- Email: [email protected]
Sporadic mitochondrial myopathy due to a new mutation in the mitochondrial tRNASer(UCN) gene
Neuromuscular Disorders 14 (2004) 417–420 www.elsevier.com/locate/nmd
Sporadic mitochondrial myopathy due to a new mutation in the mitochondrial tRNASer(UCN) gene Seyed Bidookia, Margaret J. Jacksona, Margaret A. Johnsona, Zofia M.A. Chrzanowska-Lightowlersa, Robert W. Taylora, Graham Venablesb, Robert N. Lightowlersa, Douglass M. Turnbulla, Laurence A. Bindoff c,* a
Mitochondrial Research Group, School of Neurology, Neurobiology and Psychiatry, The Medical School, Framlington Place, Newcastle upon Tyne NE2 4HH, UK b Neurology Department, Sheffield Teaching Hospitals NHS Trust, Sheffield S10 2JF, UK c Department of Neurology, Institute of Clinical Medicine and Molecular Medicine, University of Bergen, Haukeland University Hospital, 5021 Bergen, Norway Received 26 January 2004; received in revised form 12 March 2004; accepted 15 March 2004
Abstract We describe a young woman with a progressive mitochondrial myopathy that started with muscle weakness and went on to include deafness, dementia and ataxia. Skeletal muscle showed the histological and biochemical features of mitochondrial respiratory chain dysfunction. Genetic analysis identified a novel, heteroplasmic, A to G transition in tRNASer(UCN) at position 7480 affecting a highly conserved base in the anticodon loop. Single-fibre PCR showed highest levels of mutation in cytochrome c-oxidase-deficient fibres and quantification in two biopsies taken 5 years apart showed no change in percentage heteroplasmy. The mutation was present at lower levels in the patient’s blood, but was not found in either her mother’s or sister’s blood and skeletal muscle, suggesting a sporadic occurrence. This is the eighth disease-causing mutation in this tRNA gene and confirms serine (UCN) as one of the most common sites for mtDNA mutation. q 2004 Elsevier B.V. All rights reserved. Keywords: Mitochondrial myopathy; mtDNA; tRNA Serine
1. Introduction Mitochondrial myopathy is collective term for a group of clinically varied disorders [1]. Whilst these disorders often affect several tissues simultaneously, muscle and the central nervous system (CNS) are sites of predilection. The majority of adult patients with mitochondrial disease have defects (large scale rearrangements or point mutations) involving the mitochondrial DNA (mtDNA), a small genome that encodes thirteen proteins, two ribosomal RNA and 22 transfer RNA. The proteins are all components of the respiratory chain whereas the structural RNA are involved in intramitochondrial protein synthesis. Since the late 1980s, over 100 pathogenic mtDNA point mutations and deletions have been identified [2,3], with mutations involving tRNA appearing to be the most * Corresponding author. Tel.: þ 47-559-75-070; fax: þ47-559-75-165. E-mail address: [email protected] (L.A. Bindoff). 0960-8966/$ - see front matter q 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.nmd.2004.03.004
common. Whilst affecting a similar substrate, different tRNA mutations give rise to widely differing phenotypes. Interestingly, certain tRNA appear preferentially affected, for example, the tRNA for leucine (UUR), isoleucine and serine (UCN). We describe a patient who presented with a myopathy and went on to develop progressive disease of the central nervous system. Genetic analysis identified a mutation in tRNASer(UCN) and longitudinal studies showed no change in the degree of heteroplasmy. This is the eighth mutation in this tRNA and in this patient the mutation appears sporadic.
