expression was repressed by microRNA 182 at the post -transcriptional level [11, 22]. Foxo1 was previously shown to repress Th17 development [23], and was found to be indispensable for the normal functioning of specialized regulatory T cells [14]. Here we confirmed that microRNA 182 regulated Treg cells differentiation through the transcriptional factor Foxo1 during the development of EAE. We demonstrated that polarization of Foxo1 deficient CD4+T cells displayed reduced differentiation towards Treg cells (Fig. 4C). However, there were possibilities that microRNA 182 might exert its regulation on Th cell specialization through targets other than Foxo1[24] and that during the development of EAE, microRNA 182 might have direct influences on the development of other subsets of the helper T cells, albeit a preference over regulatory T cells through Foxo1. The present study demonstrated higher sensitivity of Treg cells for microRNA 182 knocked down and Foxo1 deficiency (Fig. 4C&4E).
AC
CE P
TE
D
In brief, our study provided evidence that during the pathogenesis of EAE, microRNA 182 repressed CD4+T cells differentiation towards an anti-inflammatory direction through the Foxo1 dependent pathway and that levels of microRNA 182 might be indicative of severity of autoimmune inflammations. Results presented here also hints that the augmentation of MOG35-55 mediated inflammation by microRNA 182 might be achieved primarily via inhibition of regulatory T cells, thereby exerting an indirect influence over the differentiation of helper T cell subsets. Our data however, cannot rule out the impact of other immune cells on T cell differentiation, of particular notice, dendritic cells and B cells as microRNA 182 manipulation in this study was systemic not conditional in in vivo experiments. Nevertheless, in vivo results presented in this study suggest that microRNA-182-Foxo1 axis represents a new strategy for the management of multiple sclerosis and autoimmune inflammations per se.
ACCEPTED MANUSCRIPT 5. Conclusions In conclusion, we verified a positive correlation between the level of microRNA 182 and symptom severity of EAE in vivo study in animals. MicroRNA 182 knocked-down resulted in CD4+ T cells differentiation towards an anti-inflammatory profile post MOG35-55 immunization
T
and mitigated EAE. In vitro polarization experiments also observed increased proportion of Treg
IP
cells and elevated expression of Foxo1 following microRNA 182 silencing. Therefore, microRNA
SC R
182 inhibited Treg cells specialization through Foxo1 dependent pathway, during the pathogenesis
AC
CE P
TE
D
MA
NU
of EAE.
ACCEPTED MANUSCRIPT Acknowledgements
AC
CE P
TE
D
MA
NU
SC R
IP
T
This study was supported by the National Natural Science Foundation (81430035, 81171121 and 81371323), Key Laboratory of Myocardial Ischemia, Harbin Medical University, Chinese Ministry of Education (No.KF201202, No.KF201006 and No KF201203), National Natural Science Foundation Projects (No. C080102), and grants from department of education funding (No. Z2010008). The authors have no conflicting financial interests.
ACCEPTED MANUSCRIPT References [1] L. Belver, F.N. Papavasiliou, A.R. Ramiro, MicroRNA control of lymphocyte differentiation and function, Current opinion in immunology, 23 (2011) 368-373.
T
[2] R. Dai, S.A. Ahmed, MicroRNA, a new paradigm for understanding immunoregulation, inflammation, and autoimmune diseases, Translational research : the journal of laboratory and clinical
IP
medicine, 157 (2011) 163-179.
[3] C. Du, C. Liu, J. Kang, G. Zhao, Z. Ye, S. Huang, Z. Li, Z. Wu, G. Pei, MicroRNA miR-326 regulates
SC R
TH-17 differentiation and is associated with the pathogenesis of multiple sclerosis, Nature immunology, 10 (2009) 1252-1259.
[4] M. Guerau-de-Arellano, H. Alder, H.G. Ozer, A. Lovett-Racke, M.K. Racke, miRNA profiling for neuroimmunology, 248 (2012) 32-39.
NU
biomarker discovery in multiple sclerosis: from microarray to deep sequencing, Journal of [5] R.M. O'Connell, D. Kahn, W.S. Gibson, J.L. Round, R.L. Scholz, A.A. Chaudhuri, M.E. Kahn, D.S. Rao, D. Baltimore, MicroRNA-155 promotes autoimmune inflammation by enhancing inflammatory T cell
MA
development, Immunity, 33 (2010) 607-619.
[6] W. Pan, S. Zhu, D. Dai, Z. Liu, D. Li, B. Li, N. Gagliani, Y. Zheng, Y. Tang, M.T. Weirauch, X. Chen, W. Zhu, Y. Wang, B. Chen, Y. Qian, Y. Chen, J. Fang, R. Herbst, L. Richman, B. Jallal, J.B. Harley, R.A. Flavell, Y. Yao, N. Shen, MiR-125a targets effector programs to stabilize Treg-mediated immune homeostasis,
D
Nature communications, 6 (2015) 7096.
TE
[7] L.F. Lu, M.P. Boldin, A. Chaudhry, L.L. Lin, K.D. Taganov, T. Hanada, A. Yoshimura, D. Baltimore, A.Y. Rudensky, Function of miR-146a in controlling Treg cell-mediated regulation of Th1 responses, Cell, 142 (2010) 914-929.
CE P
[8] R. Hu, R.M. O'Connell, MicroRNA control in the development of systemic autoimmunity, Arthritis Res Ther, 15 (2013) 202.
[9] A.B. Stittrich, C. Haftmann, E. Sgouroudis, A.A. Kuhl, A.N. Hegazy, I. Panse, R. Riedel, M. Flossdorf, J. Dong, F. Fuhrmann, G.A. Heinz, Z. Fang, N. Li, U. Bissels, F. Hatam, A. Jahn, B. Hammoud, M. Matz,
AC
F.M. Schulze, R. Baumgrass, A. Bosio, H.J. Mollenkopf, J. Grun, A. Thiel, W. Chen, T. Hofer, C. Loddenkemper, M. Lohning, H.D. Chang, N. Rajewsky, A. Radbruch, M.F. Mashreghi, The microRNA miR-182 is induced by IL-2 and promotes clonal expansion of activated helper T lymphocytes, Nature immunology, 11 (2010) 1057-1062. [10] M. Hecker, M. Thamilarasan, D. Koczan, I. Schroder, K. Flechtner, S. Freiesleben, G. Fullen, H.J. Thiesen, U.K. Zettl, MicroRNA expression changes during interferon-beta treatment in the peripheral blood of multiple sclerosis patients, International journal of molecular sciences, 14 (2013) 16087-16110. [11] Y.M. Kerdiles, D.R. Beisner, R. Tinoco, A.S. Dejean, D.H. Castrillon, R.A. DePinho, S.M. Hedrick, Foxo1 links homing and survival of naive T cells by regulating L-selectin, CCR7 and interleukin 7 receptor, Nature immunology, 10 (2009) 176-184. [12] J.H. Paik, R. Kollipara, G. Chu, H. Ji, Y. Xiao, Z. Ding, L. Miao, Z. Tothova, J.W. Horner, D.R. Carrasco, S. Jiang, D.G. Gilliland, L. Chin, W.H. Wong, D.H. Castrillon, R.A. DePinho, FoxOs are lineage-restricted redundant tumor suppressors and regulate endothelial cell homeostasis, Cell, 128 (2007) 309-323. [13] J. Ma, Y. Ding, X. Fang, R. Wang, Z. Sun, Protein kinase C-theta inhibits inducible regulatory T cell differentiation via an AKT-Foxo1/3a-dependent pathway, Journal of immunology, 188 (2012)
ACCEPTED MANUSCRIPT 5337-5347. [14] Y.M. Kerdiles, E.L. Stone, D.R. Beisner, M.A. McGargill, I.L. Ch'en, C. Stockmann, C.D. Katayama, S.M. Hedrick, Foxo transcription factors control regulatory T cell development and function, Immunity, 33 (2010) 890-904. populations during infection, Nature immunology, 10 (2009) 457-458.
T
[15] E.D. Tait, C.A. Hunter, The Foxo and the hound: chasing the in vivo regulation of T cell
transcription, ANTIOXIDANTS & REDOX SIGNALING, (2011).
