Molecular and functional characterization of the vitellogenin receptor in oriental river prawn, Macrobrachium nipponense

Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A journal homepage: www.elsevier.com/locate/cbpa

Molecular and functional characterization of the vitellogenin receptor in oriental river prawn, Macrobrachium nipponense Hongkun Bai a, Hui Qiao b, Fajun Li a,d, Hongtuo Fu a,b,⁎, Sufei Jiang b, Wenyi Zhang b, Yuedi Yan c, Yiwei Xiong b, Shengming Sun b, Shubo Jin a,b, Yongsheng Gong b, Yan Wu b a

Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China c Shanghai Ocean University, Shanghai 201306, China d Weifang University of Science and Technology, Shouguang 262700, China b

a r t i c l e

i n f o

Article history: Received 10 March 2015 Received in revised form 20 July 2015 Accepted 30 December 2015 Available online 7 January 2016 Keywords: Macrobrachium nipponense Vitellogenin receptor Eyestalk ablation RNA interference

a b s t r a c t A complementary DNA (cDNA) that encodes the vitellogenin receptor (VgR) in the oriental river prawn, Macrobrachium nipponense, was cloned using expressed sequence tag analysis and a rapid amplification of cDNA ends approach. The coding region consists of 5920 base pairs (bp) that encode a 1902 amino acid protein, with a predicted molecular mass of 209 kDa. The coding region is flanked by a 45 bp 5ʹ-untranslated region (UTR) and a 166 bp 3ʹ-UTR. The deduced amino acid sequence of the M. nipponense VgR cDNA had typically conserved domains, such as an extracellular, lipoprotein-binding domain, epidermal growth factor-like and O-glycosylation domains, a transmembrane domain and a short C-terminal, cytosolic tail. Quantitative real-time PCR (qPCR) indicated that Mn-VgR is highly expressed in the female ovary. Expression analysis by qPCR demonstrated the larval and ovarian developmental stage-specific expression pattern. As the ovaries developed, the expression level of Mn-VgR gradually increased during the reproductive cycle (stage I), to reach a peak in stage III. Levels then dropped as a new development cycle was entered after reproduction molting. Eyestalk ablation led to a significant increase in the expression of Mn-VgR during the ovarian development stages (P b 0.05), when compared with the eyestalk-intact group. The investigation revealed that eyestalk ablation initially affected Mn-VgR expression and then influenced vitellogenesis. In adult females, VgR RNA interference (RNAi) dramatically delayed the maturation of the ovary, in accordance with the gonad somatic index. In addition, Mn-VgR RNAi led to vitellin depletion in the oocytes and the accumulation of vitellin in the hepatopancreas. © 2016 Elsevier Inc. All rights reserved.

1. Introduction The oriental river prawn, Macrobrachium nipponense (Crustacea; Decapoda; Palaemonidae), is one of the most important freshwater decapods and inhabits freshwater and low-salinity estuarine regions of China and other Asian countries (Yu and Miyake, 1972; Mirabdullaev and Niyazov, 2005; Cai and Shokita, 2006; De and Ghane, 2006; Salman et al., 2006; Feng et al., 2008; Mareddy et al., 2011). It is one of the most cultured shrimp species in the world and accounts for a large proportion of the 230,248 t of prawn that are consumed annually (Bureau of Fishery, 2011). However, as the scale of production has gradually increased, “sexual precocity” has begun to appear. This may cause a range of serious problems, such as the coexistence of multiple generations, intensive breeding density and lack of oxygen. These circumstances lead to a short life span, a ⁎ Corresponding author at: Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, Jiangsu Province, China. Tel.: +86 510 85558835; fax: +86 510 8555883. E-mail address: [email protected] (H. Fu).

http://dx.doi.org/10.1016/j.cbpa.2015.12.008 1095-6433/© 2016 Elsevier Inc. All rights reserved.

reduction in aquacultural production and restrict the sustainable development of M. nipponense. Hence, studies on gene regulation of the development of ovaries and the search for reliable techniques to reduce the time to reproductive maturation have important practical values (Gui and Zhu, 2012; Mei and Gui, 2015). In oviparous species, oocyte growth and gonad maturity depend on the rapid production and deposition of the yolk protein precursor, vitellogenin (Vg), which is subsequently used by embryos and larvae during early development (Wilder et al., 2010). The hepatopancreas is the major production site for Vg in crustaceans such as brachyurans, astacidea, and caridea (Okuno et al., 2002). During vitellogenesis, extra-ovarian Vg is secreted into the hemolymph and incorporated into the developing oocytes by the Vg receptor (VgR), through receptor-mediated endocytosis. This ubiquitous, reproductive process is essential in all eukaryotes (Roth and Porter, 1964; Warrier and Subramoniam, 2002) and moves exogenous Vg into the developing oocyte, where it is ultimately transformed into yolk protein to provide nutrition for the maturation of the oocyte. Thus, the VgR plays an important role in oocyte maturation.

46

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

Table 1 Primers used for cDNA clone. Primer name

Sequence(5′ → 3′)

Purpose

Mn-VgR-R1 Mn-VgR-R2 5′ RACE outer 5′ RACE inner

TCGTCCTCATCCGAGTGGTCAT CATCGCAGACATAGTCAAGGGA CATGGCTACATGCTGACAGCCTA CGCGGATCCACAGCCTAC TGATGATCAGTCGATG TACCGTCGTTCCACTAGTGATTT CGCGGATCCTCCACTAGTGATTTCACTATAGG CCGACTTAGTCCTGAACAGCATC AGAGCGGAACAGAGGAGAATCC GAGGGAGTTTCCGCCATCTTTG AACCACCCCTATTCTCTGGACT TCCAGCACATCTCCTACGACGG CCTTGATGACGAGATTGCCTGC GACTCATAGAGACAGCGGCTAC AATCGACCTGCTCCCACTATTG GGACGACGAAGAATGCAAAGAG GAGAGCGGAACAGAGGAGAATC

Primer for 5′ RACE Primer for 5′ RACE Primer for 5′ RACE Primer for 5′ RACE

3′ RACE outer 3′ RACE inner Mn-VgR-F1 Mn-VgR-F2 VGR-A-F1 VGR-A-R1 VGR-B-F1 VGR-B-R1 VGR-C-F1 VGR-C-R2 VGR-D-F1 VGR-D-R1

Primer for 3′ RACE Primer for 3′ RACE Primer for 3′ RACE Primer for 3′ RACE Middle fragment A Middle fragment A Middle fragment B Middle fragment B Middle fragment C Middle fragment C Middle fragment D Middle fragment D