2. Patient and methods 2.1. Case history The patient, who is now 36, was first seen aged 3 years because of a heart murmur. At age 8 she developed difficulty
418
S. Bidooki et al. / Neuromuscular Disorders 14 (2004) 417–420
walking attributed to tendo-achilles contractures. Following surgery to lengthen her tendons, she developed exertional dyspnoea and pedal oedema. Cardiac echo and standard ECG were normal, but exercise ECG was reported as abnormal. Proximal limb weakness was noted and she underwent muscle biopsy that was reported as normal. Due to continued weakness, she underwent a second muscle biopsy seven years later. This was thought to show features compatible with polymyositis, although no active inflammatory infiltrate was seen. She was treated with steroids and azathioprine without benefit and it was not until she showed signs of progressive cognitive impairment, in her late teens, that she was referred to a neurologist for further evaluation. At this stage she had difficulty climbing stairs and walking uphill and had an exercise limit of under 1 mile on the flat. She complained of poor short-term memory and poor hearing. Examination showed occasional dystonic facial movements, pale optic discs, but no ophthalmoplegia. There was evidence of sensorineural deafness. Limb tone was normal, but she had proximal limb weakness and both axial and limb ataxia. Cognitive impairment was confirmed by formal assessment. A CT scan of her brain showed generalised atrophy with basal ganglia calcification. An EEG showed a low voltage recording without paroxysmal features. Electrophysiological examination showed features of a myopathy plus an axonal sensory neuropathy. Serum and cerebrospinal (CSF) lactate were elevated (serum 3.14 mM; NR , 1.7 mM. CSF 3.90 mM; NR , 2.0 mM). Her elder sister and both parents were healthy. A third muscle biopsy was performed under local anaesthesia with the consent of patient and family. 2.2. Histology and biochemistry Histological/histochemical [4] and biochemical [5] studies were performed as described previously.
The mismatched nucleotides create a further Nhe I site that acts as an internal control site to assess restriction digest efficiency. PCR using these primers generates a 122 bp product that is digested by Nhe I into 90, 19, and 13 bp fragments in the presence of the A7480G mutation, or fragments of 109 and 13 bp if the wild-type sequence is present. Single fibre, last cycle hot PCR analysis was performed as described [7] using the primers described above.
3. Results All muscle biopsies revealed the histopathological findings of an increased range of fibre diameters (5 – 120 mm) and increased interstitial fibrous connective tissue and fat. Occasional fibres showed a moderate increase in lipid droplets. In the third biopsy, approximately 30% of fibres showed subsarcolemmal aggregations of mitochondria (ragged-red fibres), although in some fibres, abnormal mitochondrial distribution was apparent throughout the fibre, rather than being confined to the periphery. A comparable proportion of muscle fibres had no cytochemically demonstrable cytochrome c oxidase (COX) activity and the majority if these were ragged-red. Biochemical studies of isolated skeletal muscle mitochondrial fractions showed low activities of both complex I (112 vs normal 256 ^ 70 (mean ^ SD); activity expressed per citrate synthase ^ SD) and IV (0.29 vs normal 2.1 ^ 0.3 (mean ^ SD); activity expressed as apparent first order, rate constant ^ SD). Complexes II and III were within the normal range (data not shown). Southern blotting of muscle DNA showed no length variation. Sequencing of all mitochondrial tRNA genes revealed three changes from the revised ‘Cambridge’ reference sequence [8,9]: a novel heteroplasmic A to G transition at position 7480 in the tRNASer(UCN) gene (Fig. 1),
2.3. Genetic analysis Total DNA was extracted from paraffin-embedded (second biopsy) and fresh (third biopsy) skeletal muscle and blood lymphocytes using standard protocols. Southern blotting, mitochondrial DNA sequencing and last cycle hot PCR were performed as described [6]. The A7480G mutation does not create or destroy a restriction site, therefore, the following oligonucleotide primers were designed to aid analysis: sense primer (50 AATCGAACCCCCCAAAGCTAG30 ) contains a mismatch at nucleotide position 7478 (underlined), creating an Nhe I site in the presence of the T at position 7480 on the heavy strand (note: tRNASer(UCN) is encoded by the light strand making the change an A); antisense primer (50 actcactataGCTAGCCTAT AATTTAACTTTGAC30 ), a 34 mer oligonucleotide containing a 10 base stretch of non-mitochondrial sequence at its 50 end (in lowercase) and two mismatches at positions 7571 and 7572 (underlined).
Fig. 1. The tRNASer(UCN) showing predicted folding pattern. The position of the A7480G transition is shown. Note: this base change permits a further three pairing sites.