IP
[16] S.M.H. Anne S. Dejean, and Yann M. Kerdiles{, Highly specialized role of Forkhead box O
SC R
[17] S.M. Hedrick, R. Hess Michelini, A.L. Doedens, A.W. Goldrath, E.L. Stone, FOXO transcription factors throughout T cell biology, Nature reviews. Immunology, 12 (2012) 649-661. [18] W. Ouyang, M.O. Li, Foxo: in command of T lymphocyte homeostasis and tolerance, Trends in immunology, 32 (2011) 26-33.
NU
[19] M.M. Tejera, E.H. Kim, J.A. Sullivan, E.H. Plisch, M. Suresh, FoxO1 controls effector-to-memory transition and maintenance of functional CD8 T cell memory, Journal of immunology, 191 (2013) 187-199.
MA
[20] W. Ouyang, O. Beckett, Q. Ma, J.H. Paik, R.A. DePinho, M.O. Li, Foxo proteins cooperatively control the differentiation of Foxp3+ regulatory T cells, Nature immunology, 11 (2010) 618-627. [21] I.K. Guttilla, B.A. White, Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells, The Journal of biological chemistry, 284 (2009) 23204-23216.
D
[22] S.S. Myatt, J. Wang, L.J. Monteiro, M. Christian, K.K. Ho, L. Fusi, R.E. Dina, J.J. Brosens, S.
TE
Ghaem-Maghami, E.W. Lam, Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer, Cancer research, 70 (2010) 367-377. [23] C. Wu, N. Yosef, T. Thalhamer, C. Zhu, S. Xiao, Y. Kishi, A. Regev, V.K. Kuchroo, Induction of
CE P
pathogenic TH17 cells by inducible salt-sensing kinase SGK1, Nature, 496 (2013) 513-517. [24] S. Kelada, P. Sethupathy, I.S. Okoye, E. Kistasis, S. Czieso, S.D. White, D. Chou, C. Martens, S.M. Ricklefs, K. Virtaneva, D.E. Sturdevant, S.F. Porcella, Y. Belkaid, T.A. Wynn, M.S. Wilson, miR-182 and miR-10a are key regulators of Treg specialisation and stability during Schistosome and
AC
Leishmania-associated inflammation, PLoS pathogens, 9 (2013) e1003451.
ACCEPTED MANUSCRIPT Figure Legends
CE P
TE
D
MA
NU
SC R
IP
T
Fig. 1. MicroRNA 182 is upregulated in CD4+ T cells and CD4+CD25+ Treg cells at acute phase EAE whereas Foxo1 is downregulated. (A-M) Female C57BL/6 mice age 6 to 8 weeks were immunized subcutaneously with either myelin oligodendrocyte glycoprotein35-55 (MOG35-55) suspended in complete Freund’s adjuvant (CFA) or CFA alone. Mice received MOG35-55 administration were designated EAE group (n=4) whereas mice with CFA alone CFA group (n=4). (A) & (C) MicroRNA 182 and Foxo1 mRNA levels of CD4+ T cells harvested from axillary lymph nodes in EAE and CFA mice at day 7, day 14, day 21 post immunization. (B) & (D) MicroRNA 182 and Foxo1 mRNA levels of CD4+ T cells harvested from spleens in EAE and CFA mice at day 7, day 14, day 21 post immunization. (E) & (G) MicroRNA 182 and Foxo1 mRNA levels of CD4+CD25+ Treg cells harvested from axillary lymph nodes in EAE and CFA mice at day 7, day 14, day 21 post immunization. (F) & (H) MicroRNA 182 and Foxo1 mRNA levels of CD4+CD25+ Treg cells harvested from spleens in EAE and CFA mice at day 7, day 14, day 21 post immunization. (I) & (J)Foxo1 and Foxp3 protein levels of CD4+ T cells harvested from axillary lymph nodes in EAE and CFA mice at day 7, day 14, day 21 post immunization. (K) Foxp3 mRNA level of CD4+ T cells harvested from axillary lymph nodes and spleen in EAE and CFA mice at 14 days post immunization. (L) & (M) FACS analysis of Treg subset among CD4+ T cells isolated from the lymph nodes and spleens of EAE and CFA mice at 14 days post immunization. mRNA expression level were normalized against RNU6 for MicroRNA 182 and beta-actin for Foxo1 and Foxp3. Protein levels of Foxo1 and Foxp3 were normalized against TATA-binding protein (TBP). Error bars represent standard error of the mean (SEM); * P<0.05, **P<0.01, ***P<0.001.
AC
Fig. 2. MicroRNA 182 knockdown upregulates CD4+CD25+Foxp3+ Treg at acute phase EAE and renders resistance to MOG35-55 immunization in C57BL/6 mice. (A-F) Wild type (n=4) and MicroRNA 182 knockdown (n=4) female C57BL/6 mice age 6 to 8 weeks were immunized with MOG35-55 and sacrificed 14 days post immunization for the following experiments. (A) Quantitative polymerase chain reaction (qPCR) analysis of MicroRNA 182 among CD4+ T cells in the lymph nodes and spleen of wild type and MicroRNA 182 knockdown mice. (B) Clinical scores in wild type and MicroRNA 182 knockdown mice from day 0 to day 22 post MOG35-55 immunization. (C) & (D) qPCR analysis and western blotting studies of Foxo1 and Foxp3 levels in wild type and transgenic microRNA 182 knockdown mice. Proteins were collected from CD4+T cells from lymph nodes and spleen at 14 dpi. (E)&(F) FACS analysis of Treg subset among CD4+ T cells isolated from the lymph nodes and spleens of wild type and MicroRNA 182 knockdown mice. mRNA expression level were normalized against RNU6 for MicroRNA 182 and beta-actin for Foxo1 and Foxp3. Protein levels of Foxo1 and Foxp3 were normalized against TATA-binding protein (TBP). WT: wild type, KD: knockdown. Error bars represent standard error of the mean (SEM); * P<0.05, **P<0.01, ***P<0.001. Fig. 3. MicroRNA 182 knockdown increases Treg population differentiation in vitro. (A-G) CD4+ T cells were isolated from draining lymph nodes of myelin oligodendrocyte glycoprotein35-55 (MOG35-55) immunized female wild type C57BL/6 mice age 6 to 8 weeks 7 days post immunization. Isolated CD4+ T cells were infected with lentiviral vectors packaged with
ACCEPTED MANUSCRIPT
SC R
IP
T
microRNA182 5’ inhibitor or microRNA182 inhibitor oligomers. MOG35-55 was supplemented to the culture media together with lentiviruses or oligomers throughout the infection, before the following experiments were performed. (A) Quantitative polymerase chain reaction (qPCR) analysis of microRNA 182 expression in lentivirus infected CD4+ T cells verified the delivery efficacy of viral vectors. (B)&(C) qPCR analysis of Foxo1 and Foxp3 mRNA expression in lentivirus infected CD4+ T cells. (D) & (E) FACS analysis revealed enrichments of Treg cells. (F) qPCR analysis of microRNA 182 expression in oligomers infected CD4+ T cells verified the delivery efficacy. (G) qPCR analysis of Foxo1 and Foxp3 mRNA expression in oligomers infected CD4+ T cells. LV: lentiviral vector. NC: Negative Control. Error bars represent standard error of the mean (SEM); * P<0.05, **P<0.01, ***P<0.001.
