Molecular and functional characterization of CD59 from Nile tilapia (Oreochromis niloticus) involved in the immune response to Streptococcus agalactiae

Fish & Shellfish Immunology 44 (2015) 50e59

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Molecular and functional characterization of CD59 from Nile tilapia (Oreochromis niloticus) involved in the immune response to Streptococcus agalactiae Zhen Gan a, b, c, 1, Bei Wang a, b, c, 1, Wei Zhou a, b, c, 1, Yishan Lu a, b, c, *, Weiwei Zhu a, b, c, Jufen Tang a, b, c, JiChang Jian a, b, c, Zaohe Wu b, c a b c

College of Fishery, Guangdong Ocean University, Zhanjiang, 524025, China Guangdong Provincial Key Laboratory of Pathogenic Biology and Epidemiology for Aquatic Economic Animals, Zhanjiang, 524025, China Key Laboratory of Control for Disease of Aquatic Animals of Guangdong Higher Education Insititutes, Zhanjiang, 524025, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 28 November 2014 Received in revised form 22 January 2015 Accepted 26 January 2015 Available online 7 February 2015

CD59, the major inhibitor of membrane attack complex, plays a crucial role in regulation of complement activation. In this paper, a CD59 gene of Nile tilapia, Oreochromis niloticus (designated as On-CD59) was cloned and its expression pattern under the stimulation of Streptococcus agalactiae was investigated. Sequence analysis showed main structural features required for complementeinhibitory activity were detected in the deduced amino acid sequence of On-CD59. In healthy Nile tilapia, the On-CD59 transcripts could be detected in all the examined tissues, with the most abundant expression in the brain. When immunized with inactivated S. agalactiae, there was a clear time-dependent expression pattern of On-CD59 in the skin, brain, head kidney, thymus and spleen, with quite different kinetic expressions. The assays for the complementeinhibitory activity suggested that recombinant On-CD59 protein had a species-selective inhibition of complement. Moreover, our works showed that recombinant On-CD59 protein may possess both binding activities to PGN and LTA and inhibiting activity of S. agalactiae. These findings indicated that On-CD59 may play important roles in the immune response to S. agalactiae in Nile tilapia. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Oreochromis niloticus CD59 Streptococcus agalactiae Complement-inhibitory activity Antimicrobial activity

1. Introduction The complement system, which is involved in both innate and adaptive immune responses, plays a critical role in host defense [1,2]. There exist three major pathways to activate the complement system: the classical, the alternative and the lectin pathways [3]. Activation through either pathway eventually initiates the terminal pathway involving the formation of membrane attack complex (MAC, C5b-9), which leads to complement-mediated lysis [4,5]. Given the potency of the complement system, its activation has the potential to cause unwanted inflammation on host tissue [6]. To protect self-cells against autologous complement attack, activation

* Corresponding author. College of Fishery, Guangdong Ocean University, No. 40 of East Jiefang Road, Xiashan District, Zhanjiang, Guangdong Province, 524025, China. Tel./fax: þ86 759 2383507. E-mail address: fi[email protected] (Y. Lu). 1 These authors contributed to the work equally and should be regarded as cofirst authors. http://dx.doi.org/10.1016/j.fsi.2015.01.035 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

of the complement system is tightly regulated by a group of regulatory proteins [7]. Among the various complement regulators, CD59 is a major membrane regulator which can interfere with the formation of MAC by inhibiting the binding of C9 to the C5b-8 complex [8,9]. CD59 is a small (18e20 kDa) and widely distributed glycoprotein attached to the cell membrane phospholipids via a glycosylphosphatidyl inositol (GPI) anchor [10]. From an evolutionary point of view, CD59 belongs to the leukocyte antigen 6 (Ly-6) family of proteins, which share a similar “three finger” structure maintained by 5 disulfide bonds formed by 10 cysteine residues [11]. It has been shown that the disulfide structures of CD59 are necessary for its complement inhibitory function [12]. In addition, the members of Ly-6 family, including CD59, all possess the consensus sequence motif CCXXXXCN at the C-terminal end [13]. Interestingly, accumulating data indicate that CD59 exhibits various roles independent of its function as a complement inhibitor [14]. For example, CD59 on human T cells functions as a costimulatory molecule to induce T-cell proliferation [15], but CD59 of

Z. Gan et al. / Fish & Shellfish Immunology 44 (2015) 50e59

mice has been shown to be a negative regulator of T-cell activity [16]. It is noteworthy that multiple CD59 genes in one species were found, such as mouse [17] and rainbow trout [11]. In mouse, the two CD59 isotypes showed different biological activities [18e21]. CD59 has been identified from various mammalian species and its functions have been well characterized [22e25], but little information is available to date regarding fish CD59. CD59 has only been cloned from a few species of teleosts including rainbow trout Oncorhynchus mykiss [11], large yellow croaker Pseudosciana crocea [26], channel catfish Ictalurus punctatus [27] and zebrafish Danio rerio [13], and the study of fish CD59 functional properties is rather limited. Nile tilapia (Oreochromis niloticus) is one of the most important economical fish and widely cultured throughout the world. In recent years, infectious disease caused by Streptococcus agalactiae has been severe, resulting in great economic loss and threatening the development of Nile tilapia aquaculture. Because of its high commercial interest, extensive researches on the diseases which caused high mortality were carried out, and S. agalactiae was confirmed as its main causative agent [28e30]. However, fewer studies focused on the genome of Nile tilapia, especially in the area of the complement system [31]. In this study, a CD59 gene (OnCD59) was cloned from Nile tilapia, O. niloticus, and its tissue distribution, expression profile in response to S. agalactiae stimulus and functional properties were investigated. The present results contribute to better understanding of the mechanism of the complement system response to bacteria in Nile tilapia. 2. Materials and methods 2.1. Fish and immunization Samples of Nile tilapia (average weight of 100 ± 10 g) were obtained from a commercial farm in Zhanjiang, Guangdong province, China. Prior to experiments, fish were acclimated in fiberreinforced plastic tanks (1000 L each) with a stocking rate of 4 g L1 under 28 ± 2  C for 4 weeks. All tanks were supplied with flow-through aerated sand-filtered water, and a light and dark period of 12 h: 12 h was maintained. S. agalactiae ZQ0910, a virulent strain isolated from Nile tilapia was used for immunostimulus [32]. The immunostimulation experiment was performed by injecting the Nile tilapia with 0.1 ml of formalin-inactivated bacteria resuspended in sterilized PBS with the concentration of 1  107 cells ml1 into the abdominal cavity and the Nile tilapia injected with 0.1 ml of sterilized phosphate buffered saline (PBS) were used as the control group. Then all processed Nile tilapia were returned to tanks and treated as before. At time points of 0 h, 4 h, 8 h, 12 h, 24 h, 48 h, 72 h and 96 h post-immunization, nine kinds of tissues from the brain, head kidney, thymus, spleen, liver, muscle, skin, gill and intestine were collected from the control and vaccinated groups, and immediately frozen by liquid nitrogen, followed by storage at 80  C until used. Tissues from three individuals were collected and pooled together as a replicate sample, and three replicates were taken for each sampling time point. All experiments were conducted according to the principles and procedures of the Laboratory Animal Management Ordinance of China. 2.2. Cloning of cDNA for On-CD59 All PCR primers used in this study were summarized in Table 1. Total RNA from brain was extracted using Trizol Reagent (Invitrogen, USA) as described in the manufacturer's instructions. The first-strand cDNA was synthesized from the previous total RNA using the Reverse Transcriptase M-MLV (TaKaRa, Japan) according to the manufacturer's protocol and served as a template to amplify

