MLL2 promotes cancer cell lymph node metastasis by interacting with RelA and facilitating STC1 transcription

Journal Pre-proof MLL2 promotes cancer cell lymph node metastasis by interacting with RelA and facilitating STC1 transcription Hongqi Li, Qinfang Li, Jingjing Lian, Yuan Chu, Kang Fang, Aiping Xu, Tao Chen, Meidong Xu

PII:

S0898-6568(19)30253-0

DOI:

https://doi.org/10.1016/j.cellsig.2019.109457

Reference:

CLS 109457

To appear in: Received Date:

12 August 2019

Revised Date:

23 October 2019

Accepted Date:

24 October 2019

Please cite this article as: Li H, Li Q, Lian J, Chu Y, Fang K, Xu A, Chen T, Xu M, MLL2 promotes cancer cell lymph node metastasis by interacting with RelA and facilitating STC1 transcription, Cellular Signalling (2019), doi: https://doi.org/10.1016/j.cellsig.2019.109457

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Running title MLL2 promotes cancer cell lymph node metastasis

MLL2 promotes cancer cell lymph node metastasis by interacting with RelA and facilitating STC1 transcription Hongqi Lia,1, Qinfang Lia,1, Jingjing Liana,1, Yuan Chua, Kang Fanga, Aiping Xua, Tao Chena, Meidong Xua a

Endoscopy Center, East Hospital, Tongji University School of Medicine, Shanghai,

ro of

China.

Correspondence: Meidong Xu, Endoscopy Center, East Hospital, Tongji University

School of Medicine, Shanghai 200120, China, Email: [email protected]; Tao

-p

Chen, Endoscopy Center, East Hospital, Tongji University School of Medicine, Shanghai 200120, China, Email: [email protected] These authors contributed equally to this work.

re

1



Jo



na



High level of MLL2 was significantly associated with early-stage ESCC lymph node metastasis. MLL2 positively regulates gene expression programs associated with ESCC cell migration. MLL2 interacts with RelA in the nucleus to enhance transcription of stanniocalcin1 (STC1) and to facilitates cancer metastasis. MLL2 can be a marker for early prediction of lymph node metastasis of ESCC

ur



lP

Highlights

Abstract

Esophageal squamous cell carcinoma (ESCC) presents with lymph node metastasis in the early stages, limiting the opportunities for curative local resection, including endoscopic submucosal dissection (ESD). ESD is regarded as the standard treatment for early-stage ESCCs. However, radical surgery is recommended when lymph node 1

metastasis risk exists. More efforts are needed to find the markers for early prediction and clarify the molecular mechanism underlying the pathogenesis of lymph node metastasis. Recently, aberrant regulation of gene expression by histone methylation modifiers has emerged as an important mechanism for cancer metastasis. Herein, we demonstrated that mixed-lineage leukemia 2 (MLL2) positively regulates gene expression programs associated with ESCC cell migration. MLL2 interacts with RelA in the nucleus to enhance transcription of stanniocalcin-1 (STC1) and to facilitates cancer metastasis. Meanwhile, MLL2 knockdown resulted in a significant decrease in

ro of

the migration of ESCC cells. Clinically, high level of MLL2 was significantly associated with early-stage ESCC lymph node metastasis. In summary, these findings discovered a previously unidentified molecular pathway underlying the coordinated

regulation of metastasis-related STC-1 expression by MLL2 and RelA and highlight

-p

the critical role of MLL2 in ESCC.

re

Key words: esophageal squamous cell carcinoma, lymph node metastasis, mixed-

lP

lineage leukemia 2, stanniocalcin-1, RelA

Abbreviations

na

ESCC, esophageal squamous cell carcinoma; ESD, endoscopic submucosal dissection; MLL, mixed-lineage leukemia; STC1, stanniocalcin-1; EGFR, epidermal growth factor receptor; ERK, extracellular signal-regulated kinases; IPTG, isopropyl-β-DTNM,

ur

thiogalactopyranoside;

tumor-node-metastasis;

Jo

Committee on Cancer

2

AJCC,

American

Joint

1. Introduction Esophageal squamous cell carcinoma (ESCC) is one of the most aggressive cancers worldwide and the incidence rate has significantly increased in recent years [1]. After surgical resection of ESCC, the 5 years survival rate is only 50-80% for stage I disease, 10-40% for stage II disease, and 10-15% for stage III disease [1, 2]. The major reason for the poor prognostic outcome is most likely due to metastasis of cancer cells [3]. Patients typically present with lymph node metastasis even in the early stages, limiting the opportunities for curative local resection, including endoscopic submucosal

ro of

dissection (ESD). ESD is a novel minimally invasive methodology and the standard treatment for early-stage ESCCs that have negligible risk of lymph node metastasis.

However, radical surgery with lymph node dissection is recommended when lymph

node metastasis risk exists. Therefore, more effort is needed to determine predictive

-p

molecular markers for lymph node metastasis and clarify the mechanism underlying the

re

pathogenesis.

Recent findings from deep sequencing-based cancer genetic studies indicate that

lP

chromatin remodeling and histone modulators in transcriptional activation or repression are frequently altered and that the resulting aberrations promote cancer progression. For

na

instance, methylation of lysine (K) residues on histone H3 and H4 tails confer either an activating or a silencing effect on transcription [4]. Dimethylation (me2) and trimethylation (me3) of H3K4 are associated with transcriptional activation while

ur

H3K9 and H3K27 methylation are associated with transcriptional repression [5]. Histone methylation is catalyzed by histone methyltransferases (HMTs). The best

Jo

example, includes MLL family that contains multiple set1 domain with H3K4 HMT activities [6, 7]. In humans, the MLL family has 6 members: mixed-lineage leukemia 1 (MLL1, also known as KMT2A), mixed-lineage leukemia 2 (MLL2, also known as KMT2D), mixed-lineage leukemia 3 (MLL3, also known as KMT2C), mixed-lineage leukemia 4 (MLL4, also known as KMT2B), mixed-lineage leukemia 5 (MLL5, also known as KMT2E), Set1A, and Set1B [8]. Genomic landscape studies indicated that 3

MLL2, EP300, CREBBP, and TET2 were 4 major altered epigenetic genes in ESCC [9, 10]. Compared to other 3 genes, MLL2 was frequently altered in blood cancers [11-13]. Recently, an aberrant MLL2 pathway was found in solid cancers [14-17] and MLL2 was reported to play an essential role as a coactivator for transcriptional activation[18]. However, the precise role and underlying signaling cascade of MLL2 involved in ESCC progression and metastasis remains unclear.