S. Bidooki et al. / Neuromuscular Disorders 14 (2004) 417–420
419
4. Discussion
Fig. 2. The distribution of the A7480G mutation in patient tissues and family members. U, uncut sample; con, control muscle; lane 1, mother’s blood; lane 2, father’s blood; lane 3, patient’s muscle (second biopsy); lanes 4 and 5, patient’s muscle (third biopsy); lane 6, sister’s blood; lane 7, sister’s muscle. Fragment sizes, in base pairs, are shown on the left.
an A to G transition at position 10398 in the ND3 gene, and a T to C substitution at position 14798 in the apocytochrome b gene. Both the latter two base changes were homoplasmic in skeletal muscle and have been reported previously as polymorphic variants [3]. For last cycle hot PCR, five separate PCR reactions were performed for each tissue type. The A7480G mutation was heteroplasmic both in the patient’s skeletal muscle and white blood cell homogenates, at . 80 and 30% respectively (Fig. 2), but was not found in the unaffected parents, the sisters blood and skeletal muscle or in 100 controls analysed (Fig. 2). Single-fibre PCR analysis (Fig. 3) revealed that COX deficient fibres contained more than 90% A7480G mutant mtDNA (mean 93.86, SD 2.39). The mutation was also present in the COX normal fibres, but at lower levels of heteroplasmy (mean 37.40, SD 18.45). Analysis using both Mann – Whitney and student t test confirms that these two groups differ significantly ðP , 0:0001Þ:
Fig. 3. Single fibre PCR-RFLP analysis of the A7480G mutation in the patient’s individual COX-positive and COX-deficient muscle fibres.
The clinical, morphological and biochemical features strongly suggest that this patient has a mtDNA disorder and we have identified a novel A to G transition at position 7480 in the mitochondrial genome that we believe is pathological for the following reasons. First, the mutation occurs in a functionally important region of the tRNA, changing a highly conserved base in the anticodon loop. Indeed this nucleotide is invariant throughout mammalian species (http://mamit-trna.u-strasbg.fr/). This change is likely to alter the tRNA and could explain the decreased respiratory chain activity by a diminished rate of mitochondrial protein synthesis. Second, the mutation is heteroplasmic, not detected in controls nor recognised previously, despite the availability of considerable mtDNA sequence data [3] (http://www.genpat.uu.se/mtDB/; http://www.mitokor.com/ science/560mtdnas.php). Third, the mutation is present at highest levels in the affected tissue and single fibre studies show that the highest levels of the mutation are found in COX deficient fibres i.e. the mutation segregates with the biochemical phenotype. The A7480G mutation alters the last base of the anticodon loop adjacent to the anticodon stem (Fig. 1). RNA structure prediction programmes [10] suggest that this could lengthen the anticodon stem by additional pairing, and thus reduce drastically the predicted size of this loop. This mutation may, therefore, compromise tRNASer(UCN) anticodon function by disrupting codon matching and possibly tRNA synthetase recognition with possible consequences on both translational accuracy as well as rate [11]. Seven other tRNASer(UCN) point mutations have been reported. The first found was a homoplasmic T to C transition at nt 7445 in individuals whose only clinical manifestation was hearing loss [12]. This mutation converts the 30 terminal T residue of tRNASer(UCN) to a C, and brings about a silent alteration to the COI stop codon. Interestingly, two further mutations in the aminoacyl acceptor stem have been found in families manifesting only non-syndromic sensorineural hearing loss. The first, a UK family [13], had a T to C change at nucleotide 7510 while the second, an African American family [14], had a T to C change at nucleotide 7511. In both cases, the mutations were heteroplasmic, but the mutation was present at very high levels, . 90 – 95%, suggesting that, like the T7445C, these mutations are of low pathogenicity. The remaining mutations, including the A7480G, are all associated with more extensive neurological disease. A heteroplasmic T to C transition at position 7512, involving the aminoacyl acceptor stem of the tRNA was found in a family with a MERRF/MELAS overlap syndrome [15]. A C insertion at position 7466 –7472 was observed in a family with hearing loss, ataxia and myoclonus [16] while a G7497A mutation was described in two families with myopathy [17] and a young girl with exercise intolerance and muscle pain [18].