In order to investigate the tissue distribution of Mn-VgR mRNA expression, a variety of tissues including: ovary, heart, hepatopancreas, muscle, hemolymph, gill, eyestalk, gut and brain were collected from at least three female individuals mature female/male prawn and kept in the RNA protect liquid (Takara) until total RNA extraction. Each developmental stage of embryo, larvae and post-larval were assessed by the criteria of Chen et al. (2012) and Kang et al. (1996). These samples were maintained in RNA protect liquid (Takara) until total RNA extraction. In order to observe maturational changes of ovarian Mn-VgR mRNA expression, all female ovarian maturity was classified into six stages on the basis of gonado somatic index (GSI), color, external morphology and histological feature: proliferation (stage I, GSI = 0.85 ± 0.46), fusion nucleolus (stage II, GSI = 2.54 ± 1.28), oil globules (stage III, GSI = 4.67 ± 0.98), yolk granule (stage IV, GSI = 7.55 ± 0.40), maturation (stage V, GSI = 9.85 ± 2.74), and paracmasis (stage VI, GSI = 1.24 ± 0.62) (Wu et al., 2009). The GSI of these females was calculated as (ovary weight / body weight) × 100%. 2.2. Molecular cloning and characterization of Mn-VgR cDNA

For example, VgR have been identified and characterized in vertebrates such as Gallus gallus (Bujo et al., 1994), Xenopus laevis (Okabayashi et al., 1996), Oncorhynchus mykiss (Davail et al., 1998), plus several invertebrates that include Drosophila melanogaster (Schonbaum et al., 1995) and Aedes aegypti. Several studies used RNAi (RNA interference) to disrupt the VgR gene function in the cockroach, Blattela germanica, and the tick, Dermacentor variabilis (Ciudad et al., 2006; Mitchell et al., 2007). The use of VgR dsRNA (double stranded RNA) led to gene silencing and a phenotype that was characterized by low yolk content in the ovary. Limited studies in crustaceans have identified VgR in Penaeus monodon, Metapenaeus ensis, Macrobrachium rosenbergii and Pandalopsis japonica (Tiu et al., 2008; Mekuchi et al., 2008; Roth and Khalaila, 2012; Lee et al., 2014). The VgR protein is ovary specific and consists of conserved cysteine-rich domains, epidermal growth factor-like domains and YWTD motifs, which are similar to the low-density lipoprotein, very low-density lipoprotein and VgR of insects and vertebrates. Recently, a functional analysis of a putative VgR, by dsRNA injections, was performed in P. monodon (Tiu et al., 2008). Non-molecular studies of the M. nipponense VgR (Mn-VgR) have also been published. Eyestalk ablation is mostly used to induce maturation of the gonads of prawns. In our previous studies on Mn-Vg, we have shown that it can dramatically increase the accumulation of Vg, both in the hepatopancreas and ovary (Bai et al., 2015). However, we do not know if eyestalk ablation has an effect on Mn-VgR expression. Knowledge of the Mn-VgR gene function and interaction with Mn-Vg will be of great value for research on the molecular mechanisms of ovarian development in M. nipponense. In this study, we first cloned and characterized the VgR cDNA (complementary DNA) of M. nipponense. We then determined the developmental expression pattern in the embryo, larvae, post-larval period and different developmental stages of the ovary. Quantitative realtime PCR (qPCR) was used to evaluate the effects of eyestalk ablation and gain a better understanding of the hormonal regulation mechanisms involved in Vg synthesis. We also report a functional analysis of Mn-VgR using RNAi. The results of this study will help to examine the interaction between Mn-VgR and Mn-Vg. In addition, the RNAi experiment could inspire a method to deal with the problem of sexual precocity in the aquacultural setting.

Total RNA was extracted from ovary using RNAiso Plus Reagent (TaKaRa, Japan). RNA samples treated with RNase-free DNase I (Sangon, China) to eliminate possible genomic DNA contamination for further study. The concentration of RNA was quantified by BioPhotometer (Eppendorf). 2 μL RNA sample was analyzed on a 1% agarose gel to check the integrity. The cDNA was synthesized from 3 μg total RNA using the PrimeScript™ RT-PCR Kit (TaKaRa) according to manufacturer's protocols. The partial fragment of Mn-VgR cDNA was obtained from normalized cDNA library of ovary and testis (article is in press) in our lab. Mn-VgR complete sequence was cloned by the method of rapid amplification of the cDNA ends (RACE). The 3′-RACE and 5′-RACE were performed using 3′-full RACE Core Set Ver.2.0 Kit and 5′-full RACE Kit (TaKaRa, Japan) to get cDNA 3′ and 5′ ends of Mn-VgR. In addition, we examined the middle sequence by dividing it into five fragments. All the primers used in the clone are listed in Table 1. The PCR products, subjected to electrophoresis on 1.5% agarose gel to compare the length difference, were purified using Gel Extraction kit (Sangon, China), and sequenced by ABI3730 Biosystem, USA analyzer after insertion into PMD-20 T vector (Takara, Japan). Each fragment was sequenced at least three times to confirm the validity of the sequence data that was obtained. According to the sequences acquired above, 3′-RACE and 5′RACE results were assembled with the middle cDNA sequences corresponding to each fragmental sequence by DNAMAN 4.0. Sequences were analyzed on the basis of nucleotide and protein databases of GenBank: BLASTX and BLASTN search program (http://www. ncbi. nlm.nih.gov/BLAST/). Deduced amino acid sequences were obtained using an ORF finder program (http://www.ncbi.nlm.nih.gov/gorf/ gorf.html). The homology search for the nucleotide and protein sequences was carried out by the BLAST algorithm at NCBI (http://www. Table 2 Primers used for quantitative PCR and RNA inference. Primer name

Sequence(5′ → 3′)

Purpose

2. Materials and methods

VGR-Q-F VGR-Q-R VGR-I-F

Primer for MnVGR expression Primer for MnVGR expression Primer for MnVGR dsRNA preparation

2.1. Experiment animal and tissue sampling

VGR-I-R

ACCACTCGGATGAGGACGACT CCATCTTTGCACTGGTAGTGGT TAATACGACTCACTATAGGATG ACCACTCGGATGAGGAC TAATACGACTCACTATAGGGCA AGAGCACTTGAACCCTC AGGTCTGCATCTCCCTTGACTA GCACCGTCTCGAACATAATCCT TGCTCTTGCTCTACTCAAGTCC CTGATGACAGTGAACGTTCCTG TATGCACTTCCTCATGCCATC AGGAGGCGGCAGTGGTCAT

Adult healthy M. nipponensis were obtained from Tai lake in Wuxi, China (120°13′44″E, 31°28′22″N). The body weight of the female prawns ranged from 1.26 to 4.25 g. Individuals, feed with paludina twice per day, were acclimatized in a recirculating water aquarium system filled with aerated freshwater (25–28 °C) before tissues and embryos were collected.

