- Email: [email protected]
Mitochondrial myopathy in a child with a muscle-restricted mutation in the mitochondrial transfer RNAAsn gene
Biochemical and Biophysical Research Communications 412 (2011) 518–521
Contents lists available at SciVerse ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Mitochondrial myopathy in a child with a muscle-restricted mutation in the mitochondrial transfer RNAAsn gene Claudio Bruno a,⇑, Denise Cassandrini b, Fabiana Fattori c, Marina Pedemonte a, Chiara Fiorillo b, Giorgia Brigati a, Giacomo Brisca a, Carlo Minetti a, Filippo M. Santorelli b a b c
Unit of Muscular and Neurodegenerative Disease, IRCCS G. Gaslini Institute, Genova, Italy Unit of Molecular Medicine, IRCCS Stella Maris, Pisa, Italy Unit of Molecular Medicine for Neuromuscular and Neurodegenerative Disorders, IRCCS Bambino Gesù Hospital, Rome, Italy
a r t i c l e
i n f o
Article history: Received 20 June 2011 Available online 29 June 2011 Keywords: Mitochondrial myopathy mt-tRNA gene Exercise intolerance
a b s t r a c t We report an 11-year-old boy with exercise-related myopathy, and a novel mutation m.5669G>A in the mitochondrial tRNA Asparagine gene (mt-tRNAAsn, MTTN). Muscle biopsy studies showed COX-negative, SDH-positive fibers at histochemistry and biochemical defects of oxidative metabolism. The m.5669G>A mutation was present only in patient’s muscle resulting in the first muscle-specific MTTN mutation. MttRNAAsn steady-state levels and in silico predictions supported the pathogenicity of this mutation. A mitochondrial myopathy should be considered in the differential diagnosis of exercise intolerance in children. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Exercise intolerance, a common presentation of disorders of glycogen and lipid metabolism, has been associated in the last decade with specific mutations in protein encoding genes of mitochondrial DNA (mtDNA), and in different mitochondrial tRNAs [1]. As in other functional impairment of substrate utilization in muscle, defects in the mitochondrial respiratory chain damage energy production and cause recurrent, reversible muscle dysfunction, manifesting as exercise intolerance, myalgia, and cramps. Muscle weakness is an alternative manifestation, often affecting extraocular muscles resulting in ptosis and in progressive external ophthalmoplegia (PEO), or limb girdle muscles with proximal myopathy [2]. Here, we report a child with a mitochondrial myopathy, characterized by mild exercise intolerance and mild weakness since age 10 years, who harbored a novel muscle-restricted mtDNA mutation (m.5669G>A) in the tRNAAsn (MTTN) gene.
2. Materials and methods
cular disease. His psychomotor developmental milestones were within the normal range. Since early childhood he suffered from unexplained easy fatigability. Serum CK levels were slightly increased (2–3). At 10-years of age he started to complain of muscle pain triggered by intense exercise. In one occasion, there was a rise of CK levels (up to 2000 U/l; normal <150) after intense exercise but he never presented myoglobinuria. Neurological examination at age 11 showed a slight decrease in muscle bulk, particularly at the scapular girdle and distally in his legs. His strength was decrease (4/5 MRC) distally in the legs. He did not have ptosis and his ocular motility was normal. Deep tendon reflexes, sensory examination, cerebellar function and cognition were normal. Serum CK and blood lactate levels were mildly elevated (350 U/l, normal <150; 2.9 mmol/l, normal <2.1, respectively). Metabolic laboratory investigations were normal. Electromyography (EMG) showed a myogenic pattern. Electrocardiogram and echocardiogram were normal. Two older sibs, the mother, and known maternal relatives are clinically normal. A muscle biopsy from m. vastus lateralis was performed at the age of 11 years and was analyzed histochemically and spectrophotometrically for alterations of oxidative metabolism as described [3].
2.1. Case report The patient, a full-term healthy infant, is the third child of a family with neither consanguinity nor family history of neuromus⇑ Corresponding author. Address: Laboratory of Muscle Pathology, Unit of Muscular and Neurodegenerative Disease, IRCCS Giannina Gaslini Institute, Largo G. Gaslini 5, 16147 Genova, Italy. Fax: +39 010 3538265. E-mail address: [email protected] (C. Bruno). 0006-291X/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2011.06.155
2.2. mtDNA analysis Total DNA was obtained from tissues using a standard method. Sequencing of mtDNA was performed on an ABI3500 automatic sequencer using the Big Dye terminator Labeling Kit (Applied BioSystems, Foster City, CA).
