- Email: [email protected]
miR-181a promotes osteoblastic differentiation through repression of TGF-β signaling molecules
ARTICLE IN PRESS
G Model BC 3909 1–10
The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
Contents lists available at SciVerse ScienceDirect
The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel
miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules
1 2
3
Q1
4
Raghu Bhushan a , Johannes Grünhagen b , Jessica Becker a , Peter N. Robinson b,c,d , Claus-Eric Ott b , Petra Knaus a,c,∗
5
a
6
b
Institute for Chemistry and Biochemistry, Freie Universitaet Berlin, Berlin, Germany Institute for Medical and Human Genetics, Charité Universitätsmedizin Berlin, Berlin, Germany c Berlin-Brandenburg School for Regenerative Therapies, Charité Universitätsmedizin Berlin, Berlin, Germany d Max Planck Institute for Molecular Genetics, 14195 Berlin, Germany
7 8 9
a r t i c l e
10
i n f o
a b s t r a c t
11
Article history: Received 25 September 2012 Received in revised form 3 December 2012 Accepted 7 December 2012 Available online xxx
12 13 14 15
16
Osteoblastic differentiation is controlled by complex interplay of several signaling pathways and associated key transcription factors, as well as by microRNAs (miRNAs). In our current study, we found miR-181a to be highly upregulated during BMP induced osteoblastic differentiation of C2C12 and MC3T3 cells. Overexpression of miR-181a led to upregulation of key markers of osteoblastic differentiation as well as enhanced ALP levels and Alizarin red staining, indicating the importance of this miRNA for osteoblastic differentiation. Further, we show that miR-181 isoforms (181a, 181b, 181c) are expressed during different stages of mouse calvarial and tibial development, implying their role in both endochondral and intramembranous ossification. We found several direct and indirect targets of miR-181a to be downregulated by global mRNA expression profiling. Our results demonstrate that miR-181a promotes osteoblastic differentiation via repression of TGF- signaling molecules by targeting the negative regulator of osteoblastic differentiation Tgfbi (Tgf-beta induced) and TˇR-I/Alk5 (TGF- type I receptor). Furthermore, our findings suggest that Rgs4 and Gata6 are direct targets of miR-181a. Taken together, we provide evidence for a crucial functional link between a specific miRNA, miR-181a and osteoblastic differentiation. © 2012 Published by Elsevier Ltd.
24
Keywords: Osteoblastic differentiation miR-181a TGF-/BMP C2C12 cells MC3T3 cells Tibia Calvaria
25
1. Introduction
26
Studies on osteoblastic differentiation are essential to promote better understanding of the skeletal disorders associated with progressive degeneration of bone, such as osteoporosis and osteoarthritis. Arising from mesenchymal stem cells, osteoblasts play a fundamental role during bone formation and remodeling (Komori, 2006). There are several signaling pathways which are indispensable for the regulation of osteoblastic differentiation such as transforming growth factor (TGF-)/bone morphogenetic protein (BMP), Wnt/-catenin, Notch, and Hedgehog (Bandyopadhyay et al., 2006; Gaur et al., 2005; Hilton et al., 2008; Long et al., 2004). It is well known that BMPs promote ectopic bone formation (Sampath et al., 1987; Wang et al., 1988) and induce osteoblastic differentiation by activating Runx2 and Osterix (Ducy et al., 1997; Nakashima and de Crombrugghe, 2003). In contrast to the BMPs, TGF, another member of the same superfamily, inhibits osteoblastic maturation and differentiation (Maeda et al., 2004; Alliston et al., 2001).
17 18 19 20 21 22 23
27 28 29 30 31 32 33 34 35 36 37 38 39 40 41
Q2
∗ Corresponding author at: Institute for Chemistry and Biochemistry, Freie Universitaet Berlin, Berlin, Germany. Tel.: +49 30 838 52935; fax: +49 30 838 52936. E-mail address: [email protected] (P. Knaus).
In addition to the above mentioned signaling pathways, osteoblastic differentiation is also controlled by microRNAs (miRNAs). miRNAs are small ∼20–24 nucleotide single-stranded, non-coding RNAs which regulate gene expression by direct base pairing to 3 UTRs of specific mRNAs, thereby leading to either mRNA degradation or translational repression (Bae et al., 2012; Bartel, 2004). The importance of TGF/BMP signaling in miRNA regulation is well established. R-Smads were shown to play a key role in miRNA processing by interacting with the Drosha microprocessor subunit and thereby facilitating pre-miRNA accumulation, suggesting a general mechanism of R-Smads in miRNA processing (Davis et al., 2010, 2008). Recent studies have shown that miRNAs play important roles in regulating osteoblastic cell fate by controlling spatiotemporal expression of their target genes during osteogenesis (Lian et al., 2012). There are several miRNAs known to be involved in osteoblastic differentiation such as miR-34 family, the miR-93/sp7 feedback regulatory loop, and miR-182 (Bae et al., 2012; Wei et al., 2012; Yang et al., 2012; Kim et al., 2012). BMP2, an inducer of osteoblastic differentiation, has been shown to downregulate several miRNAs in the course of BMP2mediated osteoblastic differentiation. Negative regulation by BMP2
1357-2725/$ – see front matter © 2012 Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.biocel.2012.12.008
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64
G Model BC 3909 1–10
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
2
95
of the miRNAs such as miR-141, miR-200a, miR-208, and miR-370, removes their negative control on bone formation, by targeting key molecules such as Dlx5 and Ets1 thereby establishing commitment toward osteoprogenitor cell fate (Li et al., 2008; Itoh et al., 2009, 2010, 2012). In contrast, other miRNAs are upregulated during osteoblastic cell fate decision. For example, miR-210 is upregulated during BMP4-induced osteoblastic differentiation of bone marrow stromal cells (ST2 cells) promoting the osteoblastic differentiation process by downregulating Acvr1b expression (Mizuno et al., 2009). Additionally, expression levels of miR-20a and miR-29b targeting inhibitors of osteoblast differentiation such as PPAR␥, Bambi and Crim1 were reported to increase during osteoblastic differentiation (Zhang et al., 2011b; Li et al., 2009). Previous studies have shown that miR-181 is upregulated during rat articular cartilage development, pathogenesis of osteosarcomas as well as differentiation of B-cells and muscle cells (Chen et al., 2004; Jones et al., 2012; Naguibneva et al., 2006; Sun et al., 2011). In this study, we aimed to understand the role of miR-181a during the process of osteoblast differentiation. We demonstrate that miR-181a is upregulated during BMP2 or BMP6 mediated osteogenic induction of C2C12 and MC3T3 cells in vitro, and during development of mouse tibia and calvaria in vivo. Furthermore, we show that miR-181a promotes the osteoblastic differentiation process. To functionally characterize miR-181a and identify its targets, we performed mRNA expression profiling and identified Tgfbi, TˇR-I, Rgs4 and Gata6 as direct targets. Taken together, our results demonstrate that one of the mechanisms by which miR181a positively regulates osteoblastic differentiation is by means of repression of TGF- signaling molecules.
96
2. Materials and methods
97
2.1. Cell culture
98
Different cell systems from mouse have been used in these studies such as C2C12 mesenchymal precursor cells, MC3T3 preosteoblasts and primary calvaria osteoblasts. A detailed description of different cell culturing conditions is provided in supplementary methods.
65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94
99 100 101 102
103
104 105 106 107 108 109 110 111 112 113
2.2. Tissue preparation Tibia and calvaria samples were harvested from male newborn (24 h) C57BL/6 wildtype mice aged between 1 and 6 weeks. Tissue attached to the tibiae and calvaria samples was chopped, diaphyses removed, tibiae were flushed and rinsed in phosphatebuffered saline (PBS) solution to remove bone marrow and blood. Immediately, samples were shock-frozen in liquid nitrogen. Calvariae and tibiae from each mouse were pulverized and directly dissolved in RNAPure (PeqLab). Total RNA was isolated using phenol/chloroform extraction. RNA integrity was confirmed using the Agilent RNA 6000 Nano Kit.
114
2.3. miRNA mimics transfections
115
120,000–150,000 MC3T3 cells were plated in 6-well plates with alphaMEM medium (Invitrogen) containing 10% FCS, 1 mM glutamine, penicillin (100 Units/ml) and Streptomycin (10 g/ml) (PAA). On the next day, cells were transfected with scrambled Cy3 dye-labeled negative control mimics (25 nM) or miR-181a mimics (25 nM) (Ambion) using RNAiMAX lipofectamine (Invitrogen). On the following day, cells were serum starved in 2% serum for
116 117 118 119 120 121
2 h followed by stimulations with BMP2 (25 nM) and lysates from respective time points were collected.
122
2.4. miRNA microarray
124
C2C12 cells were seeded and stimulated with BMP6 (10 nM). Total RNA was isolated at 6 h and 1 day using Trizol and quantitated using Nanodrop (ND-1000 Spectrophotometer). RNA integrity was assessed using the Agilent RNA 6000 Nano Kit and Agilent 2100 Bioanalyzer. Subsequently, 300 ng of total RNA was hybridized onto the Agilent Mouse miRNA microarrays (8× 15k, Part number G4472B, Sanger version 12, with 627 targeted miRNAs) following manufacturer’s instructions. The miRNA expression data was processed and normalized using Agilent’s Genespring software.
125
2.5. Northern blotting
134
Total RNA was isolated from C2C12 cells or MC3T3 cells stimulated with BMP2 or BMP6 using Trizol (Invitrogen). 20–30 g total RNA was loaded onto 15% TBE urea gel, transferred to Hybond-XL nylon membrane (Amersham Biosciences), UV cross linked followed by hybridization. To confirm equal loading the gel was stained with ethidium bromide (EtBr) and tRNA was used as loading control. The specific miR-181a probe (5 ACTCACCGACAGCGTTGAATGTTC 3 ) was 5 end labeled with [␥-32 P] ATP along with T4 polynucleotide kinase (Fermentas) and hybridized to the membranes using ultrahyb oligo-hyb buffer (Ambion). This was followed by washing, developing and scanning of the films (Amersham Hyperfilm ECL).
135
2.6. Quantitative PCR
147
Total RNA was isolated using Trizol (Invitrogen) and miRNAs were reverse transcribed using Taqman reverse transcription kit (ABI). Mature miRNA species were detected by quantitative PCR using a commercially available Taqman assay system (ABI) as described by the manufacturer. SnoRNA135, U6RNA, and SnoRNA202 were used as normalizing controls. For gene expression analysis, total RNA was isolated using NucleoSpin RNA II Isolation Kit (Machery-Nagel) as per the manufacturer’s instructions. Reverse transcription was performed using M-MLV transcriptase (Promega). Real-time PCR was carried out using SYBR Green mix (ABI). The mouse sequence-specific primers are listed in supplementary methods. The Ct method was used for quantifying gene expression relative to HPRT or GAPDH.
148
2.7. Alkaline phosphatase (ALP) assay
161
Standard procedure was followed for the ALP assay. Details are provided in supplementary methods.
162
2.8. Alizarin red staining
164
Cultured cells were rinsed twice with PBS and allowed to airdry. Dried cells were covered with 1 ml Alizarin red solution (2%, pH 4.5) and stained at RT for 30 min Mineral deposition appeared red after washing wells three times with water. In order to quantify Alizarin red staining, mineral-bound Alizarin red was extracted with 1 ml of 10% cetylpyridinium chloride per well at 37 ◦ C. 100 l of extracted dye was mixed with 100 l PBS and absorbance was spectrophotometrically quantified at 570 nm for triplicate wells.
165
2.9. Global mRNA expression profiling
173
Global mRNA expression profiling was performed in MC3T3 cells after transfecting with miR-181a mimics (25 nM) or scrambled
174
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
123
126 127 128 129 130 131 132 133
136 137 138 139 140 141 142 143 144 145 146
149 150 151 152 153 154 155 156 157 158 159 160
163
166 167 168 169 170 171 172
175
G Model BC 3909 1–10
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
183
control (miR-SC) mimics (25 nM) overnight. Also, untransfected controls were maintained. Next day, the cells were serum starved in 2% serum for 2 h, followed by stimulations with BMP2 (25 nM). 400 ng total RNA was extracted at 1 day subjected to mRNA expression profiling using MouseRef-8 v2.0 Expression BeadChips (BD-202-0202, Illumina). The experiment was performed in duplicates as per the manufacturer’s instructions. Further details are provided in supplementary methods.
184
2.10. DNA constructs and luciferase assays
176 177 178 179 180 181 182
185 186 187 188 189 190 191 192 193 194 195
3
The regions of the Tgfbi, TˇR-I, Rgs4 and Gata6 UTRs that flank the miR-181a binding sites were PCR amplified from genomic DNA and the PCR amplified fragments were cloned between SpeI and HindIII sites of pMIR-REPORT vector (Ambion). The primer sequences are provided in supplementary methods. C2C12 cells were cultured in 24-well plates and co-transfected with corresponding UTR reporter construct (100 ng) along with Renilla vector (40 ng) and scrambled control (25 nM) or miR-181a mimics (25 nM) using Lipofectamine 2000 (Invitrogen). On the next day, medium was replaced, and luciferase activity was measured 48 h post transfection. Luciferase activity was calculated as the ratio of Firefly to
3
Renilla. Results are mean ± s.d. of duplicate measurements, representative of two or three independent experiments as indicated.