420
S. Bidooki et al. / Neuromuscular Disorders 14 (2004) 417–420
The absence of the mutation in tissues from the mother (only blood screened) or sister (muscle and blood) is an important feature. While investigation of more tissues from the relatives was not possible, our studies strongly suggest the mutation arose de novo in the patient. This has considerable implications for her relatives, particularly the genetic counselling of her sister, and highlights the need to consider investigating relatives once a mtDNA point mutation is established. Our patient once again demonstrates the phenotypic diversity of mitochondrial disease. Comparison of the clinical features seen in our case with those occurring in patients with other tRNASer(UCN) mutations, however, shows an interesting degree of similarity. All had deafness, of varying severity. In addition, ataxia, optic atrophy, without ophthalmoparesis, and myoclonus also feature in one subgroup of tRNASer(UCN) mutation. The finding of a eighth mutation in this tRNA confirms it as one of the commonest sites for mtDNA mutation.
Acknowledgements SB was funded by the Iranian government. The financial support of The Wellcome Trust, Muscular dystrophy Campaign and the Newcastle upon Tyne Hospitals NHS Trust is gratefully acknowledged.
References [1] DiMauro S, Schon EA. Mitochondrial respiratory-chain diseases. N Engl J Med. 2003;348:2656–68. [2] Servidei S. Mitochondrial encephalomyopathies: gene mutation. Neuromuscul Disord 2004;14:107 –16. [3] MITOMAP: A human mitochondrial genome database: http://www. mitomap.org, 2003. [4] Johnson MA, Bindoff LA, Turnbull DM. Cytochrome c oxidase activity in single muscle fibres: assay techniques and diagnostic applications. Ann Neurol 1993;33:28– 35.
[5] Bindoff LA, Desnuelle C, Birch-Machin MA, et al. Multiple defects of the mitochondrial respiratory chain in a mitochondrial encephalopathy (MERRF): a clinical, biochemical and molecular study. J Neurol Sci 1991;102:17 –24. [6] Bidooki SK, Johnson MA, Chrzanowska-Lightowlers Z, et al. Intracellular mitochondrial triplasmy in a patient with two heteroplasmic base changes. Am J Hum Genet. 1997;60:1430–8. [7] Weber K, Wilson JN, Taylor L, et al. A new mtDNA mutation showing accumulation with time and restriction to skeletal muscle. Am J Hum Genet 1997;60:373–80. [8] Anderson S, Bankier AT, Barrell BG, et al. Sequence and organization of the human mitochondrial genome. Nature 1981;290:457 –65. [9] Andrews RM, Kubacka I, Chinnery PF, et al. Reanalysis and revision of the cambridge reference sequence. Nat Genet 1999;23:147. [10] Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucl Acids Res. 2003;31:3406–15. [11] Yarus M. Translational efficiency of transfer RNA’s: uses of an extended anticodon. Science 1982;218:646 –52. [12] Reid FM, Vernham GA, Jacobs HT. A novel mitochondrial point mutation in a maternal pedigree with sensorineural deafness. Human Mutat 1994;3:243–7. [13] Hutchin TP, Parker MJ, Young ID, et al. A novel mutation in the mitochondrial tRNA(Ser(UCN)) gene in a family with non-syndromic sensorineural hearing impairment. J Med Genet 2000;37:692–4. [14] Sue CM, Tanji K, Hadjigeorgiou G, et al. Maternally inherited hearing loss in a large kindred with a novel T7511C mutation in the mitochondrial DNA tRNA(Ser(UCN)) gene. Neurology 1999;52: 1905–8. [15] Nakamura M, Nakano S, Goto Y, et al. A novel point mutation in the mitochondrial tRNA(Ser(UCN)) gene detected in a family with MERRF/MELAS overlap syndrome. Biochem Biophys Res Commun 1995;214:86–93. [16] Tiranti V, Chariot P, Carella F, et al. Maternally inherited hearing loss, ataxia and myoclonus associated with a novel point mutation in mitochondrial tRNASer(UCN) gene. Hum Mol Genet 1995;4: 1421–7. [17] Jaksch M, Hofmann S, Kleinle S, et al. A systematic mutation screen of 10 nuclear and 25 mitochondrial candidate genes in 21 patients with cytochrome c oxidase (COX) deficiency shows tRNA(Ser)(UCN) mutations in a subgroup with syndromal encephalopathy. J Med Genet 1998;35:895–900. [18] Grafakou O, Hol FA, Otfried Schwab K, et al. Exercise intolerance, muscle pain and lactic acidaemia associated with a 7497G . A mutation in the tRNASer(UCN) gene. J Inherit Metab Dis 2003;26: 593 –600.