C. Bruno et al. / Biochemical and Biophysical Research Communications 412 (2011) 518–521
519
Fig. 1. (A) Serial muscle sections stained for cytochrome c oxidase (COX) (top panel) and succinate dehydrogenase (SDH) (bottom panel) reactions. Several fibers showed absence of COX activity (star) and marked mitochondrial proliferation, as shown by their strong SDH reaction (star). (B) Mutation affecting the mt-tRNAAsn gene. Sequence electropherogram encompassing the mt-tRNAAsn in patient’s skeletal muscle DNA and in a control. The m.5669G>A mutation is arrow-headed.
Fig. 2. (A) Quantification of the m.5669G>A mutation in the patient (M, muscle; B, blood), his mother (Mo), and two healthy controls (C) by PCR-RFLP (restriction-fragment length polymorphism) analysis employing the endonuclease BslI (New England Biolabs, Hitchin, UK). U, uncleaved fragment; S, 100-bp DNA marker size. Using PCR and primers (50 –30 ) MTF5630 (nt 5630–5666; AGCCACTTTAATTAAGCTAAGCCCTTACTCCACCAAT) (mismatched nucleotides are underlined) and MTR-5990 (nt 5966–5990; TAGGACTCCAGCTCATGCGCCGAAT), we amplified a 361-bp fragment encompassing the mutation. PCR was performed with a ‘‘last hot-cycle’’ in the presence of alpha-32P deoxycytidinetriphosphate. Equal amounts of products were cleaved with 10U BslI, separated through a 12% non-denaturing polyacrylamide gel, and radiolabeled products were quantified upon PhosphorImager analysis (Amersham Biosciences, Little Chalfont, UK). Wild-type amplicons are normally cleaved into fragments sized 249-, 76- and 36-bp (not shown). The m.5669G>A mutation removes a site of cleavage, resulting I fragments sized 249- and 112-bp (star). B. Determination of mt-tRNAAsn steady-state levels using high-resolution Northern blot. Total RNA (1 lg) was separated through a 13%, 8 M urea denaturing polyacrylamide gel, electroblotted onto membranes, and hybridised with alpha-32P-radiolabeled probes specific for mt-tRNAThr (endogenous control) and mt-tRNAAsn transcripts as in [4]. (i) Illustration of the relative mt-tRNAAsn/ mt-tRNAThr ratio in patient and control muscles (Ctrls). (ii) Representative determination of mt-tRNA transcripts in patient’s skeletal muscle (PM) and in an appropriate control sample (C).
Levels of mutant mtDNAs in different tissues from the child, and in blood from his mother were determined using a ‘‘last hot’’ labeled PCR method and the endonuclease BslI (New England Biolabs, Hitchin, UK). To investigate the functional effect of the
mutation on tRNA stability, mt-tRNAAsn steady state levels were determined by high resolution Northern blot analysis in muscle tissue and cultured skin fibroblasts, as described previously using the mt-tRNAThr levels as endogenous control for loading [4]. In sil-
520
C. Bruno et al. / Biochemical and Biophysical Research Communications 412 (2011) 518–521
ico predicted secondary structure of wild-type and mutated tRNAs were also analyzed [5]. 3. Results 3.1. Histochemical, biochemical and mtDNA analysis The muscle biopsy revealed the presence of several ragged red fibers (RRF) which resulted to be COX-negative and SDH-positive (Fig. 1A). Spectrophotometric analyses of the respiratory chain showed a generalized reduction of all the complexes. mtDNA analysis ruled out the presence of large-scale deletions and depletion and identified a novel G-to-A substitution at nucleotide 5669 in the tRNAAsn gene (Fig. 1B) when sequences were compared with the revised Cambridge sequence [6]. The nucleotide variant was not listed in the mitochondrial mutation databases (mtDB, Human Mitochondrial Genome Database, www.genpat.uu.se/mtDB, and MITOMAP, www.mitomap.org). When examining the radiolabeled PCR products by RFLP, the mutation appeared to be heteroplasmic in muscle (75%), whereas it was not detected in DNA from other tissues (peripheral blood and cultured skin fibroblasts) from the patient, and it was absent in the healthy mother and in 200 Caucasian control chromosomes (Fig. 2A). 3.2. Assessment of mt-tRNAAsn steady-state levels and in silico prediction Determination of mt-tRNAAsn steady-state levels showed a lower abundance relative to tissue-matched samples from individuals with no identifiable mtDNA defect used as controls. Following nor-