196 197
2.11. Western blots
198
Cells were washed with PBS, lysed in SDS sample buffer and subjected to SDS-PAGE and transferred to Nitrocellulose membranes following standard western blotting procedure. The primary antibodies used in the studies are as follows: -actin (#AC-15, Sigma–Aldrich), Tgfbi/IG-H3 (#2719, Cell Signaling), Tgfbr-I (sc9048, Santa Cruz), and Id1 (sc-488, Santa Cruz).
199
3. Results
205
3.1. Upregulation of miR-181a after osteogenic induction of C2C12 and MC3T3 cells
206
To identify miRNAs with a potential role during osteoblastic differentiation, we induced differentiation of C2C12 (mouse precursor myoblast cells) and MC3T3 cells (mouse preosteoblast cells) into the osteogenic lineage by stimulating with BMP2 or BMP6. First
208
Fig. 1. Induction of miR-181a during the osteoblastic differentiation of C2C12 and MC3T3 cells. (A) Induction of miR-181a expression upon BMP6 (10 nM) stimulation in C2C12 cells at the indicated time points (hrs: hours, d: days) by miRNA microarrays (Agilent). Mean normalized signal intensities were plotted. (B) and (C) Northern blot was performed on total RNA isolated from (B) BMP6 (10 nM) stimulated or unstimulated C2C12 cells at the indicated time points (d: days, min: minutes). (C) C2C12 cells following two different cell fate changes, osteogenic differentiation and myogenic. tRNA bands were used as loading control. (D) and (E) miR-181a expression was measured by Taqman assays, performed in (D) C2C12 and (E) MC3T3 cells, stimulated with BMP2 (50 nM). Expression of miR-181a was normalized against SnoRNA135 and fold change was calculated.
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
200 201 202 203 204
207
209 210 211
G Model BC 3909 1–10 4 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242
243 244
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
we confirmed the osteogenic potential of both cell types (C2C12 and MC3T3) in our culture conditions. For C2C12 cells, high induction of ALP (alkaline phosphatase) levels was observed following stimulation with BMP6 or BMP2 as compared to untreated control (Supplementary Fig. 1A). Using qRT-PCR, we additionally confirmed induction of the key osteoblastic marker genes Runx2 and Osterix (Sp7) (Supplementary Fig. 1B). The osteogenic potential of MC3T3 cells stimulated with BMP2 was ascertained by the expression of the osteoblastic differentiation markers Alkaline phosphatase (Alpl), Bone sialoprotein (Ibsp), Osteocalcin (Bglap), Id1, and Sp7 within 3 days (Supplementary Fig. 1C). For the identification of differentially regulated miRNAs we employed miRNA microarrays after osteogenic induction of C2C12 cells with BMP6 and found miR-181a to be significantly upregulated after 24 h (Fig. 1A). We validated the increased expression of miR-181a by Northern blots on RNA isolated at different time points of osteoblastic differentiation and found miR-181a expression to be even stronger at late stages (d3) (Fig. 1B). It has been reported that miR-181a is upregulated during myogenic differentiation, thereby establishing muscle phenotype (Naguibneva et al., 2006). We differentiated C2C12 cells into both osteogenic (serum starvation + BMP2) or myogenic (serum starvation − BMP2) lineages and confirmed its expression in both lineages (Fig. 1C). Furthermore, we performed Taqman assays following BMP2 stimulation in C2C12 and MC3T3 cells at different time points and observed that miR-181a expression was also robustly enhanced during late stages (d3–d6) of osteoblastic differentiation (Fig. 1D and E). Thus by employing two different cell systems and also stimulating them with defined growth factors (BMP2 or BMP6), we show that miR-181a is highly upregulated, suggesting that miR-181a is an important player in regulating osteogenic cell fate. 3.2. Different miR-181 isoforms are induced during endochondral and intramembranous ossifications
263
Intramembranous ossification is limited to the skull or parts of the clavicle while endochondral ossification gives rise to the rest of the skeleton (Long, 2012). To understand the regulation of the three miR-181 isoforms (181a, 181b, and 181c) during these two types of bone formation, we investigated their expression by Taqman assay in samples from calvarial and tibial bone over a time course. We observed increasing expression of miR-181 (181a, 181b, 181c) in trabecular bone from mouse tibia from day 7 to day 35 (Fig. 2A). In calvarial tissue isolated from mice at different stages, ranging from embryonic day E17.5 to 5 months postnatal, we observed miR-181 isoforms to be increased in expression from day 0 to day 42, followed by a slight decrease in aged mice, i.e. 5 months (Fig. 2B). Additionally, we confirmed the expression of miR-181 family in primary calvarial osteoblasts (pCOBs) during different stages of in vitro osteoblastic differentiation and found that the miR-181 family was highly expressed at late stages of osteoblastic differentiation (Fig. 2C). Taken together, we confirmed the expression of miR-181 isoforms in tibia and calvarial tissues in vivo as well as during in vitro differentiation.
264
3.3. miR-181a promotes osteoblastic differentiation
265
To address the functional relevance of miR-181a during osteoblastic differentiation, we performed overexpression experiments by transfecting primary calvarial osteoblasts (pCOBs) and MC3T3 cells with miR-181a or corresponding scrambled control. Transfection of miR-181a in pCOBs slightly enhanced Alizarin red staining at day 6 and day 9, compared to the scrambled negative control (Fig. 3A). We could also observe that miR-181a expression led to significant induction of ALP activity, an early marker of osteoblastic differentiation, compared to miR-455 (a
245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262
266 267 268 269 270 271 272 273
Fig. 2. miR-181 isoforms (181a, 181b, 181c) are induced during both endochondral and intramembranous ossification. (A) and (B) The expression of miR-181 family in in vivo mouse tibial, calvarial and primary calvarial osteoblasts (pCOBs). Total RNA was isolated at different stages of (A) tibial development, (B) calvarial development and in (C) pCOBs, followed by quantification of miR-181 family expression using Taqman assays and normalizing against endogenous SnoRNA202. For pCOBs, an additional control miRNA, miR-21 was also assayed for its expression.
negative control miRNA) and scrambled control (Fig. 3B). Overexpression of miR181a in MC3T3 cells with BMP2 stimulation led to significant enhancement in ALP levels and induction of key osteoblastic marker genes such as Sp7, Alpl, Bglap, and Spp1 (Fig. 3C–F, Supplementary Fig. 3A). In the presence of BMP2, miR181a also led to increased mRNA and protein levels of Id1, an early target of BMP signaling (Supplementary Fig. 3A and B). In the absence of BMP2, miR181a overexpression induced Alpl and Id1 expression (Supplementary Fig. 3C and D). These findings demonstrate that miR-181a promotes osteoblastic differentiation of preosteoblasts and primary calvarial osteoblasts.
274
3.4. Downregulation of several genes upon overexpression of miR-181a
285
To investigate the targets of miR-181a during the process of osteoblastic differentiation, we performed mRNA expression profiling. Since we were interested in identifying novel targets of miR-181a during osteoblastic differentiation, MC3T3 cells were transfected with miR-181a or scrambled control mimics. The following day, cells were stimulated with BMP2 for 24 h and isolated RNA was subjected for microarray analysis. Hierarchical clustering based on gene expression and linear correlation coefficients between samples on whole data suggested an expected segregation of control, miR-SC + BMP2 and miR-181a + BMP2 samples (Supplementary Fig. 4A and B). Genes that were detected with significant regulations in all the samples were considered (detection
287
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
275 276 277 278 279 280 281 282 283 284
286
288 289 290 291 292 293 294 295 296 297 298
G Model BC 3909 1–10
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
5
Fig. 3. miR-181a promotes osteoblastic differentiation. (A) Alizarin red stainings were executed in primary calvarial osteoblasts (pCOBs), transfected with scrambled control mimics (miR-SC) (25 nM) or miR-181a (25 nM). For ARS quantification (see Section 2). A representative image from 3 independent experiments is shown. (B) ALP assay in pCOBs. pCOBs were transfected with scrambled control mimics (25 nM) or miR-181a (25 nM) and ALP levels were assessed at indicated time points. (C) ALP assay in MC3T3 cells stimulated with BMP2 (25 nM). MC3T3 cells were transfected with scrambled control (25 nM; light gray bars) or miR-181a (25 nM; black bars), followed by BMP2 (25 nM) stimulations. ALP levels were measured at indicated time points. BMP2 stimulated cells (gray bars) were used as controls. (D)–(F) qRT-PCRs of osteoblastic markers in BMP2 (25 nM) stimulated MC3T3 cells upon transfection with miR-181a (25 nM; black bars) or scrambled control mimics (25 nM; light gray bars) followed by BMP2 (25 nM) stimulation. Fold changes in osteoblastic markers, Sp7, Alpl, and Bglap were quantified at indicated time points. BMP2 stimulated cells (gray bars) were used as control.
299 300 301 302 303 304 305 306 307 308
p-value p < 0.05) for further analysis (see supplementary methods). To filter out BMP2-regulated genes in treatments miR-SC + BMP2 or miR-181a + BMP2 and to identify the miR-181a downregulated genes, we filtered our dataset with a cutoff of 1.2 fold regulation, relative to control. We identified 78 genes common between the miR-181a + BMP2-downregulated list (898 genes) and miRSC + BMP2-upregulated list (230 genes) (detection p-value p < 0.05, ANOVA p < 0.05) (Fig. 4A, Supplementary Tables 1–3). These 78 genes comprised of genes that were exclusively downregulated by miR-181a alone. The fold-changes of a subset of 29 genes from
this list (78 genes), that were more than 1.5 fold upregulated in miR-SC + BMP2 have been represented as heat map in Fig. 4B (complete list in Supplementary Table 3). Among the most significantly downregulated genes, we found Tgfbi, TGF--induced extracellular matrix (ECM) protein, a known negative regulator of osteoblastic differentiation to be the most promising target (Thapa et al., 2005). Other potential targets we identified were Grem2, a BMP antagonist (Ideno et al., 2009), Rgs4, a regulator of G protein signaling and a negative regulator of insulin release (Ruiz de Azua et al., 2010), Gadd45b, a pro-apoptotic factor and a downstream responsive gene
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
309 310 311 312 313 314 315 316 317 318
G Model BC 3909 1–10 6
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
Fig. 4. Downregulation of several genes upon overexpression of miR-181a. Global mRNA expression profiling was performed in MC3T3 cells after transfection with miR181a (25 nM) or scrambled control (miR-SC) (25 nM) overnight. Also, untransfected and unstimulated cells were maintained. Expression profiles were analyzed relative to control. All experiments were performed in duplicates. (A) Venn diagram between the upregulated genes in miR-SC + BMP2 sample and downregulated genes in miR181a + BMP2 sample. The genes significantly detected in both samples were taken under consideration (p < 0.05). (B) Heatmap depicting a subset of the overlap between Q6 the significantly downregulated genes in miR-181a + BMP2 and significantly upregulated genes in miR-SC + BMP2. The heatmap is colored based on the log 2 fold change (detection p-value < 0.05; entire gene list is depicted in Supplementary Table 3). (C) Validation of downregulated genes from microarray experiments using qRT-PCR. MC3T3 cells were transfected with miR-181a (25 nM) or scrambled control (25 nM), followed by BMP2 (25 nM) stimulation for 1 day. qRT-PCRs were performed and fold changes calculated. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
319 320 321 322 323 324 325 326 327 328 329 330 331 332 333
of TGF- signaling (Takekawa et al., 2002; Major and Jones, 2004), Thsb3, Thrombospondin 3, an ECM protein (Posey et al., 2008), Crim2, a suppressor of TGF- and an enhancer of BMP signaling (Lin et al., 2005, 2006), Irf5, involved in immune response and tumor suppression (Yanai et al., 2007) and Gata6, an evolutionarily conserved transcription factor, highly expressed in heart and gut (Nemer and Nemer, 2003) (Fig. 4B). To prove the reliability of our data we successfully validated a subset of genes by qRTPCRs and observed that indeed the microarray data was in line with qRT-PCR validation (Fig. 4C). To ascertain, if these targets could be directly or indirectly targeted by miR-181a, we overlapped the 78 miR-181a downregulated genes to the TargetScan database (Lewis et al., 2005; Friedman et al., 2009) and found that 21 genes contained either conserved or non-conserved binding sites for miR181a (Table 1). Taken together, upon transfection with miR-181a,
we could detect downregulation of several genes during osteoblastic differentiation and identified possible direct and indirect targets of miR-181a.