AC
CE P
TE
D
MA
NU
Fig. 4. Foxo1 knockdown reduces Treg population in vitro. (A-E) CD4+ T cells were isolated from draining lymph nodes of female C57BL/6 mice age 6 to 8 weeks 7 days post myelin oligodendrocyte glycoprotein35-55 (MOG35-55) immunization. Isolated CD4+ T cells were cultured in MOG35-55 containing media with or without Foxo1 siRNA transfection for 48 hours. (A) FACS analysis decreased percentage of Treg in Foxo1 silencing CD4+ T cells. (B) Foxo1 silencing was accompanied by decreased expression of Treg transcriptional marker Foxp3 verified by qPCR and Western blotting. (C) FACS analysis of Treg post in vitro Foxo1 silencing and polarization. (D) FACS analysis of Treg post ex vivo polarization. CD4+ T cells were originated from peripheral lymph nodes of systemic microRNA182 knockdown mice. (E) FACS analysis of Treg post ex vivo Foxo1 silencing and polarization. CD4+T cells were originated from peripheral lymph nodes of systemic microRNA182 knockdown mice. mRNA levels of Foxo1 and Foxp3 were normalized against β-actin; protein levels of Foxo1 and Foxp3 were normalized against TATA-binding protein (TBP); WT: wild type, KD: knock down. Error bars represent standard error of the mean (SEM); * P<0.05, **P<0.01, ***P<0.001.
AC
Figure 1
CE P
TE
D
MA
NU
SC R
IP
T
ACCEPTED MANUSCRIPT
AC
CE P
TE
D
MA
NU
SC R
IP
T
ACCEPTED MANUSCRIPT
Figure 2
AC
CE P
TE
D
MA
NU
SC R
IP
T
ACCEPTED MANUSCRIPT
Figure 3
NU
SC R
IP
T
ACCEPTED MANUSCRIPT
AC
CE P
TE
D
MA
Figure 4
S1521-6616(16)30398-9 doi: 10.1016/j.clim.2016.09.008 YCLIM 7735
To appear in:
Clinical Immunology
Received date: Revised date: Accepted date:
15 October 2015 19 September 2016 20 September 2016
Please cite this article as: Cong Wan, Chang-Yun Ping, Xiao-Yu Shang, JiangTian Tian, Si-Han Zhao, Lei Li, Shao-Hong Fang, Wei Sun, Yan-Feng Zhao, ZhaoYing Li, Yan-Wen Xu, Li-Li Mu, Jing-Hua Wang, Qing-Fei Kong, Guang-You Wang, Hu-Lun Li, Bo Sun, MicroRNA 182 inhibits CD4+ CD25+ Foxp3+ Treg differentiation in experimental autoimmune encephalomyelitis, Clinical Immunology (2016), doi: 10.1016/j.clim.2016.09.008
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT MicroRNA 182 Inhibits CD4+CD25+Foxp3+ Treg Differentiation in Experimental Autoimmune Encephalomyelitis.
SC R
IP
T
Cong Wan 1 a b, Chang-Yun Ping 1 a, Xiao-Yu Shang 1 a f, Jiang-Tian Tian b e, Si-Han Zhao a, Lei Li c, Shao-Hong Fang b e, Wei Sun d, Yan-Feng Zhao c, Zhao-Ying Li a, Yan-Wen Xu a, Li-Li Mu a, Jing-Hua Wang a, Qing-Fei Kong a, Guang-You Wang a , Hu-Lun Li * a b and Bo Sun * a a
TE
D
MA
NU
Department of Neurobiology, Harbin Medical University, No.194 XueFu Road, Harbin, Heilongjiang 150081, China b The Key Laboratory of Myocardial Ischemia, Harbin Medical University, Ministry of Education, Heilongjiang Provence, 150086, China. c Department of Neurology, The Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang, 150086, China. d Department of Neurology, The First Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang, 150086, China. e Department of Cardiology, The Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang, 150086, China. f Xiamen City, Huli District, Administration Center of Parks and Gardens. * Corresponding authors: Hu-Lun Li and Bo Sun
AC
CE P
Bo Sun: Department of Neurobiology, Harbin Medical University, Harbin, Heilongjiang 150086, China. Email: [email protected] Tel.: +86 451 8666 2943; fax: +86 451 8750 2363. Hu-Lun Li: Department of Neurobiology, Harbin Medical University, Harbin, Heilongjiang 150086, China. The Key Laboratory of Myocardial Ischemia, Harbin Medical University, Ministry of Education, Heilongjiang Provence, China. Email: [email protected] Tel.: +86 451 8666 2943; fax: +86 451 8750 2363. 1
These authors contributed equally to this work.
ACCEPTED MANUSCRIPT Abstract
AC
CE P
TE
D
MA
NU
SC R
IP
T
MicroRNA 182 has been found to have a distinct contribution in the clonal expansion of activated- and functioning of specialized- helper T cells. In this study we knocked down microRNA 182 in vivo and induced experimental autoimmune encephalomyelitis (EAE) to determine the influences of microRNA 182 in the Treg cells functional specialization through Foxo1 dependent pathway in the peripheral lymphoid organs. Down-regulation of microRNA 182 significantly increased the proportions of Foxp3+ T cells in the peripheral lymph nodes and spleen. In vivo study verified a positive correlation between microRNA 182 levels and symptom severity of EAE, and a negative correlation between microRNA 182 and the transcriptional factor Foxp3. In vitro polarization study also confirmed the contribution of Foxo1 in microRNA 182 mediated down-regulation of Foxp3+ T cells. Together, our results provide evidence that during the development of EAE, microRNA 182 repressed Treg cells differentiation through the Foxo1 dependent pathway.
ACCEPTED MANUSCRIPT Highlights
T
IP
SC R NU MA D TE
CE P
MicroRNA 182 expression correlates with the progression of MOG35-55 mediated autoimmune inflammation. Down-regulation of microRNA 182 increases percentages of regulatory T cells in the peripheral lymph nodes and spleen and mitigates EAE. During the pathogenesis of EAE, microRNA 182 regulates the differentiation of Treg cells through Foxo1 dependent pathway.
AC
ACCEPTED MANUSCRIPT Key words
AC
CE P
TE
D
MA
NU
SC R
IP
T
MicroRNA 182; Treg cells; Experimental Autoimmune Encephalomyelitis; Foxo1
ACCEPTED MANUSCRIPT 1. Introduction
MA
NU
SC R
IP
T
MicroRNAs have been recognized to play critical roles in post-transcriptional regulation of gene expression [1-3]. In the immune system, microRNAs were highly expressed [4] and participated in autoimmunity as the regulators [3, 5]. Notably, the miR-155 was known highly expressed in Treg cells and miR-125a-deficient Treg cells demonstrated reduced immune-regulatory function [6]. MiR-146a was also found expressed in Treg cells and plays an important role in Treg cell-mediated immunological tolerance [7]. microRNA 182 of the microRNA-182-96-183 cluster was found to be essential in regulating CD4+T cells, and promotes activation of Th lymphocytes by IL-2 [1, 8]. A recent report further verified that microRNA 182 regulates clonal expression by post-transcriptional regulating clonal expansion [8, 9]. In breast cancer cell, microRNA 182 down-regulated the expression of Foxo1 mRNA [8]. MicroRNA 182 targets the 3’ untranslated region (UTR) of Foxo1 transcripts and their expressions were negatively correlated in Th cells [10]. However, participation of microRNA 182 directed regulation of Foxo1 in autoimmune disorders such as MS/EAE, still remains to be established.
CE P
TE
D
In 2009 [11, 12], studies provided new sight into the role of the forkhead box (Fox) transcription factor in various cellular processes. In mammals, members of the Foxo subfamily include Foxo1, Foxo3, Foxo4, and Foxo6 [13], which participate in regulating processes such as cell cycle progression, proliferation, energy metabolism, differentiation, apoptosis, and stress resistance [13-15]. In the immune system, Foxo1 regulates T cell and B cell mediated immune responses [16, 17]. Recently, researchers have demonstrated that Foxo1 is essential for the induction of Foxp3 expression in Treg cells [18, 19]. In addition, Foxo1 can inhibit T-bet expression and differentiation of effector CD4+T cells – Th1 and Th17 indirectly [20].
AC
In this study, we observed an elevated level of microRNA 182 and decreased Foxo1 at acute phase of Experimental Autoimmune Encephalomyelitis (EAE). Then we demonstrated that overall knockdown of microRNA 182 in C57BL/6 mice was accompanied by increased regulatory T cellpolarizations in peripheral lymphoid organs after myelin oligodendrocytic glycoprotein35-55 (MOG35-55) immunization. In addition, our in vitro experiments based on the CD4+T cells, revealed the opposing effects of microRNA 182 and its putative target Foxo1, abetting that microRNA 182 and Foxo1 act antagonistically in the specialization of regulatory T cells. Finally, the proliferation experiment of CD4+T cells from C57BL/6 mice confirmed that the microRNA 182 inhibited Treg cell specialization through Foxo1 dependent pathway.