51

On-CD59 partial cDNA sequence by PCR using specific primers designed from our previous study on Nile tilapia transcriptome data (unpublished). To amplify the full-length sequence of OnCD59, the first-strand cDNA for 50 /30 RACE (rapid amplification of cDNA ends) was synthesized with a SMARTer™ RACE cDNA Amplification Kit (Clontech, USA) using brain RNA as the template and following the manufacturer's protocol. The full-length cDNA of On-CD59 was obtained by using 50 /30 RACE methods with some gene specific primers designed based on the obtained cDNA partial sequences of On-CD59. All the PCR products were ligated into the pMD18-T vector (TaKaRa, Japan) and transformed into competent Escherichia coli DH5a cells. Then the positive clones were sequenced by sequenced SANGON BIOTECH (Shanghai, China). Finally, the partial sequence, 30 end and 50 end were assembled using contigExpress application software. 2.3. Bioinformatics analysis of On-CD59 The potential open reading frame (ORF) was analyzed with the ORF Finder program (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The protein analysis was conducted with ExPASy tools (http://expasy.org/ tools/). Location of domains was predicted using the InterProScan program (http://www.ebi.ac.uk/Tools/pfa/iprscan/). The similarity analyses of the determined nucleotide sequences and deduced amino acid sequences were performed by BLAST programs (http://blast.ncbi. nlm.nih.gov/Blast.cgi). Multiple alignments of On-CD59 amino acid sequences were performed with the Clustalw2 program (http://www. ebi.ac.uk/Tools/clustalw2/). Phylogenic trees were constructed by the neighbor-joining method using MEGA 4 software with 1000 bootstrap replications. The three-dimensional structure prediction was performed by SWISS-MODEL online software at the Expert Protein Analysis System (http://www.expasy.org/). 2.4. Quantitative analysis of On-CD59 mRNA expression The differential expression levels of On-CD59 in pre- and postimmunized tissues were measured by fluorescent quantitative real-time PCR using gene-specific primers (Table 1). The first-strand cDNA was synthesized from the DNase treated total RNA using the Reverse Transcriptase M-MLV (TaKaRa, Japan) according to the manufacturer's protocol. The b-actin gene was used as an internal control to normalize the potential variations in RNA loading. The relative expression levels of On-CD59 were calculated using Nile tilapia b-actin expression as a reference, and the results were further compared to respective control group expression levels to determine the fold induction. The PCR was performed in a 25 mL reaction volume containing 0.5 mL of each primer (10 mM), 2 mL of 101 diluted cDNA, 12.5 mL of 2  TransStart™ Green qPCR SuperMix (TransGen, China) and 9.5 mL PCR-grade water. The PCR amplification procedure was 95  C for 4 min, followed by 40 cycles of 95  C for 20 s, 56  C for 20 s and 72  C for 20 s. Melt curve analysis of amplification products was performed over a range of 70e95  C at the end of each PCR reaction aiming to confirm single product generation. Samples were run in triplicate on the Bio-Rad iQ5 Realtime PCR System (Bio-Rad, USA). The relative expression levels of On-CD59 were calculated by means of the 2DDCt method. All quantitative data were presented as the means ± standard deviation (SD). Statistical analysis was performed using SPSS statistics 17.0 software. A p-value less than 0.05 was considered to be significant. 2.5. Expression and purification of recombinant On-CD59 (rOnCD59) The cDNA region encoding the mature peptide (amino acid residues 22e93) of On-CD59 was amplified by PCR with specific

52

Z. Gan et al. / Fish & Shellfish Immunology 44 (2015) 50e59 Table 1 PCR primers used in this study. Primers

Sequence 50 /30

Purpose

CD59-F CD59-R Long Short NUP CD59-P1 CD59-P2 CD59-SP1 CD59-SP2 CD59-QS CD59-QA b-actin-S b-actin-A CD59-YS CD59-YA

CGTGGACCTGCTCTGTTA TGTGATGCGTCTTTGCTG CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGTACT(30)VN ATGACGACGCCTGCCTCACGCTC CTGACCTGTGTAACTCCGCCCCC AGGAGGGGGCGGAGTTACACAGG GTAAAACTGGAAACCTGGGGGAA CCCCAGGCTTCCAGTTTT TGCACCACCACATGACCG AACAACCACACACCACACATTTC TGTCTCCTTCATCGTTCCAGTTT CGCGGATCCCGCTGTTACAGGTGTAAGGA CCGCTCGAGTCAGTGGATGCACCACCACA