Sporadic mitochondrial myopathy due to a new mutation in the mitochondrial tRNASer(UCN) gene Seyed Bidookia, Margaret J. Jacksona, Margaret A. Johnsona, Zofia M.A. Chrzanowska-Lightowlersa, Robert W. Taylora, Graham Venablesb, Robert N. Lightowlersa, Douglass M. Turnbulla, Laurence A. Bindoff c,* a
Mitochondrial Research Group, School of Neurology, Neurobiology and Psychiatry, The Medical School, Framlington Place, Newcastle upon Tyne NE2 4HH, UK b Neurology Department, Sheffield Teaching Hospitals NHS Trust, Sheffield S10 2JF, UK c Department of Neurology, Institute of Clinical Medicine and Molecular Medicine, University of Bergen, Haukeland University Hospital, 5021 Bergen, Norway Received 26 January 2004; received in revised form 12 March 2004; accepted 15 March 2004
Abstract We describe a young woman with a progressive mitochondrial myopathy that started with muscle weakness and went on to include deafness, dementia and ataxia. Skeletal muscle showed the histological and biochemical features of mitochondrial respiratory chain dysfunction. Genetic analysis identified a novel, heteroplasmic, A to G transition in tRNASer(UCN) at position 7480 affecting a highly conserved base in the anticodon loop. Single-fibre PCR showed highest levels of mutation in cytochrome c-oxidase-deficient fibres and quantification in two biopsies taken 5 years apart showed no change in percentage heteroplasmy. The mutation was present at lower levels in the patient’s blood, but was not found in either her mother’s or sister’s blood and skeletal muscle, suggesting a sporadic occurrence. This is the eighth disease-causing mutation in this tRNA gene and confirms serine (UCN) as one of the most common sites for mtDNA mutation. q 2004 Elsevier B.V. All rights reserved. Keywords: Mitochondrial myopathy; mtDNA; tRNA Serine
1. Introduction Mitochondrial myopathy is collective term for a group of clinically varied disorders [1]. Whilst these disorders often affect several tissues simultaneously, muscle and the central nervous system (CNS) are sites of predilection. The majority of adult patients with mitochondrial disease have defects (large scale rearrangements or point mutations) involving the mitochondrial DNA (mtDNA), a small genome that encodes thirteen proteins, two ribosomal RNA and 22 transfer RNA. The proteins are all components of the respiratory chain whereas the structural RNA are involved in intramitochondrial protein synthesis. Since the late 1980s, over 100 pathogenic mtDNA point mutations and deletions have been identified [2,3], with mutations involving tRNA appearing to be the most * Corresponding author. Tel.: þ 47-559-75-070; fax: þ47-559-75-165. E-mail address: [email protected] (L.A. Bindoff). 0960-8966/$ - see front matter q 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.nmd.2004.03.004
common. Whilst affecting a similar substrate, different tRNA mutations give rise to widely differing phenotypes. Interestingly, certain tRNA appear preferentially affected, for example, the tRNA for leucine (UUR), isoleucine and serine (UCN). We describe a patient who presented with a myopathy and went on to develop progressive disease of the central nervous system. Genetic analysis identified a mutation in tRNASer(UCN) and longitudinal studies showed no change in the degree of heteroplasmy. This is the eighth mutation in this tRNA and in this patient the mutation appears sporadic.