ACCEPTED MANUSCRIPT 2. Material and Methods
AC
CE P
TE
D
MA
NU
SC R
IP
T
2.1. Animals Female C57BL/6 mice, 6-8 weeks old, were purchased from Peking Vital River Laboratory Animal Ltd. (Beijing, China). MicroRNA 182 transgenic mice constructions were cooperated with The Key Laboratory of Myocardial Ischemia (Chinese Ministry of Education, Harbin, Heilongjiang, China). All mice were kept in specific pathogen-free environments. Genetic engineering of microRNA 182 was achieved by infection of zygotes by lentiviral vectors. The specific process is as follows: Female C57BL/6 mice, 4-6 weeks old, were purchased from Peking Vital River Laboratory Animal Ltd; each mice was injected pregnant mare’s serum gonadotropin (PMSG) 5 IU; 48 hours later, each mice was injected human chorionic gonadotropin (hCG) 5 IU, then put together with mature male mice (more than 2 months old) into the same cage immediately; female mice with visible vaginal plug were selected for breeding, and zygotes were collected surgically. (SF. 4A-a). Harvested zygotes were maintained in M2 culture medium; after cleaning these zygotes with the hyaluronic acid enzyme solution, cleaned zygotes were then maintained in M16 culture medium. Indicated lentiviral vectors were injected into the zygotes (SF. 4A-b&c), and transplanted into the fallopian tube of surrogate mother mice (Female C57BL/6 mice, 6-8 weeks old, post-mating with male mice undergone vasectomy). Surrogate mother mice gave birth to the F-0 generation “transgenic mice” (SF. 4A-d&e), after detecting and screening by fluorescent lamp (SF. 4A-f&g) and qPCR analysis (SF. 4B), we could acquire the transgenic mice. Animals were inbred for more than 3 generations. Successful construction was identified by significantly lower expression of microRNA 182 compared with the WT mice in qPCR genotyping (SF. 4B). The following plasmids were engineered to lentiviruses for experiments in this study: mmu-miR-182-inhibitor (microRNA 182-inhibitor) (CGGUGUGAGUUCUACCAUUGCCAAA), and the negative control (UUCUCCGAACGUGUCACGUTT; ACGUGACACGUUCGGAGAATT) (synthesized by Shanghai GenePharma Co.,Ltd). 2.2. Induction and Clinical Evaluation of EAE Mice were immunized subcutaneously with 200μg MOG35-55 peptide (MEVGWYRSPFSRVVHLYRNGK) emulsified in complete Freund’s adjuvant (Sigma) supplemented with heat-inactivated Mycobacterium tuberculosis H37 RA (Difco Laboratories, Detroit, MI). 50μl of the emulsion were injected in each axillary fossa. 200ng of pertussis toxin (LIST BIOLOGICAL LABORATORIES, INC) were administered intravenously at the time of immunization and 48 h later. Clinical score was assessed daily according to the following scoring criteria: 0, no detectable signs of EAE; 1, limp tail; 2, hind limb weakness or impaired gait; 3, complete hind limb paralysis; 4, paralysis of fore and hind limbs; and 5, moribund or death. 0.5 was added to the lower score when clinical signs were intermediate between two grades of disease. 2.3. Preparation of mononuclear cells from lymph nodes and spleen Mononuclear cells (MNC) were obtained from the axillary lymph nodes, spleen and thymus isolated from both EAE and CFA groups on 7, 14 and 21 days post immunization. Cells from lymph nodes and thymus were washed in PBS, then filtered through a 40μm cell strainer (BD Biosciences),
ACCEPTED MANUSCRIPT and centrifuged at 700g for 10min at 4ºC, then cultured in DMEM medium (Hyclone, Logan, UT) containing 10% fetal bovine serum (Gibco, Paisley, UK), and 1% penicillin–streptomycin (Gibco). Red blood cells from spleen were lysed in ACK lysis buffer for 5min at room temperature, centrifuged at 200g for 10min and then followed the same steps as lymph nodes.
SC R
IP
T
2.4. CD4+ T cell purification and sorting CD4+ T cell from lymph nodes, spleen and thymus of mice were isolated using the MagCellectTM Mouse CD4+T Cell Isolation Kit (R&D systems) according to manufacturer’s instruction.
NU
2.5. CD4+CD25+ Regulatory T cell purification and sorting CD4+CD25+ Regulatory T Cell from lymph nodes, spleen and thymus of mice were isolated using the MagCellectTM Mouse CD4+CD25+ Regulatory T Cell Isolation Kit (R&D systems) according to manufacturer’s instruction.
AC
CE P
TE
D
MA
2.6. Flow cytometry EAE and CFA mice were sacrificed on 7, 14 and 21 days post immunization. Lymph node, spleen and thymus MNC were harvested and prepared as described above. FACSCalibur™ System (BD Biosciences) was used for profiling of CD4+T-cell subsets. The following antibodies were used for cell surface staining: PERCP-anti-CD4 (BD), FITC-anti-CD4 (BD), PE-anti-CD25 (eBioscience). For intracellular cytokine staining, mononuclear cells were stimulated with PMA and ionomycin (Sigma) in the presence of Brefeldin A (GolgiStop; BD) for 4h before staining. After incubated with surface marker, samples were treated with fixation/permeabilization buffer (eBioscience) and then stained with PE-anti–IFN-γ (eBioscience), PE-anti–IL-17 (eBioscience) and PE-anti-IL-4 (eBioscience). Intranuclear staining for APC-anti-Foxp3 was performed with the mouse regulatory T cell staining kit (eBioscience) according to the manufacturer’s instructions. Flow cytometry was performed with FACSCalibur™ (BD Biosciences) and data were analyzed using FlowJo software (Tree Star). 2.7. Quantitative PCR Total RNA from sorted CD4+T cells and CD4+CD25+ Regulatory T Cell were extracted with TRIzol reagent RnaEx (GENEray) following the manufacturer’s protocol. After microRNA was reverse transcribed with the All-in-OneTM miRNA First-Strand cDNA Synthesis Kit (GeneCopoeia, Inc) and mRNA with the M-MLV Reverse Transcriptase (Invitrogen), TransStart® Top Green qPCR SuperMix and CFX96TM Real-Time System (C1000 Touch Thermal Cycler; BIORAD) were used to assay the microRNA 182, Foxo1and Foxp3 expression using sequence specific primers. Primers of microRNA 182 and Foxo1 were purchased from GENECOPIEA, and Foxp3 were synthesized by Invitrogen (sequences available upon request). MiRNA was normalized to U6 (mouse), and other mRNAs were normalized to β-actin for qPCR analysis. Fold difference was determined by ddCq method. 2.8. CD4+T cells transduction in vitro CD4+T cells were isolated from lymph node of EAE mice on 7 days post immunization, then
ACCEPTED MANUSCRIPT
NU
SC R
IP
T
transfected with LV-mmu-miR-182-5p-inhibition (anti-LV-microRNA 182) (Viral Products were purchased from SHANGHAI GENECHEM Co., Ltd) separately according to the manufacturer’s protocol. Under the same condition, anti-LV-microRNA 182-NC was used as the negative control. All cells were treated with MOG35-55, and then collected for analysis with flow cytometry or extracted RNA or protein after 96h. CD4+T cells were transfected with oligomers, mmu-miR-182-inhibitor (microRNA 182-inhibitor) (CGGUGUGAGUUCUACCAUUGCCAAA), and the negative control (UUCUCCGAACGUGUCACGUTT; ACGUGACACGUUCGGAGAATT) (synthesized by Shanghai GenePharma Co.,Ltd) using RNAi-Mate (Shanghai GenePharma Co., Ltd) according to the manufacturer’s protocol. For siRNA-Foxo1 transfection, the transfection mixture (100μl) consists of 60pmol siRNA-Foxo1 (QIAGEN), 6μl Reagent (QIAGEN). All cells were treated with MOG35-55, and then collected to extract RNA or protein 48h later.