The epidermal growth factor receptor (EGFR) is a receptor tyrosine kinase that

ro of

mediates intracellular signaling in response to various extracellular stimuli [19]. EGFR activates downstream signaling pathways, including extracellular signal-regulated

kinases (ERKs) and protein kinase B (AKT), which increase tumor cell proliferation, metastasis and invasion[19]. In ESCC, EGFR plays a pivotal role and its overexpression

-p

was found in 59.6%-76% of patients [20, 21]. Here, we demonstrated that high level of MLL2 predicted ESCC lymph node metastasis in the early stages. Moreover, activation

re

of EGFR in human ESCC cancer cells resulted in MLL2 interaction with RelA in the nucleus and finally promotes metastasis-related Stanniocalcin-1 (STC1) expression.

lP

These findings revealed a previously unidentified pathway underlying the coordinated regulation of STC1 expression by MLL2 and RelA and highlighted the critical role of

na

MLL2 in ESCCs.

2. Materials and methods

ur

2.1 Cell lines and culture conditions Eca109，KYSE150 and TE1 cells were maintained at 37 oC in 5% CO2 in RPMI-

Jo

1640 medium (GIBCO) supplemented with 10% FBS. All of the cell lines used in this study were obtained from Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and routinely tested for mycoplasma contamination.

2.2 Cell migration and invasion assays A 24-well transwell plate (8-μm pore size, Corning) was used to measure each cell 4

line’s migratory and invasive ability. For the migration assay, 5×104 cells were plated in the top chamber lined with a non-coated membrane. For the invasion assay, chamber inserts were coated with 200 mg/ml of matrigel and dried overnight under sterile conditions. Then, 1×105 cells were plated in the top chamber. Cells on the lower surface of the insert were Giemsa stained and images from three representative fields of each membrane were taken using a light microscope (100x). The number of migratory or invasive cells was counted. Each experiment was repeated five times. Both

ro of

assays were performed according to standard procedures.

2.3 Colony formation assay.

Colony formation assay was carried out according to standard procedures. Cells were mixed with culture medium containing 0.6% agar to achieve a final agar

-p

concentration of 0.4%. One mL of the cell suspension was immediately plated onto 6well plates that were coated with 0.6% agar in tissue culture media at 1 mL/well. Cell

re

colonies were counted in triplicates at day 15.

lP

2.4 Materials

The antibody that recognize MLL2 were purchased from Sigma-Aldrich

na

(HPA035977) and Abcam (ab231239). Antibodies that recognize STC1 (ab124891), CDKN1A (ab109520), POLI (ab185686), and ECM1 (ab126629) for immunoblotting analysis were purchased from Abcam. Antibodies that recognize STC1 (HPA023918)

ur

for immunohistochemical analysis was purchased from Sigma-Aldrich. Antibodies that recognize Flag (35535) and GST (T509) were obtained from Signalway Antibody. The

Jo

Antibody against RelA (#8242) were purchased from Cell Signaling Technology. The siRNA pool for MLL2, RelA and EGFR and lentivirus for MLL2 were obtained from Genechem

Biotechnology

Two

(Shanghai).

target

MLL2

sequences,

5’-

GAGCACATGGAGTGCGAAATT and 5’- CTCGGAGTGGTTTGAGAACTA, were chosen. EGF, U0126, LY294002, and SU6656 were purchased from Sigma-Aldrich.

5

2.5 RNA extraction, quantitative real-time PCR assay and RNA sequencing Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Primers for TaqMan real-time PCR (rt-PCR) assays for MLL2, CDKN1A, POLI, EMC1, STC1, and GAPDH were from Takara Bio and listed in Supplementary Table 2. All reactions, including the no template controls, were run in triplicate. After the reactions were completed, the CT values were determined using fixed threshold settings. Data were analyzed using the 2-ΔΔCT method. Library preparation for mRNA sequencing was performed according to the manufacturer’s

ro of

instructions. Briefly, total RNA was isolated from Eca109 cells with depletion or without MLL2 depletion with TRIzol reagent (Invitrogen) and analyzed on an Agilent

2100 to determine quantity. Highquality total RNA (1 μg) was used as the starting material. Sequencing was performed using HiSeq2500 (Illumina Inc., San Diego, CA)

-p

at Genechem Biotechnology (Shanghai) Co., Ltd.

re

2.6 Immunoprecipitation and immunoblotting analysis

Proteins were extracted from cultured cells using a modified buffer (50mM Tris-

lP

HCl (pH 7.5), 1% Triton X-100, 150mM NaCl, 0.5mM EDTA, 1mM dithiothreitol (DTT), and protease inhibitor cocktail or phosphatase inhibitor cocktail. Protein lysates

na

were added to antibody conjugated beads (Santa Cruz) and rotated overnight. The beads were washed four times with RIPA buffer, followed by immunoblotting with the corresponding antibodies. The protein concentration was determined through Bradford

ur

assay. Proteins from cellular lysates or nuclear extracts were separated by SDS-PAGE, transferred onto PVDF membrane (Millipore Corporation) and probed with the

Jo

indicated antibodies.

2.7 Recombinant protein purification GST-RelA were expressed in bacteria and purified. Briefly, constructs were used to transform BL21/DE3 bacteria. The cultures were grown at 37 ◦C to the OD 600nm of ∼0.6 before isopropyl-β-D-thiogalactopyranoside (IPTG) treatment for 3h. Cell 6

pellets were collected and lysed by sonication. For GST-tagged proteins, cleared lysates were bound to glutathione-agarose. The used washing buffer was mixed with 50 mM Tris-HCl, 100 mM NaCl,1 mM DTT,10 mM GSH, pH 8.0. Eluates were concentrated using Ultrafree-15 centrifugal filters (Millipore).

2.8 In Vitro kinase assay MLL2 immunoprecipitated from Eca109 cells were incubated with the purified ERK in kinase assay buffer supplemented with 0.2 mM AMP and cold ATP in the

ro of

presence or absence of 0.2 mCi/ml hot ATP (ICN Biochemicals) for 20 min at 30ºC. Then GST-RelA protein was mixed and GST pull down analyses was performed. The

precipitates were treated with or without calf intestinal phosphatase (CIP, 10 units); and

-p

analyzed by immunoblotting.