2. Patient and methods 2.1. Case history The patient, who is now 36, was first seen aged 3 years because of a heart murmur. At age 8 she developed difficulty
418
S. Bidooki et al. / Neuromuscular Disorders 14 (2004) 417–420
walking attributed to tendo-achilles contractures. Following surgery to lengthen her tendons, she developed exertional dyspnoea and pedal oedema. Cardiac echo and standard ECG were normal, but exercise ECG was reported as abnormal. Proximal limb weakness was noted and she underwent muscle biopsy that was reported as normal. Due to continued weakness, she underwent a second muscle biopsy seven years later. This was thought to show features compatible with polymyositis, although no active inflammatory infiltrate was seen. She was treated with steroids and azathioprine without benefit and it was not until she showed signs of progressive cognitive impairment, in her late teens, that she was referred to a neurologist for further evaluation. At this stage she had difficulty climbing stairs and walking uphill and had an exercise limit of under 1 mile on the flat. She complained of poor short-term memory and poor hearing. Examination showed occasional dystonic facial movements, pale optic discs, but no ophthalmoplegia. There was evidence of sensorineural deafness. Limb tone was normal, but she had proximal limb weakness and both axial and limb ataxia. Cognitive impairment was confirmed by formal assessment. A CT scan of her brain showed generalised atrophy with basal ganglia calcification. An EEG showed a low voltage recording without paroxysmal features. Electrophysiological examination showed features of a myopathy plus an axonal sensory neuropathy. Serum and cerebrospinal (CSF) lactate were elevated (serum 3.14 mM; NR , 1.7 mM. CSF 3.90 mM; NR , 2.0 mM). Her elder sister and both parents were healthy. A third muscle biopsy was performed under local anaesthesia with the consent of patient and family. 2.2. Histology and biochemistry Histological/histochemical [4] and biochemical [5] studies were performed as described previously.
The mismatched nucleotides create a further Nhe I site that acts as an internal control site to assess restriction digest efficiency. PCR using these primers generates a 122 bp product that is digested by Nhe I into 90, 19, and 13 bp fragments in the presence of the A7480G mutation, or fragments of 109 and 13 bp if the wild-type sequence is present. Single fibre, last cycle hot PCR analysis was performed as described [7] using the primers described above.
3. Results All muscle biopsies revealed the histopathological findings of an increased range of fibre diameters (5 – 120 mm) and increased interstitial fibrous connective tissue and fat. Occasional fibres showed a moderate increase in lipid droplets. In the third biopsy, approximately 30% of fibres showed subsarcolemmal aggregations of mitochondria (ragged-red fibres), although in some fibres, abnormal mitochondrial distribution was apparent throughout the fibre, rather than being confined to the periphery. A comparable proportion of muscle fibres had no cytochemically demonstrable cytochrome c oxidase (COX) activity and the majority if these were ragged-red. Biochemical studies of isolated skeletal muscle mitochondrial fractions showed low activities of both complex I (112 vs normal 256 ^ 70 (mean ^ SD); activity expressed per citrate synthase ^ SD) and IV (0.29 vs normal 2.1 ^ 0.3 (mean ^ SD); activity expressed as apparent first order, rate constant ^ SD). Complexes II and III were within the normal range (data not shown). Southern blotting of muscle DNA showed no length variation. Sequencing of all mitochondrial tRNA genes revealed three changes from the revised ‘Cambridge’ reference sequence [8,9]: a novel heteroplasmic A to G transition at position 7480 in the tRNASer(UCN) gene (Fig. 1),
2.3. Genetic analysis Total DNA was extracted from paraffin-embedded (second biopsy) and fresh (third biopsy) skeletal muscle and blood lymphocytes using standard protocols. Southern blotting, mitochondrial DNA sequencing and last cycle hot PCR were performed as described [6]. The A7480G mutation does not create or destroy a restriction site, therefore, the following oligonucleotide primers were designed to aid analysis: sense primer (50 AATCGAACCCCCCAAAGCTAG30 ) contains a mismatch at nucleotide position 7478 (underlined), creating an Nhe I site in the presence of the T at position 7480 on the heavy strand (note: tRNASer(UCN) is encoded by the light strand making the change an A); antisense primer (50 actcactataGCTAGCCTAT AATTTAACTTTGAC30 ), a 34 mer oligonucleotide containing a 10 base stretch of non-mitochondrial sequence at its 50 end (in lowercase) and two mismatches at positions 7571 and 7572 (underlined).
Fig. 1. The tRNASer(UCN) showing predicted folding pattern. The position of the A7480G transition is shown. Note: this base change permits a further three pairing sites.