D
MA
2.9. T cell polarization Mice CD4+T cells were purified and polarized under Th1 (anti-mouse-IL-4 3.3μg/ml, IL-2 4ng/ml, IL-12 5ng/ml); Th2(anti-mouse-IL-12 0.12μg/ml, anti-mouse-IFN-γ 5μg/ml, IL-2 4ng/ml, IL-4 10ng/ml); Th17(anti-mouse-IL-4 5μg/ml, anti-mouse-IFN-γ 5μg/ml, TGF-β 2ng/ml, IL-6 20ng/ml) ; Treg (anti-mouse-IL-4 5μg/ml, anti-mouse-IFN-γ 5μg/ml, TGF-β 2ng/ml) conditions. Cells were collected at 5 days post polarization.
AC
CE P
TE
2.10. Western blotting Nuclear proteins were purified with Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime). Nuclear protein lysates were separated by 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred onto a polyvinylidene difluoride (PVDF) membrane via Mini Trans-Blot® Electrophoretic Transfer Cell (Bio-Rad Laboratories, INC). Membranes were blocked with 5% non-fat milk for 1h at room temperature. Specific antibodies were used to detect Foxo1, Foxp3 and TBP. Use the TBP (TATA-binging protein) as the internal reference. 2.11. Reagents for FACS and Western blot The following antibodies were from BD Pharmingen: FITC-conjugated anti-mouse CD4; PerCP-conjugated anti-mouse CD4; PE-conjugated anti-mouse IL-4. The following antibodies were from eBioscience (eBioscience, San Diego, CA): APC-conjugated anti-mouse Foxp3; PE-conjugated anti-mouse IFN-γ; PE-conjugated anti-mouse CD25 and PE-conjugated anti-mouse IL-17. The fixation and permeabilization kit used for flow cytometry was purchased from eBioscience. Western blotting Reagents as follows: rabbit anti-mouse/human Foxo1 (Santa Cruz Biotechnology, Santa Cruz, CA); rabbit anti-mouse/human Foxp3, rabbit anti-mouse/human TBP (Cell Signaling Technology). 2.12. Statistics All statistical analysis was performed using GraphPad Prism (GraphPad Software Inc., La Jolla, CA). Two-tailed Student’s t-test was used for comparison between pairs of groups, ANOVA among groups and clinical scores of EAE used a nonparametric Mann-Whitney test. P < 0.05 was considered statistically significant.
ACCEPTED MANUSCRIPT 3. Results
NU
SC R
IP
T
3.1. MicroRNA 182 is up-regulated and Foxo1 is down-regulated at acute phase of inflammation among peripheral CD4+ T helper cells of EAE C57BL/6 mice. Female C57BL/6 mice immunized with MOG35-55 in complete Freund’s adjuvant (CFA) demonstrated higher level of microRNA 182 in CD4+ T helper cells from axillary lymph nodes (Fig. 1A) and spleen (Fig. 1B) at acute phase of EAE (14 days post immunization) comparing with mice immunized with CFA alone. Forkhead box O1 (Foxo1) transcription factor reached the lowest level at the peak of disease progression among T helper cells from either axillary lymph nodes (Fig. 1C) or spleen (Fig. 1D). The change of Foxo1 was not significantly different between EAE and CFA group in spleen. This is probably a result of the CNS focused pathology of EAE whereas the spleen reflects the systemic immune response of the entire body.
MA
Furthermore, we isolated CD4+CD25+Treg cells from axillary lymph nodes and spleen, the data showed that at acute phase of EAE microRNA 182 expressed highest in CD4+CD25+Treg cells of axillary lymph nodes (Fig. 1E) and spleen(Fig. 1F). Foxo1 was expressed lower than CFA group at acute phase of EAE (Fig. 1G&1H), especially in Treg cells from spleen (Fig. 1H), the change of Foxo1 was significantly different between EAE and CFA group.
CE P
TE
D
Foxo1 protein demonstrated inverse correlations with the expression of microRNA 182 (Fig. 1I&SF. 1), and transcriptional factor Foxp3 also showed inverse correlations with the expression of microRNA 182 (Fig. 1J&1K), that is, the changing of Foxp3 expression was in concert with Foxo1. (Fig. 1I&SF. 1). In vivo analyses of Treg cells among CD4+ T helper cells from the spleen at 14 days post immunization displayed that the proportion of Foxp3+ Treg cells showed significant reduction in EAE mice (Fig. 1L&1M).
AC
Both at gene level (Fig. 1C&1D&1K) and protein level (Fig. 1I&1J&SF. 1), lower expression of Foxo1 in EAE mice were accompanied by reduction in Foxp3 expression compared with CFA mice in lymph nodes and spleen. 3.2. Knockdown of microRNA 182 alleviates MOG35-55 mediated autoimmune inflammation in female C57BL/6 mice in vivo. MicroRNA 182 genetic manipulation in female C57BL/6 mice showed that mice with systemic knockdown of microRNA 182 since embryo stage demonstrated shorter disease course of EAE as expected and mitigated EAE symptoms (Fig. 2B). The expression of microRNA 182 in CD4+T cells from lymph nodes and spleen were confirmed by qPCR and results showed that the expression of microRNA 182 were significantly lower in microRNA 182 knockdown mice than in WT mice at the acute phase (14dpi) of EAE (Fig. 2A). Foxo1 mRNA and Foxo1 protein demonstrated inverse correlations with microRNA 182 expression, and the tendency of transcriptional factor Foxp3 was same as Foxo1, both mRNA and protein were demonstrated inverse correlations with microRNA 182 expression in lymph nodes (Fig. 2C) and spleen (Fig. 2D). To explore if the microRNA 182 have effect on development and differentiation of CD4+CD25+Treg cells, we detected the CD4+CD25+Treg cells and the microRNA 182 expression
ACCEPTED MANUSCRIPT
IP
T
in thymus of WT and microRNA 182 knockdown mice before immunization. MicroRNA 182 expressed lower in Thymus of microRNA 182 knockdown mice compared with WT mice (SF. 2B). However, there was no significantly change with the proportion of Treg cells compared with WT mice (SF. 2A), demonstrating that knockdown microRNA 182 didn’t influence the development of Treg cells. Following EAE induction, the dynamic expression of microRNA 182 changed with the development of EAE, and displayed the same tendency in peripheral lymph organs (SF. 2C&2D).
NU
SC R
Systemic silencing of microRNA 182 consistently and significantly up-regulated regulatory T cells proportions in the peripheral lymphoid organs at acute phase (Fig. 2E&2F) of EAE course, but down-regulated regulatory T cell proportions in central lymphoid organ (SF. 2E). In addition, compared with WT mice, the expression of microRNA 182 decreased in CD4+CD25+Treg cells in Thymus of microRNA 182 KD mice at acute phase of EAE (SF. 2F).