2.9 Chromatin immunoprecipitation assay

re

A Chromatin immunoprecipitation assay was performed using an Upstate Biotechnology kit. Briefly, cells were cross-linked with 1% formaldehyde plus 1.5

lP

mmol/L ethylene glycol bis [succinimidylsuccinate] at room temperature. Cross-linked chromatin was sonicated and precipitated with antibodies against transcription factor.

na

Quantitative rt-PCR was used to measure the amount of bound DNA, and the value of enrichment was calculated according to the relative amount of input and the ratio to IgG. The primer covering MLL2 binding site of human STC1 gene promoter region

ur

was used for the rt-PCR: 5’-GATGCAAAGTAAAGCCACTGG-3’ (forward) and 5’-

Jo

CAATAAGCTGGCCAAAGCAA-3’ (reverse).

2.10 Nuclear and cytoplasmic extracts Cellular fractionation was performed using a Nuclear and Cytoplasmic Protein

Extraction Kit (Beyotime Biotechnology, Shanghai, China). Briefly, the cells were harvested in ice-cold PBS and suspended in the hypotonic buffer with incubation for 15 min on ice. After vortex for 5 s, the detergent was added into cells and incubated for 7

1 min on ice, followed by centrifugation at 16,000xg for 5 min at 4°C. The cytoplasmic fraction was transferred into separate tubes. The nuclear fraction was lysed in the complete lysis buffer on ice for 30 min and centrifuged at 16,000xg for 10 min at 4°C.

2.11 Human tissue specimens Human tumor samples and their paired noncancerous matched tissues were obtained from 150 ESCC patients with surgery. Patients with radiotherapy or chemotherapy treatment before surgery were excluded. Written informed consent was

ro of

obtained and the investigation was approved by the institutional review board of East Hospital, Tongji University. The tumor-node-metastasis (TNM) staging was performed according

to

American

Joint

Committee

on

Cancer

(AJCC)

standards.

Immunohistochemical analysis was conducted as described previously [22].

-p

Consecutive sections of formalin-fixed, paraffin-embedded (FFPE) tumors were subjected to immunohistochemical analysis for MLL2 (Sigma-Aldrich; HPA035977;

re

1:400 dilution) and STC1 (Sigma-Aldrich; HPA023918; 1:600 dilution).

lP

2.12 Animals

Eca109 cells, which were infected with lentivirus with MLL2 targeting sequence

na

(anti-MLL2-LV) or negative control (anti-NC-LV), were harvested, suspended and injected into the tail vein of each male nude (nu/nu) mouse (2×106 viable tumor cells/mouse). The animals were equally divided into control and treated groups (8 mice

ur

per group). Mice housing was SPF standard. At 6 weeks, the lungs of nude mice were removed. Tumors and lungs were fixated in 10% phosphate-buffered formaldehyde,

Jo

and embedded in paraffin for further investigation. All animal experiments were performed according to the regulations of China and Tongji University, and approved by the animal care and use committee of Tongji University.

2.13 Statistical analysis All experiments were performed in triplicate. Differences between groups were 8

calculated using Student’s t test, Chi-square test, or Fisher’s exact test. In all of the tests, P values less than 0.05 were considered statistically significant. The SPSS software program (version 19.0; SPSS Inc.) was used for statistical analyses.

3. Results 3.1 MLL2 overexpression correlates with lymph node metastasis in ESCC patients We first determined the expression of MLL2 protein in consecutive 100 primary ESCC and paired adjacent normal esophageal mucosa specimens. We observed MLL2-

ro of

positive staining in the nuclei of the cancer cells with weak MLL2-positive staining in adjacent normal esophageal tissue (Fig. 1a). Interestingly, immunostaining results

showed that cancer tissue of patients with lymph node metastasis had a significantly higher level of MLL2 expression than normal tissue (Fig. 1b). These results indicated

-p

that MLL2 was commonly overexpressed in human ESCC and its overexpression had a significantly correlation with lymph node metastasis. To further provide a strong

re

evidence of MLL2’s role in early-stage ESCC lymph node metastasis, we compared its protein levels in 25 pairs of pT1N0M0 and pT1N1M0 tumors. Our data showed that the

lP

MLL2 levels in pT1N1M0 tumors were much higher than those in pT1N0M0 tumors (Fig. 1c). However, the survival analysis indicated there was no significant difference

na

between MLL2 high and low group (Supplementary Figure 1). Therefore, these results strongly indicated that MLL2 overexpression had a direct association with ESCC

ur

lymph node metastasis in early stages and appeared to be a critical biomarker.

3.2 Silencing of MLL2 expression reduces ESCC cell migration, invasion, and clony

Jo

formation in vitro

To better understand the mechanism(s) responsible for the effects of MLL2, we

assessed the transcriptional changes in response to MLL2 depletion in ESCC cell line Eca109 and TE1. MLL2 was targeted by using siRNAs that resulted in a measurable and specific reduction of MLL2 expression, compared with the scrambled control (Fig. 2a). Then, we chose siRNA-1 to silence MLL2 expression for the further experiments. 9

Transwell assays were performed to evaluate the ability of Eca109 and TE1 cells to permeate the membrane following knockdown of MLL2. Experiments revealed that the migration and invasion of cancer cells were significantly decreased following knockdown of MLL2 when compared with controls (Fig. 2c&2d). In addition, colony formation ability was also inhibited by silencing of MLL2 expression in both cell lines (Fig. 2e). The efficiency of anti-MLL2-LV in suppressing MLL2 expression was shown in Figure 2b.

ro of

3.3 Microarray and analysis of pathways associated with silenced MLL2 in ESCC cells Total RNA was isolated 48 hours after siRNA treatment and transcriptomes were

assessed by RNA-seq. We focused our attention on differentially expressed protein-

coding genes. We observed a total of 425 downregulated genes for MLL2 siRNA. Fold

-p

changes ranged from 1.50 to 4.86. Four of these genes with fold changes more than

2.00 (Fig. 3a) were selected for validation based on their previous associations with

re

cancer progression [STC1 [23-26], CDKN1A [26, 27], POLI [28, 29], and ECM1 [30, 31], with qRT-PCR analysis confirming expression changes of each at the mRNA level

lP

(Fig. 3b). STC1, a human ortholog of fish stanniocalcin, was decreased by MLL2 siRNA treatment that was also included in the validation panel, as its expression has

na

been linked with an increase in metastatic cancers [26].