Partial cloning

primers, CD59-YS and CD59-YA (Table 1). The PCR product was digested with BamH I and Xho I, and subcloned into the plasmid expression vector pET-32a (þ) (Novagen, USA). The recombinant E. coli BL21 (DE3) was cultured in LB-ampicillin at 18  C with shaking at 150 rpm. When the culture medium reached an OD600 of 0.4e0.6, isopropyl-b-D-thiogalactopyranoside (IPTG) was then added to the medium to a final concentration of 0.2 mM and incubated for another 12 h optimal time. Recombinant protein in the culture supernatant was purified using the HisTrap affinity columns (GE Healthcare, USA) according to the manufacture's instructions. Purified protein was dialyzed in PBS and concentrated with Amicon Ultra Centrifugal Filter Devices (Millipore, USA). The purified protein was analyzed by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE). The protein concentration was measured through Braford Protein Assay kit (KeyGEN, China). Histidine-tagged thioredoxin protein (TRX), which was produced from the expression vector pET-32a (þ), was expressed in the same system and purified as a control protein. 2.6. Western blotting The purified recombinant On-CD59 (rOn-CD59) and the extracts from E. coli BL21 (DE3) containing pET-32a/CD59 expression vector before IPTG induction were run on a 12% SDSePAGE gel. The proteins on the gel were electroblotted onto PVDF membrane by a semi-dry technique. The blotted membranes were blocked with 4% BSA in 10 mM PBS (pH 7.4) at room temperature for 2 h, and then incubated in the mouse anti-His-tag antibody (CWBIO, China) diluted 1:2000 with 10 mM PBS (pH 7.4) at 4  C overnight. After washing in 10 mM PBS (pH 7.4) containing 0.1% Tween-20, the membranes were incubated in horseradish peroxidase (HRP)labeled goat anti-mouse IgG (CWBIO, China) diluted 1:5000 at room temperature for 3 h. The bands were visualized using DAB and 0.03% H2O2.

30 RACE and 50 RACE

30 RACE 50 RACE RT-PCR and real-time PCR

Expression of recombinant CD59

methods described by Li et al. [33]. Four days after the last injection, the rabbit was exsanguinated and antiserum was collected. The complement component in antiserum was inactivated by incubating at 56  C for 30 min. The IgG fraction of antiserum was then purified by protein A-Sepharose Fast Flow (GE Healthcare, USA). After determining the titre by ELISA (1:50000), antibody against red cells was stored at 80  C. 2.8. Assays for the complementeinhibitory activity of rOn-CD59 In order to investigate the complementeinhibitory activity of rOn-CD59, an in vitro lytic reaction of red cells from Nile tilapia was designed based on the classical pathway according to the methods described by Liu et al. [26]. Cellular membrane of red cells would be damaged and the absorbency of reaction solution would ascend when extrinsic complement was activated by antibody against tilapia red cells. Therefore inhibition of complement activation could be determined by measuring the absorbency of each reaction while rOn-CD59 protein at different final concentration was appended into the reaction system. The reaction system consisted of 100 mL 2% red cell suspension above, 100 mL serum (1:50 dilution) from tilapia and mouse, 100 mL antibodies against tilapia red cells (1:50000) and rOn-CD59 protein with a final concentration of 0, 50, 100, 150, 200, 250 and 300 mg/ml, respectively. Total volume of 500 mL was made in a 1.5 ml sterile eppendorf tube by appending reaction buffer. The reaction system was incubated for 30 min at 37  C and then the absorbency of 100 mL of reaction solution from individual reaction tube was measured at 415 nm by a microplate reader. Percent lysis mediated by complement was then calculated as follows: [absorbency415 (appending of rOn-CD59)/absorbency415 (absence of rOn-CD59)]. Histidine-tagged TRX was added to the reaction system above at the same final concentration as a control. All assays were performed in triplicate. 2.9. Assays for binding of rOn-CD59 to PGN and LTA

2.7. Preparation of antibody against Nile tilapia red cells Nile tilapia red cells were obtained from blood of three fish in an equal volume Alsever's solution (75 mM NaCl, 25 mM sodium citrate, 110 mM glucose, pH 6.1). Red cells were washed three times using a cold reaction buffer (150 mM NaCl, 5 mM Na2HPO4, 1 mM KH2PO4 and 0.01% MgCl2) and collected by 5 min centrifugation at 2000 rpm each time. Stacked red cells were diluted into 2% red cell suspension (107 cell ml1) with the reaction buffer above and stored at 4  C. Antibody against red cells was prepared by immunizing a rabbit. The rabbit was injected intraperitoneally using 2% stacked red cells for four times (1 ml/time) according to the

To test the binding of rOn-CD59 to peptidoglycan (PGN) and Lipoteichoic acid (LTA), rOn-CD59 and histidine-tagged TRX were individually biotinylated with biotinamidohexanoic acid Nhydroxysuccinimide ester (NHS-LC-biotin) according to the methods in Ref. [34]. In brief, 100 mL of 2 mg/ml NHS-LC-biotin was mixed with 1 ml of rOn-CD59 (0.8 mg/ml) or histidine-tagged TRX (0.8 mg/ml) solution, incubated at 25  C for 2 h, and then 20 mL of 0.5 M NH4Cl was added to the mixtures to inactivate the uncombined biotin. The uncombined biotin was removed by ultrafiltration. 50 mL PGN and LTA (80 mg/ml; Sigma, USA) in 10 mM PBS (pH 7.4) was applied to each well of a 96-well microplate and air-dried

Z. Gan et al. / Fish & Shellfish Immunology 44 (2015) 50e59

at 25  C overnight. The plate was incubated at 60  C for 30 min to further fix PGN and LTA, and the wells were each blocked with 200 mL of 1 mg/ml BSA in 10 mM PBS (pH 7.4) at 37  C for 2 h. After washing four times with 200 mL of 10 mM PBS supplemented with 0.5% Tween-20, 50 mL of biotinylated rOn-CD59 or histidine-tagged TRX (0, 5, 10, 20, 40, 80, 100, 160, 200 and 300 mg/ml) was added to each well. After incubation at room temperature for 3 h, the wells were each rinsed four times with 200 mL of 10 mM PBS supplemented with 0.5% Tween-20, and 100 mL of streptavidin-HRP (BOSTER, China) diluted to 1:5000 with 10 mM PBS (pH 7.4) containing 1 mg/ml BSA was added to each well. After incubation at room temperature for 1 h, the wells were washed four times with 200 mL of 10 mM PBS supplemented with 0.5% Tween-20, added with 75 mL of 0.4 mg/ml O-phenylenediamine in the buffer consisting of 51.4 mM Na2HPO4, 24.3 mM citric acid, and 0.045% H2O2 (pH 5.0) and reacted at 37  C for 5e30 min. Subsequently, 25 mL of 2 M H2SO4 was added to each well to terminate the reaction, and absorbance at 492 nm was monitored by a microplate reader. All assays were performed in triplicate.