AC
CE P
TE
D
MA
3.3. MicroRNA 182 suppresses differentiation to regulatory T cells (Treg) through Foxo1 dependent pathway in vitro. To exclude the unknown systemic influence on CD4+Th cells in microRNA 182 transgenic mice, we infected CD4+ T cells isolated from the draining lymph nodes of MOG35-55 immunized WT mice at early phase of EAE (7 days post immunization) with lentiviral vectors to deliver microRNA 182 inhibitor in vitro at the presence of MOG35-55. The infection efficiency of GFP shRNA lentivirus showed in SF. 3A&3B. The expression of microRNA 182 was significantly lower post infected by microRNA 182-inhibitor, which compared with negative control (Fig. 3A). The inhibition effective of microRNA 182 in vitro experiments with the lentiviral vectors was same as the knockdown effective in transgenic mice (Fig. 2A). In vitro down-regulation of microRNA 182 remarkably increased the expression of Foxo1 mRNA (Fig. 3B), the transcriptional factor Foxp3 (Fig. 3C) and the proportion of Treg cells (Fig. 3D&3E), in accord with the in vivo findings (Fig. 2). To further confirm that microRNA 182 inhibited Treg cells specialization through Foxo1 dependent pathway, we also infected CD4+T cells isolated from the draining lymph nodes of MOG35-55 immunized WT mice at early phase of EAE (7 days post immunization) with microRNA 182 inhibitor oligomers in vitro at the presence of MOG35-55. The infection efficiency is shown in Fig. 3F and SF. 3C&3D, and the expression of Foxo1 mRNA and Foxp3 mRNA also remarkably increased, these results showed same tendency as in lentiviral vectors infection experiments (Fig. 3G). 3.4. MicroRNA 182 suppresses differentiation to regulatory T cells (Treg) through Foxo1 dependent pathway in vitro. At the same time, in multiple Th subsets induction systems, siRNA inhibition of Foxo1 alone induced decreased Treg populations (Fig. 4A), and decreased the expression of the transcriptional factor Foxp3 (Fig.4B). Both at gene level and protein level, repression of Foxo1 was accompanied by reduction in Foxp3 expression (Fig. 4B). Then we suppressed the expression of Foxo1 in naïve T helper cells by siRNA and cultured these naïve cells in different polarization conditions for Th1, Th2, Th17 and Treg cells in vitro. We observed that only regulatory T cells were significantly down-regulated (Fig. 4C). These results, again raise the question of how exactly microRNA 182 manipulates the direction of
ACCEPTED MANUSCRIPT
AC
CE P
TE
D
MA
NU
SC R
IP
T
specialization for naïve helper T cells. It was well established that regulatory Th cells (Treg) and pro-inflammatory Th cells (Th1 and Th17) could inhibit the specialization of each other. To exclude the inhibitory effect of different Th cells on each other in multiple Th subsets culture system, we separately cultured naïve CD4+T cells isolated from lymph nodes of microRNA 182 knockdown mice under the polarization condition for Treg cells. Treg cells frequencies showed significant increase following microRNA 182 silencing (Fig. 4D). In further experiments, Foxo1 expression in microRNA 182 knockdown CD4+ T cells were interfered with siRNA transfection, the transfection efficiency was shown in Fig. 4B. Only Treg frequencies were downregulated and other Th cells were not influenced (Fig. 4E).
ACCEPTED MANUSCRIPT 4. Discussion
CE P
TE
D
MA
NU
SC R
IP
T
Based on our results, microRNA 182 could inhibit Foxp3+ Treg by targeting transcriptional factor Foxo1. At acute phase of EAE, microRNA 182 displayed highest level of expression (Fig. 1A&1B and Fig. 1E&1F) concomitant with the lowest expression of Foxo1 (Fig. 1C&1D and Fig. 1G&1H and Fig. 1I&SF. 1). Lower expression of Foxp3 (Fig. 1J&1K&SF. 1) and decreased proportions of Treg cells (Fig. 1L&1M) were also negatively correlated with microRNA 182 expression. In vivo knockdown of microRNA 182 raised peripheral Treg percentages (Fig. 2E&2F), as shown by the increased expression of transcriptional factor Foxp3 (Fig. 2C&2D) at acute phase, i.e. 14 days post MOG35-55 immunization, and the tendency of Foxo1 expression was also negatively correlated with microRNA 182 expression, that is, the expression of Foxo1 increased when the microRNA 182 was knocked down (Fig. 2C&2D). Overall knockdown of microRNA 182 (Fig. 2A) shortened the disease course of EAE as expected and significantly mitigated EAE symptoms (Fig. 2B). In vitro down-regulation of microRNA 182 in CD4+T cells (Fig. 3A) by infecting with lentiviral increased the Foxo1 mRNA and Foxp3 mRNA expression (Fig. 3B&3C) and Treg percentages (Fig. 3D&3E). Silencing Foxo1 in vitro decreased the Treg percentages (Fig. 4A) and transcriptional factor Foxp3 expression (Fig. 4B). Under polarization conditions, Treg demonstrated higher sensitivity towards Foxo1 knockdown (Fig. 4C). In vitro polarization of naïve T helper cells harvested from peripheral axillary draining lymph nodes of microRNA 182 knockdown mice, on the other hand, demonstrated enhanced Treg polarization (Fig. 4D). Unaltered polarization frequencies of Th subsets other than Treg under microRNA 182 knocked down and Foxo1 silenced conditions suggest that Foxo1 might not be a core mediator of microRNA 182 regulation on T helper cells differentiation other than Treg cells (Fig. 4E). From these results we concluded that microRNA 182 suppressed differentiation to regulatory T cells (Treg) through Foxo1 dependent pathway both in vivo and in vitro in MOG 35-55 peptide induced EAE.
AC
Down-regulated of microRNA 182 in mice, both in vivo and in vitro, were unequivocally increased Treg proportions in the draining lymph nodes and spleen (Fig. 2E&2F&3D&3E). Treg cells could decrease the infiltration of self-antigen-specific-reactive CD4+T cells in CNS [14] and itself could also migrate into the CNS to inhibit Th1 and Th17 differentiation. It is likely that microRNA 182 regulates the specialization of T helper cell subsets over the influences of regulatory T cells. In other words, augmentation of autoimmune inflammation by microRNA 182 might be accomplished, by and large, via the inhibition of dominant tolerance, i.e., regulatory T cell development [21]. This, however, cannot exclude the direct influence of microRNA 182 on other T helper subsets. When we knocked down the expression of microRNA 182, the percentage of pro-inflammatory cytokines IFN-γ and IL-17 have no significantly changed, as the proportions of the corresponding cells Th1 and Th17 cells unaltered. However, at the same time, the percentage of CD4+CD25+Foxp3+ Treg cells was much higher in microRNA 182 knockdown mice than in WT mice at acute phase of EAE. Also in vitro experiments, the pro-inflammatory cytokine IFN-γ was decreased significantly, at the same time, the anti-inflammatory cytokine IL-4 was increased as the transcriptional factor Foxp3 was up-regulated when we knocked down the expression of microRNA 182 in CD4+T cells ex vivo (data were not shown). Nevertheless, only Treg cells were significantly up-regulated upon microRNA182 knockdown with Foxo1 silenced conditions whereas other T helper cells were not influenced (Fig. 4E). Furthermore, we isolated Treg cells to specifically examine microRNA 182
ACCEPTED MANUSCRIPT
T
and Foxo1 expressions. Results of the dynamic change of microRNA 182 and Foxo1 mRNA in CD4+CD25+Treg cells (Fig. 1E&1F&1G&1H) also showed same tendency with in total CD4+T helper cells, that is, both in CD4+CD25+Treg cells and in total CD4+T helper cells, microRNA 182 expressed highest at acute phase of EAE in peripheral lymphoid organs, and the dynamic change of Foxo1 mRNA showed negatively correlation with microRNA 182 expression simultaneously.
MA
NU
SC R
IP
In breast cancer cell, Foxo1 expression was repressed by microRNA 182 at the post -transcriptional level [11, 22]. Foxo1 was previously shown to repress Th17 development [23], and was found to be indispensable for the normal functioning of specialized regulatory T cells [14]. Here we confirmed that microRNA 182 regulated Treg cells differentiation through the transcriptional factor Foxo1 during the development of EAE. We demonstrated that polarization of Foxo1 deficient CD4+T cells displayed reduced differentiation towards Treg cells (Fig. 4C). However, there were possibilities that microRNA 182 might exert its regulation on Th cell specialization through targets other than Foxo1[24] and that during the development of EAE, microRNA 182 might have direct influences on the development of other subsets of the helper T cells, albeit a preference over regulatory T cells through Foxo1. The present study demonstrated higher sensitivity of Treg cells for microRNA 182 knocked down and Foxo1 deficiency (Fig. 4C&4E).