3.4 STC1 overexpression and close association of MLL2 expression with STC1

ur

expression in ESCC

We further evaluated STC1 expression in the specimens. It showed an increasingly

Jo

positive staining activity of STC1 in primary ESCC tissue (Fig. 3c). Moreover, STC1 overexpression positively correlated with lymph node metastasis (P<0.001, Fig. 3d). However, the survival analysis indicated there was no significant difference between STC1 high and low group (Supplementary Figure 1). Given that both MLL2 and STC1 were closely related to lymph node metastasis of patients with ESCC, we sought to evaluated the relationship between MLL2 expression and STC1 expression in the 10

ESCC specimens. We observed that there was a significant correlation between MLL2 and STC1 expressions by analyzing consecutive ESCC sections (Fig. 3e). These data provided clinical evidence supporting our hypothesis that aberrant activation of MLL2 is associated with STC1 expression and an increased ESCC metastasis risk.

3.5 ERK activation is required for EGF-induced MLL2 binding to RelA To further investigate the molecular mechanism by which MLL2 specifically regulate STC1 expression, we first examined the potential transcriptional factor

ro of

implicated in MLL2-STC1 activation. RelA/p65 was found to participate in ESCC [3234]. Furthermore, RelA was found to directly bind to STC1 promoter and activate the

expression of STC1 [35, 36]. Immunoprecipitation analysis indicated EGF largely

promoted the interaction between RelA and MLL2, and this interaction was abolished

-p

by CIP treatment in precipitate (Fig. 4a), which suggested RelA-MLL2 interaction is phosphorylation dependent. We continued to explore the upstream signaling

re

participation in specific regulation RelA-MLL2 complex formation under EGFR activation. A couple of inhibitors were collected and used to block activities of kinases

lP

relevant to cellular response to EGF. As a result, we found that the treatment of MEK inhibitor, U0126, but not PI3K inhibitor LY294002 or c-Src inhibitor SU6656, notably

na

suppressed EGF-induced RelA-MLL2 interaction (Fig. 4b). We hypothesized that MEK/ERK kinase activities against RelA or MLL2 was required for their interaction. As revealed in Fig. 4c, purified RelA protein subjected to ERK kinase assay were

ur

incubated with precipitates of immunoprecipitated-MLL2 from cellular extracts, and GST pull down analysis indicated that only MLL2 was bound to RelA with the addition

Jo

of ERK. Collectively, these data demonstrated that EGF induced MLL2-RelA interaction in a manner dependent on ERK activity against MLL2. The efficiency of siRelA in suppressing RelA expression was shown in Supplementary Figure 2. Furthermore, the in vitro transwell assay indicated that the number of cells with EGFR knockdown was increased by overexpressed STC1 (Supplementary Figure 3).

11

3.6 MLL2 is recruited to STC1 promoter by RelA and promotes transcription We set forth to examine whether MLL2 was recruited by RelA to the promoter region, and involved in STC1 transcription. As shown in Fig. 4d, ChIP analysis in Eca109 cells indicated EGF dramatically induced accumulation of MLL2 at STC1, which was blocked by RelA depletion. Consistent with the critical role of ERK activity for MLL2-RelA interaction, EGF-induced promoter-enrichment of MLL2 was largely inhibited by MEK inhibitor U0126 treatment (Fig. 4e). MLL2 is importantly responsible for H3K4 monomethylation and trimethylation and promotes gene

ro of

transcription [18, 37, 38]. Therefore, rt-RCR analysis indicated depletion of RelA (Fig. 4f) or MLL2 (Fig. 4g) abolished EGF-increased STC1 transcription. Of note, cells

underwent serum starvation before EGF treatment and the subsequent analysis would

be better for reflecting the relevant effect from EGF. However, without EGF stimulation,

-p

MLL2 depletion led to a significant decrease of STC1 only in cells without serum

starvation, not in cells with serum starvation (Supplementary Figure 4). These data

re

suggested that RelA-MLL2 complex promoted STC1 transcription.

human ESCC cells in vivo

lP

3.7 Direct impact of altered MLL2 expression on the tumorigenicity and metastasis of

na

To determine whether MLL2 plays an important role in the metastasis of ESCC cells, we injected anti-MLL2-LV infected Eca109 cells into the tail vein of nude mice. No adverse events were reported. Consistent with the effect of altered MLL2 expression

ur

in vitro assays, downregulation of MLL2 significantly abrogated lung metastasis of Eca109 cells (Fig. 5a-c). Immunohistochemical staining assay also showed the

Jo

expression level of STC1 protein was decreased in the MLL2 knock-down tumors (Fig. 5d). Experiments were also developed to assess RelA and EFGR status and the results indicated that RelA and EFGR were expressed in ESCC cells and in mice samples (Supplementary Figure 5). These data suggested that MLL2 promoted ESCC cell metastasis.

12

4. Discussion ESCC patients are typically diagnosed with lymph node metastasis even in the early stage, losing the opportunity for curative surgical resection and prevention of cancer progression. Therefore, a clear understanding of the genetic factors contributing to the development and risk of lymph node metastasis of early ESCC is of importance. In the present study, we provided evidences on the role of MLL2, a histone methyltransferase, in modulating the metastatic potential of ESCC. In patient tissues, the MLL2 expression was higher in the ESCC tissues and moreover, the protein level

ro of

was associated with an increased lymph node metastasis. In addition, our data demonstrated that MLL2 levels in pT1N1M0 tumors were much higher than those in

pT1N0M0 tumors, in consistent with our findings that MLL2 promotes ESCC lymph

node metastasis in the early stages. Both in vitro and in vivo studies also supported this

-p

hypothesis and indicated that MLL2 functions as a promoter for ESCC cell migration

re

and notably, a knockdown of MLL2 significantly inhibited cancer cell metastasis.