malization to mt-tRNAThr, there was a reduced mt-tRNAAsn/mttRNAThr ratio in the patient’s skeletal muscle (0.35; 0.85–1.25 in controls; Fig 2B) whereas comparable levels of the mature mttRNAAsn transcript were identified in patient and control fibroblasts (not shown). Analyses in silico showed that the m.5669G>A mutation-causing the substitution of a G–C base pair to a G–U base pair in the T stem of the tRNA cloverleaf-predicts a loss of free energy of 0.4 kcal/mol, thus altering the stability of the secondary structure of the molecule. 4. Discussion The early presentation of fatigue, intolerance to mild physical exercise, and a slight increase of serum CK levels initially pointed to a possible disorder of glycogen or lipid metabolism in the patient described in this work. His mild muscle weakness, together with the increase level of blood lactate led to muscle biopsy. Combination of COX-negative, SDH-positive fibers at histochemistry and biochemical defects of oxidative metabolism suggested a possible mtDNA alteration. The m.5669A>G mutation identified meets the canonical consensus criteria for pathogenicity [2] and the scoring criteria proposed by the Newcastle group [7] for the following reasons: (i) the mutation is heteroplasmic in muscle, the only tissue affected by the disease; (ii) histochemistry and biochemistry of muscle biopsy show a clear mitochondrial dysfunction in muscle biopsy; (iii) variant m.5669A>G had not been previously reported and was not observed in about 3000 human mtDNAs from different mitochondrial haplogroups [8]; (iv) the affected nucleotide, as the complementary one in the opposite strand of the T-stem, is conserved in the mt-tRNAAsn from all the species analyzed (Fig. 3A
Fig. 3. (A) Schematic cloverleaf structure of the human mitochondrial tRNAAsn gene, indicating the position of the pathogenic mutations reported in literature (blue circle) and in the present study (yellow circle). (B) Phylogenetic conservation of the tRNAAsn sequence and the position of the m.5669A. Position nucleotide 61 corresponding to mt position 5669 is indicated at the bottom (asterisk).
521
C. Bruno et al. / Biochemical and Biophysical Research Communications 412 (2011) 518–521 Table 1 Clinical and molecular findings of patients with MTTN gene mutations. tRNA level
#
Change
Clinical features
Muscle biopsy
% mutation in tissues
Ref.
Acceptor stem
2
5728A>G
Multiorgan failure (lethal)
ND
[16]
Anticodon stem Anticodon loop
27
5703C>T
32
5698C>T
RRF RRF, COX RRF, COX
37 38
5693A>G 5692A>G
Few COX ND ND ND
61
5669C>T
PEO, fatigability PEO, fatigability PEO, myopathy PEO, progressive proximal muscle weakness Encephalomyopathy PEO PEO PEO, ataxia, deafness, peripheral neuropathy, hypertrophic cardiomyopathy Exercise intolerance
M > 99%; FB 50%; B 50% M 69%; FB 6%; B 4% M 80%; B 48% Not reported M 80%; B 20% M 99%; B 99% ND ND ND
RRF, COX
M 75%; FB 0%; B 0%
T-stem
[12] [13] [11] [14] [15] [8] [9] [10] Present report
#, position in the tRNA cloverleaf; PEO, progressive external ophthalmoplegia; M, muscle; FB, fibroblasts; B, blood; RRF, ragged-red fibers; COX, cytochrome c oxidase; ND, no data.