AC
CE P
TE
D
In brief, our study provided evidence that during the pathogenesis of EAE, microRNA 182 repressed CD4+T cells differentiation towards an anti-inflammatory direction through the Foxo1 dependent pathway and that levels of microRNA 182 might be indicative of severity of autoimmune inflammations. Results presented here also hints that the augmentation of MOG35-55 mediated inflammation by microRNA 182 might be achieved primarily via inhibition of regulatory T cells, thereby exerting an indirect influence over the differentiation of helper T cell subsets. Our data however, cannot rule out the impact of other immune cells on T cell differentiation, of particular notice, dendritic cells and B cells as microRNA 182 manipulation in this study was systemic not conditional in in vivo experiments. Nevertheless, in vivo results presented in this study suggest that microRNA-182-Foxo1 axis represents a new strategy for the management of multiple sclerosis and autoimmune inflammations per se.
ACCEPTED MANUSCRIPT 5. Conclusions In conclusion, we verified a positive correlation between the level of microRNA 182 and symptom severity of EAE in vivo study in animals. MicroRNA 182 knocked-down resulted in CD4+ T cells differentiation towards an anti-inflammatory profile post MOG35-55 immunization
T
and mitigated EAE. In vitro polarization experiments also observed increased proportion of Treg
IP
cells and elevated expression of Foxo1 following microRNA 182 silencing. Therefore, microRNA
SC R
182 inhibited Treg cells specialization through Foxo1 dependent pathway, during the pathogenesis
AC
CE P
TE
D
MA
NU
of EAE.
ACCEPTED MANUSCRIPT Acknowledgements
AC
CE P
TE
D
MA
NU
SC R
IP
T
This study was supported by the National Natural Science Foundation (81430035, 81171121 and 81371323), Key Laboratory of Myocardial Ischemia, Harbin Medical University, Chinese Ministry of Education (No.KF201202, No.KF201006 and No KF201203), National Natural Science Foundation Projects (No. C080102), and grants from department of education funding (No. Z2010008). The authors have no conflicting financial interests.
ACCEPTED MANUSCRIPT References [1] L. Belver, F.N. Papavasiliou, A.R. Ramiro, MicroRNA control of lymphocyte differentiation and function, Current opinion in immunology, 23 (2011) 368-373.
T
[2] R. Dai, S.A. Ahmed, MicroRNA, a new paradigm for understanding immunoregulation, inflammation, and autoimmune diseases, Translational research : the journal of laboratory and clinical
IP
medicine, 157 (2011) 163-179.
[3] C. Du, C. Liu, J. Kang, G. Zhao, Z. Ye, S. Huang, Z. Li, Z. Wu, G. Pei, MicroRNA miR-326 regulates
SC R
TH-17 differentiation and is associated with the pathogenesis of multiple sclerosis, Nature immunology, 10 (2009) 1252-1259.
[4] M. Guerau-de-Arellano, H. Alder, H.G. Ozer, A. Lovett-Racke, M.K. Racke, miRNA profiling for neuroimmunology, 248 (2012) 32-39.
NU
biomarker discovery in multiple sclerosis: from microarray to deep sequencing, Journal of [5] R.M. O'Connell, D. Kahn, W.S. Gibson, J.L. Round, R.L. Scholz, A.A. Chaudhuri, M.E. Kahn, D.S. Rao, D. Baltimore, MicroRNA-155 promotes autoimmune inflammation by enhancing inflammatory T cell
MA
development, Immunity, 33 (2010) 607-619.
[6] W. Pan, S. Zhu, D. Dai, Z. Liu, D. Li, B. Li, N. Gagliani, Y. Zheng, Y. Tang, M.T. Weirauch, X. Chen, W. Zhu, Y. Wang, B. Chen, Y. Qian, Y. Chen, J. Fang, R. Herbst, L. Richman, B. Jallal, J.B. Harley, R.A. Flavell, Y. Yao, N. Shen, MiR-125a targets effector programs to stabilize Treg-mediated immune homeostasis,
D
Nature communications, 6 (2015) 7096.
TE
[7] L.F. Lu, M.P. Boldin, A. Chaudhry, L.L. Lin, K.D. Taganov, T. Hanada, A. Yoshimura, D. Baltimore, A.Y. Rudensky, Function of miR-146a in controlling Treg cell-mediated regulation of Th1 responses, Cell, 142 (2010) 914-929.
CE P
[8] R. Hu, R.M. O'Connell, MicroRNA control in the development of systemic autoimmunity, Arthritis Res Ther, 15 (2013) 202.
[9] A.B. Stittrich, C. Haftmann, E. Sgouroudis, A.A. Kuhl, A.N. Hegazy, I. Panse, R. Riedel, M. Flossdorf, J. Dong, F. Fuhrmann, G.A. Heinz, Z. Fang, N. Li, U. Bissels, F. Hatam, A. Jahn, B. Hammoud, M. Matz,
AC
F.M. Schulze, R. Baumgrass, A. Bosio, H.J. Mollenkopf, J. Grun, A. Thiel, W. Chen, T. Hofer, C. Loddenkemper, M. Lohning, H.D. Chang, N. Rajewsky, A. Radbruch, M.F. Mashreghi, The microRNA miR-182 is induced by IL-2 and promotes clonal expansion of activated helper T lymphocytes, Nature immunology, 11 (2010) 1057-1062. [10] M. Hecker, M. Thamilarasan, D. Koczan, I. Schroder, K. Flechtner, S. Freiesleben, G. Fullen, H.J. Thiesen, U.K. Zettl, MicroRNA expression changes during interferon-beta treatment in the peripheral blood of multiple sclerosis patients, International journal of molecular sciences, 14 (2013) 16087-16110. [11] Y.M. Kerdiles, D.R. Beisner, R. Tinoco, A.S. Dejean, D.H. Castrillon, R.A. DePinho, S.M. Hedrick, Foxo1 links homing and survival of naive T cells by regulating L-selectin, CCR7 and interleukin 7 receptor, Nature immunology, 10 (2009) 176-184. [12] J.H. Paik, R. Kollipara, G. Chu, H. Ji, Y. Xiao, Z. Ding, L. Miao, Z. Tothova, J.W. Horner, D.R. Carrasco, S. Jiang, D.G. Gilliland, L. Chin, W.H. Wong, D.H. Castrillon, R.A. DePinho, FoxOs are lineage-restricted redundant tumor suppressors and regulate endothelial cell homeostasis, Cell, 128 (2007) 309-323. [13] J. Ma, Y. Ding, X. Fang, R. Wang, Z. Sun, Protein kinase C-theta inhibits inducible regulatory T cell differentiation via an AKT-Foxo1/3a-dependent pathway, Journal of immunology, 188 (2012)
ACCEPTED MANUSCRIPT 5337-5347. [14] Y.M. Kerdiles, E.L. Stone, D.R. Beisner, M.A. McGargill, I.L. Ch'en, C. Stockmann, C.D. Katayama, S.M. Hedrick, Foxo transcription factors control regulatory T cell development and function, Immunity, 33 (2010) 890-904. populations during infection, Nature immunology, 10 (2009) 457-458.
T
[15] E.D. Tait, C.A. Hunter, The Foxo and the hound: chasing the in vivo regulation of T cell
transcription, ANTIOXIDANTS & REDOX SIGNALING, (2011).
IP
[16] S.M.H. Anne S. Dejean, and Yann M. Kerdiles{, Highly specialized role of Forkhead box O
SC R
[17] S.M. Hedrick, R. Hess Michelini, A.L. Doedens, A.W. Goldrath, E.L. Stone, FOXO transcription factors throughout T cell biology, Nature reviews. Immunology, 12 (2012) 649-661. [18] W. Ouyang, M.O. Li, Foxo: in command of T lymphocyte homeostasis and tolerance, Trends in immunology, 32 (2011) 26-33.
NU
[19] M.M. Tejera, E.H. Kim, J.A. Sullivan, E.H. Plisch, M. Suresh, FoxO1 controls effector-to-memory transition and maintenance of functional CD8 T cell memory, Journal of immunology, 191 (2013) 187-199.
MA
[20] W. Ouyang, O. Beckett, Q. Ma, J.H. Paik, R.A. DePinho, M.O. Li, Foxo proteins cooperatively control the differentiation of Foxp3+ regulatory T cells, Nature immunology, 11 (2010) 618-627. [21] I.K. Guttilla, B.A. White, Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells, The Journal of biological chemistry, 284 (2009) 23204-23216.