S. Bidooki et al. / Neuromuscular Disorders 14 (2004) 417–420
419
4. Discussion
Fig. 2. The distribution of the A7480G mutation in patient tissues and family members. U, uncut sample; con, control muscle; lane 1, mother’s blood; lane 2, father’s blood; lane 3, patient’s muscle (second biopsy); lanes 4 and 5, patient’s muscle (third biopsy); lane 6, sister’s blood; lane 7, sister’s muscle. Fragment sizes, in base pairs, are shown on the left.
an A to G transition at position 10398 in the ND3 gene, and a T to C substitution at position 14798 in the apocytochrome b gene. Both the latter two base changes were homoplasmic in skeletal muscle and have been reported previously as polymorphic variants [3]. For last cycle hot PCR, five separate PCR reactions were performed for each tissue type. The A7480G mutation was heteroplasmic both in the patient’s skeletal muscle and white blood cell homogenates, at . 80 and 30% respectively (Fig. 2), but was not found in the unaffected parents, the sisters blood and skeletal muscle or in 100 controls analysed (Fig. 2). Single-fibre PCR analysis (Fig. 3) revealed that COX deficient fibres contained more than 90% A7480G mutant mtDNA (mean 93.86, SD 2.39). The mutation was also present in the COX normal fibres, but at lower levels of heteroplasmy (mean 37.40, SD 18.45). Analysis using both Mann – Whitney and student t test confirms that these two groups differ significantly ðP , 0:0001Þ:
Fig. 3. Single fibre PCR-RFLP analysis of the A7480G mutation in the patient’s individual COX-positive and COX-deficient muscle fibres.
The clinical, morphological and biochemical features strongly suggest that this patient has a mtDNA disorder and we have identified a novel A to G transition at position 7480 in the mitochondrial genome that we believe is pathological for the following reasons. First, the mutation occurs in a functionally important region of the tRNA, changing a highly conserved base in the anticodon loop. Indeed this nucleotide is invariant throughout mammalian species (http://mamit-trna.u-strasbg.fr/). This change is likely to alter the tRNA and could explain the decreased respiratory chain activity by a diminished rate of mitochondrial protein synthesis. Second, the mutation is heteroplasmic, not detected in controls nor recognised previously, despite the availability of considerable mtDNA sequence data [3] (http://www.genpat.uu.se/mtDB/; http://www.mitokor.com/ science/560mtdnas.php). Third, the mutation is present at highest levels in the affected tissue and single fibre studies show that the highest levels of the mutation are found in COX deficient fibres i.e. the mutation segregates with the biochemical phenotype. The A7480G mutation alters the last base of the anticodon loop adjacent to the anticodon stem (Fig. 1). RNA structure prediction programmes [10] suggest that this could lengthen the anticodon stem by additional pairing, and thus reduce drastically the predicted size of this loop. This mutation may, therefore, compromise tRNASer(UCN) anticodon function by disrupting codon matching and possibly tRNA synthetase recognition with possible consequences on both translational accuracy as well as rate [11]. Seven other tRNASer(UCN) point mutations have been reported. The first found was a homoplasmic T to C transition at nt 7445 in individuals whose only clinical manifestation was hearing loss [12]. This mutation converts the 30 terminal T residue of tRNASer(UCN) to a C, and brings about a silent alteration to the COI stop codon. Interestingly, two further mutations in the aminoacyl acceptor stem have been found in families manifesting only non-syndromic sensorineural hearing loss. The first, a UK family [13], had a T to C change at nucleotide 7510 while the second, an African American family [14], had a T to C change at nucleotide 7511. In both cases, the mutations were heteroplasmic, but the mutation was present at very high levels, . 90 – 95%, suggesting that, like the T7445C, these mutations are of low pathogenicity. The remaining mutations, including the A7480G, are all associated with more extensive neurological disease. A heteroplasmic T to C transition at position 7512, involving the aminoacyl acceptor stem of the tRNA was found in a family with a MERRF/MELAS overlap syndrome [15]. A C insertion at position 7466 –7472 was observed in a family with hearing loss, ataxia and myoclonus [16] while a G7497A mutation was described in two families with myopathy [17] and a young girl with exercise intolerance and muscle pain [18].