334
3.5. miR-181a directly targets TGF-ˇ signaling molecules Tgfbi and TˇR-I
337
The 3 UTR of the negative regulator of osteoblastic differentiation, Tgfbi contains a predicted non-conserved binding site for miR-181a (TargetScan; Fig. 5A). To confirm the functionality of this binding site, the 3 UTR region was cloned into pMIR-REPORT luciferase vector (Ambion). Furthermore, we generated a 3 UTR mutant, by altering the nucleotides in the seed sequence (Fig. 5A). Upon co-transfecting Tgfbi-UTR-wt (wild type) with either miR-181a mimics or scrambled control, we observed
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
335 336
338
339 340 341 342 343 344 345 346
ARTICLE IN PRESS
G Model BC 3909 1–10
R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
7
Table 1 miR181a downregulated genes from microarray data which are predicted (TargetScan) to contain miR-181a bindings sites.
347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388
Gene symbol
Gene name
Conserved
Non-conserved
Trim3 Dlk2 Ippk Ids Hapln4 Ank Cdr2 Slc35a2 Taf9b Dclk1 Tgfbi Grem2 Mmab Pqlc3 Prkcd Phtf2 Pi4k2b Myo9b Mcoln1 Runx1 Rsad1 Rgs4 Gata6
Tripartite motif-containing 3 Delta-like 2 homolog (Drosophila) Inositol 1,3,4,5,6-pentakisphosphate 2-kinase Iduronate 2-sulfatase Hyaluronan and proteoglycan link protein 4 Progressive ankylosis Cerebellar degeneration-related 2 Solute carrier family 35 (UDP-galactose transporter), member A2 TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor Doublecortin-like kinase 1 Transforming growth factor, beta induced Gremlin 2 homolog, cysteine knot superfamily (Xenopus laevis) Methylmalonic aciduria (cobalamin deficiency) type B homolog (human) PQ loop repeat containing Protein kinase C, delta Putative homeodomain transcription factor 2 Phosphatidylinositol 4-kinase type 2 beta Myosin IXb Mucolipin 1 Runt related transcription factor 1 Radical S-adenosyl methionine domain containing 1 Regulator of G-protein signaling 4 GATA binding protein 6
1 0 1 0 0 0 0 0 0 1 0 0 0 0 1 1 1 0 0 1 0 0 1
0 1 2 2 2 1 1 1 1 3 1 1 1 1 0 2 0 1 1 1 6 2 0
reduced Tgfbi-UTR-wt firefly luciferase activity by miR-181a mimics, when compared to miR-SC. Transfection of miR-223 which has no predicted binding site in the 3 UTR of Tgfbi further confirmed specificity for miR-181a regulation. Co-transfecting the miR-181a with Tgfbi-UTR-mut, the mutant construct, abolished the inhibitory effect, emphasizing that miR-181a directly interacts with Tgfbi 3 UTR (Fig. 5B). To assess Tgfbi protein levels, we transfected the preosteoblast MC3T3 cells with miR-181a or scrambled control under BMP2 conditions and performed western blots. Interestingly, we observed reduction in protein levels in the samples transfected with miR-181a + BMP2 compared to miR-SC + BMP2 (Fig. 5C). Thus we conclude that miR-181a promotes osteoblastic differentiation at least in part by directly suppressing Tgfbi expression. It was shown previously that Tgfbi expression is promoted by activated TGF- type I receptor (TR-I) (Ota et al., 2002). Additionally it is also known that TGF- inhibits the osteoblastic differentiation by suppressing the expression of CBFA1 through Smad3 (Alliston et al., 2001). Using TargetScan, we found a conserved and a non-conserved binding site for miR-181a in the 3 UTR of TR-I (Fig. 5D). We confirmed the reduction in protein levels of TR-I upon miR-181a transfection in preosteoblasts and C2C12 cells both stimulated with BMP2 (Fig. 5E). In line with our findings, it has recently been shown that miR-181a impedes TGF- signaling by downregulating the TR-I in MSCs derived from the Preeclampsia patients (Liu et al., 2012). Taken together, we show evidence that miR-181a promotes osteoblastic differentiation by targeting the TGF- signaling molecules TR-I and Tgfbi. Next we analyzed Rgs4 (regulator of G protein signaling) and Gata6 as potential targets of miR-181a. Of note, decreasing expression of Rgs4 at late stages of osteoblastic differentiation has been described (Teplyuk et al., 2008), which inversely correlates with the miR-181a expression shown here. To further analyze miR-181a mediated downregulation of Rgs4, we identified two non-conserved putative miR-181a binding sites in the 3 UTR of Rgs4 (TargetScan, Supplementary Fig. 5A). Using a reporter construct similar to the one described for Tgfbi we confirmed functionality of this binding site and specificity for miR181a (Supplementary Fig. 5B). We pursued Gata6 although its possible role in osteoblastic differentiation needs further investigation. Gata6 contains a single predicted conserved binding site (TargetScan; Supplementary Fig. 5C) and upon performing the luciferase assay with Gata6-UTR cotransfected with miR-181a, we
observed a reduction in Gata6 reporter UTR activity when compared to scrambled negative control or miR-223 (Supplementary Fig. 5D). Our results demonstrate that miR-181a directly targets Tgfbi and TR-I (both TGF- signaling molecules) in addition to Rgs4 and Gata6.
389
4. Discussion
394
In our current study we provide evidence for miR-181a to be a positive regulator of osteoblastic differentiation by downregulating the TGF- signaling molecules, TR-I and Tgfbi. We also identified Rgs4 and Gata6 as direct targets of miR-181a. The induction of miR-181a was found to be enhanced during late stages of osteoblastic differentiation (Figs. 1 and 2). Analogous to our observation, miR-181 was shown to be highly upregulated during myogenic differentiation (Naguibneva et al., 2006). Therefore, the role of miR181a seems to be conserved in muscle and bone tissues possibly due to their common origin, the paraxial mesoderm. We clearly show that miR-181a promotes osteoblastic differentiation (Fig. 3). To decipher the functional role of miR-181a and understand miR-181a regulated gene networks, we employed global genome expression profiling in BMP2-stimulated MC3T3 cells (24 h) after overexpression of miR-181a. The most significantly downregulated genes included Tgfbi (Fig. 4), an ECM protein induced by TGF- and a negative regulator of osteoblastic differentiation (Thapa et al., 2007) that is decreased during the differentiation (Thapa et al., 2005). Using complementary approaches, we show that Tgfbi is a direct target of miR-181a. TGF- inhibits osteoblastic differentiation (Alliston et al., 2001) and inhibition of TGF- type-I receptor enhances osteoblastic differentiation in MC3T3 and C2C12 cells (Maeda et al., 2004; Takeuchi et al., 2010). Interestingly our results indicate TR-I/ALK5 as a possible direct target of miR-181a in MC3T3 cells (Fig. 5D and E). Complementary to our findings, recently Liu et al. (2012), reported that miR-181a inhibits TGF- signaling by directly targeting TR-I in MSCs isolated from preeclampsia patients. Moreover, we found Gadd45b, a proapoptotic factor and an immediate early response gene of TGF- signaling (Yoo et al., 2003) as a possible target of miR-181a (microarray, qRT-PCR data) (Fig. 4B and C). However, we could not detect any predicted binding sites for miR-181a in the Gadd45b 3 UTR. Apart from the 3 UTRs, microRNA are known to target coding regions or 5 UTRs (Tay et al., 2008; Lee et al., 2009). Here we
395
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
390 391 392 393
396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428
G Model BC 3909 1–10 8
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
Fig. 5. miR-181a directly targets TGF- signaling molecules Tgfbi and TR-I. (A) Putative binding site for miR-181 in Tgfbi 3 UTR as predicted by TargetScan, DIANA-microT. Mutated nucleotides in mutant Tgfbi 3 UTR seed sequence are represented in blue. (B) Luciferase reporter assays in C2C12 cells. Cells were co-transfected with Tgfbi-UTRwt (wild type) or Tgfbi 3 UTR-mut (mutant) reporter construct or scrambled control (25 nM) or miR-181a mimics (25 nM) for overnight. 48 h post transfection luciferase activities were calculated as ratio of Firefly to Renilla. Results are mean ± s.d. of duplicate measurements, representative of 3 independent experiments. (C) Tgfbi western blots in MC3T3 cells. Cells were transfected with scrambled control (25 nM) or miR-181a mimics (25 nM) for overnight, followed by BMP2 (25 nM) stimulations for 1 day. Protein lysates were harvested and western blots performed. -Actin was used as loading control. (D) Putative binding sites for miR-181 in TR-I 3 UTR as predicted by TargetScan. (E) TR-I western blots in C2C12 and MC3T3 cells. Protein lysates were prepared as mentioned in (C). BMP2 stimulations were performed for 1 day for MC3T3 and 30 min for C2C12 cells. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.) 429 430 431 432 433 434 435 436
speculate that prediction tools could have either missed the miR181a binding sites in the 3 UTR of Gadd45b or miR-181a might be targeting the Gadd45b coding regions or 5 UTR (needs further investigation) Another possibility is that miR-181a might indirectly regulate Gadd45b levels by controlling the levels of TR-I. From our results it can be concluded that miR-181a might directly control the expression of both Tgfbi and TR-I, deciphering its possible role in regulating TGF- signaling.
Furthermore, miR-181 expression was reported to be induced by Wnt/-catenin signaling and putative -catenin/Tcf4 binding sites were found in the promoter region of the microRNA-181a2 transcript in hepatocellular carcinomas (Ji et al., 2009, 2011). In our preliminary data, we observed miR-181a to be upregulated by Wnt3a in MC3T3 cells (data not shown). There have been reports suggesting the promotion of Wnt signaling during osteoblastic differentiation by miRNAs that target Wnt antagonists (Kapinas et al.,
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
437 438 439 440 441 442 443 444
G Model BC 3909 1–10
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497
2010; Zhang et al., 2011a). Nemo like kinase (NLK) and Dickkopf 1 (Dkk1) are the predicted targets of miR-181a (TargetScan). Taken together, one of the mechanisms by which Wnt signaling promotes osteoblastic differentiation could be the induction of miR-181a that directly controls the expression of Tgfbi as a negative regulator of osteoblastic differentiation. This suggests that miR-181a could be an important link between Wnt and TGF- signaling during osteoblastic differentiation. MiR-181a suppresses the expression of Gata6 suggesting a mechanism of maintaining stemness of hepatic stem cells (Ji et al., 2009). We confirmed the miR-181a mediated downregulation of Gata6 in osteoblasts (Fig. 4B and C, Supplementary Fig. 5D). The role of Gata6 during osteoblastic differentiation is unclear, however it was shown to be strongly expressed in committed primary chondrocyte precursors (Alexandrovich et al., 2008). It has been proposed that Gata6 might act upstream of Grem1, controlling osteo-chondral bipotency by means of a high-affinity consensus binding sequence of Gata6 in the Grem1 promoter (MacArthur et al., 2008). Here, we show that upon overexpression of miR-181a, Grem2 was downregulated. Both Grem1 and Grem2 negatively regulate osteoblastic differentiation by opposing BMP effects in vitro (Gazzerro et al., 2005; Ideno et al., 2009). Given that miR-181a is induced during osteoblastic differentiation and promotes the process (Fig. 1), its possible role in doing so could be the inhibition of the BMP antagonists, Grem1 (via Gata6) and Grem2 and the direct suppression of Gata6 (Fig. 4B and C) thereby controlling osteo-chondral bipotency. Further, we show Rgs4 (regulator of G protein signaling) to be another miR-181a-downregulated target (Fig. 4B and C, Supplementary Fig. 5B). Rgs4 negatively regulates insulin release in pancreatic- cells (Ruiz de Azua et al., 2010). In relevance to osteoblast cell fate, consistent diminishing expression of Rgs4 at late stages of osteoblastic differentiation in MC3T3 cells has been observed (Teplyuk et al., 2008). Our results indicate that decreasing expression of Rgs4 during osteoblastic differentiation correlates with increasing miR-181a levels in MC3T3 cells (Fig. 1B–E). Hence, in an osteoblastic context, we speculate that the other mechanism by which miR-181a promotes osteoblastic differentiation might be by suppressing the levels of Rgs4. Apart from the miRNA targets we identified and validated from our miR181a overexpression microarray data, we believe that there could be several other important targets, which miR-181a might be regulating that could be crucial in establishing and maintaining the osteo-phenotype. In summary, we show that miR-181a is highly upregulated during osteogenesis, promotes osteoblastic differentiation and could be an important player for maintenance of osteoblast cell fate. Our results also suggest that miR-181a might act as a link between TGF- and Wnt signaling pathways. Furthermore, we propose a mechanism by which a specific microRNA, miR-181a co-suppresses Tgfbi, Tgfbr-I, Rgs4, and Gata6 in the osteoblastic lineage. This study provides an essential operational link between microRNAs and the osteoblast phenotype.