and B); (v) there is an important decrease of the mutated transcript level, and (vi) in silico predictions further support a functional implication of the novel mutation. To date, five different MTTN mutations have been detected in nine patients (Table 1). Seven cases presented with chronic PEO, alone or combined with proximal myopathy [9–15], and one each had encepalomyopathy [16] and multiorgan failure [17]. The m.5693A>G associated with encephalomyopathy was homoplasmic in muscle and blood [16], whereas the remaining mutations were heteroplasmic in several tissues. Thus, the m.5669A>G mutation is the first MTTN mutation to be muscle-specific. Absence in tissues from his healthy mother suggests that the disorder in this child is due to a somatic mutation in myogenic stem cells after germ-layer differentiation. Following the original observations by DiMauro and Andreu [1,2], several mtDNA point mutations affecting both tRNAs and protein-coding genes have been identified in patients with exercise intolerance or pure myopathy [18,19]. Almost invariably in the literature, the disease is diagnosed in early adulthood or even later, despite a long lasting exercise intolerance, with a few cases being described in teenagers [18,20]. Our findings further broaden the clinical and genetic spectrum of mutations in MTTN, and indicate that a mtDNA mutation should be considered as a possible cause of sporadic, otherwise undiagnosed exercise-related myopathy in childhood. References [1] S. DiMauro, A.L. Andreu, Mutations in mitochondrial DNA as a cause of exercise intolerance, Ann. Med. 33 (2001) 472–476. [2] S. DiMauro, E.A. Schon, Mitochondrial respiratory-chain diseases, N. Engl. J. Med. 348 (2003) 2656–2668. [3] V. Dubowitz, C.A. Sewry, Muscle Biopsy a Practical Approach, third ed., Elsevier, 2007. [4] H.A. Tuppen, F. Fattori, R. Carrozzo, et al., Further pitfalls in the diagnosis of mtDNA mutations: homoplasmic mt-tRNA mutations, J. Med. Genet. 45 (2008) 55–61.
[5] A.R. Gruber, R. Lorenz, S.H. Bernhart, et al., The Vienna RNA website, Nucleic Acids Res. 36 (Web Server issue) (2008) W70–W74. [6] R.M. Andrews, I. Kubacka, P.F. Chinnery, et al., Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA, Nat. Genet. 23 (1999) 147. [7] R. McFarland, J.L. Elson, R.W. Taylor, et al., Assigning pathogenicity to mitochondrial tRNA mutations: when ‘‘definitely maybe’’ is not good enough, Trends Genet. 20 (2004) 591–596. [8] E. Ruiz-Pesini, M.T. Lott, V. Procaccio, et al., An enhanced MITOMAP with a global mtDNA mutational phylogeny, Nucleic Acids Res. 35 (Database issue) (2007) D823–D828. [9] C. Munscher, J. Muller-Hocker, B. Kadenbach, Human aging is associated with various point mutations in tRNA genes of mitochondrial DNA, Biol. Chem. Hoppe Seyler 3748 (1993) 1099–1104. [10] P. Seibel, J. Lauber, T. Klopstock, et al., Chronic progressive external ophthalmoplegia is associated with a novel mutation in the mitochondrial tRNAAsn gene, Biochem. Biophys. Res. Comm. 204 (1994) 482–489. [11] D. Sternberg, C. Danan, A. Lombes, et al., Exhaustive scanning approach to screen all the mitochondrial tRNA genes for mutations and its application to the investigation of 35 independent patients with mitochondrial disorders, Hum. Mol. Genet. 7 (1998) 33–42. [12] D. Sternberg, E. Chatzoglou, P. Laforet, Mitochondrial DNA transfer RNA gene sequence variations in patients with mitochondrial disorders, Brain 124 (2001) 984–994. [13] C.T. Moraes, F. Ciacci, E. Bonilla, et al., Two novel pathogenic mitochondrial DNA mutations affecting organelle number and protein synthesis. Is the tRNALeu(UUR) gene an etiologic hot spot?, J Clin. Invest. 92 (1993) 2906–2915. [14] C. Vives-Bauza, M. Del Toro, A. Solano, et al., Genotype–phenotype correlation in the 5703G>A mutation in the tRNA(ASN) gene of mitochondrial DNA, J. Inherit. Metab. Dis. 26 (2003) 507–508. [15] A. Spinazzola, F. Carrara, M. Mora, et al., Mitochondrial myopathy and ophthalmoplegia in a sporadic patient with the 5698G?A mitochondrial DNA mutation, Neuromuscul. Disord. 14 (2004) 815–817. [16] L. Coulbault, D. Herlicoviez, F. Chapon, et al., A novel mutation in the mitochondrial tRNAAsn gene associated with a lethal disease, Biochem. Biophys. Res. Comm. 329 (2005) 1152–1154. [17] A. Meulemans, S. Seneca, L. Lagae, et al., A novel mitochondrial transfer RNA(Asn) mutation causing multiorgan failure, Arch. Neurol. 63 (2006) 1194– 1198. [18] F. Scaglia, L.J. Wong, Human mitochondrial transfer RNAs: role of pathogenic mutation in disease, Muscle Nerve 37 (2008) 150–171. [19] L.J. Wong, Pathogenic mitochondrial DNA mutations in protein-coding genes, Muscle Nerve 36 (2007) 279–293. [20] E. Zifa, S. Giannouli, P. Theotokis, et al., Mitochondrial tRNA mutations: clinical and functional perturbations, RNA Biol. 4 (2007) 38–66.