53

the 5 intrachain disulfide bonds were identified in the predicted On-CD59 protein (Fig. 1). The BLAST analysis and multiple sequence alignment of On-CD59 revealed that although the overall sequence homology of the CD59 proteins from different species was relatively poor, above important structural characteristics were highly conserved from fish to mammals (Fig. 2A). To clarify the evolutionary position of On-CD59, we constructed a phylogenetic tree using the sequence of On-CD59 as well as the CD59 proteins available. As shown in Fig. 2B, all fish CD59 proteins including OnCD59 were grouped together with amphibian CD59, forming an independent clade branched from mammalian and avian counterparts. This well reflected the established phylogeny of chosen organisms. Using the SWISS-MODEL online software, we predicted the three-dimensional (3D) structures of both human CD59 and tilapia CD59, revealing that they share a similar 3D structure, which both includes two-stranded b-sheet finger and a protein core formed by three-stranded b-sheet finger and a short helix (Fig. 2C).

3.2. Expression profiles of On-CD59 2.10. Assay for antimicrobial activity against S. agalactiae of rOnCD59

Fluorescent quantitative real-time PCR was used to examine the differential expression of On-CD59 mRNA. In healthy Nile tilapia,

To examine if rOn-CD59 has antimicrobial activity against S. agalactiae, the colony-forming unit assay was carried out according to the methods in Ref. [35]. In brief, S. agalactiae grown in Brain Heart Infusion (BHI) broth for 6 h, and harvested by centrifugation at 4000 g for 5 min. The bacterial pellets were resuspended in PBS and diluted to a density of 2  105 cells ml1. The purified rOn-CD59 or histidine-tagged TRX (as a negative control) was filtered through 0.22 mm Millipore paper, and diluted with PBS, giving different concentrations of 0 (as a blank control), 50, 100, 200, 400 and 800 mg/ml. An aliquot of 990 mL of each rOn-CD59 or histidine-tagged TRX solution was mixed with 10 mL of the bacterial suspensions, and the mixtures were pre-incubated at 37  C for 60 min. Each mixture was then plated onto three BHI agar plates (100 mL/plate). After incubation at 37  C for 16 h, the resulting bacterial colonies in each plate were counted. The percent of bacterial growth inhibition by rOn-CD59 was calculated as follows: [number of colonies (blank control-test)/number of colonies (blank control)] (n ¼ 3). 3. Results 3.1. Cloning and sequence analysis of On-CD59 The PCR product amplified by the primers CD59-F/CD59-R was 712 bp, and this fragment showed high homology to other known CD59 nucleotide sequences. The specific primers CD59-P1 and CD59-P2 designed from the above sequence were used to amplify the 30 end of CD59 and then a 848 bp fragment was obtained. A 319 bp nucleotide sequence was obtained using 50 RACE with specific primers CD59-SP1 and CD59-SP2. All of these fragments were assembled to form a continuous sequence of 1176 bp. This sequence was submitted to GenBank under the accession NO. KM823662. The full length CD59 cDNA contained a 50 -untranslated region (UTR) of 74 bp, a 30 -UTR of 748 bp and an open reading frame (ORF) of 354 bp encoding a protein of 117 amino acids with a calculated molecular weight of 12.97 kDa and a theoretical isoelectric point of 8.23. Five important structural characteristics of the known CD59 proteins, including a putative hydrophobic signal peptide at the Nterminus, an LU domain with the consensus motif CCXXXXCN of the Ly-6 superfamily, a putative GPI-anchoring region at the Cterminus, and 10 cysteine residues that are involved in formation of

Fig. 1. The full-length sequence and deduced amino acid sequence of On-CD59. Nucleotides are numbered in the 50 e30 direction. The derived amino acid sequence is shown underneath the nucleotide sequence using single-letter codes. The stop codon is indicated by an asterisk. The putative signal peptide is underlined, and the GPIanchor region is double underlined. The borders of LU domains are shown by arrows. Circle indicates Ser as the residue for GPI-anchor attachment. Box indicates the consensus sequence motif CCXXXXCN of the Ly-6 superfamily. The conserved cysteine residues of On-CD59 are shown by triangles.

Fig. 2. (A) Multiple alignments of CD59 amino acid sequence of O. niloticus with other species. The GenBank accession numbers of the CD59 are as follows: Oncorhynchus mykiss: AAT94063.1; Danio rerio: XP_005169083.1; Larimichthys crocea: ABG37787.1; Homo sapiens: CAG46523.1; Mus musculus: NP_862906.1; Xenopus tropicalis: XP_004913415.1. (B) Phylogenetic tree of CD59 family members constructed by neighbor-joining method. Numbers at each branch indicated the percentage bootstrap values on 1000 replicates. The species names and the GenBank accession numbers are as follows: Oncorhynchus mykiss: AAT94063.1; Danio rerio: XP_005169083.1; Larimichthys crocea: ABG37787.1; Homo sapiens: CAG46523.1; Mus musculus: NP_862906.1; Xenopus tropicalis: XP_004913415.1; Ictalurus punctatus: ABI18969.1; Pan troglodytes: JAA32635.1; Rattus norvegicus: AAA88909.1; Bos taurus: XP_005216431.1; Sus scrofa: AAC67231.1; Anas platyrhynchos: XP_005022853.1; Crotalus horridus: JAA97471. (C) The three dimensional structures of H. sapiens and O. niloticus CD59. This diagram was generated by SWISS-MODEL online software. a-helix residues are colored with red, b-sheet residues with yellow, and loop and unassigned residues with green. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Z. Gan et al. / Fish & Shellfish Immunology 44 (2015) 50e59

the On-CD59 mRNA expression could be detected in all the examined tissues, with the most abundant expression in the brain. After vaccinated with inactivated S. agalactiae 24 h later, the On-CD59 mRNA expression was significantly up-regulated in the skin, brain, head kidney, thymus and spleen (Fig. 3). Moreover, a clear time-dependent expression pattern of On-CD59 was observed in the skin, brain, head kidney, thymus and spleen after immunization. The On-CD59 expression level reached its peak at time points of 12 h in the skin, 24 h in the brain and head kidney, and 48 h in the thymus and spleen, respectively, and then dropped gradually but still higher than the control level (Fig. 4). 3.3. Expression and purification of rOn-CD59 An expression vector, including the cDNA encoding the mature peptide of On-CD59, was constructed and successfully transformed into E. coli BL21 (DE3). The recombinant protein with the His-tag was induced by IPTG and was purified by affinity chromatography on a Ni-nitrilotriacetic acid resin column. Purified recombinant OnCD59 yielded a single band of approximately 29 kDa on SDSePAGE gel after Coomassie blue staining, corresponding to the expected size (Fig. 5). Western blotting analysis showed that the purified protein reacted with mouse anti-His-tag antibody, indicating that On-CD59 was correctly expressed (Fig. 5). 3.4. The complementeinhibitory activity of rOn-CD59 To confirm the complementeinhibitory activity of rOn-CD59, an in vitro hemolytic system based on the classical pathway was established. As shown in Fig. 6, while the final concentration of rOn-CD59 in reaction tubes gradually increased, the corresponding percent lysis of red cell descended, indicating that the lysis of red cells mediated by serum from tilapia was markedly inhibited by rOn-CD59. However, histidine-tagged TRX in the same expression system was not shown to inhibit the lysis of red cell mediated by serum from rOn-CD59. In addition, the sera from mouse were used to initiate the red cell lysis in respective hemolytic system. When rOn-CD59 or histidine-tagged TRX was added into the reactive system at same concentration as above, no marked inhibition of red cell lysis was observed, suggesting that rOn-CD59 could not block the red cell lysis mediated by complement from mouse. 3.5. Binding of rOn-CD59 to PGN and LTA Previous studies have shown that fish CD59 could bind to both the Gram-negative and Gram-positive bacteria [13]. To better understanding the mechanism by which fish CD59 molecules bind to Gram-positive bacteria, an ELISA was performed to test if rOn-CD59