VGR-QI-F VGR-QI-R VG-QI-F VG-QI-R β-Actin F β-Actin R

Primer for MnVGR dsRNA preparation Primer for MnVGR dsRNA detection Primer for MnVGR dsRNA detection Primer for MnVG dsRNA detection Primer for MnVG dsRNA detection Primer for β-actin expression Primer for β-actin expression

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

47

Fig. 1. The nucleotide and deduced amino acid sequences of M. nipponenese VgR. The nucleotide sequence is displayed in the 5′–3′ directions and numbered to the right and left. Putative signal peptide sequences are shown in italics; lipoprotein class A domains are in gray; EGF-like domains are highlighted in blue; YWTD repeats are highlighted in green. Lipoprotein class B domains are in gray; transmembrane domain is underlined; internalization motifs (NPXF) are in red; Asn-Xaa-Ser/Thr sequence in the sequence output below is highlighted in bold. The predicted N-glycosylated site is highlighted in boxes.

48

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

Fig. 1 (continued).

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

49

Fig. 1 (continued).

ncbi.nlm.nih.gov/). The signal sequence was predicted using program SignalP (http://www.cbs.dtu.dk/services/SignalP/). Molecular mass and isoelectric point were predicted by Compute pI/Mw tool (http:// cn.expasy.org/tools/pi_tool.html). The NetNGlyc1.0 Server (http:// www.cbs.dtu.dk/services/NetNGlyc/) (N-X-S/T) was used to identify glycosylation site. The phosphorylation site was found by the NetPhos 2.0 Server (http://www.cbs.dtu.dk/services/NetPhos/). Phylogenetic analysis of M. nipponensis VgR was constructed using the neighborjoining method of MEGA 5.0. 2.3. Expression of VgR in different development stages and tissues The relative mRNA expression of Mn-VgR at different stages from embryo to larva, various adult tissues and ovarian maturity cycle was measured by qPCR. Total RNA treated with RNase-free DNase I (Sangon, China) to eliminate possible genomic DNA contamination. The concentration of RNA was quantified by BioPhotometer (Eppendorf). 1 μg of total RNA was reverse-transcribed by Iscript™ cDNA Synthesis Kit perfect Real Time (BIO-RAD, USA) following the manufacturer's instruction. The qPCR amplifications were carried out in a total volume of 25 μL, containing 1 μL cDNA (50 ng), 10 μL SsoFast™ EvaGreen Supermix (Bio-Rad, USA), 0.5 μL 10 μM of genes specific forward and reverse primer

(Table 2), and 13 μL of DEPC-water. The reaction mixture was initially incubated at 95 °C for 30 s to activate the Hot Start Taq DNA polymerase, followed by 40 cycles at 95 °C for 10 s and 60 °C for 10 s, melting cure was performed at the end of qPCR reaction at 65–95 °C (in 0.5 °C inc) for 10 s. At least three replicate qPCRs were performed per sample and three prawns were analyzed for each sample, and amplification of β-actin was used as the internal control (Zhang et al., 2013). The relative copy number of Mn-VgR mRNA was calculated according to the 2−⊿⊿ CT comparative CT method (Livak and Schmittgen, 2001). Quantitative data were expressed as means ± SD. Statistical differences were estimated by one-way ANOVA followed by Duncan's multiple range test. The significant differences of expressions were showed at p b 0.05. 2.4. Expression of the Mn-VgR gene mRNA under eyestalk ablation Adult female M. nipponense prawns were selected from the Tai Lake, Wu Xi, and had an approximate wet weight of 1.50–3.0 g. The ovarian development stage of each selected prawn was the proliferation stage. For the eyestalk ablation experiment, approximately 80 prawns were divided into two groups; one group was intact (no eyestalk ablation) and the other was eyestalk ablated (experimental group). The

50

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

Drosophila melanogaster Aedes aegypti Bombyx mori Nilaparvata lugens Periplaneta americana

Hexapods

Rhyparobia maderae Blattella germanica Solenopsis invicta Macrobrachium nipponense Macrobrachium rosenbergii Pandalopsis japonica Marsupenaeus japonicus

Crustaceans

Penaeus monodon Penaeus semisulcatus Xenopus laevis Oncorhynchus mykiss Oreochromis aureus

Vertebrate

Morone americana Dicentrarchus labrax

0.2 Fig. 2. A phylogenetic tree of vitellogenin receptor amino acid sequences. Numbers at branch nodes represent the confidence level of posterior probability. The sequences used were as follows: Drosophila melanogaster, AAB60217.1; Aedes aegypti, AAK15810.1; Bombyx mori, ADK94452.1; Nilaparvata lugens, ADE34166.1; Periplaneta americana, BAC02725.2; Rhyparobia maderae, BAE93218.1; Blattella germanica, CAJ19121.1; Solenopsis invicta, AAP92450.1; Macrobrachium nipponense, KJ768658; Macrobrachium rosenbergii, ADK55596.1; Pandalopsis japonica, AHL26192.1; Marsupenaeus japonicas, BAH57291.1; Penaeus monodon, ABW79798.1; Penaeus semisulcatus, AAL79675.1; Xenopus laevis, BAA22145.1; Oncorhynchus mykiss, CAD10640.1; Oreochromis aureus, AAO27569.1; Morone americana, AAO92396.1; Dicentrarchus labrax, CBX54721.1.

experiments were performed in duplicate and maintained for a period of 15 days at 28 °C. Female prawn eyestalks were removed by cauterization with red hot tweezers. Different tissues were collected from prawns at 1, 3, 5, 7, 9, 11 and 13 days after eyestalk ablation (N ≥ 3). All samples were stored in RNA sample protect solution (TaKaRa, Japan). The expression pattern was detected after eyestalk ablation using qPCR. The specific method of transcription and qPCR was identical for different development stages and tissues. 2.5. RNA interference (RNAi)

org/cgi-bin/RNAi_find_primers.pl). The VgR dsRNA synthesis primers are shown in Table 2. The PCR products were purified with a gel extraction kit (Sangon, Shanghai, China). Gene specific dsRNA was synthesized in vitro, in accordance with the Transcript AidTM T7 High Yield Transcription kit (Fermentas, Inc., USA) manufacturer's instructions. The purity and integrity of the dsRNA were examined by standard agarose gel electrophoresis. The concentration of dsRNA was measured at 260 nm using a BioPhotometer (Eppendorf, Hamburg, Germany). The RNAi was stored at −20 °C. All primers are listed in Table 2. The Vg detection primers were designed using the NCBI sequence, GenBank KJ768658.