Contents lists available at SciVerse ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Mitochondrial myopathy in a child with a muscle-restricted mutation in the mitochondrial transfer RNAAsn gene Claudio Bruno a,⇑, Denise Cassandrini b, Fabiana Fattori c, Marina Pedemonte a, Chiara Fiorillo b, Giorgia Brigati a, Giacomo Brisca a, Carlo Minetti a, Filippo M. Santorelli b a b c
Unit of Muscular and Neurodegenerative Disease, IRCCS G. Gaslini Institute, Genova, Italy Unit of Molecular Medicine, IRCCS Stella Maris, Pisa, Italy Unit of Molecular Medicine for Neuromuscular and Neurodegenerative Disorders, IRCCS Bambino Gesù Hospital, Rome, Italy
a r t i c l e
i n f o
Article history: Received 20 June 2011 Available online 29 June 2011 Keywords: Mitochondrial myopathy mt-tRNA gene Exercise intolerance
a b s t r a c t We report an 11-year-old boy with exercise-related myopathy, and a novel mutation m.5669G>A in the mitochondrial tRNA Asparagine gene (mt-tRNAAsn, MTTN). Muscle biopsy studies showed COX-negative, SDH-positive fibers at histochemistry and biochemical defects of oxidative metabolism. The m.5669G>A mutation was present only in patient’s muscle resulting in the first muscle-specific MTTN mutation. MttRNAAsn steady-state levels and in silico predictions supported the pathogenicity of this mutation. A mitochondrial myopathy should be considered in the differential diagnosis of exercise intolerance in children. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Exercise intolerance, a common presentation of disorders of glycogen and lipid metabolism, has been associated in the last decade with specific mutations in protein encoding genes of mitochondrial DNA (mtDNA), and in different mitochondrial tRNAs [1]. As in other functional impairment of substrate utilization in muscle, defects in the mitochondrial respiratory chain damage energy production and cause recurrent, reversible muscle dysfunction, manifesting as exercise intolerance, myalgia, and cramps. Muscle weakness is an alternative manifestation, often affecting extraocular muscles resulting in ptosis and in progressive external ophthalmoplegia (PEO), or limb girdle muscles with proximal myopathy [2]. Here, we report a child with a mitochondrial myopathy, characterized by mild exercise intolerance and mild weakness since age 10 years, who harbored a novel muscle-restricted mtDNA mutation (m.5669G>A) in the tRNAAsn (MTTN) gene.
2. Materials and methods
cular disease. His psychomotor developmental milestones were within the normal range. Since early childhood he suffered from unexplained easy fatigability. Serum CK levels were slightly increased (2–3). At 10-years of age he started to complain of muscle pain triggered by intense exercise. In one occasion, there was a rise of CK levels (up to 2000 U/l; normal <150) after intense exercise but he never presented myoglobinuria. Neurological examination at age 11 showed a slight decrease in muscle bulk, particularly at the scapular girdle and distally in his legs. His strength was decrease (4/5 MRC) distally in the legs. He did not have ptosis and his ocular motility was normal. Deep tendon reflexes, sensory examination, cerebellar function and cognition were normal. Serum CK and blood lactate levels were mildly elevated (350 U/l, normal <150; 2.9 mmol/l, normal <2.1, respectively). Metabolic laboratory investigations were normal. Electromyography (EMG) showed a myogenic pattern. Electrocardiogram and echocardiogram were normal. Two older sibs, the mother, and known maternal relatives are clinically normal. A muscle biopsy from m. vastus lateralis was performed at the age of 11 years and was analyzed histochemically and spectrophotometrically for alterations of oxidative metabolism as described [3].
2.1. Case report The patient, a full-term healthy infant, is the third child of a family with neither consanguinity nor family history of neuromus⇑ Corresponding author. Address: Laboratory of Muscle Pathology, Unit of Muscular and Neurodegenerative Disease, IRCCS Giannina Gaslini Institute, Largo G. Gaslini 5, 16147 Genova, Italy. Fax: +39 010 3538265. E-mail address: [email protected] (C. Bruno). 0006-291X/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2011.06.155
2.2. mtDNA analysis Total DNA was obtained from tissues using a standard method. Sequencing of mtDNA was performed on an ABI3500 automatic sequencer using the Big Dye terminator Labeling Kit (Applied BioSystems, Foster City, CA).