55

could recognize PGN and LTA. The results showed that rOn-CD59 was able to bind to PGN and LTA in a dose-dependent manner. By contrast, histidine-tagged TRX used as negative control did not bind to either PGN or LTA (Fig. 7). 3.6. Antimicrobial activity against S. agalactiae of rOn-CD59 To better understanding of the mechanism of On-CD59 immune response to S. agalactiae, we examined the antimicrobial activity of rOn-CD59 against S. agalactiae by colony-forming unit assay. As shown in Table 2, rOn-CD59 was able to inhibit the growth of S. agalactiae at concentrations of 100 mg/ml or above. When the concentration of rOn-CD59 was lower than 100 mg/ml, it did not suppress the growth of S. agalactiae at all; instead, it could promote the growth of S. agalactiae (possibly as a nutrient). By contrast, histidine-tagged TRX used as negative control was not able to inhibit the growth of S. agalactiae. These data showed that rOnCD59 was slightly antimicrobial and capable of inhibiting the growth of S. agalactiae in vitro. 4. Discussion Nile tilapia is one of the most important economical fishes and frequently subjected to disease in recent years, which becomes a big obstacle to Nile tilapia aquaculture [36]. To understand the immune system and immune response against infection is useful for enhancing the immunity of cultured fish, which now becomes more and more important in aquatic research [37e39]. CD59, functioning as a complement inhibitor and T-cell regulator, plays a crucial role in both innate and adaptive immune responses [8,9,15,16]. CD59 proteins have been identified from teleosts such as rainbow trout [11], large yellow croaker [26], channel catfish [27] and zebrafish [13], but no information is available to date about CD59 in Nile tilapia. In this study, we cloned and sequenced the complete cDNA sequences of CD59 from the Nile tilapia. We found that the deduced amino acid sequence of On-CD59 contains five main structural features of known CD59 proteins, including a putative hydrophobic signal peptide, an LU domain with the CCXXXXCN motif, a putative GPI-anchoring region, and 10 cysteine residues. Because LU domain and 10 cysteine residues of CD59 are necessary for its function [12], On-CD59 may, like mammalian CD59, possess similar function to inhibit complement, which is supported by assays for the complementeinhibitory activity that are discussed below. In healthy Nile tilapia, the mRNA expression level of CD59 in the brain was far higher than other examined tissues. This phenomenon could be possibly associated with the negative regulation of the complement system in the brain. In mammals, the complement

Fig. 3. CD59 mRNA levels in different tissues of healthy and vaccinated (24 h later) O. niloticus determined by quantitative real-time PCR. The values are shown as means ± S.D. Significant difference was indicated by asterisks, *: 0.05 > p > 0.01, **: p < 0.01.

56

Z. Gan et al. / Fish & Shellfish Immunology 44 (2015) 50e59

Fig. 5. Expression and purification of recombinant On-CD59. Lane M: protein molecular standard; Lane 1: pET-32a-On-CD59 in BL21(DE3), non-IPTG-induced; Lane 2: pET-32a-On-CD59 in BL21(DE3), IPTG-induced for 12 h; Lane 3: Supernatant of pET32a-On-CD59 in BL21(DE3) lysate; Lane 4: Purified supernatant of pET-32a-On-CD59 in BL21(DE3) lysate. Lane 5: purified rOn-CD59 was subjected to 12% SDS-PAGE and detected by mouse anti-His-tag antibody; Lane 6: pET-32a-On-CD59 in BL21(DE3) before IPTG induction was subjected to 12% SDS-PAGE and detected by mouse anti-Histag antibody.

Interestingly, after vaccinated of Nile tilapia with inactivation S. agalactiae, there was a clear time-dependent expression pattern of On-CD59 in the skin, brain, head kidney, thymus and spleen, with quite different kinetic expressions. In the skin, the mRNA expression level of On-CD59 was up-regulated immediately and reached its peak at 12 h after immunization. This result might be explained by complement-mediated mucosal defense mechanisms. Fish live in aquatic environments, and the mucosal immune system is the

Fig. 4. Temporal expression of CD59 in skin (A), brain (B), head kidney (C), thymus (D) and spleen (E) of O. niloticus after immunization measured by quantitative real-time PCR. The values are shown as means ± S.D. Significant difference was indicated by asterisks, *: 0.05 > p > 0.01, **: p < 0.01.

system has been implicated for a decade of brain injury by contributing to neuroinflammation and secondary neuronal cell death [40]. To protecting from homologous cell lysis in brain injury, CD59 is constitutively expressed in neurons, interfering with the formation of MAC and thus inhibiting complement activation [20,41,42]. Therefore, localization of On-CD59 in the brain may contribute to protecting the brain, the most complex and important organ in fish, from autologous complement damage.

Fig. 6. Complement-inhibitory activity of rOn-CD59 based on the classic pathway. Each of reaction system consisted of tilapia red cell suspension, antibody against tilapia red cell, serum from tilapia (A) or mouse (B), and rOn-CD59 or his-tagged TRX (as a control). Points represent the means of triplicate determinations ± S.D.s.

