Mogroside derivatives exert hypoglycemics effects by decreasing blood glucose level in HepG2 cells and alleviates insulin resistance in T2DM rats

Journal of Functional Foods 63 (2019) 103566

Contents lists available at ScienceDirect

Journal of Functional Foods journal homepage: www.elsevier.com/locate/jff

Mogroside derivatives exert hypoglycemics effects by decreasing blood glucose level in HepG2 cells and alleviates insulin resistance in T2DM rats Xuan Liua, Jingjing Zhanga, Yumeng Lia, Liyang Suna, Yao Xiaoa, Wenge Gaoa, Zesheng Zhanga,b, a b

T

⁎

State Key Laboratory of Food Nutrition and Safety, College of Food Science and Engineering, Tianjin University of Science & Technology, Tianjin 300457, China Tianjin Food Safety & Low Carbon Manufacturing Collaborative Innovation Center, Tianjin 300457, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Mogroside Insulin resistance HepG2 cells T2DM rats PI3K/Akt signaling pathway

Mogroside, a triterpenoid of Siraitia grosvenorii, has been reported to play an important role in glycometabolism processes. In this study, the mechanism of mogroside was evaluated through in vitro experiments using Mogroside III (MO3), IV (MO4), V (MO5), Siamenoside I (SO1) at 1, 5, 10 μM, and in vivo experiments using MO5 at 30, 75, 150 mg/(kg·bw·day). In cell experiments, mogrosides at 5 μM significantly restored glucose metabolism and insulin resistance (IR), and MO5 had the most obvious hypoglycemic effect. In rat experiments, fasting blood glucose, liver damage, and insulin sensitivity were improved by MO5 treatment. Moreover, the Real-Time Polymerase Chain Reaction and Western bolt analysis indicated that MO5 up-regulated the expression of phosphatidylinositol-3-kinase (PI3K), glucose transporter type 2 (GLUT2), glycogen synthesis (GS). It also downregulated phosphorylated insulin receptor substrate-1 (p-IRS-1(ser)) and glycogen synthesis kinase-3β (p-GSK3β). Overall, MO5 alleviated IR and increased glycogen synthesis through the PI3K/Akt pathway.

1. Introduction Diabetes mellitus is a chronic metabolic disease that seriously threatens human health and the quality of life (Arnolds, Heise, Flacke, & Sieber, 2013). The number of people with diabetes has dramatically increased worldwide over the past two decades (Raza et al., 2014). The majority of these cases relate to type 2 diabetes mellitus (T2DM), and lifestyle changes have resulted in an earlier age of onset (Gao et al., 2015; Gao, Guo, Qin, Shang, & Zhang, 2017). A characteristic of T2DM is insulin resistance (IR) caused by a high-fat, high-calorie diet and a lifestyle with low physical activity (Lei et al., 2019). Another characteristic of diabetes is abnormal insulin secretion (Liang, 2015; Morris, Ludwar, Swingle, Mamo, & Shubrook, 2016; Zhou, Peng, Zhao, Wang, & Li, 2017). More than 400 million people are expected to get T2DM by 2030, which is a 50% increase in the past two decades (Raza et al., 2014). Treatment of T2DM is imperative, and there are considerable

institutions and international guidelines for the treatment of T2DM. These include the World Health Organization and the International Diabetes Federation, which are probably the most influential guidelines in the diabetes community (Raza et al., 2014). Mogroside is a non-sugar substance with strong sweetness. It is a triterpenoid (Zhao, Cui, Chen, & Liang, 2010) of Siraitia grosvenorii (Suzuki, Murata, Inui, Sugiura, & Nakano, 2007; Tang et al., 2011), and it is a perennial vine of the cucurbitaceae family (Wang, Chen, Lai, Lu, & Huang, 2019). Siraitia grosvenorii is a type of Chinese medicine and edible plants, and it is primarily located in Guangxi and in other tropical and subtropical areas (Chiu, Wang, Lee, Lo, & Lu, 2013; Li, Zou, et al., 2019). In traditional medicine, Siraitia grosvenorii has long been used to treat cough, sputum, and regulate digestive tract movement. Previous reports have also indicated that mogroside can be considered a bioactive macromolecule (Sun et al., 2012; Zhang et al., 2018; Zhou, Zheng, Ebersole, & Huang, 2011). Previous reports have indicated that

Abbreviations: T2DM, type 2 diabetes mellitus; IR, insulin resistance; SO1, Siamenoside I; MO3, Mogroside III; MO4, Mogroside IV; MO5, Mogroside V; MTT, Microculture tetrazolium assay; DMEM, Dulbecco’s modified Eagle’s medium; PBS, phosphate-buffered saline; SD, Sprague-Dawley rats; STZ, streptozotocin; OGTT, oral glucose tolerance test; AUC, area under the curve for glucose; ITT, insulin tolerance test; FBG, fasting blood glucose; FINS, fasting serum insulin; HOMA-IR, homeostasis model assessment-insulin resistance; HOMA-β, homeostasis model assessment-β; ISI, insulin sensitivity index; ALT, Alanine Transaminase Measurements; AST, Aspartate Transaminase Measurements; WB, western blot; IRS-1, insulin receptor substrate-1; p-IRS-1(ser/tyr), phospho-IRS-1; PI3K, phosphatidylinositol 3-kinase; Akt, protein kinase B; p-Akt, phospho-Akt; PI3K, phosphatidylinositol 3-kinase; GLUT2, glucose transporter 2; GSK-3β, glycogen synthase kinase 3β; p-GSK-3β, phospho-GSK-3β; GS, glycogen synthase; RT-PCR, real-time polymerase chain reaction ⁎ Corresponding author at: State Key Laboratory of Food Nutrition and Safety, College of Food Science and Engineering, Tianjin University of Science & Technology, Tianjin 300457, China. E-mail address: [email protected] (Z. Zhang). https://doi.org/10.1016/j.jff.2019.103566 Received 23 May 2019; Received in revised form 25 August 2019; Accepted 11 September 2019 1756-4646/ © 2019 Elsevier Ltd. All rights reserved.

Journal of Functional Foods 63 (2019) 103566

X. Liu, et al.

Fig. 1. The chemical structure of four mogrosides. (A) The chemical structure of SO1. (B) The chemical structure of MO3. (C) The chemical structure of MO4. (D) The chemical structure of MO5.