The specific primers that contained the T7 promoter site for RNAi experiments were designed using Snap Dragon tools (http://www.flyrnai.

Fig. 3. The expression profile of Mn-VgR in different tissues was revealed by real-time quantitative PCR. The amount of VgR mRNA was normalized to the β-actin transcript level. Data are shown as means ± SD of three replicates in various tissues: O—ovary; L—hepatopancreas, B—brain; H—heart; M—muscle; E—eyestalk. AG—abdominal ganglion; T—testis; (a,b indicates a significant difference).

Fig. 4. The temporal expression of Mn-VgR in the different development larvae before the metamorphosis and post-larvae after the metamorphosis were revealed by real-time quantitative PCR. The amount of Mn-Vg mRNA was normalized to the β-actin transcript level. Data are shown as means ± SD of three repeated samples during the larvae and post-larvae. CS—cleavage stage; BS—blastula stage; GS—gastrula stage; NS—nauplius stage; ZS—zoea stage; L1—the first day larvae after hatching; P1—the first day postlarvae after metamorphosis, and so on. Statistical analyses were performed with oneway ANOVA analysis (a, b,c, d, and e indicate a significant difference with each other).

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

51

3. Results

full length sequence of Mn-VgR. The sequences were submitted to the GenBank database, under the accession number KJ768658. The full length Mn-VgR gene is 5920 base pairs (bp) in length, which includes a 5′-terminal untranslated region (UTR) of 45 bp, a 5709 bp open reading frame (ORF) and a 166 bp 3′-terminal UTR (excluding the poly (A)+ tail). The ORF encodes 1902 amino acid (aa) residues, with an estimated molecular weight of 209 kDa and isoelectric point of 5.36. The nucleotide sequences and the deduced amino acid sequences of Mn-VgR are shown in Fig. 1. Analysis with SignalP software indicated that the deduced peptide contains a putative signal peptide of 21 amino acids (M1–T21). In addition, it has 15 putative N-linked glycosylation sites and 128 phosphorylation sites (76 Ser, 23 Thr, 29 Try), as predicted by the NetNGlyc 1.0. program and NetPhos 2.0 Server. Conserved domain analysis revealed that Mn-VgR exhibits domain features that are typical of lipoprotein receptors and shares similar conserved domains with other crustaceans. The Mn-VgR sequence contains two ligand-binding domains (LBD), each with five or seven class A cysteine-rich repeats. Each LBD is followed by an epidermal growth factor (EGF) homology domain that contains two types of motifs; the class B repeats, with six cysteine residues, and the YWXD repeats. After the second EGF homology domain there is a single-pass transmembrane domain and a cytoplasmic tail with two internalization motifs (NPXF). A BLAST search revealed that Mn-VgR exhibits a high degree of identity with other shrimp VgR sequences. It shares 80% identity with M. rosenbergii VgR, 54% identity with P. japonica VgR, 41% identity with P. monodon and 31% identity with Periplaneta americana. In contrast, Mn-VgR shows less similarity with proteins of the insect and vertebrate families. A neighbor-joining phylogenetic tree was constructed (Fig. 2), using the neighbor-joining method of MEGA 4.0, to determine the evolutionary relationship between Mn-VgR and other crustacean, insect and vertebrate VgRs. The branches of the phylogenetic tree revealed that MnVgR is most closely related to M. rosenbergii, followed by P. japonica and Marsupenaeus japonicas. All crustacean VgR genes clustered together in one clade, while the insect group clustered on another branch. The vertebrate VgR genes are on separate branches. The short branch lengths between Mn-VgR and VgR genes of insects indicated a closer relationship than that between Mn-VgR and vertebrate VgR genes.

3.1. Cloning and structural analysis of a full-length cDNA of Mn-VgR

3.2. Tissue distribution of the Mn-VgR gene transcript

A combination of the 5ʹ and 3ʹ RACE (rapid amplification of cDNA ends) results, partial Mn-VgR cDNA sequences was used to obtain the

The Mn-VgR gene transcript and its tissue distribution were evaluated by qPCR in selected female and male prawn tissues. The Mn-VgR gene was highly expressed in the ovary (Fig. 3). The expression level showed significant differences in other female tissues, such as the hepatopancreas, brain, heart, muscle, eyestalk, gill and abdominal ganglion (P b 0.001). No Mn-VgR mRNA was detected in the testes of males.

Fig. 5. Quantitative analysis of Mn-VgR transcripts using real-time PCR in ovary (a) and hepatopancreas (b) in different development stages of ovaries. I—proliferation stage, II—fusion nucleolus stage; III—oil globules stage, IV—yolk granule stage, V—maturation stage, VI—paracmasis stage. Each data point represents the mean and standard deviation (n ≥ 3 samples). Statistical analyses were performed with one-way ANOVA analysis (a, b, c, and d indicate a significant difference with each other).

For the short-term in vivo dsRNA injection experiment, 100 healthy, mature female M. nipponense (each weighing 1.6–2.3 g) were selected. Injections were directed into the pericardial cavity. The female prawns, selected to be in the proliferation stage, were assigned to two treatment groups: VgR-dsRNA injection (N = 50) or vehicle injection (N = 50). Each prawn was injected with 4 μg/g VgR-dsRNA or 4 μg/g of vehicle. The Vg mRNA expression levels in the ovary and hepatopancreas were investigated by qPCR, to detect the interference efficiency at 1, 3, 5, 7, 9, 11, 13, 15 and 17 days after injection (N ≥ 3). The body weight and ovary weight of each prawn were recorded to measure the gonad somatic index (GSI). All tissues were stored in RNA protect liquid.

3.3. Expression of the Mn-VgR gene during embryo, larvae and post-larvae stages The expression pattern of Mn-VgR was analyzed in different developmental stages of the embryo (cleavage to zoea stage), larvae (first, fifth, tenth and fifteenth instar) and post-larvae (first, tenth, twentieth and thirtieth day) by qPCR (Fig. 4). A relatively high level of expression of Mn-VgR was observed in the cleavage stage of embryos. A steady decrease of expression levels was detected from the blastula stage to the zoea stage. During the larval and post-larval stages, the levels of expression of Mn-VgR were maintained at a relatively low level. However, levels gradually increased from 20 days after metamorphosis and reached a peak 30 days after metamorphosis (P b 0.001).

Fig. 6. Expression level of Mn-VgR after eyestalk ablation in ovary. Each data point represents the mean and standard deviation (n ≥ 3 samples). Statistical analyses were performed with one-way ANOVA analysis. 1–13 d represent the days after eyestalk ablation (a, b, c, d, e, f, g, and x indicate a significant difference with each other).