C. Bruno et al. / Biochemical and Biophysical Research Communications 412 (2011) 518–521
519
Fig. 1. (A) Serial muscle sections stained for cytochrome c oxidase (COX) (top panel) and succinate dehydrogenase (SDH) (bottom panel) reactions. Several fibers showed absence of COX activity (star) and marked mitochondrial proliferation, as shown by their strong SDH reaction (star). (B) Mutation affecting the mt-tRNAAsn gene. Sequence electropherogram encompassing the mt-tRNAAsn in patient’s skeletal muscle DNA and in a control. The m.5669G>A mutation is arrow-headed.
Fig. 2. (A) Quantification of the m.5669G>A mutation in the patient (M, muscle; B, blood), his mother (Mo), and two healthy controls (C) by PCR-RFLP (restriction-fragment length polymorphism) analysis employing the endonuclease BslI (New England Biolabs, Hitchin, UK). U, uncleaved fragment; S, 100-bp DNA marker size. Using PCR and primers (50 –30 ) MTF5630 (nt 5630–5666; AGCCACTTTAATTAAGCTAAGCCCTTACTCCACCAAT) (mismatched nucleotides are underlined) and MTR-5990 (nt 5966–5990; TAGGACTCCAGCTCATGCGCCGAAT), we amplified a 361-bp fragment encompassing the mutation. PCR was performed with a ‘‘last hot-cycle’’ in the presence of alpha-32P deoxycytidinetriphosphate. Equal amounts of products were cleaved with 10U BslI, separated through a 12% non-denaturing polyacrylamide gel, and radiolabeled products were quantified upon PhosphorImager analysis (Amersham Biosciences, Little Chalfont, UK). Wild-type amplicons are normally cleaved into fragments sized 249-, 76- and 36-bp (not shown). The m.5669G>A mutation removes a site of cleavage, resulting I fragments sized 249- and 112-bp (star). B. Determination of mt-tRNAAsn steady-state levels using high-resolution Northern blot. Total RNA (1 lg) was separated through a 13%, 8 M urea denaturing polyacrylamide gel, electroblotted onto membranes, and hybridised with alpha-32P-radiolabeled probes specific for mt-tRNAThr (endogenous control) and mt-tRNAAsn transcripts as in [4]. (i) Illustration of the relative mt-tRNAAsn/ mt-tRNAThr ratio in patient and control muscles (Ctrls). (ii) Representative determination of mt-tRNA transcripts in patient’s skeletal muscle (PM) and in an appropriate control sample (C).
Levels of mutant mtDNAs in different tissues from the child, and in blood from his mother were determined using a ‘‘last hot’’ labeled PCR method and the endonuclease BslI (New England Biolabs, Hitchin, UK). To investigate the functional effect of the
mutation on tRNA stability, mt-tRNAAsn steady state levels were determined by high resolution Northern blot analysis in muscle tissue and cultured skin fibroblasts, as described previously using the mt-tRNAThr levels as endogenous control for loading [4]. In sil-
520
C. Bruno et al. / Biochemical and Biophysical Research Communications 412 (2011) 518–521
ico predicted secondary structure of wild-type and mutated tRNAs were also analyzed [5]. 3. Results 3.1. Histochemical, biochemical and mtDNA analysis The muscle biopsy revealed the presence of several ragged red fibers (RRF) which resulted to be COX-negative and SDH-positive (Fig. 1A). Spectrophotometric analyses of the respiratory chain showed a generalized reduction of all the complexes. mtDNA analysis ruled out the presence of large-scale deletions and depletion and identified a novel G-to-A substitution at nucleotide 5669 in the tRNAAsn gene (Fig. 1B) when sequences were compared with the revised Cambridge sequence [6]. The nucleotide variant was not listed in the mitochondrial mutation databases (mtDB, Human Mitochondrial Genome Database, www.genpat.uu.se/mtDB, and MITOMAP, www.mitomap.org). When examining the radiolabeled PCR products by RFLP, the mutation appeared to be heteroplasmic in muscle (75%), whereas it was not detected in DNA from other tissues (peripheral blood and cultured skin fibroblasts) from the patient, and it was absent in the healthy mother and in 200 Caucasian control chromosomes (Fig. 2A). 3.2. Assessment of mt-tRNAAsn steady-state levels and in silico prediction Determination of mt-tRNAAsn steady-state levels showed a lower abundance relative to tissue-matched samples from individuals with no identifiable mtDNA defect used as controls. Following nor-