498
Acknowledgements
499
We thank Stefan Mundlos and Richard Reinhardt (Max Planck Institute for Molecular Genetics) for allowing us to access the microarray central facility for our microarray experiments. We are grateful to Aydah Sabah, Johanna Scholz, and Gisela Wendel for their technical support. We thank Jan Börgermann for critically reading the manuscript. We acknowledge the support of our funding agencies: SFB-760 (to PK), DFG grant Mu880/11-01 (to PNR), Center for International Cooperation and DRS (Freie Universität, Berlin).
500 501 502 503 504 505 506 507
9
Appendix A. Supplementary data Supplementary data associated with cle can be found, in the online http://dx.doi.org/10.1016/j.biocel.2012.12.008.
508
this artiversion, at
509 510 511
References
512
Alexandrovich A, Qureishi A, Coudert AE, Zhang L, Grigoriadis AE, Shah AM, et al. A role for GATA-6 in vertebrate chondrogenesis. Developmental Biology 2008;314:457–70. Alliston T, Choy L, Ducy P, Karsenty G, Derynck R. TGF-beta-induced repression of CBFA1 by Smad3 decreases cbfa1 and osteocalcin expression and inhibits osteoblast differentiation. EMBO Journal 2001;20:2254–72. Bae Y, Yang T, Zeng HC, Campeau PM, Chen Y, Bertin T, et al. miRNA-34c regulates Notch signaling during bone development. Human Molecular Genetics 2012;21:2991–3000. Bandyopadhyay A, Tsuji K, Cox K, Harfe BD, Rosen V, Tabin CJ. Genetic analysis of the roles of BMP2, BMP4, and BMP7 in limb patterning and skeletogenesis. PLoS Genetics 2006;2:e216. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281–97. Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science 2004;303:83–6. Davis BN, Hilyard AC, Lagna G, Hata A. SMAD proteins control DROSHA-mediated microRNA maturation. Nature 2008;454:56–61. Davis BN, Hilyard AC, Nguyen PH, Lagna G, Hata A. Smad proteins bind a conserved RNA sequence to promote microRNA maturation by Drosha. Molecular Cell 2010;39:373–84. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747–54. Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs are conserved targets of microRNAs. Genome Research 2009;19:92–105. Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, et al. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. Journal of Biological Chemistry 2005;280:33132–40. Gazzerro E, Pereira RC, Jorgetti V, Olson S, Economides AN, Canalis E. Skeletal overexpression of gremlin impairs bone formation and causes osteopenia. Endocrinology 2005;146:655–65. Hilton MJ, Tu X, Wu X, Bai S, Zhao H, Kobayashi T, et al. Notch signaling maintains bone marrow mesenchymal progenitors by suppressing osteoblast differentiation. Nature Medicine 2008;14:306–14. Ideno H, Takanabe R, Shimada A, Imaizumi K, Araki R, Abe M, et al. Protein related to DAN and cerberus (PRDC) inhibits osteoblastic differentiation and its suppression promotes osteogenesis in vitro. Experimental Cell Research 2009;315:474–84. Itoh T, Ando M, Tsukamasa Y, Akao Y. Expression of BMP-2 and Ets1 in BMP-2stimulated mouse pre-osteoblast differentiation is regulated by microRNA-370. FEBS Letters 2012;586:1693–701. Itoh T, Nozawa Y, Akao Y. MicroRNA-141 and -200a are involved in bone morphogenetic protein-2-induced mouse pre-osteoblast differentiation by targeting distal-less homeobox 5. Journal of Biological Chemistry 2009;284:19272–9. Itoh T, Takeda S, Akao Y. MicroRNA-208 modulates BMP-2-stimulated mouse preosteoblast differentiation by directly targeting V-ets erythroblastosis virus E26 oncogene homolog 1. Journal of Biological Chemistry 2010;285:27745–52. Ji J, Yamashita T, Budhu A, Forgues M, Jia HL, Li C, et al. Identification of microRNA181 by genome-wide screening as a critical player in EpCAM-positive hepatic cancer stem cells. Hepatology 2009;50:472–80. Ji J, Yamashita T, Wang XW. Wnt/beta-catenin signaling activates microRNA-181 expression in hepatocellular carcinoma. Cell & Bioscience 2011;1:4. Jones KB, Salah Z, Del Mare S, Galasso M, Gaudio E, Nuovo GJ, et al. miRNA signatures associate with pathogenesis and progression of osteosarcoma. Cancer Research 2012;72:1865–77. Kapinas K, Kessler C, Ricks T, Gronowicz G, Delany AM. miR-29 modulates Wnt signaling in human osteoblasts through a positive feedback loop. Journal of Biological Chemistry 2010;285:25221–31. Kim KM, Park SJ, Jung SH, Kim EJ, Jogeswar G, Ajita J, et al. miR-182 is a negative regulator of osteoblast proliferation, differentiation and skeletogenesis through targeting FoxO1. Journal of Bone and Mineral Research 2012;27:1669–79. Q3 Komori T. Regulation of osteoblast differentiation by transcription factors. Journal of Cellular Biochemistry 2006;99:1233–9. Lee I, Ajay SS, Yook JI, Kim HS, Hong SH, Kim NH, et al. New class of microRNA targets containing simultaneous 5 -UTR and 3 -UTR interaction sites. Genome Research 2009;19:1175–83. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005;120:15–20. Li Z, Hassan MQ, Jafferji M, Aqeilan RI, Garzon R, Croce CM, et al. Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation. Journal of Biological Chemistry 2009;284:15676–84. Li Z, Hassan MQ, Volinia S, van Wijnen AJ, Stein JL, Croce CM, et al. A microRNA signature for a BMP2-induced osteoblast lineage commitment program. Proceedings of the National Academy of Sciences of the United States of America 2008;105:13906–11.
513
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588
G Model BC 3909 1–10 10 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636
Q4
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
Lian JB, Stein GS, van Wijnen AJ, Stein JL, Hassan MQ, Gaur T, et al. MicroRNA control of bone formation and homeostasis. Nature Reviews Endocrinology 2012;8:212–27. Lin J, Patel SR, Cheng X, Cho EA, Levitan I, Ullenbruch M, et al. Kielin/chordin-like protein, a novel enhancer of BMP signaling, attenuates renal fibrotic disease. Nature Medicine 2005;11:387–93. Lin J, Patel SR, Wang M, Dressler GR. The cysteine-rich domain protein KCP is a suppressor of transforming growth factor beta/activin signaling in renal epithelia. Molecular and Cellular Biology 2006;26:4577–85. Liu L, Wang Y, Fan H, Zhao X, Liu D, Hu Y, et al. Mir-181a regulates MSCs growth and immune function: microRNA-181a regulates local immune balance by inhibiting proliferation and immunosuppressive properties of mesenchymal stem cells. Stem Cells 2012;30:1756–70. Long F. Building strong bones: molecular regulation of the osteoblast lineage. Nature Reviews Molecular Cell Biology 2012;13:27–38. Long F, Chung UI, Ohba S, McMahon J, Kronenberg HM, McMahon AP. Ihh signaling is directly required for the osteoblast lineage in the endochondral skeleton. Development 2004;131:1309–18. MacArthur BD, Tare RS, Murawski K, Oreffo RO. Identification of candidate regulators of multipotency in human skeletal progenitor cells. Biochemical and Biophysical Research Communications 2008;377:68–72. Maeda S, Hayashi M, Komiya S, Imamura T, Miyazono K. Endogenous TGF-beta signaling suppresses maturation of osteoblastic mesenchymal cells. EMBO Journal 2004;23:552–63. Major MB, Jones DA. Identification of a gadd45beta 3’ enhancer that mediates SMAD3- and SMAD4-dependent transcriptional induction by transforming growth factor beta. Journal of Biological Chemistry 2004;279:5278–87. Mizuno Y, Tokuzawa Y, Ninomiya Y, Yagi K, Yatsuka-Kanesaki Y, Suda T, et al. miR210 promotes osteoblastic differentiation through inhibition of AcvR1b. FEBS Letters 2009;583:2263–8. Naguibneva I, Ameyar-Zazoua M, Polesskaya A, Ait-Si-Ali S, Groisman R, Souidi M, et al. The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation. Nature Cell Biology 2006;8: 278–84. Nakashima K, de Crombrugghe B. Transcriptional mechanisms in osteoblast differentiation and bone formation. Trends in Genetics 2003;19:458–66. Nemer G, Nemer M. Transcriptional activation of BMP-4 and regulation of mammalian organogenesis by GATA-4 and -6. Developmental Biology 2003;254:131–48. Ota T, Fujii M, Sugizaki T, Ishii M, Miyazawa K, Aburatani H, et al. Targets of transcriptional regulation by two distinct type I receptors for transforming growth factor-beta in human umbilical vein endothelial cells. Journal of Cellular Physiology 2002;193:299–318. Posey KL, Hankenson K, Veerisetty AC, Bornstein P, Lawler J, Hecht JT. Skeletal abnormalities in mice lacking extracellular matrix proteins, thrombospondin-1, thrombospondin-3, thrombospondin-5, and type IX collagen. American Journal of Pathology 2008;172:1664–74. Ruiz de Azua I, Scarselli M, Rosemond E, Gautam D, Jou W, Gavrilova O, et al. RGS4 is a negative regulator of insulin release from pancreatic beta-cells in vitro and
in vivo. Proceedings of the National Academy of Sciences of the United States of America 2010;107:7999–8004. Sampath TK, Muthukumaran N, Reddi AH. Isolation of osteogenin, an extracellular matrix-associated, bone-inductive protein, by heparin affinity chromatography. Proceedings of the National Academy of Sciences of the United States of America 1987;84:7109–13. Sun J, Zhong N, Li Q, Min Z, Zhao W, Sun Q, et al. MicroRNAs of rat articular cartilage at different developmental stages identified by Solexa sequencing. Osteoarthritis and Cartilage 2011;19:1237–45. Takekawa M, Tatebayashi K, Itoh F, Adachi M, Imai K, Saito H. Smad-dependent GADD45beta expression mediates delayed activation of p38 MAP kinase by TGFbeta. EMBO Journal 2002;21:6473–82. Takeuchi K, Abe M, Hiasa M, Oda A, Amou H, Kido S, et al. Tgf-Beta inhibition restores terminal osteoblast differentiation to suppress myeloma growth. PLoS One 2010;5:e9870. Tay Y, Zhang J, Thomson AM, Lim B, Rigoutsos I. MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature 2008;455:1124–8. Teplyuk NM, Galindo M, Teplyuk VI, Pratap J, Young DW, Lapointe D, et al. Runx2 regulates G protein-coupled signaling pathways to control growth of osteoblast progenitors. Journal of Biological Chemistry 2008;283:27585–97. Thapa N, Kang KB, Kim IS. Beta ig-h3 mediates osteoblast adhesion and inhibits differentiation. Bone 2005;36:232–42. Thapa N, Lee BH, Kim IS. TGFBIp/betaig-h3 protein: a versatile matrix molecule induced by TGF-beta. International Journal of Biochemistry and Cell Biology 2007;39:2183–94. Wang EA, Rosen V, Cordes P, Hewick RM, Kriz MJ, Luxenberg DP, et al. Purification and characterization of other distinct bone-inducing factors. Proceedings of the National Academy of Sciences of the United States of America 1988;85:9484–8. Wei J, Shi Y, Zheng L, Zhou B, Inose H, Wang J, et al. miR-34s inhibit osteoblast proliferation and differentiation in the mouse by targeting SATB2. Journal of Cell Biology 2012;197:509–21. Yanai H, Chen HM, Inuzuka T, Kondo S, Mak TW, Takaoka A, et al. Role of IFN regulatory factor 5 transcription factor in antiviral immunity and tumor suppression. Proceedings of the National Academy of Sciences of the United States of America 2007;104:3402–7. Yang L, Cheng P, Chen C, He HB, Xie GQ, Zhou HD, et al. miR-93/Sp7 function loop mediates osteoblast mineralization. Journal of Bone and Mineral Research 2012;27:1598–606. Yoo J, Ghiassi M, Jirmanova L, Balliet AG, Hoffman B, Fornace Jr AJ, et al. Transforming growth factor-beta-induced apoptosis is mediated by Smad-dependent expression of GADD45b through p38 activation. Journal of Biological Chemistry 2003;278:43001–7. Zhang J, Tu Q, Bonewald LF, He X, Stein G, Lian J, et al. Effects of miR-335-5p in modulating osteogenic differentiation by specifically downregulating Wnt antagonist DKK1. Journal of Bone and Mineral Research 2011a;26:1953–63. Zhang JF, Fu WM, He ML, Xie WD, Lv Q, Wan G, et al. MiRNA-20a promotes osteogenic differentiation of human mesenchymal stem cells by co-regulating Q5 BMP signaling. RNA Biology 2011b;8:829–38.