Z. Gan et al. / Fish & Shellfish Immunology 44 (2015) 50e59

Fig. 7. Binding of rOn-CD59 with PGN (A) and LTA (B). His-tagged TRX instead of rOnCD59 was used as control. Points represent the means of triplicate determinations ± S.D.s.

first barrier to resist the invasion of pathogens by the fastest immune responses. It is well-known that fish mucosal secretions carry a wide variety of complement molecules, which play critical roles in the elimination of pathogens [43,44]. These complement components are abundant at mucosal surfaces and their interaction with pathogens is highly regulated to avoid hyper reaction [43,44]. Therefore, our data indicated that On-CD59 in the skin may play a critical role in regulating mucosal immune responses mediated by complement. With a similar expression pattern, the mRNA expression of OnCD59 in the brain and head kidney was up-regulated to the highest level at 24 h post-immunization, and the time point of reaching its peak was a little later than it in the skin. This finding could be possibly associated with infection with S. agalactiae, which is a major cause of acute meningoencephalitis and septicemia with high mortality in fish. The brain and head kidney are the main target organs attacked by S. agalactiae [45,46], and it has been shown that S. agalactiae can survive inside brain microvascular endothelial cell (BMEC) and macrophage, which may induce complement-mediated lysis of the organism to kill the infected cells [47e49]. Therefore, in the brain and head kidney, the increasing expression of On-CD59 in the early period after immunization demonstrated On-CD59 may protect the healthy cells against autologous complement-mediated lysis caused by S. agalactiae acute infection. In mammals, CD59 exhibits various roles independent of its function as a complement regulator, such as triggering the signal

Table 2 Antimicrobial activity of rOn-CD59 against S. agalactiae. Concentration (mg/ml)

50 100 200 400 800

Inhibition rate (%) rOn-CD59

His-tagged TRX

13.7 11.5 28.1 36.6 44.2

17.4 18.7 20.5 21.2 21.8

57

transduction pathways of T-cell activation [14]. Functioning as a costimulatory molecule, human CD59 can accelerate production of IL-2, which is the most important cytokine to promote proliferation and differentiation of T-cell [15,50]. Previous studies indicate that the capacity to modulate IL-2 expression is a primordial function that has been conserved in both fish and mammals costimulatory molecules [51e53], suggesting On-CD59 may also possess similar function to activate T-cell. This hypothesis was supporting by distinct kinetic expressions of On-CD59 in the thymus and spleen. In teleost, thymus and spleen, known as the sites of lymphopoiesis, are closely related to T-cell signal pathways [54e57]. Contrary to the increasing expression in the skin, brain and head kidney, the mRNA expression of On-CD59 in the thymus and spleen was downregulated in the time of 0e8 h, implying a possible suppression of T-cell activation pathway in the early period of bacterial infection [58]. After immunization 24 h, 48 h and 72 h later, the mRNA expression of On-CD59 was significantly up-regulated in the thymus and spleen, which indicated that immunization can improve the expression of On-CD59 in the thymus and spleen and may enhance the ability of fish defending against S. agalactiae intracellular infection via promoting T-cell immunity. Recent progress in evolutionary immunology supports the notion that the main components and functional properties of the complement system are highly conserved in vertebrates [43,59]. Inspired by this hypothesis, recombinant On-CD59 protein produced in E. coli was used to examine its complementeinhibitory activity in an in vitro hemolytic system based on the classical pathway. Interestingly, rOn-CD59 protein was shown to significantly inhibit the lysis of tilapia red cells when tilapia serum was used as a source of complement. However, no marked inhibition of red cell lysis was observed in the reaction system where mouse serum was used to initiate a hemolytic reaction. In mammals, an important functional feature of CD59 is its species selectivity, which is responsible for the homologous restriction of CD59 activity. Both pig and human CD59 were identified to be very effective at inhibiting pig, human, and sheep complement, but less effective at inhibiting rodent complement [60]. The interaction between human CD59 and C9 has been linked to the variable region residues 42e58, which exhibits the least homology between species and is responsible for its species selective inhibition of complement [61,62]. In this study, we demonstrated that rOn-CD59 protein significantly inhibited lytic activity of complement from tilapia, but not from mouse, indicating that On-CD59 is not only a functional analogue of mammalian CD59, but also has a species selective inhibition of complement. However, the residues conferring species selectivity of On-CD59 need to be identified further. Apart from binding to complement molecules C9 and C8a, other interesting topic about CD59 binding properties is its interaction with bacteria and their functional components, which is relatively poor understanding. In the absence of CD14, human CD59 was found to possess Lipopolysaccharide (LPS) binding properties [63]. Zebrafish CD59 can bind to E. coli and Staphylococcus aureus and inhibit their growth [13]. Our works showed that On-CD59 could not only bind to both PGN and LTA, but also had slight antimicrobial activity capable of inhibiting the growth of S. agalactiae. Given PGN and LTA are two main signature molecules in cell wall of S. agalactiae [46,64,65], these data indicated that when tilapia is infected by S. agalactiae, On-CD59 may identify and trap S. agalactiae by binding to its PGN and LTA, and inhibit their growth. 5. Conclusion In conclusion, a CD59 gene (On-CD59) was cloned from Nile tilapia successfully. On-CD59 contained main structural features required for complementeinhibitory activity, which were highly

58

Z. Gan et al. / Fish & Shellfish Immunology 44 (2015) 50e59

conserved in known CD59 genes. Quantitative RT-PCR analysis revealed that On-CD59 was expressed strongly in the brain and responded to S. agalactiae stimulus. The assays for the complementeinhibitory activity suggest that On-CD59 may have a species-selective inhibition of complement. Moreover, On-CD59 may play complement-independent roles via showing it possesses both binding activities to PGN and LTA and inhibiting activity of S. agalactiae. Our findings will provide some reference for further exploration of complement system in teleost.

[23]

Acknowledgments

[26]

