Mitotane exhibits dual effects on steroidogenic enzymes gene transcription under basal and cAMP-stimulating microenvironments in NCI-H295 cells

Toxicology 298 (2012) 14–23

Contents lists available at SciVerse ScienceDirect

Toxicology journal homepage: www.elsevier.com/locate/toxicol

Mitotane exhibits dual effects on steroidogenic enzymes gene transcription under basal and cAMP-stimulating microenvironments in NCI-H295 cells Chia-Wen Lin a , Yen-Hwa Chang b , Hsiao-Fung Pu a,∗ a b

Department and Institute of Physiology, School of Medicine, National Yang-Ming University, Taipei 11221, Taiwan, ROC Division of Urology, Department of Surgery, Veterans General Hospital, Taipei 11217, Taiwan, ROC

a r t i c l e

i n f o

Article history: Received 6 February 2012 Received in revised form 22 March 2012 Accepted 15 April 2012 Available online 23 April 2012 Keywords: Mitotane Cushing’s syndrome ACC Adrenal Steroidogenesis

a b s t r a c t Adrenocortical carcinoma (ACC) is an extremely rare and aggressive endocrine malignancy with a poor prognosis. The most common symptom of ACC is hypercortisolism (Cushing’s syndrome), which has the highest mortality. Mitotane is used as a steroidogenesis inhibitor for Cushing’s syndrome or as a chemical adrenalectomy drug for ACC. Mitotane induces adrenal cortex necrosis, mitochondrial membrane impairment, and irreversible binding to CYP proteins. In this study, we explored the molecular effect of mitotane on steroidogenesis in human adrenocortical cancer NCI-H295 cells. Mitotane (10–40 ␮M) inhibited basal and cAMP-induced cortisol secretion but did not cause cell death. Mitotane exhibited an inhibitory effect on the basal expression of StAR and P450scc protein. Furthermore, 40 ␮M of mitotane significantly diminished StAR, CYP11A1 and CYP21 mRNA expression. HSD3B2 and CYP17 seem to be insensitive to mitotane. The stimulatory effects of mitotane on CYP11B1 were more remarkable than its inhibitory effects. In contrast, the activation of cAMP signaling strongly elevated the expression of all these genes. Mitotane (40 ␮M) almost completely neutralized this positive effect and returned 8-BrcAMP-induced StAR, CYP11A1, CYP17 and CYP21 mRNA to control levels. After cAMP activation, mitotane did not change the levels of CYP11B1 mRNA. The present study demonstrates that mitotane can inhibit cortisol biosynthesis due to a non-specific interference with the gene transcription of steroidogenic enzymes under both basal and 8-Br-cAMP-activated conditions in NCI-H295 cells. We also identified that StAR and CYP11A1 key enzymes that participate in the rate-limiting step of steroidogenesis, were more sensitive to mitotane. In addition, the biphasic effect of mitotane on CYP11B1 was also elucidated. © 2012 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Adrenocortical carcinoma (ACC) is an extremely rare endocrine malignancy that has an estimated prevalence of 0.5–2 cases per million people per year (Soreide et al., 1992; Lindholm et al., 2001). The overall 5-year survival rate is below 40% in unselected cases (Allolio and Fassnacht, 2006; Libe et al., 2007). The most common clinical presentation of functional tumors is Cushing’s syndrome (hypercortisolism), and it is associated with the highly malignant ACC (Luton et al., 1990; Wajchenberg et al., 2000). Therefore, cortisol overproduction may be a strong factor associated with the poor prognosis of ACC (Abiven et al., 2006). Mitotane (o,p -DDD or Lysodren; molecular weight: 320.04), a derivative and metabolite of the insecticide DDT, is used as an inhibitor of adrenal steroidogenesis because it causes adrenal atrophy and adrenocortical insufficiency in dogs (Nelson and Woodard, 1949). Early literatures described the ability of mitotane to induce

∗ Corresponding author. Tel.: +886 2 28267312; fax: +886 2 28264049. E-mail addresses: [email protected] (C.-W. Lin), [email protected] (Y.-H. Chang), [email protected] (H.-F. Pu). 0300-483X/$ – see front matter © 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.tox.2012.04.007

adrenal necrosis (Ojima et al., 1984; Schteingart et al., 1993). In addition to tissue damage, mitotane can also damage the microenvironment and produce inhibitory steroidogenic effects. The observation that mitotane tends to accumulate in the zona fasciculata (ZF) and zona reticularis (ZR) cells (Lindhe et al., 2002) suggests that the compound has a specific cellular toxicity (Phan, 2007; Stigliano et al., 2008). Metabolic activation is essential for the adrenolytic activity of mitotane. The major reactive derivative acyl-chloride can covalently and irreversibly bind with adrenal molecules, which are highly probably the cytochrome P450 (CYP) enzymes (Lindhe et al., 2002; Asp et al., 2010) such as CYP11A1, CYP11B1 and CYP21B. This binding causes altered serum hormone concentrations in humans and other species (Korth-Schutz et al., 1977; Touitou et al., 1979; Ojima et al., 1984, 1985; Jorgensen et al., 2001; Daffara et al., 2008). In addition to basal secretion, cAMP-induced glucocorticoid secretion is also altered by mitotane (Morishita et al., 2001; Lacroix and Hontela, 2003; Asp et al., 2010). Moreover, mitotane modulates the profiles of proteins involved in cellular metabolism, stress response, cytoskeleton structure, and tumorigenesis (Stigliano et al., 2008). The adrenal cortex plays a crucial role in survival and adaptation through the production of mineralocorticoids and

C.-W. Lin et al. / Toxicology 298 (2012) 14–23

15

Fig. 1. The pathways of human adrenal steroidogenesis.

glucocorticoids. Various physiological challenges, such as physical or emotional stress, alter adrenocortical functions by regulating the hypothalamus-pituitary-adrenal (HPA) axis. The synthesis of adrenal steroid hormones (steroidogenesis, Fig. 1) involves five types of cytochrome P450 enzymes and 3␤-hydroxycortisol dehydrogenase (3␤-HSD). In the first step, steroidogenic acute regulatory (StAR) protein transports cholesterol from the mitochondrial outer membrane to the inner membrane. Next, the cholesterol side chain is cleaved off by CYP11A1 to generate pregnenolone. The latter step is the rate-limiting reaction. Subsequently, 3␤-HSD, CYP17 and CYP21 convert pregnenolone into 11-deoxycortisol and 11-deoxycorticosterone (11-DOC). Finally, CYP11B2 converts DOC into aldosterone (primary human mineralocorticoid) in zona glomerulosa (ZG) cells, whereas CYP11B1 converts 11-deoxycortisol and 11-DOC into cortisol (primary human glucocorticoid) and corticosterone in ZF and ZR cells. Adrenocorticotropin (ACTH), the main regulator of cortisol synthesis, is secreted by the anterior pituitary and can elevate cortisol production via the secondary messenger cAMP (Gallo-Payet and Payet, 2003). In addition, ACTH potentiates adrenocortical steroidogenesis by regulating the gene expression of steroidogenic enzymes (Hum and Miller, 1993; Stocco, 1997; Sewer and Waterman, 2003), adrenocortical cell proliferation (Arola et al., 1993) and adrenal vasculature development (Thomas et al., 2003). Studies continue to show the clinical contribution of mitotane to hypercortisolism and ACC. Previous work used both in vivo and in vitro experimental approaches to show that mitotane inhibited the secretion of several steroid hormones; however, the molecular mechanism by which mitotane regulates steroidogenesis remains