malization to mt-tRNAThr, there was a reduced mt-tRNAAsn/mttRNAThr ratio in the patient’s skeletal muscle (0.35; 0.85–1.25 in controls; Fig 2B) whereas comparable levels of the mature mttRNAAsn transcript were identified in patient and control fibroblasts (not shown). Analyses in silico showed that the m.5669G>A mutation-causing the substitution of a G–C base pair to a G–U base pair in the T stem of the tRNA cloverleaf-predicts a loss of free energy of 0.4 kcal/mol, thus altering the stability of the secondary structure of the molecule. 4. Discussion The early presentation of fatigue, intolerance to mild physical exercise, and a slight increase of serum CK levels initially pointed to a possible disorder of glycogen or lipid metabolism in the patient described in this work. His mild muscle weakness, together with the increase level of blood lactate led to muscle biopsy. Combination of COX-negative, SDH-positive fibers at histochemistry and biochemical defects of oxidative metabolism suggested a possible mtDNA alteration. The m.5669A>G mutation identified meets the canonical consensus criteria for pathogenicity [2] and the scoring criteria proposed by the Newcastle group [7] for the following reasons: (i) the mutation is heteroplasmic in muscle, the only tissue affected by the disease; (ii) histochemistry and biochemistry of muscle biopsy show a clear mitochondrial dysfunction in muscle biopsy; (iii) variant m.5669A>G had not been previously reported and was not observed in about 3000 human mtDNAs from different mitochondrial haplogroups [8]; (iv) the affected nucleotide, as the complementary one in the opposite strand of the T-stem, is conserved in the mt-tRNAAsn from all the species analyzed (Fig. 3A
Fig. 3. (A) Schematic cloverleaf structure of the human mitochondrial tRNAAsn gene, indicating the position of the pathogenic mutations reported in literature (blue circle) and in the present study (yellow circle). (B) Phylogenetic conservation of the tRNAAsn sequence and the position of the m.5669A. Position nucleotide 61 corresponding to mt position 5669 is indicated at the bottom (asterisk).
521
C. Bruno et al. / Biochemical and Biophysical Research Communications 412 (2011) 518–521 Table 1 Clinical and molecular findings of patients with MTTN gene mutations. tRNA level
#
Change
Clinical features
Muscle biopsy
% mutation in tissues
Ref.
Acceptor stem
2
5728A>G
Multiorgan failure (lethal)
ND
[16]
Anticodon stem Anticodon loop
27
5703C>T
32
5698C>T
RRF RRF, COX RRF, COX
37 38
5693A>G 5692A>G
Few COX ND ND ND
61
5669C>T
PEO, fatigability PEO, fatigability PEO, myopathy PEO, progressive proximal muscle weakness Encephalomyopathy PEO PEO PEO, ataxia, deafness, peripheral neuropathy, hypertrophic cardiomyopathy Exercise intolerance
M > 99%; FB 50%; B 50% M 69%; FB 6%; B 4% M 80%; B 48% Not reported M 80%; B 20% M 99%; B 99% ND ND ND
RRF, COX
M 75%; FB 0%; B 0%
T-stem
[12] [13] [11] [14] [15] [8] [9] [10] Present report
#, position in the tRNA cloverleaf; PEO, progressive external ophthalmoplegia; M, muscle; FB, fibroblasts; B, blood; RRF, ragged-red fibers; COX, cytochrome c oxidase; ND, no data.
and B); (v) there is an important decrease of the mutated transcript level, and (vi) in silico predictions further support a functional implication of the novel mutation. To date, five different MTTN mutations have been detected in nine patients (Table 1). Seven cases presented with chronic PEO, alone or combined with proximal myopathy [9–15], and one each had encepalomyopathy [16] and multiorgan failure [17]. The m.5693A>G associated with encephalomyopathy was homoplasmic in muscle and blood [16], whereas the remaining mutations were heteroplasmic in several tissues. Thus, the m.5669A>G mutation is the first MTTN mutation to be muscle-specific. Absence in tissues from his healthy mother suggests that the disorder in this child is due to a somatic mutation in myogenic stem cells after germ-layer differentiation. Following the original observations by DiMauro and Andreu [1,2], several mtDNA point mutations affecting both tRNAs and protein-coding genes have been identified in patients with exercise intolerance or pure myopathy [18,19]. Almost invariably in the literature, the disease is diagnosed in early adulthood or even later, despite a long lasting exercise intolerance, with a few cases being described in teenagers [18,20]. Our findings further broaden the clinical and genetic spectrum of mutations in MTTN, and indicate that a mtDNA mutation should be considered as a possible cause of sporadic, otherwise undiagnosed exercise-related myopathy in childhood. References [1] S. DiMauro, A.L. Andreu, Mutations in mitochondrial DNA as a cause of exercise intolerance, Ann. Med. 33 (2001) 472–476. [2] S. DiMauro, E.A. Schon, Mitochondrial respiratory-chain diseases, N. Engl. J. Med. 348 (2003) 2656–2668. [3] V. Dubowitz, C.A. Sewry, Muscle Biopsy a Practical Approach, third ed., Elsevier, 2007. [4] H.A. Tuppen, F. Fattori, R. Carrozzo, et al., Further pitfalls in the diagnosis of mtDNA mutations: homoplasmic mt-tRNA mutations, J. Med. Genet. 45 (2008) 55–61.