China). Insulin was purchased from Gen-view Scientific Inc. (Tallahassee, USA). The total RNA was converted to cDNA by the Prime Script TM RT reagent kit, and the cDNA was used for Real-time PCR using the SYBR PremixEx Taq TM II (Tli RNase H Plus) kit purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). Antibodies for phosphatidylinositol 3-kinase (PI3K) (p85), PI3K (p110), protein kinase B (Akt), phospho-Akt (p-Akt), glycogen synthase kinase 3β (GSK-3β), phospho-GSK-3β (p-GSK-3β), glucose transporter 2 (GLUT2), glycogen synthase (GS), insulin receptor substrate 1 (IRS-1), p-IRS-1(ser), and pIRS-1(tyr) were purchased from Tianjin SiMu Trading Co., Ltd. (Tianjin, China). The other laboratory chemicals were of analytical grade.

the favorable effects of mogroside on the regulation of blood sugar can be balanced by inhibiting the conversion of dietary glucose and raising postprandial insulin levels. It also can regulate hyperglycemia and hyperlipidemia by activating the AMPK pathway (Chen et al., 2011; Nie et al., 2017; Vidyashankar, Varma, & Patki, 2013). Furthermore, various compounds, such as Siamenoside I (SO1), Mogroside III (MO3), Mogroside IV (MO4), and Mogroside V, (MO5) were successfully evaluated, and they provide a reference for the analysis of other traditional Chinese medicines in the future (Suzuki et al., 2007). The chemical structures of the four mogrosides are shown in Fig. 1A-D. In addition, MO5 and various minor elements, such as MO4, SO1, and MO3, exerted anti-hyperglycemic effects in rats by inhibiting maltase activity with IC (50) values of 14, 12, 10, and 1.6 mM, respectively (Li et al., 2017; Shen et al., 2014). However, the molecular mechanism of the four mogrosides in the treatment of T2DM remains elusive. The aim of this article is to evaluate these four mogrosides and confirm which is best for the treatment of T2DM using the HepG2 cell experiments, and the best mogroside was then used for in vitro experiments. The T2DM rat experiments evaluated the effects on glycometabolism, glycogen synthesis, insulin sensitivity, and IR through the PI3K/Akt pathway in vivo.

HepG2 cells were cultured in complete medium (DMEM containing 4.5 mM glucose, 10% fetal serum, and 1% combined antibiotics) at 37 °C in 5% CO2 and in a humidifying atmosphere. After 3 days, all cells were washed three times with phosphate-buffered saline (PBS), and then they were inoculated in a 96-well plate at a concentration of 1 × 105 cells/mL.

2. Materials and methods

2.3. Animals and treatments

2.1. Chemicals and materials

Male Sprague-Dawley (SD) rats of 4 weeks of age (180 ± 20 g) were provided by the Beijing Weitonglihua Co., Ltd. (Beijing, China). All of the rats breeding at Tianjin University of Science & Technology (environmental facilities qualified number: SYXK (Tianjin, China) 2006-0005) were in a specific-pathogen-free animal room. They were in a controlled environment at 23 ± 2 °C, 55 ± 10% humidity, 12 h light/dark cycle, and they were provided unrestricted access to food and water. The animal experiments were approved by the Animal Care and Use Committee, and all of the related facilities and experimental procedures were executed according to the Technical Standards for Testing & Assessment of Health Food (2003). All rats were fed a normal chow diet for 1 week before randomization. The normal group (N) continued to be fed this diet, and the remaining rats were fed a high-sugar and high-fat diet (Sato, Fujita, & Iemitsu, 2014) (formula: 50% basic diet, 20% granulated sugar, 16%

2.2. Cell treatments

The SO1 (98%), MO3 (98%), MO4 (98%), and MO5 (98%) that were used for the in vitro experiments were purchased from Chengdu Biopurify Phytochemicals Co., Ltd. (Chengdu, China). The MO5 (90%) that was used for the in vivo experiments was purchased from Huacheng Biological Resources Co., Ltd. (Hunan, China). Human hepatoma HepG2 cells were provided by Tianjin University of Science & Technology (Tianjin, China). The blood glucose meter and dipsticks were purchased from JNJ, Co., (New Brunswick, USA). Dulbecco’s modified Eagle’s medium (DMEM), Total RNA Isolation (Trizol), RadioImmunoprecipitation Assay (RIPA), and secondary antibodies were purchased from Solarbio Science & Technology Co., Ltd. (Beijing, China). Streptozocin (STZ) and the Rat Insulin ELISA kit were purchased from Dingguo Changsheng Biotechnology Co., Ltd. (Beijing, 2

Journal of Functional Foods 63 (2019) 103566

X. Liu, et al.

Aldrich, Shanghai, China) and 50 µM 2-NDBG for 30 min.

Table 1 RT-PCR primer sets design. Gene

Primer

Primer sequences 5′−3′

Size (bp)

2.6. Glycogen production analysis

PI3K

sense antisense sense antisense sense antisense sense antisense sense antisense sense antisense

ACAAAGCTCTACTCTAGGCGTG TTACCAGCATGGTCATGGGC AGAGAGCCGAGTCCTACAGAATA CCGAGAGAGGTGGAAAAACA TCGTCCATCGATGTGTGGTC TTGTCCAGGGGTGAGCTTTG ACCAGCACATACGACACCAG CCAGTCAACGAGAGGCTGTT TTGCCAGAATGCACGCAGAA TGCCTGCATCATCTGTTGAC GATCGATGCCGGTGCTAAGA TCCTATGGGAGAACGGCAGA

242

Glucose production analysis was performed based on a previously reported method (Li, Sun, et al., 2019). HepG2 cells were seeded into 6well plates at a concentration of 1 × 105 cells/mL. After model establishment, the cells were treated with the four mogrosides. Then, the cells were cultured in glucose-free DMEM containing 5 mM glycine, valine, alanine, lactate, and pyruvate. After 2 h, the culture solution was collected and examined using a glucose oxidase method kit (Nanjingjiancheng, Nanjing, China).