unknown. Therefore, the main objective of this study was to investigate how mitotane modulates cellular steroidogenic ability. To maintain the anti-steroidogenic effect of mitotane and to avoid a toxic response, plasma levels of mitotane were maintained between 7 and 14 mg/l (approximately 20–43.7 ␮M; Phan, 2007). We treated human adrenocortical carcinoma NCI-H295 cells with a reasonable concentration range (10–40 ␮M) of mitotane that did not cause cytotoxicity. In addition, we investigated the different functions of mitotane under basal and cAMP-induced cortisol secretion. Regardless of whether ACTH was present, mitotane exhibited dual effects on adrenal steroidogenesis. Under the basal conditions, the higher concentrations (30–40 ␮M) of mitotane suppressed the expression of StAR and P450scc proteins. However, mitotane did not significantly abolish the 8-Br-cAMP-mediated levels of StAR and P450scc proteins. According to our experimental results, mitotane clearly modulated the mRNA levels of steroidogenic enzymes. This is the first report providing strong evidence that mitotane extensively interferes with the gene transcription of a steroidogenic enzyme. The enzymes most sensitive to mitotane were identified. In addition, the biphasic effect of mitotane on CYP11B1 was also described. These results suggest that the clinical use of mitotane should be modified in the context of the different pathological mechanisms of Cushing’s syndrome. 2. Materials and methods 2.1. Cell culture NCI-H295 cells derived from human ACC (Gazdar et al., 1990) were obtained from the Bioresource Collection and Research Center (Food Industry Research and

16

C.-W. Lin et al. / Toxicology 298 (2012) 14–23

Table 1 Primer sequences of analyzed steroidogenic enzymes used for real-time PCR. Gene

Sense

Antisense

StAR (NM 000349) CYP11A1 (NM 000781) HSD3B2 (NM 000198.1) CYP11B1 (NM 000497) CYP11B2 (NM 000498) CYP17A1 (NM 000102) CYP21A2 (NM 000500)

TTGCTTTATGGGCTCAAGAATG CTTCTTCGACCCGGAAAATTT GCGGCTAATGGGTGGAATCTA TCCCGAGGGCCTCTAGGA TTGTTCAAGCAGCGAGTGTTG GCTGACTCTGGCGCACACT TCCCAGCACTCAACCAACCT

GGAGACCCTCTGAGATTCTGCTT CCGGAAGTAGGTGATGTTCTTGT CCTCATTTATACTGGCAGAAAGGAAT GGGACAAGGTCAGCAAGATCTT GCATCCTCGGGACCTTCTC CCATCCTTGAACAGGGCAAA CAGCTCAGAATTAAGCCTCAATCC

Originally published by Oskarsson et al. (2006).

Development Institute, Taiwan, ROC). The cells were maintained in RPMI1640 medium (Gibco-BRL) containing HEPES (10 mM) and l-glutamine (2 mM), supplemented with hydrocortisol (10 pM), ␤-estradiol (10 pM), sodium selenite (5 ␮g/l), transferrin (5 mg/l), insulin (5 ␮g/ml), penicillin (100 IU/ml), streptomycin (100 ␮g/ml) and 2% fetal calf serum. The cells were cultured at 37 ◦ C in a humidified atmosphere of 5% CO2 – 95% air. When necessary, the challenge medium was replaced with serum-free medium containing 1% BSA. 2.2. Cell viability assay The viability of NCI-H295 cells was determined by a commercial WST assay kit (BioVision, USA). NCI-H295 cells were seeded in 96-well plates at a density of 10,000 cells/100 ␮l/well. After incubating for 24 h, the cultured medium was replaced with serum-free challenge medium, and then the cells were treated with mitotane (0, 5, 10, 20, 30 or 40 ␮M) for 24, 48 or 72 h. After incubation, 10 ␮l of the WST assay reagent was added to each well, and the cells were incubated for an additional 4 h (37 ◦ C, 5% CO2 ). The absorbance was measured at 420 nm with the reference measurement at 650 nm. Cell viability was presented as the percent of viable treated cells relative to the percent of viable control cells. 2.3. Drug treatment NCI-H295 cells were treated with mitotane (purity >99%) and with or without ACTH, FK and 8-Br-cAMP. All drugs were purchased from Sigma–Aldrich Chemical Company (St. Louis, MO, USA).

and the intracellular protein was extracted using triple detergent lysis buffer. The total protein was quantified using Bradford reagent (BioRad). Protein extracts, 20 to 50 ␮g, were separated by 12% SDS-PAGE gel. The primary antibodies used were specific for StAR (1:8000, rabbit), P450scc (Abcam, Cambridge, UK) and ␤-actin (Sigma). The anti-StAR antibody was kindly provided by Dr. D.M. Stocco (TTUHSC, TX, USA). The horseradish peroxidase-conjugated rabbit and mouse anti-human secondary antibodies were applied at 1:10,000 dilutions. The specific protein bands were visualized with a chemiluminescent detection system as described by the instrument (LAS-3000mini, Fujifilm, Japan). 2.6. RNA preparation and real-time RT-PCR NCI-H295 cells were cultured in 6-cm culture dishes and treated as described above. At the end of the challenge period, the cells were harvested and the total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The isolation procedure was conducted in accordance with the manufacturer’s instructions. The quantity and purity of RNA was measured with a NanoDrop spectrophotometer by measuring the absorbance at 260/280 nm. These results were further confirmed by agarose gel electrophoresis and the presence of 18S and 28S rRNA under UV light. Approximately 1–4 ␮g total RNA was reverse transcribed to first-strand cDNA in a total 20-␮l mixture containing 200 U reverse transcriptase, 50 ␮M oligo(dT) and 10 mM dNTP (Invitrogen). Real-time PCR was performed in a LightCycler System (Roche, Germany). Gene specific primers for StAR, CYP11A1, HSD3B2, CYP11B1, CYP11B2, CYP17 and CYP21 were previously described (Oskarsson et al., 2006; Table 1). Gene expression levels were calculated relative to their respective control. 2.7. Statistical analysis

2.4. Cortisol radioimmunoassay (RIA) The media cortisol concentration was determined by RIA. Medium samples were incubated with 100 ␮l anti-cortisol antibody and 3 H-cortisol (TRK407, Amersham) at room temperature for 90 min, then at 4 ◦ C overnight. After incubation, 100 ␮l ice-cold 0.05% dextrane-0.5% charcoal was added for 30 min. The samples were then centrifuged at 2000 g for 30 min, and the supernatant was mixed with 3 ml of biodegradable scintillation solution (Ecoscint A, National Diagnostics, Atlanta, GA, USA). Finally, the radioactivity was measured with a ␤-counter (Packard). The sensitivity of the cortisol RIA was 7.4 pg/tube, and the inter- and intra-assay coefficients of variation (CV) were 9% (n = 4) and 10% (n = 5), respectively.