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685
G Model BC 3909 1–10
The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
Contents lists available at SciVerse ScienceDirect
The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel
miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules
1 2
3
Q1
4
Raghu Bhushan a , Johannes Grünhagen b , Jessica Becker a , Peter N. Robinson b,c,d , Claus-Eric Ott b , Petra Knaus a,c,∗
5
a
6
b
Institute for Chemistry and Biochemistry, Freie Universitaet Berlin, Berlin, Germany Institute for Medical and Human Genetics, Charité Universitätsmedizin Berlin, Berlin, Germany c Berlin-Brandenburg School for Regenerative Therapies, Charité Universitätsmedizin Berlin, Berlin, Germany d Max Planck Institute for Molecular Genetics, 14195 Berlin, Germany
7 8 9
a r t i c l e
10
i n f o
a b s t r a c t
11
Article history: Received 25 September 2012 Received in revised form 3 December 2012 Accepted 7 December 2012 Available online xxx
12 13 14 15
16
Osteoblastic differentiation is controlled by complex interplay of several signaling pathways and associated key transcription factors, as well as by microRNAs (miRNAs). In our current study, we found miR-181a to be highly upregulated during BMP induced osteoblastic differentiation of C2C12 and MC3T3 cells. Overexpression of miR-181a led to upregulation of key markers of osteoblastic differentiation as well as enhanced ALP levels and Alizarin red staining, indicating the importance of this miRNA for osteoblastic differentiation. Further, we show that miR-181 isoforms (181a, 181b, 181c) are expressed during different stages of mouse calvarial and tibial development, implying their role in both endochondral and intramembranous ossification. We found several direct and indirect targets of miR-181a to be downregulated by global mRNA expression profiling. Our results demonstrate that miR-181a promotes osteoblastic differentiation via repression of TGF- signaling molecules by targeting the negative regulator of osteoblastic differentiation Tgfbi (Tgf-beta induced) and TˇR-I/Alk5 (TGF- type I receptor). Furthermore, our findings suggest that Rgs4 and Gata6 are direct targets of miR-181a. Taken together, we provide evidence for a crucial functional link between a specific miRNA, miR-181a and osteoblastic differentiation. © 2012 Published by Elsevier Ltd.
24
Keywords: Osteoblastic differentiation miR-181a TGF-/BMP C2C12 cells MC3T3 cells Tibia Calvaria
25
1. Introduction
26
Studies on osteoblastic differentiation are essential to promote better understanding of the skeletal disorders associated with progressive degeneration of bone, such as osteoporosis and osteoarthritis. Arising from mesenchymal stem cells, osteoblasts play a fundamental role during bone formation and remodeling (Komori, 2006). There are several signaling pathways which are indispensable for the regulation of osteoblastic differentiation such as transforming growth factor (TGF-)/bone morphogenetic protein (BMP), Wnt/-catenin, Notch, and Hedgehog (Bandyopadhyay et al., 2006; Gaur et al., 2005; Hilton et al., 2008; Long et al., 2004). It is well known that BMPs promote ectopic bone formation (Sampath et al., 1987; Wang et al., 1988) and induce osteoblastic differentiation by activating Runx2 and Osterix (Ducy et al., 1997; Nakashima and de Crombrugghe, 2003). In contrast to the BMPs, TGF, another member of the same superfamily, inhibits osteoblastic maturation and differentiation (Maeda et al., 2004; Alliston et al., 2001).
17 18 19 20 21 22 23
27 28 29 30 31 32 33 34 35 36 37 38 39 40 41
Q2
∗ Corresponding author at: Institute for Chemistry and Biochemistry, Freie Universitaet Berlin, Berlin, Germany. Tel.: +49 30 838 52935; fax: +49 30 838 52936. E-mail address: [email protected] (P. Knaus).
In addition to the above mentioned signaling pathways, osteoblastic differentiation is also controlled by microRNAs (miRNAs). miRNAs are small ∼20–24 nucleotide single-stranded, non-coding RNAs which regulate gene expression by direct base pairing to 3 UTRs of specific mRNAs, thereby leading to either mRNA degradation or translational repression (Bae et al., 2012; Bartel, 2004). The importance of TGF/BMP signaling in miRNA regulation is well established. R-Smads were shown to play a key role in miRNA processing by interacting with the Drosha microprocessor subunit and thereby facilitating pre-miRNA accumulation, suggesting a general mechanism of R-Smads in miRNA processing (Davis et al., 2010, 2008). Recent studies have shown that miRNAs play important roles in regulating osteoblastic cell fate by controlling spatiotemporal expression of their target genes during osteogenesis (Lian et al., 2012). There are several miRNAs known to be involved in osteoblastic differentiation such as miR-34 family, the miR-93/sp7 feedback regulatory loop, and miR-182 (Bae et al., 2012; Wei et al., 2012; Yang et al., 2012; Kim et al., 2012). BMP2, an inducer of osteoblastic differentiation, has been shown to downregulate several miRNAs in the course of BMP2mediated osteoblastic differentiation. Negative regulation by BMP2
1357-2725/$ – see front matter © 2012 Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.biocel.2012.12.008
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64
G Model BC 3909 1–10
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
2
95
of the miRNAs such as miR-141, miR-200a, miR-208, and miR-370, removes their negative control on bone formation, by targeting key molecules such as Dlx5 and Ets1 thereby establishing commitment toward osteoprogenitor cell fate (Li et al., 2008; Itoh et al., 2009, 2010, 2012). In contrast, other miRNAs are upregulated during osteoblastic cell fate decision. For example, miR-210 is upregulated during BMP4-induced osteoblastic differentiation of bone marrow stromal cells (ST2 cells) promoting the osteoblastic differentiation process by downregulating Acvr1b expression (Mizuno et al., 2009). Additionally, expression levels of miR-20a and miR-29b targeting inhibitors of osteoblast differentiation such as PPAR␥, Bambi and Crim1 were reported to increase during osteoblastic differentiation (Zhang et al., 2011b; Li et al., 2009). Previous studies have shown that miR-181 is upregulated during rat articular cartilage development, pathogenesis of osteosarcomas as well as differentiation of B-cells and muscle cells (Chen et al., 2004; Jones et al., 2012; Naguibneva et al., 2006; Sun et al., 2011). In this study, we aimed to understand the role of miR-181a during the process of osteoblast differentiation. We demonstrate that miR-181a is upregulated during BMP2 or BMP6 mediated osteogenic induction of C2C12 and MC3T3 cells in vitro, and during development of mouse tibia and calvaria in vivo. Furthermore, we show that miR-181a promotes the osteoblastic differentiation process. To functionally characterize miR-181a and identify its targets, we performed mRNA expression profiling and identified Tgfbi, TˇR-I, Rgs4 and Gata6 as direct targets. Taken together, our results demonstrate that one of the mechanisms by which miR181a positively regulates osteoblastic differentiation is by means of repression of TGF- signaling molecules.
96
2. Materials and methods
97
2.1. Cell culture
98
Different cell systems from mouse have been used in these studies such as C2C12 mesenchymal precursor cells, MC3T3 preosteoblasts and primary calvaria osteoblasts. A detailed description of different cell culturing conditions is provided in supplementary methods.
65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94
99 100 101 102
103
104 105 106 107 108 109 110 111 112 113
2.2. Tissue preparation Tibia and calvaria samples were harvested from male newborn (24 h) C57BL/6 wildtype mice aged between 1 and 6 weeks. Tissue attached to the tibiae and calvaria samples was chopped, diaphyses removed, tibiae were flushed and rinsed in phosphatebuffered saline (PBS) solution to remove bone marrow and blood. Immediately, samples were shock-frozen in liquid nitrogen. Calvariae and tibiae from each mouse were pulverized and directly dissolved in RNAPure (PeqLab). Total RNA was isolated using phenol/chloroform extraction. RNA integrity was confirmed using the Agilent RNA 6000 Nano Kit.
114
2.3. miRNA mimics transfections
115
120,000–150,000 MC3T3 cells were plated in 6-well plates with alphaMEM medium (Invitrogen) containing 10% FCS, 1 mM glutamine, penicillin (100 Units/ml) and Streptomycin (10 g/ml) (PAA). On the next day, cells were transfected with scrambled Cy3 dye-labeled negative control mimics (25 nM) or miR-181a mimics (25 nM) (Ambion) using RNAiMAX lipofectamine (Invitrogen). On the following day, cells were serum starved in 2% serum for
116 117 118 119 120 121
2 h followed by stimulations with BMP2 (25 nM) and lysates from respective time points were collected.
122
2.4. miRNA microarray
124
C2C12 cells were seeded and stimulated with BMP6 (10 nM). Total RNA was isolated at 6 h and 1 day using Trizol and quantitated using Nanodrop (ND-1000 Spectrophotometer). RNA integrity was assessed using the Agilent RNA 6000 Nano Kit and Agilent 2100 Bioanalyzer. Subsequently, 300 ng of total RNA was hybridized onto the Agilent Mouse miRNA microarrays (8× 15k, Part number G4472B, Sanger version 12, with 627 targeted miRNAs) following manufacturer’s instructions. The miRNA expression data was processed and normalized using Agilent’s Genespring software.
125
2.5. Northern blotting
134
Total RNA was isolated from C2C12 cells or MC3T3 cells stimulated with BMP2 or BMP6 using Trizol (Invitrogen). 20–30 g total RNA was loaded onto 15% TBE urea gel, transferred to Hybond-XL nylon membrane (Amersham Biosciences), UV cross linked followed by hybridization. To confirm equal loading the gel was stained with ethidium bromide (EtBr) and tRNA was used as loading control. The specific miR-181a probe (5 ACTCACCGACAGCGTTGAATGTTC 3 ) was 5 end labeled with [␥-32 P] ATP along with T4 polynucleotide kinase (Fermentas) and hybridized to the membranes using ultrahyb oligo-hyb buffer (Ambion). This was followed by washing, developing and scanning of the films (Amersham Hyperfilm ECL).
135
2.6. Quantitative PCR
147
Total RNA was isolated using Trizol (Invitrogen) and miRNAs were reverse transcribed using Taqman reverse transcription kit (ABI). Mature miRNA species were detected by quantitative PCR using a commercially available Taqman assay system (ABI) as described by the manufacturer. SnoRNA135, U6RNA, and SnoRNA202 were used as normalizing controls. For gene expression analysis, total RNA was isolated using NucleoSpin RNA II Isolation Kit (Machery-Nagel) as per the manufacturer’s instructions. Reverse transcription was performed using M-MLV transcriptase (Promega). Real-time PCR was carried out using SYBR Green mix (ABI). The mouse sequence-specific primers are listed in supplementary methods. The Ct method was used for quantifying gene expression relative to HPRT or GAPDH.
148
2.7. Alkaline phosphatase (ALP) assay
161
Standard procedure was followed for the ALP assay. Details are provided in supplementary methods.
162
2.8. Alizarin red staining
164
Cultured cells were rinsed twice with PBS and allowed to airdry. Dried cells were covered with 1 ml Alizarin red solution (2%, pH 4.5) and stained at RT for 30 min Mineral deposition appeared red after washing wells three times with water. In order to quantify Alizarin red staining, mineral-bound Alizarin red was extracted with 1 ml of 10% cetylpyridinium chloride per well at 37 ◦ C. 100 l of extracted dye was mixed with 100 l PBS and absorbance was spectrophotometrically quantified at 570 nm for triplicate wells.
165
2.9. Global mRNA expression profiling
173
Global mRNA expression profiling was performed in MC3T3 cells after transfecting with miR-181a mimics (25 nM) or scrambled
174
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
123
126 127 128 129 130 131 132 133
136 137 138 139 140 141 142 143 144 145 146
149 150 151 152 153 154 155 156 157 158 159 160
163
166 167 168 169 170 171 172
175
G Model BC 3909 1–10
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
183
control (miR-SC) mimics (25 nM) overnight. Also, untransfected controls were maintained. Next day, the cells were serum starved in 2% serum for 2 h, followed by stimulations with BMP2 (25 nM). 400 ng total RNA was extracted at 1 day subjected to mRNA expression profiling using MouseRef-8 v2.0 Expression BeadChips (BD-202-0202, Illumina). The experiment was performed in duplicates as per the manufacturer’s instructions. Further details are provided in supplementary methods.
184
2.10. DNA constructs and luciferase assays
176 177 178 179 180 181 182
185 186 187 188 189 190 191 192 193 194 195
3
The regions of the Tgfbi, TˇR-I, Rgs4 and Gata6 UTRs that flank the miR-181a binding sites were PCR amplified from genomic DNA and the PCR amplified fragments were cloned between SpeI and HindIII sites of pMIR-REPORT vector (Ambion). The primer sequences are provided in supplementary methods. C2C12 cells were cultured in 24-well plates and co-transfected with corresponding UTR reporter construct (100 ng) along with Renilla vector (40 ng) and scrambled control (25 nM) or miR-181a mimics (25 nM) using Lipofectamine 2000 (Invitrogen). On the next day, medium was replaced, and luciferase activity was measured 48 h post transfection. Luciferase activity was calculated as the ratio of Firefly to
3
Renilla. Results are mean ± s.d. of duplicate measurements, representative of two or three independent experiments as indicated.