3.4. Expression of the Mn-VgR gene in different developmental stages of the ovaries The expression patterns of Mn-VgR in the ovary were detected by qPCR throughout the reproductive cycle (Fig. 5). The results confirmed

52

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

Fig. 7. Real-time PCR analysis of injection with VgR dsRNA (4 μg/g). a) Represents the effects of Mn-VgR knock-down on gonad stimulation index (GSI)of prawns; b) represents the relative Mn-VgR expression levels in the ovary after RNA inference; c) represents the relative Mn-Vg expression levels in the hepatopancreas after RNA inference; d) represents the relative Mn-Vg expression levels in the ovary after injection with vg-dsRNA. Each data point represents the mean and standard deviation (n ≥ 3 samples). Statistical analyses were performed with oneway ANOVA analysis (a, b, c, d, e, f, g, and h indicate a significant difference with each other).

that it was expressed throughout the ovarian maturation phase. The Mn-VgR transcript level was low at the beginning of the reproductive cycle (stage I; GSI b 1%) and increased to a maximum at the oil globules stage (stage III; GSI 3%–4%). Beyond this stage the levels dropped, reaching their lowest level in the late vitellogenic and post-spawners stage. This implied a possible role for Mn-VgR in the reproductive development of the shrimp. 3.5. Expression of the Mn-VgR gene after eyestalk ablation The expression level of the Mn-VgR gene in the ovary, after eyestalk removal, was determined by qPCR (Fig. 6). When compared with the control group, the reproductive molt cycle in the eyestalk ablation group was dramatically shortened. Overall, the level of gene expression detected in the experimental group was higher than that in the control group. As the ovary developed, Mn-VgR expression peaked five days after eyestalk ablation in the treatment group, whereas it peaked at seven days in the control group. 3.6. Functional analysis of Mn-VgR by RNA interference In order to study the function of Mn-VgR in the process of vitellogenesis, 4 μg/g of dsRNA were injected into freshly emerged adult females. When RNAi was used, the VgR-dsRNA inhibited development of the ovary, based on the GSI (Fig. 7a) and expression pattern data.

The overall trend in GSI is shown in Fig. 7a. The GSI value increased in both the test and control groups, with the development of the ovary, but different patterns were observed. The control group peaked at 11 days, whereas the injection group peaked after 15 or more days. When the control group had completed a normal reproductive cycle, the test group was still in the maturation phase (stage V). Relative to the control, only a slight change in Mn-VgR expression level was recorded in dsRNA-injected prawn after one day (Fig. 7b). However, significant Mn-VgR gene knockdown was detected five days after injection, when the decrease in transcript level represented a drop of 91% (P b 0.01). The level of expression then remained very low. To determine whether the disruption of the Mn-VgR gene function in the ovary affects the expression of Mn-Vg, total RNA were extracted from the hepatopancreas or ovary of dsRNA-injected prawn (Fig. 7c, d). In the ovary, Mn-Vg transcript declined dramatically from five to 11 days after injection, presumably due to decreased Mn-VgR expression (P b 0.05). In the process of ovary maturation, the level of Mn-Vg fluctuated in the control group, whereas the expression in the injection group remained low. A similar expression pattern was detected in the hepatopancreas. The amount of Vg in the hepatopancreas accumulated from 11 to 15 days in the reproductive cycle and the expression at peak point up to one times when contrast with that of the control group. When compared with the control group, the transcription trend with time in the injection group indicated a dramatically delayed developmental cycle.

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

4. Discussion In all oviparous animals, vitellogenesis is one of the most symbolic processes required for reproduction. Vitellogenins are incorporated into the oocyte through a receptor-mediated endocytic pathway (Mukherjee et al., 1997) and the VgR plays a number of crucial roles throughout the process of reproduction. In this study, we determined the complete Mn-VgR transcript sequence of approximately 6 kb. It encodes 1902 amino acids that encode a predicted 209 kDa protein, with an isoelectric point of 5.36. The size of the Mn-VgR transcript and protein is similar to that of other crustacean and insect VgRs (Sappington et al., 1995; Schonbaum et al., 1995; Ciudad et al., 2006; Tufail and Takeda, 2009; Roth and Khalaila, 2012). Conserved domain analysis results revealed that Mn-VgR belongs to the superfamily of low-density lipoprotein receptors (LDLR) and contains the typical VgR domains found in insects and vertebrates. These domains are the LDL class A domains, EGF homology domain, an extracellular O-glycosylation domain, which is adjacent to a transmembrane domain, and a short cytosolic tail (Jeon and Blacklow, 2005). This molecular characterization of Mn-VgR also showed significant homology with insects and vertebrates. The Mn-VgR domain composition includes two LBDs, with either five or eight class A cysteine-rich repeats that are responsible for ligand recognition. Each LBD is followed by an EGF domain that contains two types of motifs; the class B repeats, with six cysteine residues each, and the YWXD repeats. This is similar to the composition of P. monodon and M. rosenbergii VgR (Tiu et al., 2008; Roth and Khalaila, 2012). All crustacean VgR sequences described to date contain two LBDs, with five or eight class A cysteine-rich repeats in each domain. In contrast, the vertebrate VgRs have a single LBD that comprises eight class A cysteine-rich repeats (Cho and Raikhel, 2001; Mekuchi et al., 2008; Tiu et al., 2008; Tufail and Takeda, 2009). In crustaceans, the first LBD is well-conserved, whereas the number of repeats varies in the second LBD. In Mn-VgR there are seven LDL class A repeats within the second LBD. This is consistent with VgRs from Pleocyemata, which includes P. japonica and M. rosenbergii (Yano and Chinzei, 1987; Roth and Khalaila, 2012). In contrast, eight LDL class A repeats were identified in the second LBD of P. monodon (Tiu et al., 2008). The EGF domain is important for sensing endosomal pH, which leads to the release of bound ligands (Davis et al., 1987). The Mn-VgR EGF domain 2, present on the Cterminal side of the transmembrane domain, shows some differences to other crustaceans and vertebrates. In Mn-VgR, this domain contains a single YWXD repeat, while the same domain contains two or three such repeats in other crustaceans and vertebrates (Mekuchi et al., 2008; Tiu et al., 2008; Roth and Khalaila, 2012). The O-linked sugar domain is thought to facilitate free interaction with ligands (i.e. vitellogenin) by holding the receptor away from the membrane (Goldstein et al., 1985; Hussain et al., 1999). The cytoplasmic tail is critical for the binding of an adaptor protein (e.g. clathrin), which assembles other protein machinery necessary for endocytosis (Sappington and Raikhel, 1998). In the vertebrate and invertebrate LDLR superfamily, the most common tyrosinebased signal is NPX(Y/F). There are two NPXF motifs in Mn-VgR, located at AA1787–1790 and at AA 1818–1891, which is consistent with M. rosenbergii and P. monodon (Tiu et al., 2008; Roth and Khalaila, 2012). The VgR genes are commonly expressed in a sex and tissue-specific manner in many species. In decapod species, the ovary is considered to be the major site of VgR gene expression (Tiu et al., 2008; Roth and Khalaila, 2012). The expression pattern and tissue distribution of MnVgR were analyzed by real time PCR (RT-PCR), which demonstrated that there are significant levels of expression in the ovary. The result is in accordance with the reports from insect (Sappington et al., 1996; Schonbaum et al., 1995; Chen et al., 2004; Tufail and Takeda, 2005; Ciudad et al., 2006; Tiu et al., 2008; Roth and Khalaila, 2012) and vertebrate species (Bujo et al., 1994; Okabayashi et al., 1996; Davail et al., 1998). Our tissue expression analysis further suggested the essential role of Mn-VgR in the process of female germ cell development and vitellogenesis.