The experimental results are presented as the mean ± SEM. All data were subjected to one-way analysis of variance followed by the Duncan multiple-range test. The difference between two specific means was tested using Student’s t-test. Values of P < 0.05 and P < 0.01 were taken as the level of significance and high significance, respectively. All statistical analyses were performed with SPSS10 (SPSS Inc., Chicago, IL, USA).

3. Results

2.5. Western blot analysis

3.1. Mitotane inhibits the basal cortisol secretion of NCI-H295 cells but does not induce cell death

To evaluate the effect of mitotane on StAR and P450scc protein expression, NCI-H295 cells were incubated with different concentrations of mitotane alone or with 100 ␮M 8-Br-cAMP for 24 h. At the end of incubation, the cells were harvested

To determine the appropriate dosage and incubation time of mitotane on cortisol secretion, NCI-H295 cells were treated with

Fig. 2. The effects of mitotane on cortisol production and cellular viability of NCI-H295 cells. Cells were treated with mitotane (0, 5, 10, 20, 30 or 40 ␮M) for 24, 48 or 72 h. Cortisol levels in the cell media were determined using a radioimmunoassay. (A) Cell viability was determined by the WST assay. (B) The data are expressed as the mean ± SEM (n = 6). **P < 0.01 when compared with the basal secretion at 24 h (0 ␮M mitotane); # P < 0.05, ## P < 0.01 when compared with the respective vehicle group.

C.-W. Lin et al. / Toxicology 298 (2012) 14–23

17

Fig. 3. The effects of mitotane on the basal level of protein expression of StAR (A) and P450scc (B). Cells were treated with mitotane (0, 10, 20, 30 or 40 ␮M) for 24 h. The protein expressions of StAR (37, 32 and 30 kDa) and P450scc (60 kDa) was analyzed by Western blot. The data are expressed as the mean ± SEM (n = 3–4). *P < 0.05 when compared with 0 ␮M mitotane.

mitotane (0, 5, 10, 20, 30 or 40 ␮M) for 24, 48 or 72 h. As shown in Fig. 2A, basal cortisol secretion was enhanced by extending the reaction time (P < 0.01), and mitotane suppressed cortisol secretion in a dose-dependent manner. After 24 and 48 h of incubation, only 40 ␮M mitotane significantly reduced cortisol secretion (P < 0.05); however, more than 20 ␮M mitotane exhibited a similar suppressive effect after 72 h of incubation. The highest mitotane concentration (40 ␮M) decreased cortisol production by approximately 40% when compared with the respective control at all reaction times analyzed (24, 48 or 72 h). To ascertain whether the inhibitory steroidogenic effect was induced by mitotane-mediated cytotoxicity, cell viability was evaluated by a WST assay. Our results demonstrated that in NCI-H295 cells treated with mitotane (0, 5, 10, 20, 30 or 40 ␮M) for 24, 48

or 72 h, cell viability was not significantly altered (Fig. 2B). These results suggest that mitotane-suppressed cortisol production was not due to cell death. 3.2. Mitotane inhibits basal StAR and P450scc protein expression StAR and P450scc are the key enzymes of the steroidogenic pathway and their levels were analyzed by Western blot (Fig. 3). After incubation for 24 h, 30 and 40 ␮M mitotane suppressed protein expression of the 37 kDa form of StAR, but not the 32 or 30 kDa forms (Fig. 3A, P < 0.05). The protein level of P450scc was dosedependently reduced with the mitotane concentration, but only 40 ␮M mitotane significantly inhibited P450scc under basal condition (Fig. 3B, P < 0.05).

Fig. 4. The effects of mitotane on basal and cAMP-mediated cortisol production in NCI-H295 cells. Cells were treated with mitotane (0, 20 or 40 ␮M) and combined with ACTH (0, 1 or 100 nM; A), FK (0, 1 or 10 ␮M; B), or 8-Br-cAMP (0, 10 or 100 ␮M; C) for 24 h. Cortisol levels in the media were determined by a radioimmunoassay. The data are expressed as the mean ± SEM (n = 3–4). *P < 0.05; **P < 0.01 when compared with 0 ␮M mitotane; # P < 0.05; ## P < 0.01 when compared with the respective 0 ␮M mitotane group.

18

C.-W. Lin et al. / Toxicology 298 (2012) 14–23

to the basal level after incubation with 40 ␮M mitotane for 24 h (Fig. 5A and B). 3.4. Mitotane inhibited the basal gene expression of steroidogenic enzymes

Fig. 5. The effects of mitotane on the 8-Br-cAMP mediated protein expressions of StAR (A) and P450scc (B). Cells were treated with mitotane (0, 20 or 40 ␮M) and combined with 100 ␮M 8-Br-cAMP for 24 h. The protein expressions levels of StAR (37, 32 and 30 kDa) and P450scc (60 kDa) were analyzed by Western blot. The data are expressed as the mean ± SEM (n = 3–4).

3.3. Mitotane impairs the ACTH/cAMP-mediated cortisol secretion of NCI-H295 cells ZF cells are responsible for the production of glucocorticoids, chiefly cortisol, in humans. This biosynthetic process is positively activated by ACTH. To investigate whether mitotane interferes with ACTH-mediated cortisol secretion, NCI-H295 cells were cultured with mitotane (0, 20 or 40 ␮M) in combination with ACTH (0, 1 or 100 nM) for 24 h. Cortisol secretion was enhanced in cells challenged with 1 and 100 nM ACTH (Fig. 4A, P < 0.05). Mitotane (20 or 40 ␮M) treatment completely abolished the ACTH-induced cortisol secretion. To further investigate the role of mitotane in the cAMP signaling pathway, the cells were treated with forskolin (FK; an adenylyl cyclase activator; 0, 1 or 10 ␮M) and 8-Br-cAMP (a permeable cAMP analog; 0, 10 or 100 ␮M; Fig. 4) for 24 h. Our results indicate that 10 ␮M FK significantly elevated cortisol secretion when compared with the control group (Fig. 4B; P < 0.01). Both basal and FK (1 and 10 ␮M)-mediated cortisol secretion was suppressed by mitotane in a dose-dependent manner. FK (10 ␮M)-induced cortisol secretion was partially and completely inhibited by 20 ␮M and 40 ␮M mitotane, respectively, when compared with the respective control. In contrast, when NCI-H295 cells were treated with 8-Br-cAMP (0, 10 or 100 ␮M; Fig. 4B) for 24 h, only 100 ␮M 8-Br-cAMP effectively increased cortisol secretion. Basal and 8-Br-cAMP-stimulated cortisol release was significantly suppressed by 20 and 40 ␮M mitotane in a dose-dependent manner. These results suggest that mitotane suppressed cortisol production by interfering with the cAMP downstream pathway. StAR and P450scc are mainly regulated by ACTH/cAMP related signaling; therefore, we further investigated the protein levels of these two enzymes. The effects of 8-Br-cAMP (100 ␮M) and mitotane (20 or 40 ␮M) on StAR protein expression were not observed in our Western blot analysis (Fig. 5). Although there was no statistically significant difference, P450scc appeared to be slightly elevated by 8-Br-cAMP and then restored