196 197
2.11. Western blots
198
Cells were washed with PBS, lysed in SDS sample buffer and subjected to SDS-PAGE and transferred to Nitrocellulose membranes following standard western blotting procedure. The primary antibodies used in the studies are as follows: -actin (#AC-15, Sigma–Aldrich), Tgfbi/IG-H3 (#2719, Cell Signaling), Tgfbr-I (sc9048, Santa Cruz), and Id1 (sc-488, Santa Cruz).
199
3. Results
205
3.1. Upregulation of miR-181a after osteogenic induction of C2C12 and MC3T3 cells
206
To identify miRNAs with a potential role during osteoblastic differentiation, we induced differentiation of C2C12 (mouse precursor myoblast cells) and MC3T3 cells (mouse preosteoblast cells) into the osteogenic lineage by stimulating with BMP2 or BMP6. First
208
Fig. 1. Induction of miR-181a during the osteoblastic differentiation of C2C12 and MC3T3 cells. (A) Induction of miR-181a expression upon BMP6 (10 nM) stimulation in C2C12 cells at the indicated time points (hrs: hours, d: days) by miRNA microarrays (Agilent). Mean normalized signal intensities were plotted. (B) and (C) Northern blot was performed on total RNA isolated from (B) BMP6 (10 nM) stimulated or unstimulated C2C12 cells at the indicated time points (d: days, min: minutes). (C) C2C12 cells following two different cell fate changes, osteogenic differentiation and myogenic. tRNA bands were used as loading control. (D) and (E) miR-181a expression was measured by Taqman assays, performed in (D) C2C12 and (E) MC3T3 cells, stimulated with BMP2 (50 nM). Expression of miR-181a was normalized against SnoRNA135 and fold change was calculated.
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
200 201 202 203 204
207
209 210 211
G Model BC 3909 1–10 4 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242
243 244
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
we confirmed the osteogenic potential of both cell types (C2C12 and MC3T3) in our culture conditions. For C2C12 cells, high induction of ALP (alkaline phosphatase) levels was observed following stimulation with BMP6 or BMP2 as compared to untreated control (Supplementary Fig. 1A). Using qRT-PCR, we additionally confirmed induction of the key osteoblastic marker genes Runx2 and Osterix (Sp7) (Supplementary Fig. 1B). The osteogenic potential of MC3T3 cells stimulated with BMP2 was ascertained by the expression of the osteoblastic differentiation markers Alkaline phosphatase (Alpl), Bone sialoprotein (Ibsp), Osteocalcin (Bglap), Id1, and Sp7 within 3 days (Supplementary Fig. 1C). For the identification of differentially regulated miRNAs we employed miRNA microarrays after osteogenic induction of C2C12 cells with BMP6 and found miR-181a to be significantly upregulated after 24 h (Fig. 1A). We validated the increased expression of miR-181a by Northern blots on RNA isolated at different time points of osteoblastic differentiation and found miR-181a expression to be even stronger at late stages (d3) (Fig. 1B). It has been reported that miR-181a is upregulated during myogenic differentiation, thereby establishing muscle phenotype (Naguibneva et al., 2006). We differentiated C2C12 cells into both osteogenic (serum starvation + BMP2) or myogenic (serum starvation − BMP2) lineages and confirmed its expression in both lineages (Fig. 1C). Furthermore, we performed Taqman assays following BMP2 stimulation in C2C12 and MC3T3 cells at different time points and observed that miR-181a expression was also robustly enhanced during late stages (d3–d6) of osteoblastic differentiation (Fig. 1D and E). Thus by employing two different cell systems and also stimulating them with defined growth factors (BMP2 or BMP6), we show that miR-181a is highly upregulated, suggesting that miR-181a is an important player in regulating osteogenic cell fate. 3.2. Different miR-181 isoforms are induced during endochondral and intramembranous ossifications
263
Intramembranous ossification is limited to the skull or parts of the clavicle while endochondral ossification gives rise to the rest of the skeleton (Long, 2012). To understand the regulation of the three miR-181 isoforms (181a, 181b, and 181c) during these two types of bone formation, we investigated their expression by Taqman assay in samples from calvarial and tibial bone over a time course. We observed increasing expression of miR-181 (181a, 181b, 181c) in trabecular bone from mouse tibia from day 7 to day 35 (Fig. 2A). In calvarial tissue isolated from mice at different stages, ranging from embryonic day E17.5 to 5 months postnatal, we observed miR-181 isoforms to be increased in expression from day 0 to day 42, followed by a slight decrease in aged mice, i.e. 5 months (Fig. 2B). Additionally, we confirmed the expression of miR-181 family in primary calvarial osteoblasts (pCOBs) during different stages of in vitro osteoblastic differentiation and found that the miR-181 family was highly expressed at late stages of osteoblastic differentiation (Fig. 2C). Taken together, we confirmed the expression of miR-181 isoforms in tibia and calvarial tissues in vivo as well as during in vitro differentiation.
264
3.3. miR-181a promotes osteoblastic differentiation
265
To address the functional relevance of miR-181a during osteoblastic differentiation, we performed overexpression experiments by transfecting primary calvarial osteoblasts (pCOBs) and MC3T3 cells with miR-181a or corresponding scrambled control. Transfection of miR-181a in pCOBs slightly enhanced Alizarin red staining at day 6 and day 9, compared to the scrambled negative control (Fig. 3A). We could also observe that miR-181a expression led to significant induction of ALP activity, an early marker of osteoblastic differentiation, compared to miR-455 (a
245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262
266 267 268 269 270 271 272 273
Fig. 2. miR-181 isoforms (181a, 181b, 181c) are induced during both endochondral and intramembranous ossification. (A) and (B) The expression of miR-181 family in in vivo mouse tibial, calvarial and primary calvarial osteoblasts (pCOBs). Total RNA was isolated at different stages of (A) tibial development, (B) calvarial development and in (C) pCOBs, followed by quantification of miR-181 family expression using Taqman assays and normalizing against endogenous SnoRNA202. For pCOBs, an additional control miRNA, miR-21 was also assayed for its expression.
negative control miRNA) and scrambled control (Fig. 3B). Overexpression of miR181a in MC3T3 cells with BMP2 stimulation led to significant enhancement in ALP levels and induction of key osteoblastic marker genes such as Sp7, Alpl, Bglap, and Spp1 (Fig. 3C–F, Supplementary Fig. 3A). In the presence of BMP2, miR181a also led to increased mRNA and protein levels of Id1, an early target of BMP signaling (Supplementary Fig. 3A and B). In the absence of BMP2, miR181a overexpression induced Alpl and Id1 expression (Supplementary Fig. 3C and D). These findings demonstrate that miR-181a promotes osteoblastic differentiation of preosteoblasts and primary calvarial osteoblasts.
274
3.4. Downregulation of several genes upon overexpression of miR-181a
285
To investigate the targets of miR-181a during the process of osteoblastic differentiation, we performed mRNA expression profiling. Since we were interested in identifying novel targets of miR-181a during osteoblastic differentiation, MC3T3 cells were transfected with miR-181a or scrambled control mimics. The following day, cells were stimulated with BMP2 for 24 h and isolated RNA was subjected for microarray analysis. Hierarchical clustering based on gene expression and linear correlation coefficients between samples on whole data suggested an expected segregation of control, miR-SC + BMP2 and miR-181a + BMP2 samples (Supplementary Fig. 4A and B). Genes that were detected with significant regulations in all the samples were considered (detection
287
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
275 276 277 278 279 280 281 282 283 284
286
288 289 290 291 292 293 294 295 296 297 298
G Model BC 3909 1–10
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
5
Fig. 3. miR-181a promotes osteoblastic differentiation. (A) Alizarin red stainings were executed in primary calvarial osteoblasts (pCOBs), transfected with scrambled control mimics (miR-SC) (25 nM) or miR-181a (25 nM). For ARS quantification (see Section 2). A representative image from 3 independent experiments is shown. (B) ALP assay in pCOBs. pCOBs were transfected with scrambled control mimics (25 nM) or miR-181a (25 nM) and ALP levels were assessed at indicated time points. (C) ALP assay in MC3T3 cells stimulated with BMP2 (25 nM). MC3T3 cells were transfected with scrambled control (25 nM; light gray bars) or miR-181a (25 nM; black bars), followed by BMP2 (25 nM) stimulations. ALP levels were measured at indicated time points. BMP2 stimulated cells (gray bars) were used as controls. (D)–(F) qRT-PCRs of osteoblastic markers in BMP2 (25 nM) stimulated MC3T3 cells upon transfection with miR-181a (25 nM; black bars) or scrambled control mimics (25 nM; light gray bars) followed by BMP2 (25 nM) stimulation. Fold changes in osteoblastic markers, Sp7, Alpl, and Bglap were quantified at indicated time points. BMP2 stimulated cells (gray bars) were used as control.
299 300 301 302 303 304 305 306 307 308
p-value p < 0.05) for further analysis (see supplementary methods). To filter out BMP2-regulated genes in treatments miR-SC + BMP2 or miR-181a + BMP2 and to identify the miR-181a downregulated genes, we filtered our dataset with a cutoff of 1.2 fold regulation, relative to control. We identified 78 genes common between the miR-181a + BMP2-downregulated list (898 genes) and miRSC + BMP2-upregulated list (230 genes) (detection p-value p < 0.05, ANOVA p < 0.05) (Fig. 4A, Supplementary Tables 1–3). These 78 genes comprised of genes that were exclusively downregulated by miR-181a alone. The fold-changes of a subset of 29 genes from
this list (78 genes), that were more than 1.5 fold upregulated in miR-SC + BMP2 have been represented as heat map in Fig. 4B (complete list in Supplementary Table 3). Among the most significantly downregulated genes, we found Tgfbi, TGF--induced extracellular matrix (ECM) protein, a known negative regulator of osteoblastic differentiation to be the most promising target (Thapa et al., 2005). Other potential targets we identified were Grem2, a BMP antagonist (Ideno et al., 2009), Rgs4, a regulator of G protein signaling and a negative regulator of insulin release (Ruiz de Azua et al., 2010), Gadd45b, a pro-apoptotic factor and a downstream responsive gene
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
309 310 311 312 313 314 315 316 317 318
G Model BC 3909 1–10 6
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
Fig. 4. Downregulation of several genes upon overexpression of miR-181a. Global mRNA expression profiling was performed in MC3T3 cells after transfection with miR181a (25 nM) or scrambled control (miR-SC) (25 nM) overnight. Also, untransfected and unstimulated cells were maintained. Expression profiles were analyzed relative to control. All experiments were performed in duplicates. (A) Venn diagram between the upregulated genes in miR-SC + BMP2 sample and downregulated genes in miR181a + BMP2 sample. The genes significantly detected in both samples were taken under consideration (p < 0.05). (B) Heatmap depicting a subset of the overlap between Q6 the significantly downregulated genes in miR-181a + BMP2 and significantly upregulated genes in miR-SC + BMP2. The heatmap is colored based on the log 2 fold change (detection p-value < 0.05; entire gene list is depicted in Supplementary Table 3). (C) Validation of downregulated genes from microarray experiments using qRT-PCR. MC3T3 cells were transfected with miR-181a (25 nM) or scrambled control (25 nM), followed by BMP2 (25 nM) stimulation for 1 day. qRT-PCRs were performed and fold changes calculated. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
319 320 321 322 323 324 325 326 327 328 329 330 331 332 333
of TGF- signaling (Takekawa et al., 2002; Major and Jones, 2004), Thsb3, Thrombospondin 3, an ECM protein (Posey et al., 2008), Crim2, a suppressor of TGF- and an enhancer of BMP signaling (Lin et al., 2005, 2006), Irf5, involved in immune response and tumor suppression (Yanai et al., 2007) and Gata6, an evolutionarily conserved transcription factor, highly expressed in heart and gut (Nemer and Nemer, 2003) (Fig. 4B). To prove the reliability of our data we successfully validated a subset of genes by qRTPCRs and observed that indeed the microarray data was in line with qRT-PCR validation (Fig. 4C). To ascertain, if these targets could be directly or indirectly targeted by miR-181a, we overlapped the 78 miR-181a downregulated genes to the TargetScan database (Lewis et al., 2005; Friedman et al., 2009) and found that 21 genes contained either conserved or non-conserved binding sites for miR181a (Table 1). Taken together, upon transfection with miR-181a,
we could detect downregulation of several genes during osteoblastic differentiation and identified possible direct and indirect targets of miR-181a.