Akt GSK-3β GLUT2 GS β-actin

133 202 195 125 367

2.7. Glycogen content determination Glycogen content analysis was performed based on a previously reported method (Gupta & Khandelwal, 2004). HepG2 cells were seeded into 6-well plates at a concentration of 1 × 105 cells/mL. After model establishment, the cells were treated with the four mogrosides. Then, the cells were washed three times with PBS and collected by centrifugation (4000 rpm for 15 min, 4 °C) for the glycogen content assay kit (Nanjingjiancheng, Nanjing, China). The remaining cells were used to analyze the PI3K/Akt pathway.

lard, 10.5% casein, 1% gelatin, 1% cholesterol, 0.5% cholate, 0.5% minerals, 0.5% vitamins). After 4 weeks, STZ was intraperitoneally injected into the rats fed the high-sugar and high-fat diet. The dissolved dose of STZ was 30 mg/(kg·body·bw), and the buffer was citric acid with a pH of 4.2–4.5. Meanwhile, the rats in the N group were injected with a buffer vehicle. After 72 h, rats with a blood glucose level above 11.1 mM were considered to have developed T2DM, and they were used in future tests. Then, the T2DM rats were randomly divided into four groups of 10 rats. The low-dose group (L), middle-dose group (M), and high-dose group (H) were treated with MO5 at 30, 75, and 150 mg/ (kg·bw·day), respectively, by oral gavage. The N group and the control group (C) were given distilled water (Zhou, Zhang, Li, Wang, & Li, 2018). To investigate the effects of MO5 on glucose metabolism in rats, body weight was measured weekly in all groups. After 5 weeks, all rats were sacrificed to collect the venous blood, and serum was isolated by centrifugation (4500 rpm for 15 min, 4 °C). Tissue was collected by dissection. Then, the serum (Aleali, Namjooyan, Latifi, & Cheraghian, 2019) and liver tissue (Li, Zhao, et al., 2019) were stored at −80 °C and in liquid nitrogen.

2.8. Biochemical analysis and serum insulin measurements The blood glucose levels of rats were measured by taking blood from the tail vein after an overnight fast. For serum insulin measurements (Liu, Li, Zhang, Sun, & Zhang, 2019), the fasting blood glucose level (FBG) was measured weekly in all groups using a glucometer after overnight fasting. The fasting serum insulin (FINS) was determined with a Rat Insulin ELISA kit (Nanjingjiancheng, Nanjing, China). Formula 1 was used to determine the insulin sensitivity index (ISI). Formula 2 was used to determine the homeostasis model assessment-insulin resistance (HOMA-IR). Formula 3 was used to determine the homeostasis model assessment-β (HOMA-β).

2.4. Microculture tetrazolium (MTT) assay Based on a previously reported method (Gu et al., 2014), an MTT assay was performed. When the cells reached 70%−80% confluence, they were cultured in DMEM. The normal control (N) group was maintained in DMEM, and the treatment groups were maintained in DMEM containing different concentrations (1, 5, and 10 μM) of SO1, MO3, MO4, or MO5 for 24 h (Li et al., 2017). Then, 20 μl MTT labeling reagent was added to each well. After 4 h, all culture medium was discarded and replaced with 150 μl Dimethyl sulfoxide. The absorbance of the samples at 490 nm was measured to determine effects on cell viability or cytotoxicity.

ISI = Ln(1/FINS × FBG)

(1)

HOMA − IR = (FBG × FINS/22.5)

(2)

HOMA − β = (20 × FINS)/(FBG − 3.5)

(3)

2.9. Oral glucose tolerance test (OGTT), and insulin tolerance test (ITT) Four weeks after oral administration, an OGTT was given to all groups of rats after an overnight fast (Dolo et al., 2019). The N and C groups were orally gavaged with distilled water. The MO5 doses of 30, 75, and 150 mg/(kg·bw·day) were administered via oral gavage to the L, M, and H groups, respectively. Then, after 20 min, all rats were orally gavaged with 2 g/kg glucose. The blood glucose levels of each group were measured, and blood samples were taken from the tail tip at 0, 30, 60, and 120 min. Three days after the OGTT, an ITT was employed in overnightfasted rats (Dolo et al., 2019). Similar to the OGTT, the N and C groups were orally gavaged with distilled water. The MO5 doses of 30, 75, and 150 mg/(kg·bw·day) were administered via oral gavage to the L, M, and H groups, respectively. After 20 min, all rats were hypodermically injected with 0.15 U/kg insulin. Blood samples were collected using the same method as the OGTT.

2.5. Glucose uptake analysis Glucose uptake analysis was performed based on a previously reported method (Li, Sun, et al., 2019). Cells were inoculated in a 96-well plate at a concentration of 1 × 105 cells/mL. When cells reached 70%−80% confluence, the cells were cultured in DMEM. The N group was maintained in DMEM, and the model control group (C) and treatment groups (group SO1, MO3, MO4, and MO5) were maintained in DMEM containing 0.6 mM palmitic acid (PA) for 36 h. In the C and N groups, DMEM was used to replace the medium. In the treatment groups, the medium was replaced with DMEM mixed with different concentrations (1, 5, and 10 μM) of the four mogrosides for 24 h. The glucose uptake was determined using a fluorescence microplate reader (Molecular Devices, USA). Before the measurements, the culture medium was added to the fluorescent D-glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (Solarbio, Beijing, China). The cells were incubated with insulin (Sigma

2.10. Liver glycogen measurements, alanine transaminase (ALT), and aspartate transaminase (AST) assays in rats All rat liver tissues were homogenized, and the homogenate contents were tested using a Liver/Muscle Glycogen kit (Nanjingjiancheng, 3

Journal of Functional Foods 63 (2019) 103566

X. Liu, et al.

Fig. 2. Effect of four mogrosides on MTT and glucose uptake in IR HepG2 cells. (A) MTT assay. (B) Glucose uptake analysis. (C) Glycogen production analysis. (D) Glycogen Content Determination. (E) Effect of four mogrosides on the expression of key genes in HepG2 cells: (E1) The mRNA expression of PI3K. (E2) The mRNA expression of Akt. (E3) The mRNA expression of GSK-3β. (E4) The mRNA expression of GS. (E5) The mRNA expression of GLUT2. Data are presented as the means ± SD (n = 6 per group), ##P < 0.01 vs. N, normal control group; *P < 0.05 vs. C, model control group; **P < 0.01 vs. C, model control group.

Nanjing, China). All rat serum samples were tested with ALT Assay and AST Assay kits (Nanjingjiancheng, Nanjing, China).

2017). First, HepG2 cells were washed with PBS and collected by centrifugation (4000 rpm for 15 min, 4 °C), and rat livers were ground into powder in liquid nitrogen. Next, the Trizol solution, chloroform, and other reagents were added as described in the instructions. This was followed by centrifugation and stasis, as required. The resulting precipitate was dissolved in the RNA solution, which is usually diethypyrocarbonate water. The absorbance values of the RNA diluent at OD260 and OD280 were measured by an ultraviolet spectrophotometer

2.11. Real-time polymerase chain reaction (RT-PCR) analysis In this study, the Trizol method was used to extract RNA from HepG2 cells (Li, Sun, et al., 2019) and SD rat liver tissue (Gao et al., 4

Journal of Functional Foods 63 (2019) 103566

X. Liu, et al.

Package for the Social Sciences Software 20.0 software (SPSS Inc., Chicago, IL, USA) was applied for analysis.