53

There are no reports on the VgR expression pattern in the developmental stages of embryos and the post-larval stage. In our study, the Mn-VgR expression level was high in the early embryo stages but decreased at the blastula stage, which indicated that Mn-VgR mRNA may be maternally provided at the cleavage stage and consumed during development of the embryo. As many crustaceans and other species proved that, VgRs gene expresses abundant proteins in the oocyte membrane (Tiu et al., 2008; Lu et al., 2009; Pousis et al., 2012). The expression level of Mn-VgR showed an upward trend during post-larval stages and there was a remarkable increase from 20 to 30 days post larval which is consistent with the expression pattern of Mn-Vg (Bai et al., 2015). In our previous study, we used histological sections to show that juvenile shrimp gonad differentiation forms occurred from 20 days post-larvae and subsequently the oocyte began to develop and mature (in press). This expression pattern suggested that Mn-VgR begins to transfer Vg into the ovary to provide nutrition after gonad differentiation. The consistent increase in the transcripts of Mn-VgR and Mn-Vg, with maturation of the oocyte, also indicated the close functional correlation between the two transcripts. During the shrimp gonad maturation cycle, the Vg transcript level is known to fluctuate (Phiriyangkul, 2007; Raviv et al., 2006). This expression pattern has been demonstrated in M. nipponense (Bai et al., 2015). In crustaceans, VgR gene expression in the ovary coincides with the rapid fluctuations in Vg. The VgR synthesis activity increases from the pre-vitellogenesis stage to the final maturation of the ovary. Levels then decline after oviposition (Mekuchi et al., 2008; Tiu et al., 2008; Roth and Khalaila, 2012). In the current study, a varied expression pattern was also detected in the ovary. The level of expression of Mn-VgR was low at the beginning of the reproductive cycle (stage I), then increased and reach a peak at the Oil globules stage (stage III), after which levels were observed to drop. Our previous study on Mn-Vg indicated a similar expression pattern to Mn-VgR. However, the Mn-VgR expression levels peaked in stage III, whereas the Mn-Vg expression levels in the hepatopancreas peaked in stage IV. The Mn-Vg expression levels in the ovary peaked in stage V. We conclude that Mn-VgR is transcribed first and accumulates in the ovary. Expression of Mn-Vg then begins in the hepatopancreas, from where it is transported into the ovary to perform its function in the process of vitellogenesis. The expression of MnVgR in the different developmental stages of the ovary is in accordance with previous studies on P. monodon, M. japonicus and M. rosenbergii, in addition to other insects and fish (Davail et al., 1998; Mekuchi et al., 2008; Tiu et al., 2008; Roth and Khalaila, 2012 Tufail and Takeda, 2009). Gonad maturation is thought to be negatively regulated by the Xorgan sinus gland in the eyestalk. Eyestalk ablation may accelerate maturation of the ovary and cause accumulation of Vg in the hepatopancreas and ovary in M. nipponense (Bai et al., 2015). A few investigations into the hormone regulation of VgR have been published. In P. monodon, VgR was detected at all stages of ovarian development in eyestalk ablated and control shrimp but there was no significant difference between the two groups (Klinbunga et al., 2015). However, we found differences in the expression pattern of Mn-VgR after eyestalk ablation, evaluated in the ovary during one reproductive cycle, compared with the control group. In general, the level of gene expression detected in the ablation group was higher than that observed in the control group. As the ovary developed, Mn-VgR expression peaked five days after eyestalk ablation in the treatment group, whereas it peaked at seven days in the control group. This result indicated that eyestalk ablation can affect the expression of Mn-VgR. When the Mn-Vg gene expression pattern from a previous study was compared with the Mn-VgR pattern, we found that the peak time of Mn-VgR is at least two days previous to Mn-Vg in the hepatopancreas and ovary (Bai et al., 2015). We concluded that eyestalk ablation accelerates the transcription of Mn-VgR in the ovary and then promotes the transport of Vg from the hepatopancreas to the ovary. RNA interference techniques were used to analyze the function of Mn-VgR. The VgR gene function has successfully been disrupted by