To investigate the molecular mechanism by which this methyltransferase

lP

contributes to ESCC development, we therefore went on to explore the potential downstream molecules of MLL2. Our RNA-seq experiment and subsequent analysis

na

highlighted changes in several metastasis-related genes, which have been previously reported in association with cancer progression. STC1, a human ortholog of fish stanniocalcin, has been linked with an increased expression in metastatic cancers[26].

ur

In mammalian tissues, STC1 appears to function in multiple aspects. For instance, STC1 is able to inhibit apoptosis and activate multipotent stromal cells [23]. In cancers,

Jo

STC1 has been identified as a proto-oncogene by previous studies. Overexpression of STC1 was found in cancer tissues and was revealed to be associated with metastasis or advanced tumor stage, suggesting that STC1 promotes cancer progression [39]. In ESCC, our findings were consistent with previous findings from other groups, showing STC1 overexpression in cancer tissues [23, 40]. Furthermore, the evidence from this study revealed that high level of STC1 was associated with tumor lymph node 13

metastasis. In addition, as the downstream gene of MLL2, there was a significant correlation between MLL2 and STC1 expressions by analyzing consecutive ESCC sections. However, the survival analysis indicated there was no significant difference between MLL2 high and low group, as well as STC1. There was not association between MLL2 and STC1 with patient survival. This kind of difference and association might be observed in a larger series of patients.

Previous studies have shown that NF-κB P65 protein directly binds to the promoter

ro of

of STC1 and activates the expression of STC1 [35, 41]. The NF-κB family is composed of p50 (NF-κB1), p52 (NF-κB2), p65 (RelA), c-Rel, and RelB and functions in the form

of heterodimeric and homodimeric complexes [42]. In general, NF-κB can be activated via distinct pathways under various stimuli such as cytokines, growth factors, and

-p

oncoproteins. The regulation of NF-κB signal pathway becomes more complicated in cross-talking with other cellular signals, because its consequent effect is determined in

re

a diverse manner. The cooperative effect between EGFR and NF-κB pathways has been importantly implicated in carcinogenesis and cancer progression [43]. To further

lP

investigate the precise mechanism by which MLL2 specifically regulates STC1 expression, we examined the EGFR and RelA pathways implicated in MLL2-STC1

na

activation. Our data indicated that EGFR and RelA were expressed in ESCC (Supplementary Figure 5) and EGF largely promoted the interaction between RelA and MLL2. Subsequently, MLL2 was recruited by RelA to the promoter region and was

ur

involved in STC1 transcription. The elevated expression of STC1 could be due to MLL2 mediated H3K4me3 binding. Then RelA associates with STC1 promoter after

Jo

EGF treatment, leading to the recruitment of MLL2 to the promoter. MLL2 could conduct H3K4 trimethylation and lead to transcription activation. Hence, RelA-MLL2 complex positively regulates STC1 expression in distinct signaling environmental conditions (Fig. 5e).

In summary, we have identified the roles of MLL2 and STC1 as molecular 14

predictors in ESCC lymph node metastasis in early stages. In addition, our study demonstrated that silencing of MLL2 impacted on the ESCC cell migration and led to a reduction in cancer metastasis. Mechanismly, MLL2 interacts with RelA in the nucleus to enhance transcription of STC1 and to facilitates cancer metastasis. These findings provide a novel molecular basis for developing therapeutic benefits of targeting MLL2/STC1 axis in ESCC.

Author Contributions M.X and T.C. conceived the project, designed the experiments

ro of

and H.L. and Q.L. performed the experiments and data analysis. J.L., Y.C. and K.F. helped with analysis and interpretation of data. T.C. wrote the manuscript. J.L. and A.X. helped with review and revision of the manuscript.

re

-p

Conflicts of Interest The authors declare that they have no conflict of interest.

Acknowledgements This work was supported by grants from Shanghai Committee of

lP

Science and Technology [grant number, 18140900100, 17140901100, 18140900101 and 18140900102] and National Natural Science Foundation of China [grant number,

Jo

ur

na

81872351 and 81570595].

15

References [1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancer statistics, CA Cancer J Clin 61(2) (2011) 69-90. [2] H. Shimada, H. Kitabayashi, Y. Nabeya, S. Okazumi, H. Matsubara, Y. Funami, Y. Miyazawa, T. Shiratori, T. Uno, H. Itoh, T. Ochiai, Treatment response and prognosis of patients after

ro of

recurrence of esophageal cancer, Surgery 133(1) (2003) 24-31. [3] P.C. Enzinger, R.J. Mayer, Esophageal cancer, N Engl J Med 349(23) (2003) 2241-52.

[4] R.J. Sims, 3rd, K. Nishioka, D. Reinberg, Histone lysine methylation: a signature for

-p

chromatin function, Trends Genet 19(11) (2003) 629-39.

re

[5] J. Chen, Q. Luo, Y. Yuan, X. Huang, W. Cai, C. Li, T. Wei, L. Zhang, M. Yang, Q. Liu, G. Ye, X. Dai, B. Li, Pygo2 associates with MLL2 histone methyltransferase and GCN5 histone

lP

acetyltransferase complexes to augment Wnt target gene expression and breast cancer stemlike cell expansion, Mol Cell Biol 30(24) (2010) 5621-35.

na

[6] B.D. Crawford, J.L. Hess, MLL core components give the green light to histone methylation, ACS Chem Biol 1(8) (2006) 495-8.

ur

[7] X.Q. Zeng, J. Wang, S.Y. Chen, Methylation modification in gastric cancer and approaches

Jo

to targeted epigenetic therapy (Review), Int J Oncol 50(6) (2017) 1921-1933. [8] D. Hu, A.S. Garruss, X. Gao, M.A. Morgan, M. Cook, E.R. Smith, A. Shilatifard, The Mll2 branch of the COMPASS family regulates bivalent promoters in mouse embryonic stem cells, Nat Struct Mol Biol 20(9) (2013) 1093-7. [9] Y. Song, L. Li, Y. Ou, Z. Gao, E. Li, X. Li, W. Zhang, J. Wang, L. Xu, Y. Zhou, X. Ma, L. Liu,

16

Z. Zhao, X. Huang, J. Fan, L. Dong, G. Chen, L. Ma, J. Yang, L. Chen, M. He, M. Li, X. Zhuang, K. Huang, K. Qiu, G. Yin, G. Guo, Q. Feng, P. Chen, Z. Wu, J. Wu, L. Ma, J. Zhao, L. Luo, M. Fu, B. Xu, B. Chen, Y. Li, T. Tong, M. Wang, Z. Liu, D. Lin, X. Zhang, H. Yang, J. Wang, Q. Zhan, Identification of genomic alterations in oesophageal squamous cell cancer, Nature 509(7498) (2014) 91-5. [10] G. Sawada, A. Niida, R. Uchi, H. Hirata, T. Shimamura, Y. Suzuki, Y. Shiraishi, K. Chiba,

ro of

S. Imoto, Y. Takahashi, T. Iwaya, T. Sudo, T. Hayashi, H. Takai, Y. Kawasaki, T. Matsukawa,

H. Eguchi, K. Sugimachi, F. Tanaka, H. Suzuki, K. Yamamoto, H. Ishii, M. Shimizu, H. Yamazaki, M. Yamazaki, Y. Tachimori, Y. Kajiyama, S. Natsugoe, H. Fujita, K. Mafune, Y.