Table 2 Effect of MO5 on body weight in T2DM rats. Group

Body weight (g)

3. Results 1 week N C L M H

463 353 355 346 350

± ± ± ± ±

3 weeks 10.9 21.6## 21.9 22.8 27.6

499 345 367 368 392

± ± ± ± ±

5 weeks 15.2 26.0## 34.5 18.6 22.3*

535 340 374 393 457

± ± ± ± ±

3.1. Mogroside improved glucose metabolism in IR HepG2 cells

14.5 32.2## 29.4 27.8* 31.8**

Doses of different concentrations of SO1, MO3, MO4 and MO5 had no harmful or cytotoxic effects on cell viability based on the MTT test (Fig. 2A). Glucose uptake was significantly improved in the groups given 5 μM SO1, MO3, MO4, and MO5, when compared to the C group (P < 0.01). The regulating effect was most apparent in the MO5 group (Fig. 2B). Additionally, the glucose production was significantly inhibited in the MO5 group (Fig. 2C). Our study also indicated that the four mogrosides increased the glycogen content of IR HepG2 cells at the 5 μM dose (Fig. 2D). In this study, the glycogen content of the HepG2 cells in the SO1, MO3, and MO4 groups were significantly different (P < 0.05), but the glycogen content of the MO5 group demonstrated an extremely significant difference (P < 0.01). These data suggested that MO5 significantly improved glucose metabolism in IR HepG2 cells.

Note: Data are presented as the means ± SD (n = 10 per group), ##P < 0.01 vs. N, normal control group; *P < 0.05 vs. C, diabetic control group; **P < 0.01 vs. C, diabetic control group.

to determine the purity of RNA. When the absorbance value was 1.8 < OD260/OD280 < 2.2, the RNA purity was ideal. After agarose gel electrophoresis, the integrity of the rRNA band was verified by visualization. Then, the RNA was reverse transcribed to cDNA for subsequent experiments using a Prime Script TM RT reagent kit under the following conditions: 37 °C for 15 min, 85 °C for 5 s, and 4 °C. The specific primer pairs (Beijingdingguo, Beijing, China) used for DNA amplification are listed in Table 1. RT-PCR analysis was performed in the real-time detector (Bio-rad laboratories, HemelHempstead, UK).

3.2. Mogroside affected the PI3K/Akt pathway in HepG2 cells In this study, the effects of mogrosides (5 μM SO1, MO3, MO4, and MO5) on the gene expression of PI3K (Fig. 2E1), Akt (Fig. 2E2), GSK-3β (Fig. 2E3), GS (Fig. 2E4), and GLUT2 (Fig. 2E5) were evaluated using RT-PCR. There were extremely significant differences (P < 0.01) in the gene expression of PI3K, GSK-3β, GLUT2, and GS in the MO5 group.

2.12. Western blot analysis Western blot analysis of protein expression was performed (Gao et al., 2015; Sun et al., 2018). In this study, 0.1 g of rat liver was homogenized in RIPA reagent. This was followed by centrifugation (10000 rpm for 5 min at 4 °C) to collect the supernatant, and the protein concentrations were normalized. Then, the proteins were separated by polyacrylamide gel electrophoresis for 0.5 h at 100 V, followed by 1 h at 120 V. Then, the protein samples were transferred to the polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA) for 2.5 h at 300 mA. The membrane was incubated at normal atmospheric temperature for 1.5 h in a closed solution containing 5% nonfat milk powder. Then, the membrane was incubated overnight at 4 °C in TBST containing the following primary antibodies: anti-IRS (1:1,000), anti-p-IRS (ser) (1:1,000), anti-p-IRS (tyr) (1:1,000), anti-PI3K (p110) (1:1000), antiPI3K (p85) (1:1000), anti-Akt (1:1000), anti-p-Akt (Ser473) (1:2000), anti-GSK-3β (1:1000), anti-p-GSK-3β (1:500), anti-GS (1:1000), antiGLUT2 (1:1000), and anti-β-actin (1:10,000). β-actin was used as the control. After incubation with the secondary antibody at room temperature for 2 h, the membrane was exposed to a chemiluminescence reagent. The Image J program was used to quantify the density of the protein bands on the fluorescent film in the dark room.

3.3. MO5 affected the body weight and blood glucose in T2DM rats In this study, after 5 weeks of MO5 treatment, the body weight of each treatment group was recovered to varying degrees. Compared with C group, H group showed extremely significantly difference (P < 0.01) (Table 2). The FBG of T2DM rats was significantly higher than normal rats (P < 0.05). After 5 weeks of MO5 treatment, the FBG of the treated groups improved in a dose-dependent manner. The reduction rates were 8.24%, 12.8%, and 17.0%, as compared to the initial values (Table 3). 3.4. MO5 affected OGTT and ITT in T2DM rats The OGTT results showed that the blood glucose of rats peaked at 30 min, and it recovered at 120 min. There was no significant change in the N group. However, in the C group, the blood glucose did not return to the original level after 120 min, and the blood glucose level still remained high. The blood glucose level of the H group showed a sharp decline (Fig. 3A). The area under the curve (AUC) of the blood glucose level was calculated, and the AUC of the C group was extremely significantly higher than the N group (P < 0.01). After intragastric administration, the blood glucose of the H group was significantly decreased compared to the C group (P < 0.01) (Fig. 3B).