We thank all the laboratory members for their critical reviews and comments on this manuscript. We are especially grateful for the critical comments from the anonymous reviewers. This work was supported by research grants (No. 31302226, No. 2012B020308009) from the National Natural Science Foundation of China and Science & Technology Planning Project of Guangdong Province of China. References [1] Dunkelberger JR, Song WC. Complement and its role in innate and adaptive immune responses. Cell Res 2010;20:34e50. [2] Wills-Karp M. Complement activation pathways: a bridge between innate and adaptive immune responses in asthma. Proc Am Thorac Soc 2007;4:247e51. [3] Sarma JV, Ward PA. The complement system. Cell Tissue Res 2011;343: 227e35. [4] Rojana-udomsart A, Mitrpant C, Bundell C, Price L, Luo YB, Fabian V, et al. Complement-mediated muscle cell lysis: a possible mechanism of myonecrosis in anti-SRP associated necrotizing myopathy (ASANM). J Neuroimmunol 2013;264:65e70. [5] Tegla CA, Cudrici C, Patel S, Trippe 3rd R, Rus V, Niculescu F, et al. Membrane attack by complement: the assembly and biology of terminal complement complexes. Immunol Res 2011;51:45e60. [6] Radu RA, Hu J, Yuan Q, Welch DL, Makshanoff J, Lloyd M, et al. Complement system dysregulation and inflammation in the retinal pigment epithelium of a mouse model for stargardt macular degeneration. J Biol Chem 2011;286: 18593e601. [7] Zipfel PF, Skerka C. Complement regulators and inhibitory proteins. Nat Rev Immunol 2009;9:729e40. [8] Huang Y, Qiao F, Abagyan R, Hazard S, Tomlinson S. Defining the CD59-C9 binding interaction. J Biol Chem 2006;281:27398e404. [9] Wu G, Hu W, Shahsafaei A, Song W, Dobarro M, Sukhova GK, et al. Complement regulator CD59 protects against atherosclerosis by restricting the formation of complement membrane attack complex. Circ Res 2009;104:550e8. [10] Davies A, Lachmann PJ. Membrane defence against complement lysis: the structure and biological properties of CD59. Immunol Res 1993;12:258e75. [11] Papanastasiou AD, Georgaka E, Zarkadis IK. Cloning of a CD59-like gene in rainbow trout. Expression and phylogenetic analysis of two isoforms. Mol Immunol 2007;44:1300e6. [12] Petranka J, Zhao J, Norris J, Tweedy NB, Ware RE, Sims PJ, et al. Structurefunction relationships of the complement regulatory protein, CD59. Blood Cells Mol Dis 1996;22:281e96. [13] Sun C, Wu J, Liu S, Li H, Zhang S. Zebrafish CD59 has both bacterial-binding and inhibiting activities. Dev Comp Immunol 2013;41:178e88. [14] Kimberley FC, Sivasankar B, Paul Morgan B. Alternative roles for CD59. Mol Immunol 2007;44:73e81. [15] Korty PE, Brando C, Shevach EM. CD59 functions as a signal-transducing molecule for human T cell activation. J Immunol 1991;146:4092e8. [16] Longhi MP, Sivasankar B, Omidvar N, Morgan BP, Gallimore A. Cutting edge: murine CD59a modulates antiviral CD4þ T cell activity in a complementindependent manner. J Immunol 2005;175:7098e102. [17] Qin X, Miwa T, Aktas H, Gao M, Lee C, Qian YM, et al. Genomic structure, functional comparison, and tissue distribution of mouse Cd59a and Cd59b. Mamm Genome 2001;12:582e9. [18] Baalasubramanian S, Harris CL, Donev RM, Mizuno M, Omidvar N, Song WC, et al. CD59a is the primary regulator of membrane attack complex assembly in the mouse. J Immunol 2004;173:3684e92. [19] Donev RM, Sivasankar B, Mizuno M, Morgan BP. The mouse complement regulator CD59b is significantly expressed only in testis and plays roles in sperm acrosome activation and motility. Mol Immunol 2008;45:534e42. [20] Harhausen D, Khojasteh U, Stahel PF, Morgan BP, Nietfeld W, Dirnagl U, et al. Membrane attack complex inhibitor CD59a protects against focal cerebral ischemia in mice. J Neuroinflammation 2010;7:15. [21] Qin X, Krumrei N, Grubissich L, Dobarro M, Aktas H, Perez G, et al. Deficiency of the mouse complement regulatory protein mCd59b results in spontaneous

[22]

[24]

[25]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37] [38] [39] [40] [41]

[42]

[43]

[44]

[45] [46]

[47]

[48]

[49]