54

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55

RNAi experiments in the cockroach, B. germanica, and the tick, D. variabilis (Ciudad et al., 2006; Mitchell et al., 2007). The use of VgR dsRNA caused the gene to be silenced and created a phenotype that was characterized by low yolk content in the ovary. In an RNAi study in P. monodon, VgR dsRNA lead to a decrease in vitellin content in the ovary and elevated the levels of Vg in the hemolymph (Tiu et al., 2008). In this study, we monitored the VgR expression pattern in the ovary and GSI changes after dsRNA injection. The GSI result showed that 4 μg/g of VgR-dsRNA injections effectively delayed oocyte development and extended the ovarian cycle. This critical result revealed that VgR has a functional role in reproductive maturation in M. nipponense. The RT-PCR results showed that the expression level of Mn-VgR was significantly decreased five days after injection and remained at a low level, when compared with the control group. To further investigate the effect of silencing VgR in ovarian development, the Vg levels in the ovary and hepatopancreas were analyzed by RT-PCR. The Vg content in the ovaries of the dsRNA-injected group was significantly decreased (75% less, compared with the control) three days after the injection and the expression remained at a low level from day five to day 11, when compared with the control group. Our previous study showed that the Mn-Vg dsRNA injection dramatically down-regulated VgR expression in the ovary (Bai et al., 2015). These results indicated the close relationship between Vg and VgR in the process of vitellogenesis. A delayed expression pattern of Mn-Vg was detected in the hepatopancreas but the expression level in the VgR gene disrupted group was higher than in the control group in the late stage of the reproductive cycle. As demonstrated by the RNAi experiment, the process of receptor mediated endocytosis was blocked when Mn-VgR was silenced, which lead to Vg depletion in the oocytes. As Vg is mainly synthesized in the extra-ovarian site (hepatopancreas), we detected an accumulation of Vg in the hepatopancreas. In conclusion, we successfully cloned the full-length VgR gene in M. nipponense. We identified the domain organization and expression patterns in different tissues, different developmental stages and during the ovarian development cycle. Eyestalk ablation initially affected MnVgR mRNA levels in the ovary, to accelerate the process of vitellogenesis. The VgR RNAi investigation indicated that VgR dsRNA injection delayed the maturation of the ovary, which established a theoretical basis for solving the sexual precocity issue in aquaculture practice. In addition, expression of Mn-Vg in different tissues was also confirmed. Silencing of Mn-VgR leaded to vitellin depletion in the oocytes and accumulation of vitellin in the hepatopancreas. Acknowledgments The project was supported by the Freshwater Fisheries Research Center, China Central Governmental Research Institutional Basic Special Research Project from the Public Welfare Fund (2013JBFM15), the National Natural Science Foundation of China (Grant No. 31272654), the National Science & Technology Supporting Program of the 12th Fiveyear Plan of China (Grant No. 2012BAD26B04), the Jiangsu Provincial Natural Science Foundation for Young Scholars of China (Grant No. BK2012091), the Science & Technology Supporting Program of Jiangsu Province (Grant No. BE2012334) and the three aquatic projects of the Jiangsu Province (D2013-6). References Bai, H.K., Qiao, H., Li, F.J., Fu, H.T., Sun, S.M., Zhang, W.Y., Jin, S.B., Gong, Y.S., Jiang, S.F., Xiong, Y.W., 2015. Molecular Characterization and Developmental Expression of Vitellogenin in the Oriental River Prawn Macrobrachium nipponense and the Effects of RNA Interference and Eyestalk Ablation on Ovarian Maturation Gene.online. Bujo, H., Hermann, M., Kaderli, M.O., Jacobsen, L., Sugawara, S., Nimpf, J., Yamamoto, T., Schneider, W.J., 1994. Chicken Oocyte Growth is Mediated by an Eight Ligand Binding Repeat Member of the LDL Receptor Family EMBO J 13: 5165–5175. Bureau of Fishery, Ministry of Agriculture, P.R.C., 2011. Fisheries Economic Statistics. China Fishery Yearbook. China Agricultural Press, Beijing, p. 236.

Cai, Y., Shokita, S., 2006. Report on a collection of freshwater shrimps (Crustacea: Decapoda: Caridea) from the Philippines, with descriptions of four new species. Raffles B Zool 54, 245–270. Chen, M.E., Lewis, D.K., Keeley, L.L., Pietrantonio, P.V., 2004. CDNA cloning and transcriptional regulation of the vitellogenin receptor from the imported fire ant, Solenopsis invicta Buren (Hymenoptera: Formicidae). Insect Mol. Biol. 13 (2), 195–204. Chen, Y., Zhu, Q., Chen, H., Zhu, X.L., Cui, Z., Qiu, G.F., 2012. The morphological and histological observation of embryonic development in the oriental river prawn Macrobrachium nipponense. J. Shanghai Ocean Univ. 21 (1), 33–40. Cho, K.H., Raikhel, A.S., 2001. Organization and developmental expression of the mosquito vitellogenin receptor gene. Insect Mol. Biol. 10, 465–474. Ciudad, L., Piulachs, M.D., Belles, X., 2006. Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant. FEBS J. 273, 325–335. Davail, B., Pakdel, F., Bujo, H., Perazzolo, L.M., Waclawek, M., Schneider, W.J., Le Menn, .F., 1998. Evolution of oogenesis: the receptor for vitellogenin from the rainbow trout. J. Lipid Res. 39 (10), 1929–1937. Davis, C.G., Goldstein, J.L., Südhof, T.C., Anderson, R.G., Russell, D.W., Brown, M.S., 1987. Acid-dependent ligand dissociation and recycling of LDL receptor mediated by growth factor homology region. Nature 326 (6115), 760–765. De, G.S., Ghane, A., 2006. The establishment of the oriental river prawn, Macrobrachium nipponense (de Haan, 1849) in Anzali Lagoon, Iran. Aquat. Invasions 1, 204–208. Feng, J.B., Li, J.L., Cheng, X., 2008. Research progress on germplasm resource exploitation and protection of Macrobrachium nipponense. J. Shanghai Fish. Univ. 17, 371–376. Goldstein, J.L., Brown, M.S., Andersen, R.G.W., Russell, D.W., Scheider, W.J., 1985. Receptor-Mediated Endocytosis: Concepts Emerging from the LDL Receptor System Ann Rev Cell Biol 1: 1–39. Gui, J.F., Zhu, Z.Y., 2012. Molecular basis and genetic improvement of economically important traits in aquaculture animals. Chin. Sci. Bull. 57, 1751–1760. Hussain, M.M., Strickland, D.K., Bakillah, A., 1999. The Mammalian Low-density Lipoprotein Receptor Family Annu Rev Nutr 19: 141–172. Jeon, H., Blacklow, S.C., 2005. Structure and physiologic function of the low-density lipoprotein receptor. Annu. Rev. Biochem. 74, 535–562. Kang, X.J., Sun, T.C., Wang, S.A., 1996. Preliminary study on the isolated culture of the fertilized egg and embryonic development of the Macrobrachium nipponense (Crustacea Decapoda). J. Hebei Univ. (Nat. Sci. Ed.) 16 (4), 41–45. Klinbunga, S., Sittikankaew, K., Jantee, N., Prakopphet, S., Janpoom, S., Hiransuchalert, R., Khamnamtong, B., 2015. Expression levels of vitellogenin receptor (Vtgr) during ovarian development and association between its single nucleotide polymorphisms (SNPs) and reproduction-related parameters of the giant tiger shrimp Penaeus monodon. Aquaculture 435, 18–27. Lee, J.H., Kim, B.K., Seo, Y.I., Choi, J.H., Kang, S.W., Kang, C.K., ... Kim, H.W., 2014. Four cDNAs encoding lipoprotein receptors from shrimp Pandalopsis japonica: structural characterization and expression analysis during maturation. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 169, 51–62. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2 (−delta delta C (T)) method. Methods 25, 402–408. Lu, H.L., Vinson, S.B., Pietrantonio, P.V., 2009. Oocyte membrane localization of vitellogenin receptor coincides with queen flying age, and receptor silencing by RNAi disrupts egg formation in fire ant virgin queens. FEBS J. 276 (11), 3110–3123. Mareddy, V.R., Rosen, O., Thaggard, H.B., Manor, R., Kuballa, A.V., et al., 2011. Isolation and characterization of the complete cDNA sequence encoding a putative insulin-like peptide from the androgenic gland of Penaeus monodon. Aquaculture 3-4, 364–370. Mei, J., Gui, J.F., 2015. Genetic basis and biotechnological manipulation of sexual dimorphism and sex determination in fish. Sci. China Life Sci. 58 (2), 124–136. Mekuchi, M., Ohira, T., Kawazoe, I., Jasmani, S., Suitoh, K., Kim, Y.K., Jayasankar, V., Nagasawa, H., Wilder, M.N., 2008. Characterization and expression of the putative ovarian lipoprotein receptor in the Kuruma prawn, Marsupenaeus japonicus. Zool. Sci. 25, 428–437. Mirabdullaev, I.M., Niyazov, D.S., 2005. Alien decapods (Crustacea) in Uzbekistan. Abstracts of the II International Symposium Invasion of Alien species in Holarctic, Borok, Russia 2, pp. 113–114. Mitchell, R.D.I.I.I., Ross, E., Osgood, C., Sonenshine, D.E., Donohue, K.V., Khalil, S.M., Thompson, D.M., Roe, R.M., 2007. Molecular characterization, tissuespecific expression and RNAi knockdown of the first vitellogenin receptor from a tick. Insect Biochem. Mol. Biol. 37, 375–388. Mukherjee, S., Ghosh, R.N., Maxfield, F.R., 1997. Endocytosis. Physiol. Rev. 77, 759–803. Okabayashi, K., Shoji, H., Nakamura, T., Hashimoto, O., Asashima, M., Sugino, H., 1996. CDNA cloning and expression of the Xenopus laevis vitellogenin receptor. Biochem. Biophys. Res. Commun. 224 (2), 406–413. Okuno, A., Yang, W.J., et al., 2002. Deduced primary structure of vitellogenin in the giant freshwater prawn, Macrobrachium rosenbergii, and yolk processing during ovarian maturation. J. Exp. Zool. 292 (5), 417–429. Pousis, C., Santamaria, N., Zupa, R., De Giorgi, C., Mylonas, C.C., Bridges, C.R., ... Corriero, A., 2012. Expression of vitellogenin receptor gene in the ovary of wild and captive Atlantic bluefin tuna Thunnus thynnus. Anim. Reprod. Sci. 132 (1), 101–110. Raviv, S., Parnes, S., Segall, C., Davis, C., Sagi, A., 2006. Complete sequence of Litopenaeus vannamei (Crustacea: Decapoda) vitellogenin cDNA and its expression in endocrinologically induced sub-adult females. Gen. Comp. Endocrinol. 145 (1), 39–50. Roth, Z., Khalaila, I., 2012. Identification and characterization of the vitellogenin receptor in Macrobrachium rosenbergii and its expression during vitellogenesis. Mol. Reprod. Dev. 79 (7), 478–487. Roth, T.F., Porter, K.R., 1964. Yolk protein uptake in the oocyte of the mosquito Aedes aegypti. J. Cell Biol. 20, 313–332.