334
3.5. miR-181a directly targets TGF-ˇ signaling molecules Tgfbi and TˇR-I
337
The 3 UTR of the negative regulator of osteoblastic differentiation, Tgfbi contains a predicted non-conserved binding site for miR-181a (TargetScan; Fig. 5A). To confirm the functionality of this binding site, the 3 UTR region was cloned into pMIR-REPORT luciferase vector (Ambion). Furthermore, we generated a 3 UTR mutant, by altering the nucleotides in the seed sequence (Fig. 5A). Upon co-transfecting Tgfbi-UTR-wt (wild type) with either miR-181a mimics or scrambled control, we observed
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
335 336
338
339 340 341 342 343 344 345 346
ARTICLE IN PRESS
G Model BC 3909 1–10
R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
7
Table 1 miR181a downregulated genes from microarray data which are predicted (TargetScan) to contain miR-181a bindings sites.
347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388
Gene symbol
Gene name
Conserved
Non-conserved
Trim3 Dlk2 Ippk Ids Hapln4 Ank Cdr2 Slc35a2 Taf9b Dclk1 Tgfbi Grem2 Mmab Pqlc3 Prkcd Phtf2 Pi4k2b Myo9b Mcoln1 Runx1 Rsad1 Rgs4 Gata6
Tripartite motif-containing 3 Delta-like 2 homolog (Drosophila) Inositol 1,3,4,5,6-pentakisphosphate 2-kinase Iduronate 2-sulfatase Hyaluronan and proteoglycan link protein 4 Progressive ankylosis Cerebellar degeneration-related 2 Solute carrier family 35 (UDP-galactose transporter), member A2 TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor Doublecortin-like kinase 1 Transforming growth factor, beta induced Gremlin 2 homolog, cysteine knot superfamily (Xenopus laevis) Methylmalonic aciduria (cobalamin deficiency) type B homolog (human) PQ loop repeat containing Protein kinase C, delta Putative homeodomain transcription factor 2 Phosphatidylinositol 4-kinase type 2 beta Myosin IXb Mucolipin 1 Runt related transcription factor 1 Radical S-adenosyl methionine domain containing 1 Regulator of G-protein signaling 4 GATA binding protein 6
1 0 1 0 0 0 0 0 0 1 0 0 0 0 1 1 1 0 0 1 0 0 1
0 1 2 2 2 1 1 1 1 3 1 1 1 1 0 2 0 1 1 1 6 2 0
reduced Tgfbi-UTR-wt firefly luciferase activity by miR-181a mimics, when compared to miR-SC. Transfection of miR-223 which has no predicted binding site in the 3 UTR of Tgfbi further confirmed specificity for miR-181a regulation. Co-transfecting the miR-181a with Tgfbi-UTR-mut, the mutant construct, abolished the inhibitory effect, emphasizing that miR-181a directly interacts with Tgfbi 3 UTR (Fig. 5B). To assess Tgfbi protein levels, we transfected the preosteoblast MC3T3 cells with miR-181a or scrambled control under BMP2 conditions and performed western blots. Interestingly, we observed reduction in protein levels in the samples transfected with miR-181a + BMP2 compared to miR-SC + BMP2 (Fig. 5C). Thus we conclude that miR-181a promotes osteoblastic differentiation at least in part by directly suppressing Tgfbi expression. It was shown previously that Tgfbi expression is promoted by activated TGF- type I receptor (TR-I) (Ota et al., 2002). Additionally it is also known that TGF- inhibits the osteoblastic differentiation by suppressing the expression of CBFA1 through Smad3 (Alliston et al., 2001). Using TargetScan, we found a conserved and a non-conserved binding site for miR-181a in the 3 UTR of TR-I (Fig. 5D). We confirmed the reduction in protein levels of TR-I upon miR-181a transfection in preosteoblasts and C2C12 cells both stimulated with BMP2 (Fig. 5E). In line with our findings, it has recently been shown that miR-181a impedes TGF- signaling by downregulating the TR-I in MSCs derived from the Preeclampsia patients (Liu et al., 2012). Taken together, we show evidence that miR-181a promotes osteoblastic differentiation by targeting the TGF- signaling molecules TR-I and Tgfbi. Next we analyzed Rgs4 (regulator of G protein signaling) and Gata6 as potential targets of miR-181a. Of note, decreasing expression of Rgs4 at late stages of osteoblastic differentiation has been described (Teplyuk et al., 2008), which inversely correlates with the miR-181a expression shown here. To further analyze miR-181a mediated downregulation of Rgs4, we identified two non-conserved putative miR-181a binding sites in the 3 UTR of Rgs4 (TargetScan, Supplementary Fig. 5A). Using a reporter construct similar to the one described for Tgfbi we confirmed functionality of this binding site and specificity for miR181a (Supplementary Fig. 5B). We pursued Gata6 although its possible role in osteoblastic differentiation needs further investigation. Gata6 contains a single predicted conserved binding site (TargetScan; Supplementary Fig. 5C) and upon performing the luciferase assay with Gata6-UTR cotransfected with miR-181a, we
observed a reduction in Gata6 reporter UTR activity when compared to scrambled negative control or miR-223 (Supplementary Fig. 5D). Our results demonstrate that miR-181a directly targets Tgfbi and TR-I (both TGF- signaling molecules) in addition to Rgs4 and Gata6.
389
4. Discussion
394
In our current study we provide evidence for miR-181a to be a positive regulator of osteoblastic differentiation by downregulating the TGF- signaling molecules, TR-I and Tgfbi. We also identified Rgs4 and Gata6 as direct targets of miR-181a. The induction of miR-181a was found to be enhanced during late stages of osteoblastic differentiation (Figs. 1 and 2). Analogous to our observation, miR-181 was shown to be highly upregulated during myogenic differentiation (Naguibneva et al., 2006). Therefore, the role of miR181a seems to be conserved in muscle and bone tissues possibly due to their common origin, the paraxial mesoderm. We clearly show that miR-181a promotes osteoblastic differentiation (Fig. 3). To decipher the functional role of miR-181a and understand miR-181a regulated gene networks, we employed global genome expression profiling in BMP2-stimulated MC3T3 cells (24 h) after overexpression of miR-181a. The most significantly downregulated genes included Tgfbi (Fig. 4), an ECM protein induced by TGF- and a negative regulator of osteoblastic differentiation (Thapa et al., 2007) that is decreased during the differentiation (Thapa et al., 2005). Using complementary approaches, we show that Tgfbi is a direct target of miR-181a. TGF- inhibits osteoblastic differentiation (Alliston et al., 2001) and inhibition of TGF- type-I receptor enhances osteoblastic differentiation in MC3T3 and C2C12 cells (Maeda et al., 2004; Takeuchi et al., 2010). Interestingly our results indicate TR-I/ALK5 as a possible direct target of miR-181a in MC3T3 cells (Fig. 5D and E). Complementary to our findings, recently Liu et al. (2012), reported that miR-181a inhibits TGF- signaling by directly targeting TR-I in MSCs isolated from preeclampsia patients. Moreover, we found Gadd45b, a proapoptotic factor and an immediate early response gene of TGF- signaling (Yoo et al., 2003) as a possible target of miR-181a (microarray, qRT-PCR data) (Fig. 4B and C). However, we could not detect any predicted binding sites for miR-181a in the Gadd45b 3 UTR. Apart from the 3 UTRs, microRNA are known to target coding regions or 5 UTRs (Tay et al., 2008; Lee et al., 2009). Here we
395
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
390 391 392 393
396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428
G Model BC 3909 1–10 8
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
Fig. 5. miR-181a directly targets TGF- signaling molecules Tgfbi and TR-I. (A) Putative binding site for miR-181 in Tgfbi 3 UTR as predicted by TargetScan, DIANA-microT. Mutated nucleotides in mutant Tgfbi 3 UTR seed sequence are represented in blue. (B) Luciferase reporter assays in C2C12 cells. Cells were co-transfected with Tgfbi-UTRwt (wild type) or Tgfbi 3 UTR-mut (mutant) reporter construct or scrambled control (25 nM) or miR-181a mimics (25 nM) for overnight. 48 h post transfection luciferase activities were calculated as ratio of Firefly to Renilla. Results are mean ± s.d. of duplicate measurements, representative of 3 independent experiments. (C) Tgfbi western blots in MC3T3 cells. Cells were transfected with scrambled control (25 nM) or miR-181a mimics (25 nM) for overnight, followed by BMP2 (25 nM) stimulations for 1 day. Protein lysates were harvested and western blots performed. -Actin was used as loading control. (D) Putative binding sites for miR-181 in TR-I 3 UTR as predicted by TargetScan. (E) TR-I western blots in C2C12 and MC3T3 cells. Protein lysates were prepared as mentioned in (C). BMP2 stimulations were performed for 1 day for MC3T3 and 30 min for C2C12 cells. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.) 429 430 431 432 433 434 435 436
speculate that prediction tools could have either missed the miR181a binding sites in the 3 UTR of Gadd45b or miR-181a might be targeting the Gadd45b coding regions or 5 UTR (needs further investigation) Another possibility is that miR-181a might indirectly regulate Gadd45b levels by controlling the levels of TR-I. From our results it can be concluded that miR-181a might directly control the expression of both Tgfbi and TR-I, deciphering its possible role in regulating TGF- signaling.
Furthermore, miR-181 expression was reported to be induced by Wnt/-catenin signaling and putative -catenin/Tcf4 binding sites were found in the promoter region of the microRNA-181a2 transcript in hepatocellular carcinomas (Ji et al., 2009, 2011). In our preliminary data, we observed miR-181a to be upregulated by Wnt3a in MC3T3 cells (data not shown). There have been reports suggesting the promotion of Wnt signaling during osteoblastic differentiation by miRNAs that target Wnt antagonists (Kapinas et al.,
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
437 438 439 440 441 442 443 444
G Model BC 3909 1–10
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497
2010; Zhang et al., 2011a). Nemo like kinase (NLK) and Dickkopf 1 (Dkk1) are the predicted targets of miR-181a (TargetScan). Taken together, one of the mechanisms by which Wnt signaling promotes osteoblastic differentiation could be the induction of miR-181a that directly controls the expression of Tgfbi as a negative regulator of osteoblastic differentiation. This suggests that miR-181a could be an important link between Wnt and TGF- signaling during osteoblastic differentiation. MiR-181a suppresses the expression of Gata6 suggesting a mechanism of maintaining stemness of hepatic stem cells (Ji et al., 2009). We confirmed the miR-181a mediated downregulation of Gata6 in osteoblasts (Fig. 4B and C, Supplementary Fig. 5D). The role of Gata6 during osteoblastic differentiation is unclear, however it was shown to be strongly expressed in committed primary chondrocyte precursors (Alexandrovich et al., 2008). It has been proposed that Gata6 might act upstream of Grem1, controlling osteo-chondral bipotency by means of a high-affinity consensus binding sequence of Gata6 in the Grem1 promoter (MacArthur et al., 2008). Here, we show that upon overexpression of miR-181a, Grem2 was downregulated. Both Grem1 and Grem2 negatively regulate osteoblastic differentiation by opposing BMP effects in vitro (Gazzerro et al., 2005; Ideno et al., 2009). Given that miR-181a is induced during osteoblastic differentiation and promotes the process (Fig. 1), its possible role in doing so could be the inhibition of the BMP antagonists, Grem1 (via Gata6) and Grem2 and the direct suppression of Gata6 (Fig. 4B and C) thereby controlling osteo-chondral bipotency. Further, we show Rgs4 (regulator of G protein signaling) to be another miR-181a-downregulated target (Fig. 4B and C, Supplementary Fig. 5B). Rgs4 negatively regulates insulin release in pancreatic- cells (Ruiz de Azua et al., 2010). In relevance to osteoblast cell fate, consistent diminishing expression of Rgs4 at late stages of osteoblastic differentiation in MC3T3 cells has been observed (Teplyuk et al., 2008). Our results indicate that decreasing expression of Rgs4 during osteoblastic differentiation correlates with increasing miR-181a levels in MC3T3 cells (Fig. 1B–E). Hence, in an osteoblastic context, we speculate that the other mechanism by which miR-181a promotes osteoblastic differentiation might be by suppressing the levels of Rgs4. Apart from the miRNA targets we identified and validated from our miR181a overexpression microarray data, we believe that there could be several other important targets, which miR-181a might be regulating that could be crucial in establishing and maintaining the osteo-phenotype. In summary, we show that miR-181a is highly upregulated during osteogenesis, promotes osteoblastic differentiation and could be an important player for maintenance of osteoblast cell fate. Our results also suggest that miR-181a might act as a link between TGF- and Wnt signaling pathways. Furthermore, we propose a mechanism by which a specific microRNA, miR-181a co-suppresses Tgfbi, Tgfbr-I, Rgs4, and Gata6 in the osteoblastic lineage. This study provides an essential operational link between microRNAs and the osteoblast phenotype.
498
Acknowledgements
499
We thank Stefan Mundlos and Richard Reinhardt (Max Planck Institute for Molecular Genetics) for allowing us to access the microarray central facility for our microarray experiments. We are grateful to Aydah Sabah, Johanna Scholz, and Gisela Wendel for their technical support. We thank Jan Börgermann for critically reading the manuscript. We acknowledge the support of our funding agencies: SFB-760 (to PK), DFG grant Mu880/11-01 (to PNR), Center for International Cooperation and DRS (Freie Universität, Berlin).