To investigate how mitotane regulates adrenocortical steroidogenesis, NCI-H295 cells were treated with mitotane (0, 10, 20, 30 or 40 ␮M) for 24 h, and then mRNA levels of steroidogenic enzymes, including StAR, CYP11A1, HSD3B2, CYP17, CYP21, CYP11B1 and CYP11B2 were analyzed by real-time RT-PCR. Mitotane was unable to significantly inhibit StAR mRNA expression (Fig. 6A) at 20 ␮M; however, this concentration of mitotane effectively inhibited CYP11A1 mRNA expression (Fig. 6B; P < 0.05). In addition, the highest concentration of mitotane (40 ␮M) significantly suppressed both StAR (Fig. 6A) and CYP11A1 (Fig. 6B) mRNA expression in a dose-dependent manner. Mitotane was unable to alter HSD3B2 (Fig. 6C) or CYP17 (Fig. 6D). CYP21 mRNA slightly decreased with increasing mitotane concentrations and was significantly reduced by 40 ␮M mitotane (Fig. 6E, P < 0.01). Interestingly, 20 and 30 ␮M mitotane strongly enhanced CYP11B1 mRNA expression approximately 2.6-fold compared with 0 ␮M mitotane (Fig. 6F). We also found that 40 ␮M mitotane neither promoted nor inhibited CYP11B1 mRNA expression when compared with the control group. 3.5. Mitotane blocked the cAMP-enhanced gene transcription of steroidogenic enzymes NCI-H295 cells were treated with 8-Br-cAMP (0, 100 ␮M) and mitotane (0, 10, 20, 30 or 40 ␮M) for 24 h and mRNA levels of steroidogenic enzymes were analyzed by real-time RT-PCR. When compared with 8-Br-cAMP alone, middle concentrations of mitotane (20–30 ␮M) suppressed StAR and CYP11A1 up to 50% (Fig. 7A and B, P < 0.05 and <0.01, respectively); and 40 ␮M almost completely abolished this positive effect that caused by 8-Br-cAMP. Increasing doses of mitotane gradually decreased HSD3B2 to near basal levels (Fig. 7C). CYP17 (Fig. 7D) and CYP21 (Fig. 7E) was significantly decreased by different concentrations of mitotane. The mRNA of CYP11B1 was only decreased by 40 ␮M mitotane (Fig. 7F). Certainly, 40 ␮M mitotane deeply impaired the cAMPinduced mRNA levels of these enzymes. Based on Figs. 6 and 7, mitotane exhibited similar inhibitory efficacy on StAR mRNA in the cells treated with mitotane alone (Mtbasal) or mitotane plus 8-Br-cAMP (Mt-cAMP). In contrast with the Mt-basal group, the inhibition of 30 ␮M mitotane on CYP11A1 was more potentially than which in Mt-cAMP group (Table 2; P < 0.01). Less than 40 ␮M mitotane could not alter CYP17 expression in the Mt-basal group (Fig. 6D); however, 20 and 30 ␮M mitotane were more effective in the Mt-cAMP group (Fig. 7D and Table 2; P < 0.05; P < 0.01). The 10 ␮M mitotane remarkably inhibited CYP21 in Mt-cAMP than in Mt-basal group (Figs. 6E and 7E; Table 2; P < 0.05). The elevation of CYP11B1 caused by 20–30 ␮M mitotane was remarkably in the Mt-basal group (Table 3; P < 0.01). Moreover, the inhibitory efficacy of 40 ␮M mitotane on CYP11B1 that was more effective in the Mt-cAMP group (Table 3; P < 0.01). 4. Discussion The causes of Cushing’s syndrome are divided into ACTHdependent and -independent (Newell-Price et al., 2006) groups. The same clinical symptoms are present in both groups. In ACTH-dependent Cushing’s syndrome, caused by a pituitary tumor (Cushing’s disease), the oversecretion of ACTH induces inappropriate cortisol synthesis. In contrast, ACTH-independent Cushing’s syndrome, such as ACC, is caused by hypertrophy of the adrenal

C.-W. Lin et al. / Toxicology 298 (2012) 14–23

19

Fig. 6. The effects of mitotane (0, 10, 20, 30 or 40 ␮M) on the mRNA expression of steroidogenic enzymes (A) StAR, (B) CYP11A1, (C) HSD3B2, (D) CYP17, (E) CYP21 and (F) CYP11B1 in NCI-H295 cells after a 24-h incubation. The mRNA levels were determined by real-time PCR and calculated relative to the control value. The data are expressed as the mean ± SEM (n = 3). *P < 0.05, **P < 0.01 when compared with the 0 ␮M mitotane control group.

exceeding 22 mg/l (68.74 ␮M) are toxic (Phan, 2007; Hermsen et al., 2011). Side effects and mitotane plasma levels of patients who are receiving mitotane should be monitored because the therapeutic window is narrow. On the other hand, plasma cortisol level and patients’ responses to mitotane were proposed as predictors of ACC metastasis and prognosis (Gonzalez et al., 2007; Schwarte et al., 2007), revealing the benefit of mitotane-cortisol studies for clinical therapy of Cushing’s syndrome, Cushing’s disease and ACC. NCIH295 cells originated from human ACC, and cortisol was the most abundant composition in the supernatant fluid. Hence, this cell line

cortex that results in the oversecretion of cortisol (bypassing the effect of ACTH). In the clinic, mitotane is not only used as a steroid hormone biosynthesis inhibitor for Cushing’s syndrome (Igaz et al., 2008), but it is also the only drug approved by the U.S. Food and Drug Administration (FDA) for the treatment of ACC (Phan, 2007). The current recommendation is to keep the plasma level greater than 7 mg/l (>21.8 ␮M) to produce anti-steroidogenic effects. Anti-tumorigenic effects occurred when the plasma level was kept between 14 and 20 mg/l (43.7–62.5 ␮M). Importantly, plasma mitotane levels

Table 2 The inhibitory percentages of the mitotane basal (Mt-basal) group and the 8-Br-cAMP-stimulated (Mt-cAMP) group on mRNA expression of steroidogenic enzymes. Mt conc. (␮M)

Steroidogenic genes StAR

CYP11A1

Mt-basal 10 20 30 40

−3.67 34.00 28.33 80.33

± ± ± ±

Mt-cAMP 23.25 5.13 18.76 3.84

34.11 33.33 56.10 84.52

± ± ± ±

13.22 14.58 9.38 4.87

CYP17

Mt-basal 12.00 44.33 30.00 85.67

± ± ± ±

Mt-cAMP 15.04 8.41 9.54 1.76

25.07 49.77 61.09 79.81

± ± ± ±

6.51 5.95 3.68** 6.91

CYP21

Mt-basal −73.67 −103 −144.33 44

± ± ± ±

30.18 56.89 62.13 3.79

Mt-cAMP

Mt-basal

−1.57 14.81 32.32 62.41

10.00 44.00 44.67 65.33

± ± ± ±

22.20 6.81* 9.85** 7.67

± ± ± ±

Mt-cAMP 19.67 5.51 9.06 19.22

62.81 52.06 62.19 83.96

± ± ± ±

2.88* 12.17 9.61 3.60

Data are presented as the percentage of untreated cells in the Mt-basal groups and as the percentage of 8-Br-cAMP-treated cells in the Mt-cAMP groups. Abbreviation: Mt, mitotane. * P < 0.05 compared with the respective Mt basal group. ** P < 0.01 compared with the respective Mt basal group.