420
S. Bidooki et al. / Neuromuscular Disorders 14 (2004) 417–420
The absence of the mutation in tissues from the mother (only blood screened) or sister (muscle and blood) is an important feature. While investigation of more tissues from the relatives was not possible, our studies strongly suggest the mutation arose de novo in the patient. This has considerable implications for her relatives, particularly the genetic counselling of her sister, and highlights the need to consider investigating relatives once a mtDNA point mutation is established. Our patient once again demonstrates the phenotypic diversity of mitochondrial disease. Comparison of the clinical features seen in our case with those occurring in patients with other tRNASer(UCN) mutations, however, shows an interesting degree of similarity. All had deafness, of varying severity. In addition, ataxia, optic atrophy, without ophthalmoparesis, and myoclonus also feature in one subgroup of tRNASer(UCN) mutation. The finding of a eighth mutation in this tRNA confirms it as one of the commonest sites for mtDNA mutation.
Acknowledgements SB was funded by the Iranian government. The financial support of The Wellcome Trust, Muscular dystrophy Campaign and the Newcastle upon Tyne Hospitals NHS Trust is gratefully acknowledged.
References [1] DiMauro S, Schon EA. Mitochondrial respiratory-chain diseases. N Engl J Med. 2003;348:2656–68. [2] Servidei S. Mitochondrial encephalomyopathies: gene mutation. Neuromuscul Disord 2004;14:107 –16. [3] MITOMAP: A human mitochondrial genome database: http://www. mitomap.org, 2003. [4] Johnson MA, Bindoff LA, Turnbull DM. Cytochrome c oxidase activity in single muscle fibres: assay techniques and diagnostic applications. Ann Neurol 1993;33:28– 35.
[5] Bindoff LA, Desnuelle C, Birch-Machin MA, et al. Multiple defects of the mitochondrial respiratory chain in a mitochondrial encephalopathy (MERRF): a clinical, biochemical and molecular study. J Neurol Sci 1991;102:17 –24. [6] Bidooki SK, Johnson MA, Chrzanowska-Lightowlers Z, et al. Intracellular mitochondrial triplasmy in a patient with two heteroplasmic base changes. Am J Hum Genet. 1997;60:1430–8. [7] Weber K, Wilson JN, Taylor L, et al. A new mtDNA mutation showing accumulation with time and restriction to skeletal muscle. Am J Hum Genet 1997;60:373–80. [8] Anderson S, Bankier AT, Barrell BG, et al. Sequence and organization of the human mitochondrial genome. Nature 1981;290:457 –65. [9] Andrews RM, Kubacka I, Chinnery PF, et al. Reanalysis and revision of the cambridge reference sequence. Nat Genet 1999;23:147. [10] Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucl Acids Res. 2003;31:3406–15. [11] Yarus M. Translational efficiency of transfer RNA’s: uses of an extended anticodon. Science 1982;218:646 –52. [12] Reid FM, Vernham GA, Jacobs HT. A novel mitochondrial point mutation in a maternal pedigree with sensorineural deafness. Human Mutat 1994;3:243–7. [13] Hutchin TP, Parker MJ, Young ID, et al. A novel mutation in the mitochondrial tRNA(Ser(UCN)) gene in a family with non-syndromic sensorineural hearing impairment. J Med Genet 2000;37:692–4. [14] Sue CM, Tanji K, Hadjigeorgiou G, et al. Maternally inherited hearing loss in a large kindred with a novel T7511C mutation in the mitochondrial DNA tRNA(Ser(UCN)) gene. Neurology 1999;52: 1905–8. [15] Nakamura M, Nakano S, Goto Y, et al. A novel point mutation in the mitochondrial tRNA(Ser(UCN)) gene detected in a family with MERRF/MELAS overlap syndrome. Biochem Biophys Res Commun 1995;214:86–93. [16] Tiranti V, Chariot P, Carella F, et al. Maternally inherited hearing loss, ataxia and myoclonus associated with a novel point mutation in mitochondrial tRNASer(UCN) gene. Hum Mol Genet 1995;4: 1421–7. [17] Jaksch M, Hofmann S, Kleinle S, et al. A systematic mutation screen of 10 nuclear and 25 mitochondrial candidate genes in 21 patients with cytochrome c oxidase (COX) deficiency shows tRNA(Ser)(UCN) mutations in a subgroup with syndromal encephalopathy. J Med Genet 1998;35:895–900. [18] Grafakou O, Hol FA, Otfried Schwab K, et al. Exercise intolerance, muscle pain and lactic acidaemia associated with a 7497G . A mutation in the tRNASer(UCN) gene. J Inherit Metab Dis 2003;26: 593 –600.