-p

Tanaka, D.P. Kelsell, C.A. Scott, S. Tsuji, S. Yachida, T. Shibata, S. Sugano, Y. Doki, T.

re

Akiyama, H. Aburatani, S. Ogawa, S. Miyano, M. Mori, K. Mimori, Genomic Landscape of

(2016) 1171-1182.

lP

Esophageal Squamous Cell Carcinoma in a Japanese Population, Gastroenterology 150(5)

[11] D.W. Parsons, M. Li, X. Zhang, S. Jones, R.J. Leary, J.C. Lin, S.M. Boca, H. Carter, J.

na

Samayoa, C. Bettegowda, G.L. Gallia, G.I. Jallo, Z.A. Binder, Y. Nikolsky, J. Hartigan, D.R.

ur

Smith, D.S. Gerhard, D.W. Fults, S. VandenBerg, M.S. Berger, S.K. Marie, S.M. Shinjo, C. Clara, P.C. Phillips, J.E. Minturn, J.A. Biegel, A.R. Judkins, A.C. Resnick, P.B. Storm, T. Curran,

Jo

Y. He, B.A. Rasheed, H.S. Friedman, S.T. Keir, R. McLendon, P.A. Northcott, M.D. Taylor, P.C. Burger, G.J. Riggins, R. Karchin, G. Parmigiani, D.D. Bigner, H. Yan, N. Papadopoulos, B. Vogelstein, K.W. Kinzler, V.E. Velculescu, The genetic landscape of the childhood cancer medulloblastoma, Science 331(6016) (2011) 435-9. [12] R.D. Morin, M. Mendez-Lago, A.J. Mungall, R. Goya, K.L. Mungall, R.D. Corbett, N.A. 17

Johnson, T.M. Severson, R. Chiu, M. Field, S. Jackman, M. Krzywinski, D.W. Scott, D.L. Trinh, J. Tamura-Wells, S. Li, M.R. Firme, S. Rogic, M. Griffith, S. Chan, O. Yakovenko, I.M. Meyer, E.Y. Zhao, D. Smailus, M. Moksa, S. Chittaranjan, L. Rimsza, A. Brooks-Wilson, J.J. Spinelli, S. Ben-Neriah, B. Meissner, B. Woolcock, M. Boyle, H. McDonald, A. Tam, Y. Zhao, A. Delaney, T. Zeng, K. Tse, Y. Butterfield, I. Birol, R. Holt, J. Schein, D.E. Horsman, R. Moore, S.J. Jones, J.M. Connors, M. Hirst, R.D. Gascoyne, M.A. Marra, Frequent mutation of histone-modifying

ro of

genes in non-Hodgkin lymphoma, Nature 476(7360) (2011) 298-303.

[13] L. Pasqualucci, V. Trifonov, G. Fabbri, J. Ma, D. Rossi, A. Chiarenza, V.A. Wells, A. Grunn, M. Messina, O. Elliot, J. Chan, G. Bhagat, A. Chadburn, G. Gaidano, C.G. Mullighan, R.

-p

Rabadan, R. Dalla-Favera, Analysis of the coding genome of diffuse large B-cell lymphoma,

re

Nat Genet 43(9) (2011) 830-7.

[14] C.S. Grasso, Y.M. Wu, D.R. Robinson, X. Cao, S.M. Dhanasekaran, A.P. Khan, M.J. Quist,

lP

X. Jing, R.J. Lonigro, J.C. Brenner, I.A. Asangani, B. Ateeq, S.Y. Chun, J. Siddiqui, L. Sam, M. Anstett, R. Mehra, J.R. Prensner, N. Palanisamy, G.A. Ryslik, F. Vandin, B.J. Raphael, L.P.

na

Kunju, D.R. Rhodes, K.J. Pienta, A.M. Chinnaiyan, S.A. Tomlins, The mutational landscape of

ur

lethal castration-resistant prostate cancer, Nature 487(7406) (2012) 239-43. [15] Z.J. Zang, I. Cutcutache, S.L. Poon, S.L. Zhang, J.R. McPherson, J. Tao, V. Rajasegaran,

Jo

H.L. Heng, N. Deng, A. Gan, K.H. Lim, C.K. Ong, D. Huang, S.Y. Chin, I.B. Tan, C.C. Ng, W. Yu, Y. Wu, M. Lee, J. Wu, D. Poh, W.K. Wan, S.Y. Rha, J. So, M. Salto-Tellez, K.G. Yeoh, W.K. Wong, Y.J. Zhu, P.A. Futreal, B. Pang, Y. Ruan, A.M. Hillmer, D. Bertrand, N. Nagarajan, S. Rozen, B.T. Teh, P. Tan, Exome sequencing of gastric adenocarcinoma identifies recurrent somatic mutations in cell adhesion and chromatin remodeling genes, Nat Genet 44(5) (2012) 18

570-4. [16] A. Fujimoto, Y. Totoki, T. Abe, K.A. Boroevich, F. Hosoda, H.H. Nguyen, M. Aoki, N. Hosono, M. Kubo, F. Miya, Y. Arai, H. Takahashi, T. Shirakihara, M. Nagasaki, T. Shibuya, K. Nakano, K. Watanabe-Makino, H. Tanaka, H. Nakamura, J. Kusuda, H. Ojima, K. Shimada, T. Okusaka, M. Ueno, Y. Shigekawa, Y. Kawakami, K. Arihiro, H. Ohdan, K. Gotoh, O. Ishikawa, S. Ariizumi, M. Yamamoto, T. Yamada, K. Chayama, T. Kosuge, H. Yamaue, N. Kamatani, S.

ro of

Miyano, H. Nakagama, Y. Nakamura, T. Tsunoda, T. Shibata, H. Nakagawa, Whole-genome sequencing of liver cancers identifies etiological influences on mutation patterns and recurrent mutations in chromatin regulators, Nat Genet 44(7) (2012) 760-4.