H. Bai et al. / Comparative Biochemistry and Physiology, Part A 194 (2016) 45–55 Salman, S.D., Page, T.J., Naser, M.D., Yasser, A.G., 2006. The invasion of Macrobrachium nipponense (de Haan, 1849) (Caridea: Palaemonidae) into the southern Iraqi marshes. Aquat. Invasions 1, 109–115. Sappington, T.W., Raikhel, A.S., 1998. Molecular characteristics of insect vitellogenins and vitellogenin receptors. Insect Biochem. Mol. Biol. 28 (5–6), 277–300. Sappington, T.W., Hays, A.R., Raikhel, A.S., 1995. Mosquito vitellogenin receptor: purification, developmental and biochemical characterization. Insect Biochem. Mol. Biol. 25, 807–817. Sappington, T.W., Kokoza, V.A., Cho, W.L., Raikhel, A.S., 1996. Molecular characterization of the mosquito vitellogenin receptor reveals unexpected high homology to the Drosophila yolk protein receptor. PNAS 93 (17), 8934–8939. Schonbaum, C.P., Lee, S., Mahowald, A.P., 1995. The Drosophila yolkless gene encodes a vitellogenin receptor belonging to the low density lipoprotein receptor superfamily. Proc. Natl. Acad. Sci. U. S. A. 92, 1485–1489. Tiu, S.H., Benzie, J., Chan, S.M., 2008. From hepatopancreas to ovary: molecular characterization of a shrimp vitellogenin receptor involved in the processing of vitellogenin. Biol. Reprod. 79, 66–74. Tufail, M., Takeda, M., 2005. Molecular cloning, characterization and regulation of the cockroach vitellogenin receptor during oogenesis. Insect Mol. Biol. 14 (4), 389–401.

55

Tufail, M., Takeda, M., 2009. Insect vitellogenin/lipophorin receptors: molecular structures, role in oogenesis, and regulatory mechanisms. J. Insect Physiol. 55, 87–103. Warrier, S., Subramoniam, T., 2002. Receptor mediated yolk protein uptake in the crab Scylla serrata: crustacean vitellogenin receptor recognizes related mammalian serum lipoproteins. Mol. Reprod. Dev. 61, 536–548. Wilder, M.N., Okumura, T., Tsutsui, N., 2010. Reproductive mechanisms in Crustacea focusing on selected prawn species: vitellogenin structure, processing and synthetic control. Aqua BioSci. Monogr. 3, 73–110. Wu, P., Qi, D., Chen, L.Q., et al., 2009. Gene discovery from an ovary cDNA library of oriental river prawn Macrobrachium nipponensis by ESTs annotation. J. Comp. Bioehem. Physiol. D 4 (2), 111–120. Yano, I., Chinzei, Y., 1987. Ovary is the site of vitellogenin synthesis in kuruma prawn, Penaeus japonicus. Comp. Biochem. Physiol. B Comp. Biochem. 86, 213–218. Yu, H., Miyake, S., 1972. Five species of the genus Macrobrachium (Crustacea, Decapoda, Palaemonidae) from Taiwan. Ohmu 3, 45–55. Zhang, Y.P., Jiang, S.F., Xiong, Y.W., Sun, S.M., Qiao, H., Jin, S.B., Gong, Y.S., Fu, H.T., 2013. Molecular cloning and expression analysis of extra sex combs gene during development in Macrobrachium nipponense. Turkish. J. Fish Aquat. Sci. 13, 331–340.