500 501 502 503 504 505 506 507
9
Appendix A. Supplementary data Supplementary data associated with cle can be found, in the online http://dx.doi.org/10.1016/j.biocel.2012.12.008.
508
this artiversion, at
509 510 511
References
512
Alexandrovich A, Qureishi A, Coudert AE, Zhang L, Grigoriadis AE, Shah AM, et al. A role for GATA-6 in vertebrate chondrogenesis. Developmental Biology 2008;314:457–70. Alliston T, Choy L, Ducy P, Karsenty G, Derynck R. TGF-beta-induced repression of CBFA1 by Smad3 decreases cbfa1 and osteocalcin expression and inhibits osteoblast differentiation. EMBO Journal 2001;20:2254–72. Bae Y, Yang T, Zeng HC, Campeau PM, Chen Y, Bertin T, et al. miRNA-34c regulates Notch signaling during bone development. Human Molecular Genetics 2012;21:2991–3000. Bandyopadhyay A, Tsuji K, Cox K, Harfe BD, Rosen V, Tabin CJ. Genetic analysis of the roles of BMP2, BMP4, and BMP7 in limb patterning and skeletogenesis. PLoS Genetics 2006;2:e216. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281–97. Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science 2004;303:83–6. Davis BN, Hilyard AC, Lagna G, Hata A. SMAD proteins control DROSHA-mediated microRNA maturation. Nature 2008;454:56–61. Davis BN, Hilyard AC, Nguyen PH, Lagna G, Hata A. Smad proteins bind a conserved RNA sequence to promote microRNA maturation by Drosha. Molecular Cell 2010;39:373–84. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747–54. Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs are conserved targets of microRNAs. Genome Research 2009;19:92–105. Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, et al. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. Journal of Biological Chemistry 2005;280:33132–40. Gazzerro E, Pereira RC, Jorgetti V, Olson S, Economides AN, Canalis E. Skeletal overexpression of gremlin impairs bone formation and causes osteopenia. Endocrinology 2005;146:655–65. Hilton MJ, Tu X, Wu X, Bai S, Zhao H, Kobayashi T, et al. Notch signaling maintains bone marrow mesenchymal progenitors by suppressing osteoblast differentiation. Nature Medicine 2008;14:306–14. Ideno H, Takanabe R, Shimada A, Imaizumi K, Araki R, Abe M, et al. Protein related to DAN and cerberus (PRDC) inhibits osteoblastic differentiation and its suppression promotes osteogenesis in vitro. Experimental Cell Research 2009;315:474–84. Itoh T, Ando M, Tsukamasa Y, Akao Y. Expression of BMP-2 and Ets1 in BMP-2stimulated mouse pre-osteoblast differentiation is regulated by microRNA-370. FEBS Letters 2012;586:1693–701. Itoh T, Nozawa Y, Akao Y. MicroRNA-141 and -200a are involved in bone morphogenetic protein-2-induced mouse pre-osteoblast differentiation by targeting distal-less homeobox 5. Journal of Biological Chemistry 2009;284:19272–9. Itoh T, Takeda S, Akao Y. MicroRNA-208 modulates BMP-2-stimulated mouse preosteoblast differentiation by directly targeting V-ets erythroblastosis virus E26 oncogene homolog 1. Journal of Biological Chemistry 2010;285:27745–52. Ji J, Yamashita T, Budhu A, Forgues M, Jia HL, Li C, et al. Identification of microRNA181 by genome-wide screening as a critical player in EpCAM-positive hepatic cancer stem cells. Hepatology 2009;50:472–80. Ji J, Yamashita T, Wang XW. Wnt/beta-catenin signaling activates microRNA-181 expression in hepatocellular carcinoma. Cell & Bioscience 2011;1:4. Jones KB, Salah Z, Del Mare S, Galasso M, Gaudio E, Nuovo GJ, et al. miRNA signatures associate with pathogenesis and progression of osteosarcoma. Cancer Research 2012;72:1865–77. Kapinas K, Kessler C, Ricks T, Gronowicz G, Delany AM. miR-29 modulates Wnt signaling in human osteoblasts through a positive feedback loop. Journal of Biological Chemistry 2010;285:25221–31. Kim KM, Park SJ, Jung SH, Kim EJ, Jogeswar G, Ajita J, et al. miR-182 is a negative regulator of osteoblast proliferation, differentiation and skeletogenesis through targeting FoxO1. Journal of Bone and Mineral Research 2012;27:1669–79. Q3 Komori T. Regulation of osteoblast differentiation by transcription factors. Journal of Cellular Biochemistry 2006;99:1233–9. Lee I, Ajay SS, Yook JI, Kim HS, Hong SH, Kim NH, et al. New class of microRNA targets containing simultaneous 5 -UTR and 3 -UTR interaction sites. Genome Research 2009;19:1175–83. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005;120:15–20. Li Z, Hassan MQ, Jafferji M, Aqeilan RI, Garzon R, Croce CM, et al. Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation. Journal of Biological Chemistry 2009;284:15676–84. Li Z, Hassan MQ, Volinia S, van Wijnen AJ, Stein JL, Croce CM, et al. A microRNA signature for a BMP2-induced osteoblast lineage commitment program. Proceedings of the National Academy of Sciences of the United States of America 2008;105:13906–11.
513
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588
G Model BC 3909 1–10 10 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636
Q4
ARTICLE IN PRESS R. Bhushan et al. / The International Journal of Biochemistry & Cell Biology xxx (2012) xxx–xxx
Lian JB, Stein GS, van Wijnen AJ, Stein JL, Hassan MQ, Gaur T, et al. MicroRNA control of bone formation and homeostasis. Nature Reviews Endocrinology 2012;8:212–27. Lin J, Patel SR, Cheng X, Cho EA, Levitan I, Ullenbruch M, et al. Kielin/chordin-like protein, a novel enhancer of BMP signaling, attenuates renal fibrotic disease. Nature Medicine 2005;11:387–93. Lin J, Patel SR, Wang M, Dressler GR. The cysteine-rich domain protein KCP is a suppressor of transforming growth factor beta/activin signaling in renal epithelia. Molecular and Cellular Biology 2006;26:4577–85. Liu L, Wang Y, Fan H, Zhao X, Liu D, Hu Y, et al. Mir-181a regulates MSCs growth and immune function: microRNA-181a regulates local immune balance by inhibiting proliferation and immunosuppressive properties of mesenchymal stem cells. Stem Cells 2012;30:1756–70. Long F. Building strong bones: molecular regulation of the osteoblast lineage. Nature Reviews Molecular Cell Biology 2012;13:27–38. Long F, Chung UI, Ohba S, McMahon J, Kronenberg HM, McMahon AP. Ihh signaling is directly required for the osteoblast lineage in the endochondral skeleton. Development 2004;131:1309–18. MacArthur BD, Tare RS, Murawski K, Oreffo RO. Identification of candidate regulators of multipotency in human skeletal progenitor cells. Biochemical and Biophysical Research Communications 2008;377:68–72. Maeda S, Hayashi M, Komiya S, Imamura T, Miyazono K. Endogenous TGF-beta signaling suppresses maturation of osteoblastic mesenchymal cells. EMBO Journal 2004;23:552–63. Major MB, Jones DA. Identification of a gadd45beta 3’ enhancer that mediates SMAD3- and SMAD4-dependent transcriptional induction by transforming growth factor beta. Journal of Biological Chemistry 2004;279:5278–87. Mizuno Y, Tokuzawa Y, Ninomiya Y, Yagi K, Yatsuka-Kanesaki Y, Suda T, et al. miR210 promotes osteoblastic differentiation through inhibition of AcvR1b. FEBS Letters 2009;583:2263–8. Naguibneva I, Ameyar-Zazoua M, Polesskaya A, Ait-Si-Ali S, Groisman R, Souidi M, et al. The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation. Nature Cell Biology 2006;8: 278–84. Nakashima K, de Crombrugghe B. Transcriptional mechanisms in osteoblast differentiation and bone formation. Trends in Genetics 2003;19:458–66. Nemer G, Nemer M. Transcriptional activation of BMP-4 and regulation of mammalian organogenesis by GATA-4 and -6. Developmental Biology 2003;254:131–48. Ota T, Fujii M, Sugizaki T, Ishii M, Miyazawa K, Aburatani H, et al. Targets of transcriptional regulation by two distinct type I receptors for transforming growth factor-beta in human umbilical vein endothelial cells. Journal of Cellular Physiology 2002;193:299–318. Posey KL, Hankenson K, Veerisetty AC, Bornstein P, Lawler J, Hecht JT. Skeletal abnormalities in mice lacking extracellular matrix proteins, thrombospondin-1, thrombospondin-3, thrombospondin-5, and type IX collagen. American Journal of Pathology 2008;172:1664–74. Ruiz de Azua I, Scarselli M, Rosemond E, Gautam D, Jou W, Gavrilova O, et al. RGS4 is a negative regulator of insulin release from pancreatic beta-cells in vitro and
in vivo. Proceedings of the National Academy of Sciences of the United States of America 2010;107:7999–8004. Sampath TK, Muthukumaran N, Reddi AH. Isolation of osteogenin, an extracellular matrix-associated, bone-inductive protein, by heparin affinity chromatography. Proceedings of the National Academy of Sciences of the United States of America 1987;84:7109–13. Sun J, Zhong N, Li Q, Min Z, Zhao W, Sun Q, et al. MicroRNAs of rat articular cartilage at different developmental stages identified by Solexa sequencing. Osteoarthritis and Cartilage 2011;19:1237–45. Takekawa M, Tatebayashi K, Itoh F, Adachi M, Imai K, Saito H. Smad-dependent GADD45beta expression mediates delayed activation of p38 MAP kinase by TGFbeta. EMBO Journal 2002;21:6473–82. Takeuchi K, Abe M, Hiasa M, Oda A, Amou H, Kido S, et al. Tgf-Beta inhibition restores terminal osteoblast differentiation to suppress myeloma growth. PLoS One 2010;5:e9870. Tay Y, Zhang J, Thomson AM, Lim B, Rigoutsos I. MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature 2008;455:1124–8. Teplyuk NM, Galindo M, Teplyuk VI, Pratap J, Young DW, Lapointe D, et al. Runx2 regulates G protein-coupled signaling pathways to control growth of osteoblast progenitors. Journal of Biological Chemistry 2008;283:27585–97. Thapa N, Kang KB, Kim IS. Beta ig-h3 mediates osteoblast adhesion and inhibits differentiation. Bone 2005;36:232–42. Thapa N, Lee BH, Kim IS. TGFBIp/betaig-h3 protein: a versatile matrix molecule induced by TGF-beta. International Journal of Biochemistry and Cell Biology 2007;39:2183–94. Wang EA, Rosen V, Cordes P, Hewick RM, Kriz MJ, Luxenberg DP, et al. Purification and characterization of other distinct bone-inducing factors. Proceedings of the National Academy of Sciences of the United States of America 1988;85:9484–8. Wei J, Shi Y, Zheng L, Zhou B, Inose H, Wang J, et al. miR-34s inhibit osteoblast proliferation and differentiation in the mouse by targeting SATB2. Journal of Cell Biology 2012;197:509–21. Yanai H, Chen HM, Inuzuka T, Kondo S, Mak TW, Takaoka A, et al. Role of IFN regulatory factor 5 transcription factor in antiviral immunity and tumor suppression. Proceedings of the National Academy of Sciences of the United States of America 2007;104:3402–7. Yang L, Cheng P, Chen C, He HB, Xie GQ, Zhou HD, et al. miR-93/Sp7 function loop mediates osteoblast mineralization. Journal of Bone and Mineral Research 2012;27:1598–606. Yoo J, Ghiassi M, Jirmanova L, Balliet AG, Hoffman B, Fornace Jr AJ, et al. Transforming growth factor-beta-induced apoptosis is mediated by Smad-dependent expression of GADD45b through p38 activation. Journal of Biological Chemistry 2003;278:43001–7. Zhang J, Tu Q, Bonewald LF, He X, Stein G, Lian J, et al. Effects of miR-335-5p in modulating osteogenic differentiation by specifically downregulating Wnt antagonist DKK1. Journal of Bone and Mineral Research 2011a;26:1953–63. Zhang JF, Fu WM, He ML, Xie WD, Lv Q, Wan G, et al. MiRNA-20a promotes osteogenic differentiation of human mesenchymal stem cells by co-regulating Q5 BMP signaling. RNA Biology 2011b;8:829–38.
Please cite this article in press as: Bhushan R, et al. miR-181a promotes osteoblastic differentiation through repression of TGF- signaling molecules. Int J Biochem Cell Biol (2012), http://dx.doi.org/10.1016/j.biocel.2012.12.008
637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685