20

C.-W. Lin et al. / Toxicology 298 (2012) 14–23

Fig. 7. The effects of mitotane (0, 10, 20, 30 or 40 ␮M) on the 8-Br-cAMP (100 ␮M)-induced mRNA expression of steroidogenic enzymes (A) StAR, (B) CYP11A1, (C) HSD3B2, (D) CYP17, (E) CYP21 and (F) CYP11B1 in NCI-H295 cells after a 24-h incubation. The mRNA levels were calculated relative to the control value. The data are expressed as the mean ± SEM (n = 3–5). **P < 0.01 when compared with the 0 ␮M mitotane control group; # P < 0.05, ## P < 0.01 when compared with 8-Br-cAMP alone.

Table 3 The stimulatory or inhibitory percentage of mitotane on Mt basal and 8-Br-cAMPinduced CYP11B1 and CYP11B2 mRNA expression. Mt conc. (␮M)

Steroidogenic genes CYP11B1 Mt-basal

10 20 30 40

38.24 37.22 52.24 44

± ± ± ±

Mt-cAMP 12.31 24.83 13.83 3.79

7.62 19.25 8.2 62.78

± ± ± ±

20.8 6.38 0.41** 6.57*

A stimulatory effect was observed in response to 10–30 ␮M mitotane. An inhibitory effect was observed at 40 ␮M mitotane. Data are presented as the percentage of untreated cells in the Mt-basal groups and as the percentage of 8-Br-cAMP treated alone cells in the Mt-cAMP groups. Abbreviation: Mt, mitotane. * P < 0.05 compared with the respective Mt basal group. ** P < 0.01 compared with the respective Mt basal group.

was more suitable for glucocorticoids-related investigations compared with the H295R and H295A substrains that produce more androgens and mineralocorticoids, respectively (Samandari et al., 2007). The present study displayed a close correlation between the mitotane incubation time and concentration on cortisol production. The extended incubation time allowed the 10–30 ␮M mitotane to generate the inhibition of cortisol secretion that was only induced by 40 ␮M mitotane in 24- and 48-h incubation groups. The 40 ␮M mitotane caused the equal inhibitory efficacy in 24-, 48- and 72-h incubation groups (Fig. 2A). This long-lasting effects of mitotane can persist for at least for 3 days because it has a long half-life (18–159 days) caused by its lipophilic properties (van Erp et al., 2011). A previous study demonstrated that H295R cells cultured with 20 ␮M mitotane for 72 h exhibited severe cytotoxicity (Asp et al., 2010). In our experimental environments, mitotane (10–40 ␮M) did not induce cell death even though the reaction time was extended to 72 h (Fig. 2B). These results suggested that the differences of species

C.-W. Lin et al. / Toxicology 298 (2012) 14–23

(Cai et al., 1995), substrains and the medium composition, may contribute to the cellular sensitivity to mitotane. Previous studies indicated that mitotane inhibited FK- and dbcAMP-induced glucocorticoid secretion in fish and mice adrenocortical cells (Lacroix and Hontela, 2003; Asp et al., 2009); however, the mechanism of this effect remains unknown. According to our results, a greater increase in cortisol secretion was observed in cells treated with 10 ␮M FK and 100 ␮M 8-Br-cAMP than in cells treated with ACTH (Fig. 4). This difference may be caused by the decreased expression of the ACTH receptor in NCI-H295 cells (Rainey et al., 1994; Zenkert et al., 2000). Mitotane remarkably inhibited 8-BrcAMP-induced cortisol production in a dose-dependent manner (Fig. 4C). The observation that 20 and 40 ␮M mitotane suppressed cortisol to levels as low as the respective control groups showed that mitotane has dual inhibitory effects on cortisol secretion under these two different microcellular environments. These results suggested that adenylyl cyclase activity and/or cAMP downstream pathways were involved in the suppressive effects of mitotane on cortisol secretion (Hart and Straw, 1971; Ilan and Yaron, 1980; Lacroix and Hontela, 2003). The present study extends the clinical value and supports the clinical usage of mitotane for ACTHdependent forms of Cushing’s syndrome (Kamenicky et al., 2011) to block cAMP signaling. DDT and its metabolites markedly impaired mammalian female reproductive capabilities (Wojtowicz et al., 2004, 2007a,b). Among these metabolites, mitotane possessed high specificity for the adrenal cortex of different species (Phan, 2007; Schteingart, 2007; Wandoloski et al., 2009), induced adrenal cortex damage (Schteingart et al., 1993) and disrupted adrenocortical hormones synthesis (Schteingart et al., 1993; Morishita et al., 2001). Moreover, mitotane irreversibly binds to proteins in Y1 cells that originated from a murine corticosterone-producing adrenocortical tumor, in a time- and dose-dependent manner (Hermansson et al., 2007). In addition, mitotane extensively modulates the expression of proteins that are responsible for energy metabolism, stress response, and the cytoskeleton, despite the tumorigenic ability of NCI-H295R cells (Stigliano et al., 2008). According to our results, mitotane inhibited the 37 kDa forms of StAR and P450scc (Fig. 3A and B) in basal conditions. In contrast, 40 ␮M mitotane was unable to induce an effect on 8-Br-cAMP-mediated StAR and P450scc expression (Fig. 5A and B). To further investigate the molecular effects of mitotane, the gene expressions of a series of steroidogenic enzymes, including StAR, CYP11A1, HSD3B2, CYP17, CYP21, and CYP11B1 were detected by real-time PCR. The mRNA levels of StAR and CYP11A1, proteins that participate in the rate-limiting step of steroidogenesis, was slightly decreased and severely decreased at 20 ␮M and 40 ␮M, respectively (Fig. 6A and B; Table 2). CYP21 mRNA was significantly suppressed by 20–40 ␮M mitotane (Fig. 6E). HSD3B2 (Fig. 6C) and CYP17 (Fig. 6D) were unchanged (Fig. 6C and D). Therefore, we propose that StAR, CYP11A1 and CYP21 mRNA expression are more sensitive to mitotane. This is the first report demonstrating that mitotane interfered upstream of the steroidogenesis pathway, specifically by affecting StAR expression. Apparently mitotane disrupts the gene expression of a series of steroidogenic enzymes that exhibit different sensitivity to various mitotane concentrations. A previous clinical study found that mitotane inhibited 3␤-HSD (HSD3B2), as determined by higher decrement of progesterone and 17␣hydroxyprogesterone than pregnenolone and 17␣-pregnenolone in mitotane-treated patients with adrenal carcinoma or Cushing’s disease (Ojima et al., 1984). However, our results indicated that HSD3B2 expression was not affected by 0–40 ␮M mitotane in NCIH295 cells, suggesting that mitotane may be change the translation and/or protein activity of 3␤-HSD.