hemolytic anemia with platelet activation and progressive male infertility. Immunity 2003;18:217e27. Hu W, Ge X, You T, Xu T, Zhang J, Wu G, et al. Human CD59 inhibitor sensitizes rituximab-resistant lymphoma cells to complement-mediated cytolysis. Cancer Res 2011;71:2298e307. Amet T, Ghabril M, Chalasani N, Byrd D, Hu N, Grantham A, et al. CD59 incorporation protects hepatitis C virus against complement-mediated destruction. Hepatology 2012;55:354e63. Bora NS, Jha P, Lyzogubov VV, Kaliappan S, Liu J, Tytarenko RG, et al. Recombinant membrane-targeted form of CD59 inhibits the growth of choroidal neovascular complex in mice. J Biol Chem 2010;285:33826e33. Miwa T, Zhou L, Maldonado MA, Madaio MP, Eisenberg RA, Song WC. Absence of CD59 exacerbates systemic autoimmunity in MRL/lpr mice. J Immunol 2012;189:5434e41. Liu G, Zhang J, Chen X. Molecular and functional characterization of a CD59 analogue from large yellow croaker Pseudosciana crocea. Mol Immunol 2007;44:3661e71. Yeh HY, Klesius PH. Molecular cloning and expression of channel catfish, Ictalurus punctatus, complement membrane attack complex inhibitor CD59. Vet Immunol Immunopathol 2007;120:246e53. Barros MM, Falcon DR, Orsi Rde O, Pezzato LE, Fernandes Jr AC, Guimaraes IG, et al. Non-specific immune parameters and physiological response of Nile tilapia fed beta-glucan and vitamin C for different periods and submitted to stress and bacterial challenge. Fish Shellfish Immunol 2014;39:188e95. Huang LY, Wang KY, Xiao D, Chen DF, Geng Y, Wang J, et al. Safety and immunogenicity of an oral DNA vaccine encoding Sip of Streptococcus agalactiae from Nile tilapia Oreochromis niloticus delivered by live attenuated Salmonella typhimurium. Fish Shellfish Immunol 2014;38:34e41. Wang YT, Huang HY, Tsai MA, Wang PC, Jiang BH, Chen SC. Phosphoglycerate kinase enhanced immunity of the whole cell of Streptococcus agalactiae in tilapia, Oreochromis niloticus. Fish Shellfish Immunol 2014;41:250e9. He A, Yang J, Tang S, Wang C. Cloning and molecular characterization of complement component 1 inhibitor (C1INH) and complement component 8beta (C8beta) in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol 2013;35:1055e8. Wang B, Jian J, Lu Y, Cai S, Huang Y, Tang J, et al. Complete genome sequence of Streptococcus agalactiae ZQ0910, a pathogen causing meningoencephalitis in the GIFT strain of Nile tilapia (Oreochromis niloticus). J Bacteriol 2012;194: 5132e3. Li JH, Chang MX, Xue NN, Nie P. Functional characterization of a short peptidoglycan recognition protein, PGRP5 in grass carp Ctenopharyngodon idella. Fish Shellfish Immunol 2013;35:221e30. Fan C, Zhang S, Li L, Chao Y. Fibrinogen-related protein from amphioxus Branchiostoma belcheri is a multivalent pattern recognition receptor with a bacteriolytic activity. Mol Immunol 2008;45:3338e46. Tunkijjanukij S, Olafsen JA. Sialic acid-binding lectin with antibacterial activity from the horse mussel: further characterization and immunolocalization. Dev Comp Immunol 1998;22:139e50. Mian GF, Godoy DT, Leal CA, Yuhara TY, Costa GM, Figueiredo HC. Aspects of the natural history and virulence of S. agalactiae infection in Nile tilapia. Vet Microbiol 2009;136:180e3. Secombes C. Will advances in fish immunology change vaccination strategies? Fish Shellfish Immunol 2008;25:409e16. Gudding R, Van Muiswinkel WB. A history of fish vaccination: science-based disease prevention in aquaculture. Fish Shellfish Immunol 2013;35:1683e8. Van Muiswinkel WB, Nakao M. A short history of research on immunity to infectious diseases in fish. Dev Comp Immunol 2014;43:130e50. Stahel PF, Morganti-Kossmann MC, Kossmann T. The role of the complement system in traumatic brain injury. Brain Res Brain Res Rev 1998;27:243e56. Pedersen ED, Aass HC, Rootwelt T, Fung M, Lambris JD, Mollnes TE. CD59 efficiently protects human NT2-N neurons against complement-mediated damage. Scand J Immunol 2007;66:345e51. Stahel PF, Flierl MA, Morgan BP, Persigehl I, Stoll C, Conrad C, et al. Absence of the complement regulatory molecule CD59a leads to exacerbated neuropathology after traumatic brain injury in mice. J Neuroinflammation 2009;6:2. Nakao M, Tsujikura M, Ichiki S, Vo TK, Somamoto T. The complement system in teleost fish: progress of post-homolog-hunting researches. Dev Comp Immunol 2011;35:1296e308. Gomez D, Sunyer JO, Salinas I. The mucosal immune system of fish: the evolution of tolerating commensals while fighting pathogens. Fish Shellfish Immunol 2013;35:1729e39. Eldar A, Bejerano Y, Livoff A, Horovitcz A, Bercovier H. Experimental streptococcal meningo-encephalitis in cultured fish. Vet Microbiol 1995;43:33e40. Doran KS, Engelson EJ, Khosravi A, Maisey HC, Fedtke I, Equils O, et al. Bloodbrain barrier invasion by group B streptococcus depends upon proper cellsurface anchoring of lipoteichoic acid. J Clin Invest 2005;115:2499e507. Nizet V, Kim KS, Stins M, Jonas M, Chi EY, Nguyen D, et al. Invasion of brain microvascular endothelial cells by group B streptococci. Infect Immun 1997;65:5074e81. Valenti-Weigand P, Benkel P, Rohde M, Chhatwal GS. Entry and intracellular survival of group B streptococci in J774 macrophages. Infect Immun 1996;64: 2467e73. Cornacchione P, Scaringi L, Fettucciari K, Rosati E, Sabatini R, Orefici G, et al. Group B streptococci persist inside macrophages. Immunology 1998;93: 86e95.

Z. Gan et al. / Fish & Shellfish Immunology 44 (2015) 50e59 [50] Malek TR, Bayer AL. Tolerance, not immunity, crucially depends on IL-2. Nat Rev Immunol 2004;4:665e74. [51] Bernard D, Riteau B, Hansen JD, Phillips RB, Michel F, Boudinot P, et al. Costimulatory receptors in a teleost fish: typical CD28, elusive CTLA4. J Immunol 2006;176:4191e200. [52] Zhang YA, Hikima J, Li J, LaPatra SE, Luo YP, Sunyer JO. Conservation of structural and functional features in a primordial CD80/86 molecule from rainbow trout (Oncorhynchus mykiss), a primitive teleost fish. J Immunol 2009;183:83e96. [53] Sugamata R, Suetake H, Kikuchi K, Suzuki Y. Teleost B7 expressed on monocytes regulates T cell responses. J Immunol 2009;182:6799e806. [54] Zapata A, Diez B, Cejalvo T, Gutierrez-de Frias C, Cortes A. Ontogeny of the immune system of fish. Fish Shellfish Immunol 2006;20:126e36. [55] Bowden TJ, Cook P, Rombout JH. Development and function of the thymus in teleosts. Fish Shellfish Immunol 2005;19:413e27. [56] Ma D, Wei Y, Liu F. Regulatory mechanisms of thymus and T cell development. Dev Comp Immunol 2013;39:91e102. [57] Cesta MF. Normal structure, function, and histology of the spleen. Toxicol Pathol 2006;34:455e65. [58] Gan Z, Wang B, Lu Y, Cai S, Cai J, Jian J, et al. Molecular characterization and expression of CD2BP2 in Nile tilapia (Oreochromis niloticus) in response to Streptococcus agalactiae stimulus. Gene 2014;548:126e33.

59

[59] Nonaka M. Evolution of the complement system. Subcell Biochem 2014;80: 31e43. [60] Hinchliffe SJ, Rushmere NK, Hanna SM, Morgan BP. Molecular cloning and functional characterization of the pig analogue of CD59: relevance to xenotransplantation. J Immunol 1998;160:3924e32. [61] Zhao XJ, Zhao J, Zhou Q, Sims PJ. Identity of the residues responsible for the species-restricted complement inhibitory function of human CD59. J Biol Chem 1998;273:10665e71. [62] Zhang HF, Yu J, Chen S, Morgan BP, Abagyan R, Tomlinson S. Identification of the individual residues that determine human CD59 species selective activity. J Biol Chem 1999;274:10969e74. [63] Yamamoto T, Nakane T, Doi S, Osaki T. Lipopolysaccharide signal transduction in oral keratinocyteseinvolvement of CD59 but not CD14. Cell Signal 2003;15: 861e9. [64] Henneke P, Berner R. Interaction of neonatal phagocytes with group B streptococcus: recognition and response. Infect Immun 2006;74:3085e95. [65] Henneke P, Morath S, Uematsu S, Weichert S, Pfitzenmaier M, Takeuchi O, et al. Role of lipoteichoic acid in the phagocyte response to group B streptococcus. J Immunol 2005;174:6449e55.