-p

[17] N. Cancer Genome Atlas Research, Comprehensive genomic characterization of

re

squamous cell lung cancers, Nature 489(7417) (2012) 519-25.

[18] C. Guo, L.H. Chen, Y. Huang, C.C. Chang, P. Wang, C.J. Pirozzi, X. Qin, X. Bao, P.K.

lP

Greer, R.E. McLendon, H. Yan, S.T. Keir, D.D. Bigner, Y. He, KMT2D maintains neoplastic cell proliferation and global histone H3 lysine 4 monomethylation, Oncotarget 4(11) (2013) 2144-

na

53.

ur

[19] N. Tebbutt, M.W. Pedersen, T.G. Johns, Targeting the ERBB family in cancer: couples therapy, Nat Rev Cancer 13(9) (2013) 663-73.

Jo

[20] W. Zhang, H. Zhu, X. Liu, Q. Wang, X. Zhang, J. He, K. Sun, X. Liu, Z. Zhou, N. Xu, Z. Xiao, Epidermal growth factor receptor is a prognosis predictor in patients with esophageal squamous cell carcinoma, Ann Thorac Surg 98(2) (2014) 513-9. [21] C.D. Fichter, V. Gudernatsch, C.M. Przypadlo, M. Follo, G. Schmidt, M. Werner, S. Lassmann, ErbB targeting inhibitors repress cell migration of esophageal squamous cell 19

carcinoma and adenocarcinoma cells by distinct signaling pathways, J Mol Med (Berl) 92(11) (2014) 1209-23. [22] T. Chen, J. Li, M. Xu, Q. Zhao, Y. Hou, L. Yao, Y. Zhong, P.C. Chou, W. Zhang, P. Zhou, Y. Jiang, PKCepsilon phosphorylates MIIP and promotes colorectal cancer metastasis through inhibition of RelA deacetylation, Nat Commun 8(1) (2017) 939. [23] K.K. Chan, C.O. Leung, C.C. Wong, D.W. Ho, K.S. Chok, C.L. Lai, I.O. Ng, R.C. Lo,

of JNK signaling pathway, Cancer Lett 403 (2017) 330-338.

ro of

Secretory Stanniocalcin 1 promotes metastasis of hepatocellular carcinoma through activation

[24] C. Pena, M.V. Cespedes, M.B. Lindh, S. Kiflemariam, A. Mezheyeuski, P.H. Edqvist, C.

-p

Hagglof, H. Birgisson, L. Bojmar, K. Jirstrom, P. Sandstrom, E. Olsson, S. Veerla, A. Gallardo,

re

T. Sjoblom, A.C. Chang, R.R. Reddel, R. Mangues, M. Augsten, A. Ostman, STC1 expression by cancer-associated fibroblasts drives metastasis of colorectal cancer, Cancer Res 73(4)

lP

(2013) 1287-97.

[25] A.C. Chang, J. Doherty, L.I. Huschtscha, R. Redvers, C. Restall, R.R. Reddel, R.L.

na

Anderson, STC1 expression is associated with tumor growth and metastasis in breast cancer,

ur

Clin Exp Metastasis 32(1) (2015) 15-27. [26] X. Zuo, W. Xu, M. Xu, R. Tian, M.J. Moussalli, F. Mao, X. Zheng, J. Wang, J.S. Morris, M.

Jo

Gagea, C. Eng, S. Kopetz, D.M. Maru, A. Rashid, R. Broaddus, D. Wei, M.C. Hung, A.K. Sood, I. Shureiqi, Metastasis regulation by PPARD expression in cancer cells, JCI Insight 2(1) (2017) e91419. [27] M. Bi, H. Yu, B. Huang, C. Tang, Long non-coding RNA PCAT-1 over-expression promotes proliferation and metastasis in gastric cancer cells through regulating CDKN1A, Gene 626 20

(2017) 337-343. [28] H. Sun, S. Zou, S. Zhang, B. Liu, X. Meng, X. Li, J. Yu, J. Wu, J. Zhou, Elevated DNA polymerase iota (Poli) is involved in the acquisition of aggressive phenotypes of human esophageal squamous cell cancer, Int J Clin Exp Pathol 8(4) (2015) 3591-601. [29] S. Zou, Z.F. Shang, B. Liu, S. Zhang, J. Wu, M. Huang, W.Q. Ding, J. Zhou, DNA polymerase iota (Pol iota) promotes invasion and metastasis of esophageal squamous cell

ro of

carcinoma, Oncotarget 7(22) (2016) 32274-85.

[30] H. Ye, X. Yu, J. Xia, X. Tang, L. Tang, F. Chen, MiR-486-3p targeting ECM1 represses cell proliferation and metastasis in cervical cancer, Biomed Pharmacother 80 (2016) 109-114.

-p

[31] P. Gomez-Contreras, J.M. Ramiro-Diaz, A. Sierra, C. Stipp, F.E. Domann, R.J. Weigel, G.

re

Lal, Extracellular matrix 1 (ECM1) regulates the actin cytoskeletal architecture of aggressive breast cancer cells in part via S100A4 and Rho-family GTPases, Clin Exp Metastasis 34(1)

lP

(2017) 37-49.

[32] C. Lin, L. Song, H. Gong, A. Liu, X. Lin, J. Wu, M. Li, J. Li, Nkx2-8 downregulation promotes

na

angiogenesis and activates NF-kappaB in esophageal cancer, Cancer Res 73(12) (2013) 3638-

ur

48.