2.13. Statistical analysis Data are presented as means ± standard deviation (M ± SD). Among the groups, P < 0.05 was considered statistically significant, while P < 0.01 was considered extremely significant. Statistical Table 3 Effect of MO5 on FBG levels in T2DM rats. Group

Fasting blood glucose (mM) 0 weeks

N C L M H

4.88 23.7 23.6 24.0 24.0

± ± ± ± ±

Reduction rate (%) 1 week

0.41 3.08## 2.46 1.62 3.11

4.81 26.0 24.3 23.8 24.8

± ± ± ± ±

3 weeks 0.52 3.81## 4.49 1.03 3.56

4.73 25.7 22.2 21.6 21.5

± ± ± ± ±

5 weeks 0.46 3.15## 0.99 2.00 1.78*

4.86 25.9 21.4 20.9 19.6

± ± ± ± ±

0.47 2.80## 0.75** 2.92* 2.02**

– – 8.24 12.8 17.0

Note: Data are presented as the means ± SD (n = 10 per group), ##P < 0.01 vs. N, normal control group; *P < 0.05 vs. C, diabetic control group; **P < 0.01 vs. C, diabetic control group. 5

Journal of Functional Foods 63 (2019) 103566

X. Liu, et al.

Fig. 3. Effect of MO5 on OGTT and ITT in T2DM rats. (A) Blood glucose levels during the oral glucose tolerance test. (B) The area under curve (AUC) of blood glucose levels in the oral glucose tolerance test. (C) Descension rate of blood glucose during the insulin tolerance test. (D) The area under curve (AUC) of blood glucose levels in the insulin tolerance test. Data are presented as the means ± SD (n = 10 per group), ##P < 0.01 vs. N, normal control group; *P < 0.05 vs. C, diabetic control group; **P < 0.01 vs. C, diabetic control group.

Following the subcutaneous injection of insulin (0.15 U/kg) for the ITT, the ability of the C group to utilize insulin was extremely significantly lower than the N group (P < 0.01) (Fig. 3C). The AUC was calculated, and there was a significant difference between the treatment group and the C group (P < 0.05). This indicates that MO5 improved the insulin utilization rate of T2DM rats (Fig. 3D).

Table 4 Effect of MO5 on insulin sensitivity in T2DM rats. Group

FINS(mIU/L)

ISI

N C L M H

19.1 28.0 23.3 21.5 21.1

−4.51 −6.58 −6.20 −6.07 −6.02

± ± ± ± ±

2.88 2.68## 3.05* 4.30* 1.13**

± ± ± ± ±

0.17 0.14## 0.14** 0.26** 0.09**

HOMA-β

HOMA-IR

334 ± 183 25.4 ± 4.07## 26.1 ± 3.65 25.5 ± 7.24 26.6 ± 4.34

4.10 32.2 22.2 19.9 18.3

± ± ± ± ±

0.66 4.18## 2.95** 4.71** 1.67**

3.5. MO5 affected the insulin sensitivity in T2DM rats

##

Note: Data are presented as the means ± SD (n = 10 per group), P < 0.01 vs. N, normal control group; *P < 0.05 vs. C, diabetic control group; **P < 0.01 vs. C, diabetic control group.

Insulin sensitivity can also be represented by FINS, ISI, HOMA-β, and HOMA-IR. The results of this study showed that IR led to severe functional impairment of cells, and the HOMA-IR and insulin concentration of the C group were extremely significantly higher than the N group (P < 0.01). The intervention of MO5 not only significantly improved hyperinsulinemia, but it also significantly reduced the HOMA-IR value (P < 0.01) in a dose-dependent manner (Table 4).

Table 5 Effect of MO5 on liver damage in T2DM rats. Group

Liver Glycogen (mg/g)

AST (U/L)

ALT (U/L)

N C L M H

10.5 6.58 7.01 8.43 8.83

53.8 ± 9.85 143 ± 27.0## 102 ± 18.0* 82.1 ± 18.1* 72.0 ± 12.1**

38.7 96.3 88.7 71.0 65.2

± ± ± ± ±

0.57 0.87## 1.07 1.00** 1.60*

± ± ± ± ±

5.68 17.3## 18.6 13.1* 10.3**

3.6. MO5 affected the liver glycogen content, AST, and ALT in T2DM rats The synthesis of liver glycogen in the tissue homogenates was promoted by MO5. In this study, the liver glycogen content of the T2DM rats in the H group was significantly different (P < 0.05), and there were extremely significant differences (P < 0.01) in the M group (Table 5). The serum levels of AST and ALT were reduced by MO5. There were significant differences in the AST and ALT of the T2DM rats

Note: Data are presented as the means ± SD (n = 10 per group), ##P < 0.01 vs. N, normal control group; *P < 0.05 vs. C, diabetic control group; **P < 0.01 vs. C, diabetic control group.

6

Journal of Functional Foods 63 (2019) 103566

X. Liu, et al.

Fig. 4. Effect of MO5 on the expression of key genes in T2DM rats. (A) The mRNA expression of PI3K. (B) The mRNA expression of Akt. (C) The mRNA expression of GSK-3β. (D) The mRNA expression of GS. (E) The mRNA expression of GLUT2. Data are presented as the means ± SD (n = 10 per group), ##P < 0.01 vs. N, normal control group; *P < 0.05 vs. C, diabetic control group; **P < 0.01 vs. C, diabetic control group.

In the current study, the effects of MO5 intervention on the physiological and biochemical indexes related to blood glucose in the experimental animals were tested. The effects of MO5 on blood glucose regulation in T2DM rats were evaluated. Weight loss and polyphagia are basic symptoms of diabetes. The results obtained in this study are similar to those of many anti-diabetic drugs. This indicates that MO5 may improve body weight by increasing carbohydrate and blood glucose utilization, which prevents muscle atrophy and tissue damage (Liu et al., 2019). FBG is the most common and important indicator for diagnosing disorders of glucose metabolism. The results obtained in the current study suggest that MO5 may improve T2DM, various endocrine diseases, and severe liver diseases by regulating FBG levels (Zhao et al., 2019). The OGTT assay is a glucose load test used to understand the function of β-cells and the ability of the body to regulate blood sugar. It is used as a diagnostic test for diabetes (Cobb et al., 2015; Salemans, van Dieijen-Visser, & Brombacher, 1987). The results suggest that MO5 may accelerate glucose metabolism by increasing the response to insulin, thereby increasing the acute hypoglycemic ability of the animals. The ITT assay focuses on tissue sensitivity to insulin. These results suggest that MO5 may act as an insulin sensitizer that can reduce the IR of T2DM rats. Insulin sensitivity can also be indicated by FINS, ISI, HOMA-β, and HOMA-IR. The ISI and HOMA-IR index were calculated by measuring the serum insulin and blood glucose levels of the test animals. The results suggest that MO5 alleviates IR in rat peripheral tissues and increases the ability of the receptor to bind to insulin. In this study, the results suggest that MO5 promotes the synthesis of liver glycogen in T2DM rats, indicating that MO5 can regulate glucose levels by enhancing glycogen production. A previous study by Qi (Qi et al., 2008) mentions that MO5 may help prevent diabetic complications associated with oxidative stress, hyperlipidemia, and fatty liver. AST and ALT are sensitive indicators of liver damage. When these liver enzyme levels are above normal levels, it can indicate liver disease. Qi et al. found that MO5 plays a key role in activating the antioxidant enzymes in the livers of diabetic mice. In the present study, the results suggest that MO5 plays a role in improving blood glucose control in livers damage by hyperglycemia in T2DM rats. The PI3K/Akt pathway is a key signaling pathway involved in multiple biological activities, and it is closely related to T2DM, cardiovascular disease, obesity, and other IR-related diseases (Gao et al., 2015, 2017; Liu et al., 2019). Previous reports indicated that the IRS