21

Interestingly, CYP11B1 mRNA expression was upregulated approximately 2.6-fold in response to 20 ␮M and 30 ␮M mitotane when compared with the control (Fig. 6E). This stimulatory effect disappeared at 40 ␮M mitotane and which concentration was also failed to suppress CYP11B1. Mitotane exhibited a similar stimulatory effect on CYP11B2 encoding aldosterone synthase (data not shown). These data highlight the importance of a stimulatory effect of mitotane on CYP11B1 and CYP11B2 mRNA expression. Under basal conditions, 40 ␮M mitotane significantly inhibited StAR, CYP11A1, and CYP21 mRNA expression that resulted in decreased cortisol secretion. However, CYP11A1 was inhibited and subsequently lowered the generation of the precursor pregnenolone; therefore, mitotane-induced CYP11B1 could not reverse the cortisol production at 20 ␮M mitotane. Under the cAMP-activating condition, StAR and CYP11A1 (Fig. 7A and B) mRNA were inhibited by 10–20 ␮M mitotane, revealing that these genes exhibited a similar response to mitotane. The consistent expression of HSD3B2 (Fig. 7C) suggested that which was insensitive to 10–40 ␮M mitotane. CYP17 and CYP21 mRNA (Fig. 7D and E) became more sensitive to mitotane when compared with the basal condition (Fig. 6D and E; Table 2). The CYP11B1 mRNA expression was increased 6-fold by 8Br-cAMP (Fig. 7F) and was the most sensitive to 8-Br-cAMP among the tested mitochondrial enzymes. Moreover, CYP11B2 was increased 4-fold by 8-Br-cAMP (data not shown). Generally, CYP11B1 mRNA expression is primarily regulated by ACTH, whereas CYP11B2 is mainly regulated by the rennin-angiotensin system (Quinn and Williams, 1988; Waterman and Simpson, 1989). Mitotane exhibited a single inhibitory effect on CYP11B1, and the biphasic phenomenon of mitotane found under basal conditions (Fig. 6F) disappeared under cAMP-stimulating conditions. Unexpectedly, the combination of 8-Br-cAMP and mitotane exhibited a synergic positive effect on CYP11B2 expression and then weakened rapidly when mitotane was increased to 40 ␮M (data not shown). This suggests that mitotane may be the concentration-dependent switch for CYP11B1 and CYP11B2 gene expression in NCH-H295 cells. Mitotane interferes with adrenal steroidogenesis and exhibited inhibitory ability through different mechanisms under basal and cAMP-stimulating microenvironments. Although the molecular mechanism of the biphasic effect of mitotane on CYP11B1 and CYP11B2 needs further study, the similarities between CYP11B1 and CYP11B2 mRNA expression (Lisurek and Bernhardt, 2004) may be the key reason behind this phenomenon. Another metabolite of DDT, 3-methylsulfonyl-2,2-bis(4-chlorophenyl)-1,1dichloroethene (3-MeSO2 -DDE) showed similar biphasic effects on CYP11B1 and CYP11B2 mRNA expression (Asp et al., 2010). Both 3MeSO2 -DDE and mitotane generated biphasic effects on CYP11B1 and CYP11B2 expression levels, revealing a possible mechanism of action for the biochemical properties of DDT metabolites. Certainly, mRNA stability needs to be considered (Li et al., 2004; Lin et al., 2006). These results demonstrate that mitotane positively and negatively regulates the transcriptional activity of individual steroidogenic enzymes. Mitotane seems to neutralize the positive effect of 8-Br-cAMP in a dose-dependent manner; in addition, it almost returned the 8-Br-cAMP-induced gene expression of STAR, CYP11A1, HSD3B2, CYP17, CYP21 and CYP11B1 to control levels at 40 ␮M. However, 40 ␮M mitotane suppressed cortisol lower than the basal level. We presumed mitotane extensively affects cAMPmediated de novo cholesterol biosynthesis mechanism and/or the activity of steroidogenic enzymes. The sensitivity of each enzyme for mitotane was different depending on the presence of 8-Br-cAMP (Tables 2 and 3), revealing that the clinical application of mitotane in ACTH-dependent and -independent Cushing’s syndrome should be differentiated.

22

C.-W. Lin et al. / Toxicology 298 (2012) 14–23

To investigate the true anti-steroidogenic effect and mimic the clinical utilization of mitotane, we conscientiously adjusted the applied mitotane concentrations that inhibited cortisol secretion but did not cause cell death. Our laboratory results agreed with the observed clinical outcomes of mitotane treatment. Narrow spacing of the mitotane concentration enabled the discovery of its biphasic effect on specific genes. Multiple studies demonstrated that steroidogenic factor-1 (SF-1), a transcriptional factor, plays a crucial role in regulating the gene transcription of steroidogenic enzymes through interaction with corepressors and/or coactivators downstream of the ERK, JAK and/or PI3K signaling pathways (Sewer and Waterman, 2003; Hsu et al., 2006; Ferreira et al., 2007; Hoivik et al., 2010). Moreover, mitotane also produced an anti-tumorigenic effect through decreased vascular endothelial growth factor (VEGF) secretion and induced cell death (data not shown). In summary, we demonstrated that mitotane exerted multiple effects on cortisol biosynthesis because it extensively interfered with the mRNA expression of adrenal steroidogenic enzymes including StAR, CYP11A1, CYP17 and CYP21 under basal and/or cAMP-stimulating microenvironments in NCI-H295 cells. The biphasic effect on CYP11B1 and CYP11B2 mRNA expression may indicate some disadvantages that should be avoided. Determining the detailed mechanisms of these effects warrants further investigation in order to improve ACC pharmacotherapy. Conflict of interest The authors declare no conflict of interest. Acknowledgments We would like to thank Prof. Paulus S. Wang from the Department of Physiology, School of Medicine at the National Yang-Ming University for providing the cortisol RIA kit. This research was supported by grants from the Veterans General Hospital of Taipei, Taiwan, R.O.C. (V101C-197). References Abiven, G., Coste, J., Groussin, L., Anract, P., Tissier, F., Legmann, P., Dousset, B., Bertagna, X., Bertherat, J., 2006. Clinical and biological features in the prognosis of adrenocortical cancer: poor outcome of cortisol-secreting tumors in a series of 202 consecutive patients. J. Clin. Endocrinol. Metab. 91, 2650–2655. Allolio, B., Fassnacht, M., 2006. Clinical review: adrenocortical carcinoma: clinical update. J. Clin. Endocrinol. Metab. 91, 2027–2037. Arola, J., Heikkila, P., Voutilainen, R., Kahri, A.I., 1993. Role of adenylate cyclase-cyclic AMP-dependent signal transduction in the ACTH-induced biphasic growth effect of rat adrenocortical cells in primary culture. J. Endocrinol. 139, 451–461. Asp, V., Lindstrom, V., Olsson, J.A., Bergstrom, U., Brandt, I., 2009. Cytotoxicity and decreased corticosterone production in adrenocortical Y-1 cells by 3-methylsulfonyl-DDE and structurally related molecules. Arch. Toxicol. 83, 389–396. Asp, V., Ulleras, E., Lindstrom, V., Bergstrom, U., Oskarsson, A., Brandt, I., 2010. Biphasic hormonal responses to the adrenocorticolytic DDT metabolite 3methylsulfonyl-DDE in human cells. Toxicol. Appl. Pharmacol. 242, 281–289. Cai, W., Counsell, R.E., Djanegara, T., Schteingart, D.E., Sinsheimer, J.E., Wotring, L.L., 1995. Metabolic activation and binding of mitotane in adrenal cortex homogenates. J. Pharm. Sci. 84, 134–138. Daffara, F., De Francia, S., Reimondo, G., Zaggia, B., Aroasio, E., Porpiglia, F., Volante, M., Termine, A., Di Carlo, F., Dogliotti, L., Angeli, A., Berruti, A., Terzolo, M., 2008. Prospective evaluation of mitotane toxicity in adrenocortical cancer patients treated adjuvantly. Endocr. Relat. Cancer 15, 1043–1053. Ferreira, J.G., Cruz, C.D., Neves, D., Pignatelli, D., 2007. Increased extracellular signal regulated kinases phosphorylation in the adrenal gland in response to chronic ACTH treatment. J. Endocrinol. 192, 647–658. Gallo-Payet, N., Payet, M.D., 2003. Mechanism of action of ACTH: beyond cAMP. Microsc. Res. Tech. 61, 275–287. Gazdar, A.F., Oie, H.K., Shackleton, C.H., Chen, T.R., Triche, T.J., Myers, C.E., Chrousos, G.P., Brennan, M.F., Stein, C.A., La Rocca, R.V., 1990. Establishment and characterization of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res. 50, 5488–5496. Gonzalez, R.J., Tamm, E.P., Ng, C., Phan, A.T., Vassilopoulou-Sellin, R., Perrier, N.D., Evans, D.B., Lee, J.E., 2007. Response to mitotane predicts outcome in patients