[5] A.R. Gruber, R. Lorenz, S.H. Bernhart, et al., The Vienna RNA website, Nucleic Acids Res. 36 (Web Server issue) (2008) W70–W74. [6] R.M. Andrews, I. Kubacka, P.F. Chinnery, et al., Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA, Nat. Genet. 23 (1999) 147. [7] R. McFarland, J.L. Elson, R.W. Taylor, et al., Assigning pathogenicity to mitochondrial tRNA mutations: when ‘‘definitely maybe’’ is not good enough, Trends Genet. 20 (2004) 591–596. [8] E. Ruiz-Pesini, M.T. Lott, V. Procaccio, et al., An enhanced MITOMAP with a global mtDNA mutational phylogeny, Nucleic Acids Res. 35 (Database issue) (2007) D823–D828. [9] C. Munscher, J. Muller-Hocker, B. Kadenbach, Human aging is associated with various point mutations in tRNA genes of mitochondrial DNA, Biol. Chem. Hoppe Seyler 3748 (1993) 1099–1104. [10] P. Seibel, J. Lauber, T. Klopstock, et al., Chronic progressive external ophthalmoplegia is associated with a novel mutation in the mitochondrial tRNAAsn gene, Biochem. Biophys. Res. Comm. 204 (1994) 482–489. [11] D. Sternberg, C. Danan, A. Lombes, et al., Exhaustive scanning approach to screen all the mitochondrial tRNA genes for mutations and its application to the investigation of 35 independent patients with mitochondrial disorders, Hum. Mol. Genet. 7 (1998) 33–42. [12] D. Sternberg, E. Chatzoglou, P. Laforet, Mitochondrial DNA transfer RNA gene sequence variations in patients with mitochondrial disorders, Brain 124 (2001) 984–994. [13] C.T. Moraes, F. Ciacci, E. Bonilla, et al., Two novel pathogenic mitochondrial DNA mutations affecting organelle number and protein synthesis. Is the tRNALeu(UUR) gene an etiologic hot spot?, J Clin. Invest. 92 (1993) 2906–2915. [14] C. Vives-Bauza, M. Del Toro, A. Solano, et al., Genotype–phenotype correlation in the 5703G>A mutation in the tRNA(ASN) gene of mitochondrial DNA, J. Inherit. Metab. Dis. 26 (2003) 507–508. [15] A. Spinazzola, F. Carrara, M. Mora, et al., Mitochondrial myopathy and ophthalmoplegia in a sporadic patient with the 5698G?A mitochondrial DNA mutation, Neuromuscul. Disord. 14 (2004) 815–817. [16] L. Coulbault, D. Herlicoviez, F. Chapon, et al., A novel mutation in the mitochondrial tRNAAsn gene associated with a lethal disease, Biochem. Biophys. Res. Comm. 329 (2005) 1152–1154. [17] A. Meulemans, S. Seneca, L. Lagae, et al., A novel mitochondrial transfer RNA(Asn) mutation causing multiorgan failure, Arch. Neurol. 63 (2006) 1194– 1198. [18] F. Scaglia, L.J. Wong, Human mitochondrial transfer RNAs: role of pathogenic mutation in disease, Muscle Nerve 37 (2008) 150–171. [19] L.J. Wong, Pathogenic mitochondrial DNA mutations in protein-coding genes, Muscle Nerve 36 (2007) 279–293. [20] E. Zifa, S. Giannouli, P. Theotokis, et al., Mitochondrial tRNA mutations: clinical and functional perturbations, RNA Biol. 4 (2007) 38–66.