in the M group (P < 0.05), and there were extremely significant differences (P < 0.01) in the H group (Table 5). These results suggest that MO5 may protect against liver damage caused by hyperglycemia. 3.7. MO5 affected the expression of key genes and proteins in the PI3K/Akt pathway in T2DM rats In this study, MO5 affected genes associated with glucose metabolism, including PI3K, Akt, GSK-3β, GS, and GLUT2 (Fig. 4A-E). The gene expression was assessed by RT-PCR. These results indicate that MO5 treatment significantly up-regulated the expression levels of PI3K, GLUT2, and GS. The expression of GSK-3β was down- regulated (P < 0.05), and the expression of Akt was not affected. Moreover, Western blot analysis revealed that the protein expression levels of PI3K (p110), PI3K (p85), p-Akt, GLUT2, GS, p-IRS-1(tyr) were up-regulated by MO5 treatment. The protein expression levels of p-GSK-3β and pIRS-1(ser) were down-regulated in the liver of T2DM rats (Fig. 5A-H) (P < 0.05). Taken together, these data indicate that MO5 improved hyperglycemia through the PI3K/Akt signaling pathway in T2DM rats. 4. Discussion Previous studies have shown that mogroside has a potential value in preventing diabetes (Qi, Chen, Zhang, & Xie, 2008; Zhou et al., 2018). To further evaluate the therapeutic effect of mogroside in T2DM, both in vitro and in vivo T2DM models were studied. The purpose of this study was to evaluate the effects of SO1, MO3, MO4, and MO5 treatment on hyperglycemia using HepG2 cells. In addition, SD rats were used as an in vivo model to investigate the related mechanisms of MO5 as a treatment for T2DM. In this study, HepG2 cells were selected as the experimental model, and they were induced by PA to establish an IR model to investigate the effects of the four mogrosides. We observed that the four mogrosides at 5 μM significantly attenuated IR, restored glucose uptake, suppressed glucose production, increased the glycogen content, and activated the PI3K signaling pathway in HepG2 cells. In accordance with previous research (Zhou et al., 2018), we found that MO5 can alleviate glucose levels in vitro, and we investigated its molecular mechanism. Among the mogrosides, MO5 was better than MO3, MO4, and SO1. Therefore, MO5 was selected as the treatment for the subsequent animal experiments. 7

Journal of Functional Foods 63 (2019) 103566

X. Liu, et al.

kinases, and transcription factors. Therefore, it promotes GLUT2 transport and uptake of glucose by liver cells. Akt also inhibits GSK-3β activity, thereby promoting glucose metabolism and regulating the cell cycle. In this study, RT-PCR and Western blot analysis were used to confirm the ability of MO5 to positively regulate liver glycogen synthesis, and this was indirectly confirmed. This indicates that MO5 can alleviate IR and increase glycogen by regulating the expression of key genes and proteins in the signal transduction pathways, thereby lowering blood glucose. In conclusion, the metabolic parameters of insulin sensitivity, glucose homeostasis, and liver damage were improved by treatment with four mogrosides (especially MO5) in IR HepG2 cells and T2DM rats. The present results suggest that MO5 may be useful in alleviating T2DM through the PI3K/Akt pathway. This study provides useful information for understanding the efficacy and mechanism of action of MO5 in the treatment of T2DM. The results of this research lay a theoretical foundation for the development of mogroside-related products, and it also serves as a reference for the functional research of mogrosides. 5. Ethics statement All the procedures in the experiment were approved by the Institutional animal Care and Use Committee of Tianjin University of Science and Technology (TUST20161011). Acknowledgments This research has got the support of the National Key R&D Program of China (2016YFD0400803). Declaration of Competing Interest The authors declare no conflict of interest. References Aleali, A. M., Namjooyan, F., Latifi, S. M., & Cheraghian, B. (2019). The effect of hydroalcoholic Saffron (Crocus sativus L.) extract on fasting plasma glucose, HbA1c, lipid profile, liver, and renal function tests in patients with type 2 diabetes mellitus: A randomized double - blind clinical trial. Phytotherapy Research, 33(6), 1648–1657. https://doi.org/10.1002/ptr.6351. Arnolds, S., Heise, T., Flacke, F., & Sieber, J. (2013). Common standards of basal insulin titration in T2DM. Journal of Diabetes Science and Technology, 7(3), 771–1188. https://doi.org/10.1177/193229681300700323. Chen, X. B., Zhuang, J. J., Liu, J. H., Lei, M., Ma, L., Chen, J., ... Hu, L. H. (2011). Bioorganic & medicinal chemistry potential AMPK activators of cucurbitane triterpenoids from Siraitia grosvenorii swingle. Bioorganic & Medicinal Chemistry, 19(19), 5776–5781. https://doi.org/10.1016/j.bmc.2011.08.030. Chiu, C. H., Wang, R., Lee, C. C., Lo, Y. C., & Lu, T. J. (2013). Biotransformation of mogrosides from Siraitia grosvenorii swingle by Saccharomyces cerevisiae. Journal of Agricultural and Food Chemistry, 61(29), 7127–7134. https://doi.org/10.1021/ jf402058p. Cobb, J., Eckhart, A., Perichon, R., Wulff, J., Mitchell, M., Adam, K., ... Ferrannini, E. (2015). A novel test for IGT utilizing metabolite markers of glucose tolerance. Journal of Diabetes Science and Technology, 9(1), 69–76. https://doi.org/10.1177/ 1932296814553622. Dolo, P. R., Shao, Y., Li, C., Zhu, X. C., Yao, L. B., & Wang, H. (2019). The effect of gastric bypass with a distal gastric pouch on glucose tolerance and diabetes remission in type 2 diabetes Sprague-Dawley rat model. Obesity Surgery, 29(6), 1889–1990. https://doi. org/10.1007/s11695-019-03776-w. Gao, S., Guo, Q., Qin, C., Shang, R., & Zhang, Z. S. (2017). Sea buckthorn fruit oil extract alleviates insulin resistance through the PI3K/Akt signaling pathway in type 2 diabetes mellitus cells and rats. Journal of Agricultural and Food Chemistry, 65(7), 1328–1336. https://doi.org/10.1021/acs.jafc.6b04682. Gao, Y. F., Zhang, M. N., Wu, T. C., Xu, M. Y., Cai, H. N., & Zhang, Z. S. (2015). Effects of d-Pinitol on insulin resistance through the PI3K/Akt signaling pathway in type 2 diabetes mellitus rats. Journal of Agricultural and Food Chemistry, 63(26), 6019–6026. https://doi.org/10.1021/acs.jafc.5b01238. Gu, J., Zheng, Z., Yuan, J., Zhao, B., Wang, C., Zhang, L., ... Jia, X. B. (2014). Comparison on hypoglycemic and antioxidant activities of the fresh and dried Portulaca oleracea L. in insulin-resistant HepG2 cells and streptozotocin-induced C57BL/6J diabetic mice. Journal of Ethnopharmacology, 161, 214–223. https://doi.org/10.1016/j.jep. 2014.12.002. Gupta, D., & Khandelwal, R. L. (2004). Modulation of insulin effects on phosphorylation of protein kinase B and glycogen synthesis by tumor necrosis factor-α in HepG2 cells.