with recurrent adrenal cortical carcinoma. Surgery 142, 867–875, discussion 867–875. Hart, M.M., Straw, J.A., 1971. Studies on the site of action of o,p -DDD in the dog adrenal cortex. 1. Inhibition of ACTH-mediated pregnenolone synthesis. Steroids 17, 559–574. Hermansson, V., Asp, V., Bergman, A., Bergstrom, U., Brandt, I., 2007. Comparative CYP-dependent binding of the adrenocortical toxicants 3-methylsulfonyl-DDE and o,p -DDD in Y-1 adrenal cells. Arch. Toxicol. 81, 793–801. Hermsen, I.G., Fassnacht, M., Terzolo, M., Houterman, S., den Hartigh, J., Leboulleux, S., Daffara, F., Berruti, A., Chadarevian, R., Schlumberger, M., Allolio, B., Haak, H.R., Baudin, E., 2011. Plasma concentrations of o,p DDD, o,p DDA, and o,p DDE as predictors of tumor response to mitotane in adrenocortical carcinoma: results of a retrospective ENS@T multicenter study. J. Clin. Endocrinol. Metab. 96, 1844–1851. Hoivik, E.A., Lewis, A.E., Aumo, L., Bakke, M., 2010. Molecular aspects of steroidogenic factor 1 (SF-1). Mol. Cell. Endocrinol. 315, 27–39. Hsu, H.T., Chang, Y.C., Chiu, Y.N., Liu, C.L., Chang, K.J., Guo, I.C., 2006. Leptin interferes with adrenocorticotropin/3 ,5 -cyclic adenosine monophosphate (cAMP) signaling, possibly through a Janus kinase 2-phosphatidylinositol 3-kinase/Aktphosphodiesterase 3-cAMP pathway, to down-regulate cholesterol side-chain cleavage cytochrome P450 enzyme in human adrenocortical NCI-H295 cell line. J. Clin. Endocrinol. Metab. 91, 2761–2769. Hum, D.W., Miller, W.L., 1993. Transcriptional regulation of human genes for steroidogenic enzymes. Clin. Chem. 39, 333–340. Igaz, P., Tombol, Z., Szabo, P.M., Liko, I., Racz, K., 2008. Steroid biosynthesis inhibitors in the therapy of hypercortisolism: theory and practice. Curr. Med. Chem. 15, 2734–2747. Ilan, Z., Yaron, Z., 1980. Suppression by organochlorines of the response to adrenocorticotrophin of the interrenal tissue in Sarotherodon aureus (Teleostei). J. Endocrinol. 87, 185–193. Jorgensen, E.H., Balm, P.H., Christiansen, J.S., Plotitsyna, N., Ingebrigtsen, K., 2001. Influence of o p-DDD on the physiological response to stress in Arctic charr (Salvelinus alpinus). Aquat. Toxicol. 54, 179–193. Kamenicky, P., Droumaguet, C., Salenave, S., Blanchard, A., Jublanc, C., Gautier, J.F., Brailly-Tabard, S., Leboulleux, S., Schlumberger, M., Baudin, E., Chanson, P., Young, J., 2011. Mitotane, metyrapone, and ketoconazole combination therapy as an alternative to rescue adrenalectomy for severe ACTH-dependent Cushing’s syndrome. J. Clin. Endocrinol. Metab. 96, 2796–2804. Korth-Schutz, S., Levine, L.S., Roth, J.A., Saenger, P., New, M.I., 1977. Virilizing adrenal tumor in a child suppressed with dexamethasone for three years. Effect of o,p -DDD on serum and urinary androgens. J. Clin. Endocrinol. Metab. 44, 433–439. Lacroix, M., Hontela, A., 2003. The organochlorine o,p -DDD disrupts the adrenal steroidogenic signaling pathway in rainbow trout (Oncorhynchus mykiss). Toxicol. Appl. Pharmacol. 190, 197–205. Li, L.A., Wang, P.W., Chang, L.W., 2004. Polychlorinated biphenyl 126 stimulates basal and inducible aldosterone biosynthesis of human adrenocortical H295R cells. Toxicol. Appl. Pharmacol. 195, 92–102. Libe, R., Fratticci, A., Bertherat, J., 2007. Adrenocortical cancer: pathophysiology and clinical management. Endocr. Relat. Cancer 14, 13–28. Lin, T.C., Chien, S.C., Hsu, P.C., Li, L.A., 2006. Mechanistic study of polychlorinated biphenyl 126-induced CYP11B1 and CYP11B2 up-regulation. Endocrinology 147, 1536–1544. Lindhe, O., Skogseid, B., Brandt, I., 2002. Cytochrome P450-catalyzed binding of 3-methylsulfonyl-DDE and o,p -DDD in human adrenal zona fasciculata/reticularis. J. Clin. Endocrinol. Metab. 87, 1319–1326. Lindholm, J., Juul, S., Jorgensen, J.O., Astrup, J., Bjerre, P., Feldt-Rasmussen, U., Hagen, C., Jorgensen, J., Kosteljanetz, M., Kristensen, L., Laurberg, P., Schmidt, K., Weeke, J., 2001. Incidence and late prognosis of Cushing’s syndrome: a population-based study. J. Clin. Endocrinol. Metab. 86, 117–123. Lisurek, M., Bernhardt, R., 2004. Modulation of aldosterone and cortisol synthesis on the molecular level. Mol. Cell. Endocrinol. 215, 149–159. Luton, J.P., Cerdas, S., Billaud, L., Thomas, G., Guilhaume, B., Bertagna, X., Laudat, M.H., Louvel, A., Chapuis, Y., Blondeau, P., et al., 1990. Clinical features of adrenocortical carcinoma, prognostic factors, and the effect of mitotane therapy. N. Engl. J. Med. 322, 1195–1201. Morishita, K., Okumura, H., Ito, N., Takahashi, N., 2001. Primary culture system of adrenocortical cells from dogs to evaluate direct effects of chemicals on steroidogenesis. Toxicology 165, 171–178. Nelson, A.A., Woodard, G., 1949. Severe adrenal cortical atrophy (cytotoxic) and hepatic damage produced in dogs by feeding 2,2-bis(parachlorophenyl)-1,1dichloroethane (DDD or TDE). Arch. Pathol. 48, 387–394. Newell-Price, J., Bertagna, X., Grossman, A.B., Nieman, L.K., 2006. Cushing’s syndrome. Lancet 367, 1605–1617. Ojima, M., Saito, M., Fukuchi, S., 1984. The effects of o,p -DDD on human adrenal steroid synthesis. Nippon Naibunpi Gakkai Zasshi 60, 852–871. Ojima, M., Saitoh, M., Itoh, N., Kusano, Y., Fukuchi, S., Naganuma, H., 1985. The effects of o,p -DDD on adrenal steroidogenesis and hepatic steroid metabolism. Nippon Naibunpi Gakkai Zasshi 61, 168–178. Oskarsson, A., Ulleras, E., Plant, K.E., Hinson, J.P., Goldfarb, P.S., 2006. Steroidogenic gene expression in H295R cells and the human adrenal gland: adrenotoxic effects of lindane in vitro. J. Appl. Toxicol. 26, 484–492. Phan, A.T., 2007. Adrenal cortical carcinoma – review of current knowledge and treatment practices. Hematol. Oncol. Clin. North Am. 21, 489–507. Quinn, S.J., Williams, G.H., 1988. Regulation of aldosterone secretion. Annu. Rev. Physiol. 50, 409–426.