D
[22] S.S. Myatt, J. Wang, L.J. Monteiro, M. Christian, K.K. Ho, L. Fusi, R.E. Dina, J.J. Brosens, S.
TE
Ghaem-Maghami, E.W. Lam, Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer, Cancer research, 70 (2010) 367-377. [23] C. Wu, N. Yosef, T. Thalhamer, C. Zhu, S. Xiao, Y. Kishi, A. Regev, V.K. Kuchroo, Induction of
CE P
pathogenic TH17 cells by inducible salt-sensing kinase SGK1, Nature, 496 (2013) 513-517. [24] S. Kelada, P. Sethupathy, I.S. Okoye, E. Kistasis, S. Czieso, S.D. White, D. Chou, C. Martens, S.M. Ricklefs, K. Virtaneva, D.E. Sturdevant, S.F. Porcella, Y. Belkaid, T.A. Wynn, M.S. Wilson, miR-182 and miR-10a are key regulators of Treg specialisation and stability during Schistosome and
AC
Leishmania-associated inflammation, PLoS pathogens, 9 (2013) e1003451.
ACCEPTED MANUSCRIPT Figure Legends
CE P
TE
D
MA
NU
SC R
IP
T
Fig. 1. MicroRNA 182 is upregulated in CD4+ T cells and CD4+CD25+ Treg cells at acute phase EAE whereas Foxo1 is downregulated. (A-M) Female C57BL/6 mice age 6 to 8 weeks were immunized subcutaneously with either myelin oligodendrocyte glycoprotein35-55 (MOG35-55) suspended in complete Freund’s adjuvant (CFA) or CFA alone. Mice received MOG35-55 administration were designated EAE group (n=4) whereas mice with CFA alone CFA group (n=4). (A) & (C) MicroRNA 182 and Foxo1 mRNA levels of CD4+ T cells harvested from axillary lymph nodes in EAE and CFA mice at day 7, day 14, day 21 post immunization. (B) & (D) MicroRNA 182 and Foxo1 mRNA levels of CD4+ T cells harvested from spleens in EAE and CFA mice at day 7, day 14, day 21 post immunization. (E) & (G) MicroRNA 182 and Foxo1 mRNA levels of CD4+CD25+ Treg cells harvested from axillary lymph nodes in EAE and CFA mice at day 7, day 14, day 21 post immunization. (F) & (H) MicroRNA 182 and Foxo1 mRNA levels of CD4+CD25+ Treg cells harvested from spleens in EAE and CFA mice at day 7, day 14, day 21 post immunization. (I) & (J)Foxo1 and Foxp3 protein levels of CD4+ T cells harvested from axillary lymph nodes in EAE and CFA mice at day 7, day 14, day 21 post immunization. (K) Foxp3 mRNA level of CD4+ T cells harvested from axillary lymph nodes and spleen in EAE and CFA mice at 14 days post immunization. (L) & (M) FACS analysis of Treg subset among CD4+ T cells isolated from the lymph nodes and spleens of EAE and CFA mice at 14 days post immunization. mRNA expression level were normalized against RNU6 for MicroRNA 182 and beta-actin for Foxo1 and Foxp3. Protein levels of Foxo1 and Foxp3 were normalized against TATA-binding protein (TBP). Error bars represent standard error of the mean (SEM); * P<0.05, **P<0.01, ***P<0.001.
AC
Fig. 2. MicroRNA 182 knockdown upregulates CD4+CD25+Foxp3+ Treg at acute phase EAE and renders resistance to MOG35-55 immunization in C57BL/6 mice. (A-F) Wild type (n=4) and MicroRNA 182 knockdown (n=4) female C57BL/6 mice age 6 to 8 weeks were immunized with MOG35-55 and sacrificed 14 days post immunization for the following experiments. (A) Quantitative polymerase chain reaction (qPCR) analysis of MicroRNA 182 among CD4+ T cells in the lymph nodes and spleen of wild type and MicroRNA 182 knockdown mice. (B) Clinical scores in wild type and MicroRNA 182 knockdown mice from day 0 to day 22 post MOG35-55 immunization. (C) & (D) qPCR analysis and western blotting studies of Foxo1 and Foxp3 levels in wild type and transgenic microRNA 182 knockdown mice. Proteins were collected from CD4+T cells from lymph nodes and spleen at 14 dpi. (E)&(F) FACS analysis of Treg subset among CD4+ T cells isolated from the lymph nodes and spleens of wild type and MicroRNA 182 knockdown mice. mRNA expression level were normalized against RNU6 for MicroRNA 182 and beta-actin for Foxo1 and Foxp3. Protein levels of Foxo1 and Foxp3 were normalized against TATA-binding protein (TBP). WT: wild type, KD: knockdown. Error bars represent standard error of the mean (SEM); * P<0.05, **P<0.01, ***P<0.001. Fig. 3. MicroRNA 182 knockdown increases Treg population differentiation in vitro. (A-G) CD4+ T cells were isolated from draining lymph nodes of myelin oligodendrocyte glycoprotein35-55 (MOG35-55) immunized female wild type C57BL/6 mice age 6 to 8 weeks 7 days post immunization. Isolated CD4+ T cells were infected with lentiviral vectors packaged with
ACCEPTED MANUSCRIPT
SC R
IP
T
microRNA182 5’ inhibitor or microRNA182 inhibitor oligomers. MOG35-55 was supplemented to the culture media together with lentiviruses or oligomers throughout the infection, before the following experiments were performed. (A) Quantitative polymerase chain reaction (qPCR) analysis of microRNA 182 expression in lentivirus infected CD4+ T cells verified the delivery efficacy of viral vectors. (B)&(C) qPCR analysis of Foxo1 and Foxp3 mRNA expression in lentivirus infected CD4+ T cells. (D) & (E) FACS analysis revealed enrichments of Treg cells. (F) qPCR analysis of microRNA 182 expression in oligomers infected CD4+ T cells verified the delivery efficacy. (G) qPCR analysis of Foxo1 and Foxp3 mRNA expression in oligomers infected CD4+ T cells. LV: lentiviral vector. NC: Negative Control. Error bars represent standard error of the mean (SEM); * P<0.05, **P<0.01, ***P<0.001.
AC
CE P
TE
D
MA
NU
Fig. 4. Foxo1 knockdown reduces Treg population in vitro. (A-E) CD4+ T cells were isolated from draining lymph nodes of female C57BL/6 mice age 6 to 8 weeks 7 days post myelin oligodendrocyte glycoprotein35-55 (MOG35-55) immunization. Isolated CD4+ T cells were cultured in MOG35-55 containing media with or without Foxo1 siRNA transfection for 48 hours. (A) FACS analysis decreased percentage of Treg in Foxo1 silencing CD4+ T cells. (B) Foxo1 silencing was accompanied by decreased expression of Treg transcriptional marker Foxp3 verified by qPCR and Western blotting. (C) FACS analysis of Treg post in vitro Foxo1 silencing and polarization. (D) FACS analysis of Treg post ex vivo polarization. CD4+ T cells were originated from peripheral lymph nodes of systemic microRNA182 knockdown mice. (E) FACS analysis of Treg post ex vivo Foxo1 silencing and polarization. CD4+T cells were originated from peripheral lymph nodes of systemic microRNA182 knockdown mice. mRNA levels of Foxo1 and Foxp3 were normalized against β-actin; protein levels of Foxo1 and Foxp3 were normalized against TATA-binding protein (TBP); WT: wild type, KD: knock down. Error bars represent standard error of the mean (SEM); * P<0.05, **P<0.01, ***P<0.001.
AC
Figure 1
CE P
TE
D
MA
NU
SC R
IP
T
ACCEPTED MANUSCRIPT
AC
CE P
TE
D
MA
NU
SC R
IP
T
ACCEPTED MANUSCRIPT
Figure 2
AC
CE P
TE
D
MA
NU
SC R
IP
T
ACCEPTED MANUSCRIPT
Figure 3
NU
SC R
IP
T
ACCEPTED MANUSCRIPT
AC
CE P
TE
D
MA
Figure 4