Fig. 5. Effect of MO5 on the expression of main proteins in T2DM rats. (A) The protein expression of IRS-1, p-IRS-1 (ser). (B) The protein expression of p-IRS-1 (tyr). (C) The protein expression of PI3K (p85). (D) The protein expression of PI3K (p110). (E) The protein expression of Akt, p-Akt. (F) The protein expression of GSK-3β, p-GSK-3β. (G) The protein expression of GLUT2. (H) The protein expression of GS. Data are presented as the means ± SD (n = 3 per group), ## P < 0.01 vs. N, normal control group; *P < 0.05 vs. C, diabetic control group; **P < 0.01 vs. C, diabetic control group.

protein plays an important role in the insulin activation cascade (Xin et al., 2016). Phosphorylation of the IRS protein by p-IRS-1 (ser) and pIRS-1 (tyr) may lead to damage and hinder the signal cascade, which could lead to T2DM (Khodabandehloo, Gorgani-Firuzjaee, Panahi, & Meshkani, 2016). PI3K is an intracellular phosphatidylinositol kinase composed of a regulatory subunit p85 and a catalytic subunit p110, which promotes the activation of the downstream gene Akt. Activated Akt phosphorylates various downstream factors, such as enzymes,

8

Journal of Functional Foods 63 (2019) 103566

X. Liu, et al.

identi fi cation and quanti fi cation of fi ve major mogrosides in Siraitia grosvenorii (Luo-Han-Guo) by high performance liquid chromatography–triple quadrupole linear ion trap tandem mass spectrometry combined with microwave-assisted extraction. Microchemical Journal, 116, 142–150. https://doi.org/10.1016/j.microc.2014.04. 014. Sun, B. S., Chen, Y. P., Wang, Y. B., Tang, S. W., Pan, F. Y., Li, Z., & Sung, C. K. (2012). Anti-obesity effects of mogrosides extracted from the fruits of Siraitia grosvenorii (Cucurbitaceae). African Journal of Pharmacy and Pharmacology, 6(20), 1492–1501. https://doi.org/10.5897/ajpp12.310. Sun, Y., Shi, H., Yin, S., Ji, C., Zhang, X., Zhang, B., & Qian, H. (2018). Human mesenchymal stem cell derived exosomes alleviate type 2 diabetes mellitus through reversing peripheral insulin resistance and relieving β-cell destruction. ACS Nano. https://doi.org/10.1021/acsnano.7b07643. Suzuki, Y. A., Murata, Y., Inui, H., Sugiura, M., & Nakano, Y. (2007). Triterpene glycosides of Siraitia grosvenori inhibit rat intestinal maltase and suppress the rise in blood glucose level after a single oral administration of maltose in rats. Journal of Agricultural and Food Chemistry, 53(8), 2941–2946. https://doi.org/10.1021/ jf0478105. Tang, Q., Ma, X. J., Mo, C. M., Wilson, I. W., Song, C., Zhao, H., ... Qiu, D. Y. (2011). An efficient approach to finding Siraitia grosvenorii triterpene biosynthetic genes by RNA-seq and digital gene expression analysis. BMC Genomics, 12, 343. https://doi. org/10.1186/1471-2164-12-343. Vidyashankar, S., Varma, R. S., & Patki, P. S. (2013). Quercetin ameliorate insulin resistance and up-regulates cellular antioxidants during oleic acid induced hepatic steatosis in HepG2 cells. Toxicology in Vitro, 27(2), 945–953. https://doi.org/10. 1016/j.tiv.2013.01.014. Wang, R., Chen, Y. C., Lai, Y. J., Lu, T. J., & Huang, S. T. (2019). Dekkera bruxellensis, a beer yeast that specifically bioconverts mogroside extracts into the intense natural sweetener siamenoside I. Food Chemistry, 276, 43–49. https://doi.org/10.1016/j. foodchem.2018.09.163. Xin, W., Li, Z. P., Xu, Y., Yu, Y., Zhou, Q., Chen, L. Y., & Wan, Q. (2016). Autophagy protects human podocytes from high glucose-induced injury by preventing insulin resistance. Metabolism-Clinical and Experimental, 65(9), 1307–1315. https://doi.org/ 10.1016/j.m etabol.2016.05.015. Zhang, X. B., Song, Y. F., Ding, Y. P., Wang, W., Liao, L., Zhong, J., ... Xie, W. D. (2018). Effects of mogrosides on high-fat-diet-induced obesity and nonalcoholic fatty liver disease in mice. Molecules (Basel, Switzerland), 23(8), 1–11. https://doi.org/10.3390/ molecules23081894. Zhao, C. L., Cui, X. M., Chen, Y. P., & Liang, Q. (2010). Key enzymes of triterpenoid saponin biosynthesis and the induction of their activities and gene expressions in plants. Natural Product Communications, 5(7), 1147–1158. https://doi.org/10.1177/ 1934578x1000500736. Zhao, T., Gong, H. P., Dong, Z. Q., Du, Y. M., Lu, Q. H., & Chen, H. Q. (2019). Predictive value of fasting blood glucose for serious coronary atherosclerosis in non-diabetic patients. Journal of International Medical Research, 47(1), 152–158. https://doi.org/ 10.1177/0300060518798252. Zhou, G. S., Peng, Y., Zhao, L. J., Wang, M. Y., & Li, X. B. (2017). Biotransformation of total saponins in Siraitia fructus by human intestinal microbiota of normal and type 2 diabetic patients: Comprehensive metabolite identification and metabolic profile elucidation using LC-Q-TOF/MS. Journal of Agricultural and Food Chemistry, 65(8), 1518–1524. https://doi.org/10.1021/acs.jafc.6b04498. Zhou, G. S., Zhang, Y. L., Li, Y., Wang, M. Y., & Li, X. B. (2018). The metabolism of a natural product mogroside V, in healthy and type 2 diabetic rats. Journal of Chromatography B-Analytical Technologies in the Biomedical and Life Sciences, 1079, 25–33. https://doi.org/10.1016/j.jchromb.2018.02.002. Zhou, Y., Zheng, Y., Ebersole, J., & Huang, C. F. (2011). Insulin secretion stimulating effects of mogroside V and fruit extract of Luo Han Kuo (Siraitia grosvenori Swingle) fruit extract. Acta pharmaceutica Sinica, 44(11), 1252–1257.