C.-W. Lin et al. / Toxicology 298 (2012) 14–23 Rainey, W.E., Bird, I.M., Mason, J.I., 1994. The NCI-H295 cell line: a pluripotent model for human adrenocortical studies. Mol. Cell. Endocrinol. 100, 45–50. Samandari, E., Kempna, P., Nuoffer, J.M., Hofer, G., Mullis, P.E., Fluck, C.E., 2007. Human adrenal corticocarcinoma NCI-H295R cells produce more androgens than NCI-H295A cells and differ in 3␤-hydroxysteroid dehydrogenase type 2 and 17,20 lyase activities. J. Endocrinol. 195, 459–472. Schteingart, D.E., 2007. Adjuvant mitotane therapy of adrenal cancer – use and controversy. N. Engl. J. Med. 356, 2415–2418. Schteingart, D.E., Sinsheimer, J.E., Counsell, R.E., Abrams, G.D., McClellan, N., Djanegara, T., Hines, J., Ruangwises, N., Benitez, R., Wotring, L.L., 1993. Comparison of the adrenalytic activity of mitotane and a methylated homolog on normal adrenal cortex and adrenal cortical carcinoma. Cancer Chemother. Pharmacol. 31, 459–466. Schwarte, S., Brabant, E.G., Bastian, L., Bruns, F., 2007. Cortisol as a possible marker of metastatic adrenocortical carcinoma: a case report with 3-year follow-up. Anticancer Res. 27, 1917–1920. Sewer, M.B., Waterman, M.R., 2003. ACTH modulation of transcription factors responsible for steroid hydroxylase gene expression in the adrenal cortex. Microsc. Res. Tech. 61, 300–307. Soreide, J.A., Brabrand, K., Thoresen, S.O., 1992. Adrenal cortical carcinoma in Norway, 1970–1984. World J. Surg. 16, 663–667. Stigliano, A., Cerquetti, L., Borro, M., Gentile, G., Bucci, B., Misiti, S., Piergrossi, P., Brunetti, E., Simmaco, M., Toscano, V., 2008. Modulation of proteomic profile in H295R adrenocortical cell line induced by mitotane. Endocr. Relat. Cancer 15, 1–10. Stocco, D.M., 1997. A StAR search: implications in controlling steroidgenesis. Biol. Reprod. 56, 328–336. Thomas, M., Keramidas, M., Monchaux, E., Feige, J.J., 2003. Role of adrenocorticotropic hormone in the development and maintenance of the adrenal cortical vasculature. Microsc. Res. Tech. 61, 247–251.

23

Touitou, Y., Bogdan, A., Auzeby, A., Dommergues, J.P., 1979. Glucocorticoid and mineralocorticoid pathways in two adrenocortical carcinomas: comparison of the effects of o,p -dichlorodiphenyldichloroethane, aminoglutethimide and 2-p-aminophenyl-2-phenylethylamine in vitro. J. Endocrinol. 82, 87–94. van Erp, N.P., Guchelaar, H.J., Ploeger, B.A., Romijn, J.A., Hartigh, J., Gelderblom, H., 2011. Mitotane has a strong and a durable inducing effect on CYP3A4 activity. Eur. J. Endocrinol. 164, 621–626. Wajchenberg, B.L., Albergaria Pereira, M.A., Medonca, B.B., Latronico, A.C., Campos Carneiro, P., Alves, V.A., Zerbini, M.C., Liberman, B., Carlos Gomes, G., Kirschner, M.A., 2000. Adrenocortical carcinoma: clinical and laboratory observations. Cancer 88, 711–736. Wandoloski, M., Bussey, K.J., Demeure, M.J., 2009. Adrenocortical cancer. Surg. Clin. North Am. 89, 1255–1267. Waterman, M.R., Simpson, E.R., 1989. Regulation of steroid hydroxylase gene expression is multifactorial in nature. Recent Prog. Horm. Res. 45, 533–563, discussion 563–536. Wojtowicz, A.K., Gregoraszczuk, E.L., Ptak, A., Falandysz, J., 2004. Effect of single and repeated in vitro exposure of ovarian follicles to o,p -DDT and p,p -DDT and their metabolites. Pol. J. Pharmacol. 56, 465–472. Wojtowicz, A.K., Kajta, M., Gregoraszczuk, E.L., 2007a. DDT- and DDE-induced disruption of ovarian steroidogenesis in prepubertal porcine ovarian follicles: a possible interaction with the main steroidogenic enzymes and estrogen receptor ␤. J. Physiol. Pharmacol. 58, 873–885. Wojtowicz, A.K., Milewicz, T., Gregoraszczuk, E.L., 2007b. DDT and its metabolite DDE alter steroid hormone secretion in human term placental explants by regulation of aromatase activity. Toxicol. Lett. 173, 24–30. Zenkert, S., Schubert, B., Fassnacht, M., Beuschlein, F., Allolio, B., Reincke, M., 2000. Steroidogenic acute regulatory protein mRNA expression in adrenal tumours. Eur. J. Endocrinol. 142, 294–299.