[33] F.M. Ping, G.J. Liu, Z.J. Liu, H.B. Li, J.W. Zhai, S.X. Li, Y.M. Liu, B.W. Li, H. Wei,

Jo

Expression of RKIP, E-cadherin and NF-kB p65 in esophageal squamous cell carcinoma and their correlations, Int J Clin Exp Pathol 8(9) (2015) 10164-70. [34] L. Zhang, J.H. Wang, R.X. Liang, S.T. Huang, J. Xu, L.J. Yuan, L. Huang, Y. Zhou, X.J. Yu, S.Y. Wu, R.Z. Luo, J.P. Yun, W.H. Jia, M. Zheng, RASSF8 downregulation promotes lymphangiogenesis and metastasis in esophageal squamous cell carcinoma, Oncotarget 6(33) 21

(2015) 34510-24. [35] F. Guo, Y. Li, J. Wang, Y. Li, Y. Li, G. Li, Stanniocalcin1 (STC1) Inhibits Cell Proliferation and Invasion of Cervical Cancer Cells, PLoS One 8(1) (2013) e53989. [36] A.Y. Law, K.P. Lai, W.C. Lui, H.T. Wan, C.K. Wong, Histone deacetylase inhibitor-induced cellular apoptosis involves stanniocalcin-1 activation, Exp Cell Res 314(16) (2008) 2975-84. [37] C.V. Andreu-Vieyra, R. Chen, J.E. Agno, S. Glaser, K. Anastassiadis, A.F. Stewart, M.M.

silencing, PLoS Biol 8(8) (2010).

ro of

Matzuk, MLL2 is required in oocytes for bulk histone 3 lysine 4 trimethylation and transcriptional

[38] D.J. Ford, A.K. Dingwall, The cancer COMPASS: navigating the functions of MLL

-p

complexes in cancer, Cancer Genet 208(5) (2015) 178-91.

re

[39] G. Liu, G. Yang, B. Chang, I. Mercado-Uribe, M. Huang, J. Zheng, R.C. Bast, S.H. Lin, J. Liu, Stanniocalcin 1 and ovarian tumorigenesis, J Natl Cancer Inst 102(11) (2010) 812-27.

lP

[40] Y. Fujiwara, Y. Sugita, S. Nakamori, A. Miyamoto, K. Shiozaki, H. Nagano, M. Sakon, M. Monden, Assessment of Stanniocalcin-1 mRNA as a molecular marker for micrometastases of

na

various human cancers, Int J Oncol 16(4) (2000) 799-804.

ur

[41] X. Pan, B. Jiang, J. Liu, J. Ding, Y. Li, R. Sun, L. Peng, C. Qin, S. Fang, G. Li, STC1 promotes cell apoptosis via NF-kappaB phospho-P65 Ser536 in cervical cancer cells,

Jo

Oncotarget 8(28) (2017) 46249-46261. [42] M. Karin, How NF-kappaB is activated: the role of the IkappaB kinase (IKK) complex, Oncogene 18(49) (1999) 6867-74. [43] K. Shostak, A. Chariot, EGFR and NF-kappaB: partners in cancer, Trends Mol Med 21(6) (2015) 385-93. 22

23

ro of

-p

re

lP

na

ur

Jo

Figure Legends Figure 1 MLL2 expression was associated with ESCC lymph node metastasis. a, MLL2 expression levels in ESCC specimens were significantly higher than those in normal tissue specimens. b, MLL2 expression levels were significantly higher in ESCC with lymph node metastasis specimens than in primary ESCC specimens. c, MLL2 expression levels in pT1N1M0 tumors were significantly higher than those in pT1N0M0 tumors. * represents P<0.05, ** represents P<0.01, and *** represents P<0.001;

na

lP

re

-p

ro of

student’s t test.

ur

Figure 2 The effect of MLL2 on ESCC cell migration, invasion and colony formation. a, The effect of MLL2-siRNAs was examined. b, The effect of anti-MLL2-LV was

Jo

examined. c, Eca109 cells were transfected with MLL2-siRNA-1. The migration and invasiveness of Eca109 cell were examined. d, TE1 cells were transfected with MLL2siRNA-1. The migration and invasiveness of TE1 cell were examined. e, The number of clones of Eca109 or TE1 transfected with anti-MLL2-LV was fewer than that of control cells. * represents P<0.05, ** represents P<0.01, and *** represents P<0.001; student’s

t

24

test.

ro of -p

Figure 3 STC-1 is one of the MLL2’s downstream genes in ESCC. a, Heatmaps for

re

MLL2 dataset showing its downstream genes. The left three groups were si-MLL2 groups. b, Four genes were selected for validation. c, STC1 expression levels in ESCC

lP

specimens were significantly higher than those in normal tissue specimens. d, STC1 expression levels were significantly higher in ESCC with lymph node metastasis

na

specimens than in primary ESCC specimens. e, the STC1 expression levels were directly correlated with the MLL2 expression levels. * represents P<0.05, ** represents

Jo

ur

P<0.01, and *** represents P<0.001; student’s t test.

25

ro of -p re lP

na

Figure 4 MLL2 is recruited to STC1 promoter by RelA and promotes transcription. a, Eca109 cells were treated with or without EGF (100ng/ml) for 2 h; whole cellular extracts subjected to immunoprecipitation with an anti-RelA antibody were analyzed

ur

by immunoblotting. b, Eca109 cells were pretreated with U0126 (20 M) or LY294002 (shown as ‘LY’, 10 M) or SU6656 (shown as ‘SU’, 10 M) for 1 h before EGF

Jo

(100ng/ml) treatment for 2 h; whole cellular extracts subjected to immunoprecipitation with an anti-RelA antibody were analyzed by immunoblotting. c, In vitro phosphorylation analyses were performed by mixing the purified ERK with MLL2 immunoprecipitated from Eca109 cells in the presence of ATP; then GST-RelA protein was mixed with MLL2, and GST pull down analyses was performed. The precipitates were treated with or without calf intestinal phosphatase (CIP, 10 units) and analyzed by 26

immunoblotting. d, Eca109 cells with or without RelA depletion were treated with or without EGF (100ng/ml). f, Eca109 cells pretreated with or without U0126 (20 M) were treated with or without EGF (100ng/ml). d-e, ChIP analyses were performed using the indicated antibody. The primers covering RelA binding site of STC1 gene promoter region were used for the rt-PCR. The Y axis indicates the value normalized to the input. f, Eca109 cells with or without RelA depletion were treated with or without EGF (100ng/ml). g, Eca109 cells with or without MLL2 depletion were treated with or

na

lP

re

-p

ro of

without EGF (100ng/ml). f-g, rt-PCR analyses were performed.

ur

Figure 5 Influence of MLL2 expression on tumor metastasis. a, Eca109 cells with MLL2 knockdown were injected into the tail vein of nude mice. b, The number of

Jo

visible metastatic lesions in the lung was measured. c, Hematoxylin-eosin staining showed the lung metastasis loci and the umber of metastasis loci was analyzed. d, Immunohistochemical staining assay showed the expression level of STC1 protein was decreased in the MLL2 knock-down tumors. e, A schematic diagram of model displaying the implication of MLL2 in STC1 activation-induced ESCC metastasis.

27

28

ro of

-p

re

lP

na

ur

Jo