Biochimica et Biophysica Acta-General Subjects, 1671(1–3), 51–58. https://doi.org/10. 1016/j.bbagen.2004.01.003. Khodabandehloo, H., Gorgani-Firuzjaee, S., Panahi, G., & Meshkani, R. (2016). Molecular and cellular mechanisms linking inflammation to insulin resistance and β-cell dysfunction. Translational Research, 167(1), 228–256. https://doi.org/10.1016/j.trsl. 2015.08.011. Lei, Y. Y., Gong, L. L., Tan, F., Liu, Y. X., Li, S., Shen, H. W., ... Sun, H. J. (2019). Vaccarin ameliorates insulin resistance and steatosis by activating the AMPK signaling pathway. European Journal of Pharmacology, 851, 13–24. https://doi.org/10.1016/j. ejphar.2019.02.029. Li, Y. M., Sun, M. Z., Liu, Y. P., Liang, J. J., Wang, T. X., & Zhang, Z. S. (2019). Gymnemic acid alleviates type 2 diabetes mellitus and suppresses endoplasmic reticulum stress in vivo and in vitro. Journal of Agricultural and Food Chemistry, 67(13), 3662–3669. https://doi.org/10.1021/acs.jafc.9b00431. Li, F., Yang, F. M., Liu, X., Wang, L., Chen, B., Li, L., & Wang, M. K. (2017). Cucurbitane glycosides from the fruit of Siraitia grosvenori and their effects on glucose uptake in human HepG2 cells in vitro. Food Chemistry, 228, 567–573. https://doi.org/10.1016/ j.foodchem.2017.02.018. Li, J. J., Zhao, H. B., Hu, X. Z., Shi, J. L., Shao, D. Y., & Jin, M. L. (2019). Antidiabetic effects of different polysaccharide fractions from Artemisia sphaerocephala Krasch seeds in db/db mice. Food Hydrocolloids, 91, 1–9. https://doi.org/10.1016/j.foodhyd. 2019.01.002. Li, Y., Zou, L. Y., Li, T., Lai, D. N., Wu, Y. Y., & Qin, S. (2019). Mogroside V inhibits LPSinduced COX-2 expression/ROS production and overexpression of HO-1 by blocking phosphorylation of AKT1. Acta Biochimica Et Biophysica Sinica, 51(4), 365–374. https://doi.org/10.1093/abbs/gmz014. Liang, H. (2015). Renal protective effects of a diet and exercise intervention in type 2 diabetic rats. Biological Research for Nursing, 18(1), 76–81. https://doi.org/10.1177/ 1099800415583106. Liu, Y. P., Li, Y. M., Zhang, W. L. Z., Sun, M. Z., & Zhang, Z. S. (2019). Hypoglycemic effect of inulin combined with ganoderma lucidum polysaccharides in T2DM rats. Journal of Functional Foods, 55, 381–390. https://doi.org/10.1016/j.jff.2019.02.036. Morris, M. R., Ludwar, B. C., Swingle, E., Mamo, M. N., & Shubrook, J. H. (2016). A new method to assess asymmetry in fingerprints could be used as an early indicator of type 2 diabetes mellitus. Journal of Diabetes Science and Technology, 10(4), 864–871. https://doi.org/10.1177/1932296816629984. Nie, J. R., Chang, Y. N., Li, Y. J., Zhou, Y. J., Qin, J. W., Sun, Z., & Li, H. (2017). Caffeic acid phenethyl ester (propolis extract) ameliorates insulin resistance by inhibiting JNK and NF-KB inflammatory pathways in diabetic mice and HepG2 cells models. Journal of Agricultural and Food Chemistry, 65(41), 9041–9053. https://doi.org/10. 1021/acs.jafc.7b02880. Qi, X. Y., Chen, W. J., Zhang, L. Q., & Xie, B. J. (2008). Mogrosides extract from Siraitia grosvenori scavenges free radicals in vitro and lowers oxidative stress, serum glucose, and lipid levels in alloxan-induced diabetic mice. Nutrition Research, 28(4), 278–284. https://doi.org/10.1016/j.nutres.2008.02.008. Raza, S. T., Fatima, J., Ahmed, F., Abbas, S., Zaidi, Z. H., Singh, S., & Mahdi, F. (2014). Association of angiotensin-converting enzyme (ACE) and fatty acid binding protein 2 (FABP2) genes polymorphism with type 2 diabetes mellitus in Northern India. Journal of the Renin-Angiotensin-Aldosterone System, 15(4), 572–579. https://doi.org/10. 1177/1470320313481082. Salemans, T. H., van Dieijen-Visser, M. P., & Brombacher, P. J. (1987). The value of HbA 1 and fructosamine in predicting impaired glucose tolerance-an alternative to OGTT to detect diabetes mellitus or gestational diabetes. Annals of Clinical Biochemistry, 24(5), 447–452. https://doi.org/10.1177/000456328702400504. Sato, K., Fujita, S., & Iemitsu, M. (2014). Acute administration of diosgenin or dioscorea improves hyperglycemia with increases muscular steroidogenesis in STZ-induced type 1 diabetic rats. Journal of Steroid Biochemistry and Molecular Biology, 143, 152–159. https://doi.org/10.1016/j.jsbmb.2014.02.020. Shen, Y., Lin, S. J., Han, C., Zhu, Z. O., Hou, X. D., Long, Z., & Xu, K. L. (2014). Rapid

9